Mechanism of vascular toxicity in rats subjected to treatment with a tyrosine kinase inhibitor

toxics Article Mechanism of Vascular Toxicity in Rats Subjected to Treatment with a Tyrosine Kinase Inhibitor Claudia Reyes-Goya 1,Álvaro Santana-Garrido 1,2 , Estefanía Soto-Astacio 1,Óscar Aramburu 3, Sonia Zambrano 4, Alfonso Mate 1,2,* and Carmen M. Vázquez 1,2 1Departamento de Fisiología, Facultad de Farmacia, Universidad de Sevilla, E-41012 Sevilla, Spain; [email protected] (C.R.-G.); [email protected] (Á.S.-G.); [email protected] (E.S.-A.); [email protected] (C.M.V.) 2Instituto de Biomedicina de Sevilla (IBIS), Hospital Universitario Virgen del Rocío/Consejo Superior de Investigaciones Científicas/Universidad de Sevilla, E- 41013 Sevilla, Spain 3Servicio de Medicina Interna, Hospital Universitario Virgen Macarena, E-41009 Sevilla, Spain; [email protected] 4 Integrated Cardiometabolic Center, Department of Laboratory Medicine, Karolinska Institutet at Karolinska University Hospital Huddinge, 17177 Stockholm, Sweden; [email protected] *Correspondence: [email protected] Received: 29 June 2020; Accepted: 17 July 2020; Published: 20 July 2020   Abstract: Sunitinib (Su) is a tyrosine kinase inhibitor with antiangiogenic and antineoplastic effects that is recommended therapy for renal cell carcinoma, gastrointestinal stromal tumors, and pancreatic neuroendocrine tumors. Arterial hypertension is one of the adverse effects observed in the treatment with Su. The aim of this work was to deepen our understanding of the underlying mechanisms involved in the development of this side effect. Studies on endothelial function, vascular remodeling and nicotinamide adenine dinucleotide phosphate oxidase (NADPH oxidase) system were carried out in thoracic aortas from rats treated with Su for three weeks. Animals subjected to Su treatment presented with increased blood pressure and reduced endothelium-dependent vasodilation, the latter being reverted by NADPH oxidase blockade. Furthermore, vascular remodeling and stronger Masson trichrome staining, together with enhanced immunofluorescence signal for collagen 1 alpha 1 (Col1 α 1), were observed in aortas from treated animals. These results were accompanied by a significant elevation in superoxide anion production and the activity/protein/gene expression of NADPH oxidase isoforms (NOX1, NOX2, and NOX4), which was also prevented by NOX inhibition. Furthermore, a decrease in nitric oxide (NO) levels and endothelial nitric oxide synthase (eNOS) activation was observed in aortas from Su-treated animals. All these results indicate that endothelial dysfunction secondary to changes in vascular remodeling and oxidative stress might be responsible for the typical arterial hypertension that develops following treatment with Su. Keywords: arterial hypertension; endothelial dysfunction; tyrosine kinase inhibitor; vascular remodeling 1. Introduction Antiangiogenic treatment with tyrosine kinase inhibitors (TKIs) has been widely used in cancer therapy in the last years [ 1 ]. TKIs effect consist of competing with ATP for the ATP-binding site on protein tyrosine kinases, thus decreasing phosphorylation and cancer cell proliferation. TKIs inhibit epidermal growth factor receptor (EGFR), platelet-derived growth factor receptor (PDGFR), and vascular endothelial growth factor receptor (VEGFR). The variety of commercially available TKIs has improved the therapeutic management of cancer in the last decades. However, these drugs are often associated with adverse side effects, including cardiovascular toxicity and arterial hypertension [2]. Toxics 2020,8, 49; doi:10.3390/toxics8030049 www.mdpi.com/journal/toxics Toxics 2020,8, 49 2 of 17 Sunitinib (Su) is an orally active multitarget TKI accepted by the U.S. Food and Drug Administration (FDA) and by the European Commission [ 3 ]. Su is the first-line choice for metastatic renal cell carcinoma treatment and the second-line one for gastrointestinal stromal tumors (GISTs) and pancreatic neuroendocrine tumors [ 4 , 5 ]. This compound binds to several tyrosine kinase receptors including VEGFR, PDGFR, and the stem cell factor receptor (c-KIT). Similar to other VEGFR inhibitors, arterial hypertension is a common feature associated with Su treatment [ 6 ]. Although several mechanisms have been suggested to explain this side effect, the underlying pathophysiological mechanism remains unknown. Reduced nitric oxide (NO) generation, endothelial dysfunction, and capillary rarefaction have been proposed as factors involved in anti-VEGF-induced arterial hypertension [ 7 , 8 ]. Su-induced arterial hypertension has also been related to an increase in endothelin-1 (ET-1) levels [ 9 ], and the administration with the ET-1 receptor antagonist macitentan showed attenuation in the elevation of blood pressure [ 10 ]. However, these results were not reproduced with bosentan, another blocker of the ET-1 receptor [ 11 ]. Additionally, stiffness of large arteries, changes in arterial mechanical properties and fibrosis have been implicated in blood pressure elevation secondary to treatment with TKIs [ 12 , 13 ], suggesting that local vasoconstriction in specific areas might be responsible for the onset of arterial hypertension [11]. Other investigators, in addition to our previous work, have demonstrated that enhanced oxidative stress is one of the relevant alterations in hearts from Su-treated rats, suggesting the important role of reactive oxygen species (ROS) in the vascular dysfunction and hypertension processes surrounding TKI-induced cardiotoxicity [ 14 – 16 ]. Our present work furthers our understanding of the possible mechanisms involved in arterial hypertension secondary to treatment with Su. To this purpose, histomorphometric studies were carried out in aortas from Su-treated rats, to check this tissue for vascular remodeling and analyzing the location of type I collagen as a final product of fibrosis. In addition, superoxide anion (O 2− ) production, location, activity, and expression of ROS-generating nicotinamide adenine dinucleotide phosphate oxidase (NADPH oxidase), NO levels, endothelial nitric oxide synthase (eNOS) protein/mRNA expression, together with vascular reactivity experiments, were performed in aortas from Su-treated animals and compared with non-treated normotensive Wistar rats. 2. Materials and Methods 2.1. Animals and Experimental Design Male Wistar rats (8–10 weeks old) were supplied by the Center for Animal Production and Experimentation (University of Seville, Spain) and kept under standard conditions (23 ± 1 ◦ C, 12h/12h light/dark cycles). All procedures complied with the European Union (EU Directive 2010/63/EU) and the National (RD 53/2013) guidelines and were approved by the competent Institutional Animal Care and Use Committee (approval reference #08/03/2017/034; date of approval: 08 March 2017, issued by Junta de Andaluc í a, Direcci ó n General de la Producci ó n Agr í cola y Ganadera). Two groups of 15 rats each were randomly assigned to: (i) control group with free access to food and tap water; and (ii) rats subjected to treatment with 25 mg Su/kg body weight/day for three weeks. An appropriate solution of Su (Pfizer Inc, 2019) was prepared in tap water and homogenized mixed homogeneously within crushed pellet to form Su-containing pellets. To ensure the correct dosage, the concentration of Su was weekly adjusted according to each animal’s body weight and average daily food intake. 2.2. Blood Pressure and Tissue Preparations During the experimental period, blood pressure, heart rate, and body weight were continuously monitored, as previously described [ 14 ]. Upon treatment completion, animals were injected with 75 mg/kg ketamine +10 mg/kg diazepam (i.p.), the intact thoracic aorta was removed and ice-cold 0.9% saline solution was used to wash the tissue. The connective tissue around the aorta was removed and the vessel was then cut into pieces. The superior portion (including the aortic arch) was immediately frozen in liquid nitrogen and stored at − 80 ◦ C until use for detection of mRNA/protein expression. The Toxics 2020,8, 49 3 of 17 rest was employed for functional studies (vascular reactivity) and dihydroethidium (DHE) assay and histomorphometric studies. All animals were routinely sacrificed between 9:00 to 10:00 h to minimize diurnal variation. Aorta tissue was homogenized in radioimmunoprecipitation assay (RIPA) buffer with a micro-pestle motor-driven tissue homogenizer (Heidolph Instruments, Schwabach, Germany) for Western blot studies. After centrifugation at 2000 × gfor 10 min at 4 ◦ C, the supernatant was stored at − 80 ◦ C and the pellet was discarded. The Bradford method was used for determining protein concentration [17] (Bio-Rad Protein Assay. Bio-Rad Laboratories, USA). 2.3. Measurement of the Levels of Superoxide Anion and Nitric Oxide Concentration The superoxide-sensitive fluorescent dye dihydroethidium (DHE; MedChemExpress, HY-D0079) was used to estimate the level of O 2− as previously reported [ 18 ]. Thoracic aortas were embedded in Tissue-Tek ® O.C.T. ™ (Sakura Finetek, 4583) and frozen sections were cut into 10 µ m thick sections with a cryostat (Leica CM1510 S, Leica Biosystems). Sections were thawed, incubated with DHE (10 mM) at 37 ◦ C for 10 min and with 4’,6-diamidino-2-phenylindole (DAPI) Fluoromount-G ® (SouthernBiotech, 0100-20). Serial sections were treated with either 10 µ mol/L VAS2870 (pan-inhibitor of NOX isoforms; Merk Millipore, 492000), 0.1 µmol/L GKT136901 (NOX1 and NOX4 inhibitor, Merk Millipore, 5340320001), 0.5 µ mol/L ML171 (specific NOX1 inhibitor; Sigma Aldrich, 175226); or 100 µ mol/L L-NAME (eNOS inhibitor; Sigma-Aldrich, N5751) for 30 min prior to incubation with DHE. Preincubation with 100 U/mL polyethylene glycol-conjugated SOD (PEG-SOD; Sigma Aldrich, S9549) for 10 min at 37 ◦ C was carried out to confirm the specificity of staining. All sections were examined on a fluorescence microscope (Olympus BX61. Olympus Corporation) and photographed with a color digital camera (Olympus DP73. Olympus Corporation). O 2− production was estimated from the ratio ethidium/DAPI fluorescence signal using ImageJ (Version 2.0.0-rc-69/1.52p. National Institutes of Health, Bethesda, MD). Nitrite and nitrate levels in aorta homogenates were estimated by the Griess method [ 19 ] in the absence and presence of NOX inhibitors in the same final concentration as described above. 2.4. Measurement of NADPH Oxidase Activity Aorta homogenates were used to determine NADPH oxidase activity by lucigenin-enhanced chemiluminescence, as previously reported [ 20 ]. In order to confirm the isoform involved in the production of superoxide anions (O 2− ), homogenate samples were preincubated for 5 min at 37 ◦ C with VAS2870, GKT136901, ML171, and L-NAME at the same final concentrations stated in Section 2.3. 2.5. RNA Extraction and Real-Time PCR Frozen aortas were used to extract total RNA and retro-transcribed as previously described [ 21 ]. The generated cDNAs were used for real-time PCR with SYBR Green TM (Roche, 04673514001) reactions in a LightCycler1 480 Real-Time PCR System (Roche Diagnostics, Madrid, Spain). Primer sequences (Biomedal, Seville, Spain) used in this study are detailed in Table 1, including glyceraldehyde 3-phosphate dehydrogenase (GAPDH) that was used as an endogenous control reference. Data were analyzed and quantified with the 2−∆∆Ct method [22]. Toxics 2020,8, 49 4 of 17 Table 1. The primers used for real-time RT-PCR. Gene Forward (50–30) Reverse (50–30) Col1 TCAGGGGCGAAGGCAACAGT TTGGGATGGAGGGAGTTTACACGA TGF-β1 GCCCTGGATACCAACTACTGCT AGGCTCCAAATGTAGGGGCAGG NOX1 TTCACCAATTCCCAGGATTGAAGTGGATGGTC GACCTGTCACGATGTCAGTGGCCTTGTCAA NOX2 CCCTTTGGTACAGCCAGTGAAGAT CAATCCCAGCTCCCACTAACATCA NOX4 TTGCTTTTGTATCTTC CTTACCTTCGTCACAG eNOS GGGCCAGGGTGATGAGCTCTG CCCTCCTGGCTTCCAGTGTCC GAPDH GCCAAAAGGGTCATCATCTCCGC GGATGACCTTGCCCACAGCCTTG Notes: Collagen type I (Col1), transforming growth factor β (TGF- β 1), NADPH oxidase isoforms (NOX1, NOX2, and NOX4), endothelial nitric oxide synthase (eNOS), and glyceraldehyde 3-phosphate dehydrogenase (GAPDH). 2.6. Western Blotting Following SDS-PAGE, proteins were transferred to nitrocellulose membrane and incubated with specific antibodies: mouse monoclonal anti-TGF- β 1 (3C11) (Santa Cruz Biotechnology, Santa Cruz, CA, USA; 1:3000 dilution); rabbit polyclonal anti-MOX1 (H-75) (Santa Cruz Biotechnology, Santa Cruz, CA, USA; 1:1000 dilution); rabbit monoclonal anti-NOX2 (Epitomics-Abcam, Burlingame, CA, USA; 1:8000 dilution); rabbit monoclonal anti-NOX4 (Epitomics-Abcam, Burlingame, CA, USA; 1:7500 dilution); mouse monoclonal anti-NOS3 (A-9) (Santa Cruz Biotechnology, Santa Cruz, CA, USA; 1:2000 dilution); purified mouse anti-eNOS (pS1177) (BD Transduction Laboratories, 1:2000 dilution); mouse monoclonal anti-p-NOS3 (pt495.33) (Santa Cruz Biotechnology, Santa Cruz, CA, USA; 1:2000 dilution); mouse monoclonal anti-3-nitrotyrosine (Santa Cruz Biotechnology, Santa Cruz, CA, USA; 1:1000 dilution). Mouse monoclonal antiβ -actin (Santa Cruz Biotechnology, Santa Cruz, CA, USA; 1:20,000 dilution) was also used for protein loading control. Adequate anti-rabbit or anti-mouse secondary antibodies were used following the manufacturer’s recommendations, and signals were revealed with ECL ™ Prime Western Blotting System (Amersham, RPN2232) and measured with an Amersham Imager 600 (GE Healthcare Life Science). 2.7. Vascular Reactivity Vascular function was carried out as previously reported [ 23 ] using a Panlab organ bath (Harvard Apparatus) and a PowerLab ® 8/30 data acquisition system (ADInstruments) coupled to appropriate transducers and controlled by the LabChartTM software (ADInstruments). Endothelium-intact aortic rings were contracted with 10 −9 –3 × 10 −5 mol/L phenylephrine (Phe) and relaxed with 10 −9 –3 × 10 −5 mol/L acetylcholine (ACh) or 10 −10 –3 × 10 −6 mol/L sodium nitroprusside (SNP). Selective NOX1 inhibitor ML171 (2-acetylphenothiazine) and eNOS inhibitor (L-NAME) were preincubated at 10−4mol/L. 2.8. Histomorphometric Studies Slices from thoracic aortas were stained with hematoxylin and eosin and photographed with an Olympus BX41 microscope. The area and thickness of tunica media and the lumen area were calculated using Image J (Version 2.0.0-rc-69/1.52p. National Institutes of Health, Bethesda, MD). Additional slices were stained with Masson’s trichrome to determine qualitative total collagen content following the instructions from the Sigma-Aldrich kit HT15-1KT. Images were captured and processed with bright field of the microscope Zeiss Axio Observer Z1 using bright field and the 10×objective. 2.9. Immunofluorescence Studies Double immunofluorescence was carried out on frozen sections using the following antibodies: α -smooth muscle actin-Cy3 ( α -SMA) (Sigma Aldrich, 1:1000 dilution); sheep polyclonal anti-Collagen 1 α 1 (Alexa Fluor; 1:200 dilution); rabbit polyclonal anti-CD31 (Epitomics-Abcam, Burlingame, CA, USA; 1:100 dilution); rabbit polyclonal anti-MOX1(H-75) (Santa Cruz Biotechnology, Santa Cruz, CA, USA; 1:200 dilution); goat polyclonal anti-CD31/PECAM-1 (Alexa Fluor; 1:500 dilution). After Toxics 2020,8, 49 5 of 17 incubation, sections were treated with appropriate anti-rabbit, anti-goat or anti-sheep fluorescent secondary antibodies. Nuclei were also stained with DAPI during secondary antibody incubation. Random aortic rings were captured and processed with a Zeiss Axio Observer Z1 Inverted Phase Contrast Fluorescence Microscope using the 20×, 40×or oil 100×objective. 2.10. Statistics Results were evaluated using GraphPad Prism version 5.01 (GraphPad Software Inc., San Diego, CA, USA, 2007) and expressed as the mean ± S.E.M. Differences in mean values between groups were analyzed with the unpaired, two-tailed Student’s t-test and considered statistically different at p<0.05. Data from ACh-mediated vasodilation, including preincubation with ML171, DHE, NADPH oxidase, and NO assays were analyzed by one-way ANOVA followed by the Tukey’s multiple comparisons test and considered statistically different at p<0.05. 3. Results 3.1. General Characteristics of Animals Upon three-week experimental period completion, a significant decrease in weight gain was observed in treated animals when compared with control group (Figure 1A), despite no changes in food/water intake between both groups of study (Figure 1B,C). In addition, Su-treated animals presented with enhanced final blood pressure values (Figure 1D,E). On the other hand, heart rate values were similar in both groups (Figure 1F). Toxics 2020, 8, x FOR PEER REVIEW 5 of 18 2.9. Immunofluorescence Studies Double immunofluorescence was carried out on frozen sections using the following antibodies: α-smooth muscle actin-Cy3 (α-SMA) (Sigma Aldrich, 1:1000 dilution); sheep polyclonal anti-Collagen 1α1 (Alexa Fluor; 1:200 dilution); rabbit polyclonal anti-CD31 (Epitomics-Abcam, Burlingame, CA, USA; 1:100 dilution); rabbit polyclonal anti-MOX1(H-75) (Santa Cruz Biotechnology, Santa Cruz, CA, USA; 1:200 dilution); goat polyclonal anti-CD31/PECAM-1 (Alexa Fluor; 1:500 dilution). After incubation, sections were treated with appropriate anti-rabbit, anti-goat or anti-sheep fluorescent secondary antibodies. Nuclei were also stained with DAPI during secondary antibody incubation. Random aortic rings were captured and processed with a Zeiss Axio Observer Z1 Inverted Phase Contrast Fluorescence Microscope using the 20×, 40× or oil 100× objective. 2.10. Statistics Results were evaluated using GraphPad Prism version 5.01 (GraphPad Software Inc., San Diego, CA, USA, 2007) and expressed as the mean ± S.E.M. Differences in mean values between groups were analyzed with the unpaired, two-tailed Student’s t-test and considered statistically different at p < 0.05. Data from ACh-mediated vasodilation, including preincubation with ML171, DHE, NADPH oxidase, and NO assays were analyzed by one-way ANOVA followed by the Tukey’s multiple comparisons test and considered statistically different at p < 0.05. 3. Results 3.1. General Characteristics of Animals Upon three-week experimental period completion, a significant decrease in weight gain was observed in treated animals when compared with control group (Figure 1A), despite no changes in food/water intake between both groups of study (Figure 1B,C). In addition, Su-treated animals presented with enhanced final blood pressure values (Figure 1D,E). On the other hand, heart rate values were similar in both groups (Figure 1F). Figure 1. (A) Weight gain, (B) food intake, (C) water intake, (D) systolic blood pressure, (E) diastolic blood pressure, and (F) heart rate in control and sunitinib (Su)-treated (25 mg/kg/day) animals. Values are expressed as mean ± S.E.M. of 15 animals per group. **p < 0.01, ***p < 0.001 vs. control group. 3.2. Endothelial Dysfunction in Su-treated Rats Vascular reactivity studies showed no changes between both groups of rats regarding the vasoconstrictor response to phenylephrine (Phe) (Figure 2A). On the other hand, endotheliumdependent vasodilation in response to acetylcholine (ACh) was significantly lower in aortic rings from treated animals (Figure 2B); thus, a significant decrease in ACh-induced maximal vasorelaxation response (Emax) was observed in this group when compared with the control group Control Sunitinib 0 5 10 15 20 25 30 35 Food intake (g/day) Control Sunitinib 0 5 10 15 20 25 30 Water intake (mL/day) A D Control Sunitinib 0 10 20 30 40 50 Weight gain (g) ** Control Sunitinib 0 50 100 150 200 *** Final SBP (mmHg) B E Control Sunitinib 0 50 100 150 *** Final DBP (mmHg) Control Sunitinib 0 100 200 300 400 500 Heart rate (min -1 ) F C Figure 1. ( A ) Weight gain, ( B ) food intake, ( C ) water intake, ( D ) systolic blood pressure, ( E ) diastolic blood pressure, and ( F ) heart rate in control and sunitinib (Su)-treated (25 mg/kg/day) animals. Values are expressed as mean ±S.E.M. of 15 animals per group. ** p<0.01, *** p<0.001 vs. control group. 3.2. Endothelial Dysfunction in Su-treated Rats Vascular reactivity studies showed no changes between both groups of rats regarding the vasoconstrictor response to phenylephrine (Phe) (Figure 2A). On the other hand, endothelium-dependent vasodilation in response to acetylcholine (ACh) was significantly lower in aortic rings from treated animals (Figure 2B); thus, a significant decrease in ACh-induced maximal vasorelaxation response (E max ) was observed in this group when compared with the control group (63 ± 3.8% vs. 106 ± 1.7%, respectively; p<0.01). In contrast, EC 50 values for ACh-induced vasodilation were similar in both experimental groups (7.72 ± 0.06 vs. 7.76 ± 0.24 for control and Su, respectively). Interestingly, when aortic rings from Su-treated rats were preincubated with ML171 (an inhibitor of NOX1 isoform of NADPH oxidase), the E max for endothelium-dependent relaxation reached values similar to those of the control group (95.3 ± 2.98%), while EC 50 was unaffected by the inhibitor (7.36 ± Toxics 2020,8, 49 6 of 17 0.11). When studies on ACh-induced vasodilation were done in the presence of 10 −4 mol/L L-NAME (N ω - nitro-L-arginine methyl ester, an inhibitor of NO synthesis), E max values dropped to similar levels in both cases (44 ± 2.88% and 32.3 ± 1.93% for control and treated rats, respectively; Figure 2C). Results concerning endothelium-independent vasorelaxation did not show changes between control and Su groups in either E max (109 ± 2.4% vs. 118.5 ± 3.1%) or EC 50 (8.7 ± 0.09 vs. 8.9 ± 0.09) parameters in response to nitric oxide donor sodium nitroprusside (SNP; Figure 2D). Toxics 2020, 8, x FOR PEER REVIEW 6 of 18 (63 ± 3.8% vs. 106 ± 1.7%, respectively; p < 0.01). In contrast, EC50 values for ACh-induced vasodilation were similar in both experimental groups (7.72 ± 0.06 vs. 7.76 ± 0.24 for control and Su, respectively). Interestingly, when aortic rings from Su-treated rats were preincubated with ML171 (an inhibitor of NOX1 isoform of NADPH oxidase), the Emax for endothelium-dependent relaxation reached values similar to those of the control group (95.3 ± 2.98%), while EC50 was unaffected by the inhibitor (7.36 ± 0.11). When studies on ACh-induced vasodilation were done in the presence of 10−4 mol/L L-NAME (Nωnitro-L-arginine methyl ester, an inhibitor of NO synthesis), Emax values dropped to similar levels in both cases (44 ± 2.88% and 32.3 ± 1.93% for control and treated rats, respectively; Figure 2C). Results concerning endothelium-independent vasorelaxation did not show changes between control and Su groups in either Emax (109 ± 2.4% vs. 118.5 ± 3.1%) or EC50 (8.7 ± 0.09 vs. 8.9 ± 0.09) parameters in response to nitric oxide donor sodium nitroprusside (SNP; Figure 2D). Figure 2. Dose-response curve of (A) vasoconstriction mediated by phenylephrine (Phe) (10−9–3×10−5 mol/L); (B) ACh-mediated (10−9–3×10−5 mol/L) vasodilation, including preincubation with ML171 (10−4 mol/L); (C) ACh-mediated vasodilation in the presence of L-NAME (Nωnitro-L-arginine methyl ester (10−4 mol/L); and (D) vasorelaxation response to sodium nitroprusside (SNP) (10−10–3×10−6 mol/L) in phenylephrine (Phe)-precontracted vessels from control and sunitinib-treated (25 mg/kg/day) animals. The results correspond to mean ± S.E.M. of at least six experiments (n = 6–12). Results are expressed as relative percentages of the maximum contraction induced by 60 mmol/L KCl (A), or to the contraction induced by a submaximal dose of Phe (B–D). **p < 0.01; ***p < 0.001 vs. control group, #p < 0.05, ##p < 0.01, ###p < 0.001 vs. Su group. 3.3. Vascular Remodeling and Fibrosis Morphometric studies revealed that the thickness of tunica media (Figure 3A,B) and the crosssectional area (CSA; Figure 3C) increased in Su-treated rats when compared with control rats. Since the luminal area showed no changes between groups (Figure 3D), a rise in the media/lumen ratio was found in Su-treated rats (Figure 3E), thus indicating the presence of vascular remodeling in these hypertensive animals. The Masson’s trichrome staining showed a slightly intensified blue coloration in aortas from treated rats, revealing an increased total content of collagen (Figure 4A,B). Collagen 1 alpha 1 (Col1α1) isoform is per se expressed in the outer layer of the aortic vascular tissue in both groups, mostly in the adventitia (Figure 4C,D). Nevertheless, aortic rings from Su-treated rats also showed -9 -8 -7 -6 -5 -4 0 20 40 60 80 100 Acetylcholine, log [mol/L] % Relaxation Sunitinib Control -10-9-8-7-6-5 0 20 40 60 80 100 120 140 160 Sodium nitroprusside, log [mol/L] % Relaxation Sunitinib Control With L-NAME AB CD -9 -8 -7 -6 -5 -4 0 20 40 60 80 100 120 Acetylcholine, log [mol/L] % Relaxation Control Sunitinib Sunitinib + ML171 *** ** ** *** *** *** ** ### ### ## # Figure 2. Dose-response curve of ( A ) vasoconstriction mediated by phenylephrine (Phe) (10 −9 –3 × 10 −5 mol/L); ( B ) ACh-mediated (10 −9 –3 × 10 −5 mol/L) vasodilation, including preincubation with ML171 (10 −4 mol/L); ( C ) ACh-mediated vasodilation in the presence of L-NAME (N ω - nitro-L-arginine methyl ester (10 −4 mol/L); and ( D ) vasorelaxation response to sodium nitroprusside (SNP) (10 −10 –3 × 10 −6 mol/L) in phenylephrine (Phe)-precontracted vessels from control and sunitinib-treated (25 mg/kg/day) animals. The results correspond to mean ± S.E.M. of at least six experiments (n=6–12). Results are expressed as relative percentages of the maximum contraction induced by 60 mmol/L KCl ( A ), or to the contraction induced by a submaximal dose of Phe ( B – D ). ** p<0.01; *** p<0.001 vs. control group, # p <0.05, ## p<0.01, ### p<0.001 vs. Su group. 3.3. Vascular Remodeling and Fibrosis Morphometric studies revealed that the thickness of tunica media (Figure 3A,B) and the cross-sectional area (CSA; Figure 3C) increased in Su-treated rats when compared with control rats. Since the luminal area showed no changes between groups (Figure 3D), a rise in the media/lumen ratio was found in Su-treated rats (Figure 3E), thus indicating the presence of vascular remodeling in these hypertensive animals. Toxics 2020,8, 49 7 of 17 Toxics 2020, 8, x FOR PEER REVIEW 7 of 18 an intense immunofluorescence staining with collagen deposition in the media and intima layer (basement membrane and the extracellular matrix of endothelial cells) (Figure 4E–H). In addition, the mRNA expression of Col1 and the protein and gene expression of TGF-β were also increased in aortas from treated rats (Figure 4I–K), thus suggesting a correlation between Col1α1 immunofluorescence and the expressions of these fibrosis-related components. Figure 3. Aorta thickness (A and B; delimited by arrowheads), cross-sectional area (CSA) of tunica media (C), lumen area (D) and media/lumen ratio (E) in control and Su-treated (25 mg/kg/day) animals. Magnification: 10×. Values are expressed as mean ± S.E.M. of six animals per group. *p < 0.05; **p < 0.01; ***p < 0.001 vs. control group. B C D E A Sunitinib Control Figure 3. Aorta thickness ( A and B ; delimited by arrowheads), cross-sectional area (CSA) of tunica media ( C ), lumen area ( D ) and media/lumen ratio ( E ) in control and Su-treated (25 mg/kg/day) animals. Magnification: 10 × . Values are expressed as mean ± S.E.M. of six animals per group. * p<0.05; ** p< 0.01; *** p<0.001 vs. control group. The Masson’s trichrome staining showed a slightly intensified blue coloration in aortas from treated rats, revealing an increased total content of collagen (Figure 4A,B). Collagen 1 alpha 1 (Col1 α 1) isoform is per se expressed in the outer layer of the aortic vascular tissue in both groups, mostly in the adventitia (Figure 4C,D). Nevertheless, aortic rings from Su-treated rats also showed an intense immunofluorescence staining with collagen deposition in the media and intima layer (basement membrane and the extracellular matrix of endothelial cells) (Figure 4E–H). In addition, the mRNA expression of Col1 and the protein and gene expression of TGF- β were also increased in aortas from treated rats (Figure 4I–K), thus suggesting a correlation between Col1 α 1 immunofluorescence and the expressions of these fibrosis-related components. 3.4. Assessment of Vascular Oxidative Stress Dihydroethidium (DHE) imaging showed an increase in superoxide anion (O 2− ) production in the aortas of rats subjected to treatment with Su compared to the control group (Figure 5). When aortic ring preparations were preincubated with polyethylene glycol-superoxide dismutase (PEG-SOD, DHE staining disappeared and confirmed the presence of O 2− . Preincubating aortic segments from Su-treated animals with NADPH oxidase inhibitors, namely ML171, GKT136901, and VAS2870, attenuated the superoxide anion formation back to levels measured in the control group. On the other hand, no change in O 2− production was observed following incubation of rings from Su-treated animals with the eNOS inhibitor, L-NAME (Figure 5A,B). Toxics 2020,8, 49 8 of 17 Toxics 2020, 8, x FOR PEER REVIEW 8 of 18 Figure 4. Masson’s trichrome staining for collagen fibers in blue (A and B, marked with arrowheads), double immunostaining of collagen 1 alpha 1 (Col1α1) (red) and α-smooth muscle actin (α-SMA) from vascular smooth muscle cells (VSMCs) (green) (C–F), and Col1ߙ1 (red) and CD31 (green) (G and H), and protein/mRNA expression of Col1 (I) and TGF-β1 (J and K), in aortas from control and sunitinibtreated (25 mg/kg/day) animals. Magnification 10× for Masson’s trichrome staining. Magnifications: C Sunitinib Control Sunitinib AB α-SMA Col1α1 Merged Control D E F Dapi Dapi CD31 Col1α1 G Control H Sunitinib Merged IJK TGF-β 1 (50 kDa) β-actin (48 kDa) Figure 4. Masson’s trichrome staining for collagen fibers in blue ( A , B , marked with arrowheads), double immunostaining of collagen 1 alpha 1 (Col1 α 1) (red) and α -smooth muscle actin ( α -SMA) from vascular smooth muscle cells (VSMCs) (green) ( C – F ), and Col1 α 1 (red) and CD31 (green) ( G , H ), and protein/mRNA expression of Col1 ( I ) and TGF- β 1 ( J , K ), in aortas from control and sunitinib-treated (25 mg/kg/day) animals. Magnification 10 × for Masson’s trichrome staining. Magnifications: 10 × ( A , B ), 20 × ( C , E ) and 40 × ( D , F – H ). Values are expressed as mean ± S.E.M. of at least 6 animals per group (n= 6–8). * p<0.05; ** p<0.01; *** p<0.001 vs. control group. Toxics 2020,8, 49 9 of 17 FIGURE 5 Control Sunitinib Sunitinib + ML171 Sunitinib + GKT136901 Sunitinib + VAS2870 Sunitinib + L-NAME 0 100 200 300 Ethidium fluorescence (% relative to DAPI) *** ***,+++, ººº, yyy ### ### *, ###, ++ A Control Sunitinib DHE Dapi + PEG-SOD + PEG-SOD +GKT136901 +VAS2870 + L-NAME + ML171 Dapi β-actin (48 kDa) 3-Nitrotyrosine Control Sunitinib 0 50 100 150 200 3-Nitrotyrosine relative protein expression * D B C Control Sunitinib Sunitinib + ML171 Sunitinib + GKT136901 Suntinib + VAS2870 Sunitinib + L-NAME 0 50 100 150 200 *** ***, ++, ººº, yyy ### ### ### NADPH oxidase activity (%) Figure 5. Superoxide anion production in thoracic aortas. ( A ) Representative dihydroethidium (DHE) staining, ( B ) superoxide anion quantification, ( C ) NADPH oxidase activity in aorta homogenates, and ( D ) 3-nitrotyrosine protein expression, in aortas from control and sunitinib-treated (25 mg/kg/day) animals. Magnification: 10 × . Values are expressed as mean ± S.E.M. of at least four animals per group (n=4–8). * p<0.05, *** p<0.001 vs. control group; ## p<0.01, ### p<0.001 vs. Su group; ++ p<0.01, +++ p<0.001 vs. Su +ML171 group; ººº p<0.001 vs. Su +GKT136901 group; yyy p<0.001 vs. Su + VAS2870 group. The activity of NADPH oxidase was increased in aortas from Su-treated rats compared to the control group (Figure 5C). Again, NOX inhibitors reduced the activity of the enzyme in aortas from Su-treated rats in a similar manner as observed with DHE staining. In contrast, L-NAME had no Toxics 2020,8, 49 16 of 17 5. Faivre, S.; Niccoli, P.; Castellano, D.; Valle, J.W.; Hammel, P.; Raoul, J.L.; Vinik, A.; Van Cutsem, E.; Bang, Y.J.; Lee, S.H.; et al. Sunitinib in pancreatic neuroendocrine tumors: Updated progression-free survival and final overall survival from a phase III randomized study. Ann. Oncol. 2017. [CrossRef] 6. Gorini, S.; De Angelis, A.; Berrino, L.; Malara, N.; Rosano, G.; Ferraro, E. Chemotherapeutic Drugs and Mitochondrial Dysfunction: Focus on Doxorubicin, Trastuzumab, and Sunitinib. Oxidative Med. Cell. Longev. 2018,2018. [CrossRef] 7. Robinson, E.S.; Khankin, E.V.; Choueiri, T.K.; Dhawan, M.S.; Rogers, M.J.; Karumanchi, S.A.; Humphreys, B.D. Suppression of the Nitric Oxide Pathway in Metastatic Renal Cell Carcinoma Patients Receiving Vascular Endothelial Growth Factor–Signaling Inhibitors. Hypertension 2010,56, 1131–1136. [CrossRef] 8. Belcik, J.T.; Qi, Y.; Kaufmann, B.A.; Xie, A.; Bullens, S.; Morgan, T.K.; Bagby, S.P.; Kolumam, G.; Kowalski, J.; Oyer, J.A.; et al. Cardiovascular and Systemic MicrovascularEffects of Anti-Vascular Endothelial Growth Factor Therapy for Cancer. J. Am. Coll. Cardiol. 2012,60, 618–625. [CrossRef] 9. Kappers, M.H.W.; Van Esch, J.H.M.; Sluiter, W.; Sleijfer, S.; Danser, A.H.J.; Van Den Meiracker, A.H. Hypertension induced by the tyrosine kinase inhibitor sunitinib is associated with increased circulating endothelin-1 levels. Hypertension 2010,56, 675–681. [CrossRef] 10. Lankhorst, S.; Kappers, M.H.W.; Van Esch, J.H.M.; Smedts, F.M.M.; Sleijfer, S.; Mathijssen, R.H.J.; Baelde, H.J.; Danser, A.H.J.; Van Den Meiracker, A.H. Treatment of hypertension and renal injury induced by the angiogenesis inhibitor sunitinib preclinical study. Hypertension 2014,64, 1282–1289. [CrossRef] 11. Carter, J.J.; Fretwell, L.V.; Woolard, J. Effects of 4 multitargeted receptor tyrosine kinase inhibitors on regional hemodynamics in conscious, freely moving rats. FASEB J. 2017,31, 1193–1203. [CrossRef] 12. Alivon, M.; Giroux, J.; Briet, M.; Goldwasser, F.; Laurent, S.; Boutouyrie, P. Large artery stiffness and hypertension after antiangiogenic drugs: Influence on cancer progression. J. Hypertens. 2015 ,33, 1310–1317. [CrossRef] 13. Svilaas, T.; Lefrandt, J.D.; Gietema, J.A.; Kamphuisen, P.W. Long-term arterial complications of chemotherapy in patients with cancer. Thromb. Res. 2016,140, S109–S118. [CrossRef] 14. Blanca, A.J.; Ruiz-Armenta, M.V.; Zambrano, S.; Miguel-Carrasco, J.L.; Arias, J.L.; Ar é valo, M.; Mate, A.; Aramburu, O.; V á zquez, C.M. Inflammatory and fibrotic processes are involved in the cardiotoxic effect of sunitinib: Protective role of l -carnitine. Toxicol. Lett. 2016,241, 9–18. [CrossRef] 15. Neves, K.B.; Rios, F.J.; Van Der Mey, L.; Alves-Lopes, R.; Cameron, A.C.; Volpe, M.; Montezano, A.C.; Savoia, C.; Touyz, R.M. VEGFR (vascular endothelial growth factor receptor) inhibition induces cardiovascular damage via redox-sensitive processes. Hypertension 2018,71, 638–647. [CrossRef] 16. Sridharan, V.; Thomas, C.J.; Cao, M.; Melnyk, S.B.; Pavliv, O.; Joseph, J.; Singh, S.P.; Sharma, S.; Moros, E.G.; Boerma, M. Effects of local irradiation combined with sunitinib on early remodeling, mitochondria, and oxidative stress in the rat heart. Radiother. Oncol. 2016,119, 259–264. [CrossRef] [PubMed] 17. Bradford, M.M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 1976. [CrossRef] 18. Wei, J.; Xu, L.; Du, Y.; Tang, X.; Ye, M.; Wu, Y.; Han, W.; Gao, P. Membrane raft redox signalling contributes to endothelial dysfunction and vascular remodelling of thoracic aorta in angiotensin II-infused rats. Exp. Physiol. 2019,104, 946–956. [CrossRef] 19. Marzinzig, M.; Nussler, A.K.; Stadler, J.; Marzinzig, E.; Barthlen, W.; Nussler, N.C.; Beger, H.G.; Morris, S.M.; Brückner, U.B. Improved methods to measure end products of nitric oxide in biological fluids: Nitrite, nitrate, and S-nitrosothiols. Nitric Oxide 1997,1, 177–189. [CrossRef] 20. Blanca, A.J.; Ruiz-Armenta, M.V.; Zambrano, S.; Miguel-Carrasco, J.L.; Gonz á lez-Roncero, F.M.; Fortuño, A.; Revilla, E.; Mate, A.; V á zquez, C.M. l-Carnitine ameliorates the oxidative stress response to angiotensin II by modulating NADPH oxidase through a reduction in protein kinase c activity and NF- κ B translocation to the nucleus. Food Chem. 2017,228, 356–366. [CrossRef] 21. Chomczynski, P.; Sacchi, N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 1987,162, 156–159. [CrossRef] 22. Livak, K.J.; Schmittgen, T.D. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−∆∆CT Method. Methods 2001,25, 402–408. [CrossRef] [PubMed] 23. Bueno, R.; Alvarez de Sotomayor, M.; Perez-Guerrero, C.; Gomez-Amores, L.; Vazquez, C.M.; Herrera, M.D. L-carnitine and propionyl-L-carnitine improve endothelial dysfunction in spontaneously hypertensive rats: Different participation of NO and COX-products. Life Sci. 2005,77, 2082–2097. [CrossRef] Toxics 2020,8, 49 17 of 17 24. Le ó n-Mateos, L.; Mosquera, J.; Ant ó n Aparicio, L. Treatment of sunitinib-induced hypertension in solid tumor by nitric oxide donors. Redox Biol. 2015,6, 421–425. [CrossRef] 25. Gupta, K.; Miller, J.D.; Li, J.Z.; Russell, M.W.; Charbonneau, C. Epidemiologic and socioeconomic burden of metastatic renal cell carcinoma (mRCC): A literature review. Cancer Treat. Rev. 2008 ,34, 193–205. [CrossRef] 26. Speed, B.; Bu, H.Z.; Pool, W.F.; Peng, G.W.; Wu, E.Y.; Patyna, S.; Bello, C.; Kang, P. Pharmacokinetics, distribution, and metabolism of [14C] sunitinib in rats, monkeys, and humans. Drug Metab. Dispos. 2012 . [CrossRef] [PubMed] 27. Thijs, A.M.J.; Van Herpen, C.M.L.; Verweij, V.; Pertijs, J.; Van Den Broek, P.H.H.; Van Der Graaf, W.T.A.; Rongen, G.A. Impaired endothelium-dependent vasodilation does not initiate the development of sunitinib-associated hypertension. J. Hypertens. 2015,33, 2075–2082. [CrossRef] [PubMed] 28. Goodman, V.L.; Rock, E.P.; Dagher, R.; Ramchandani, R.P.; Abraham, S.; Gobburu, J.V.S.; Booth, B.P.; Verbois, S.L.; Morse, D.E.; Liang, C.Y.; et al. Approval Summary: Sunitinib for the Treatment of Imatinib Refractory or Intolerant Gastrointestinal Stromal Tumors and Advanced Renal Cell Carcinoma. Clin. Cancer Res. 2007,13, 1367–1373. [CrossRef] 29. Blasi, E.; Heyen, J.; Patyna, S.; Hemkens, M.; Ramirez, D.; John-Baptiste, A.; Steidl-Nichols, J.; McHarg, A. Sunitinib, a Receptor Tyrosine Kinase Inhibitor, Increases Blood Pressure in Rats without Associated Changes in Cardiac Structure and Function. Cardiovasc. Ther. 2012,30, 287–294. [CrossRef] 30. Kojonazarov, B.; Sydykov, A.; Pullamsetti, S.S.; Luitel, H.; Dahal, B.K.; Kosanovic, D.; Tian, X.; Majewski, M.; Baumann, C.; Evans, S.; et al. Effects of multikinase inhibitors on pressure overload-induced right ventricular remodeling. Int. J. Cardiol. 2013,167, 2630–2637. [CrossRef] 31. Zhu, X.; Stergiopoulos, K.; Wu, S. Risk of hypertension and renal dysfunction with an angiogenesis inhibitor sunitinib: Systematic review and meta-analysis. Acta Oncol. 2009,48, 9–17. [CrossRef] 32. Henderson, K.A.; Borders, R.B.; Ross, J.B.; Huwar, T.B.; Travis, C.O.; Wood, B.J.; Ma, Z.J.; Hong, S.P.; Vinci, T.M.; Roche, B.M. Effects of tyrosine kinase inhibitors on rat isolated heart function and protein biomarkers indicative of toxicity. J. Pharmacol. Toxicol. Methods 2013,68, 150–159. [CrossRef] [PubMed] 33. Sandhu, H.; Cooper, S.; Hussain, A.; Mee, C.; Maddock, H. Attenuation of Sunitinib-induced cardiotoxicity through the A3 adenosine receptor activation. Eur. J. Pharmacol. 2017,814, 95–105. [CrossRef] [PubMed] 34. Eechoute, K.; Van Der Veldt, A.A.M.; Oosting, S.; Kappers, M.H.W.; Wessels, J.A.M.; Gelderblom, H.; Guchelaar, H.J.; Reyners, A.K.L.; Van Herpen, C.M.L.; Haanen, J.B.; et al. Polymorphisms in endothelial nitric oxide synthase (eNOS) and vascular endothelial growth factor (VEGF) predict sunitinib-induced hypertension. Clin. Pharmacol. Ther. 2012,92, 503–510. [CrossRef] [PubMed] 35. Renna, N.F.; de las Heras, N.; Miatello, R.M. Pathophysiology of Vascular Remodeling in Hypertension. Int. J. Hypertens. 2013,2013. [CrossRef] 36. Lakatta, E.G. The reality of aging viewed from the arterial wall. Artery Res. 2013,7, 73. [CrossRef] 37. Coen, M.; Gabbiani, G.; Bochaton-Piallat, M.-L. ATVB in Focus Vascular Cell Lineage Determination and Differentiation Myofibroblast-Mediated Adventitial Remodeling An Underestimated Player in Arterial Pathology. Arterioscler. Thromb. Vasc. Biol. 2011,31, 2391–2396. [CrossRef] 38. Tsamis, A.; Krawiec, J.T.; Vorp, D.A. Elastin and collagen fibre microstructure of the human aorta in ageing and disease: A review. J. R. Soc. Interface 2013,10. [CrossRef] 39. Zhang, M.-J.; Zhou, Y.; Chen, L.; Wang, Y.-Q.; Wang, X.; Pi, Y.; Gao, C.-Y.; Li, J.-C.; Zhang, L.-L. An overview of potential molecular mechanisms involved in VSMC phenotypic modulation. Histochem. Cell Biol. 2016 , 145, 119–130. [CrossRef] 40. Owens, G.K.; Kumar, M.S.; Wamhoff, B.R. Molecular regulation of vascular smooth muscle cell differentiation in development and disease. Physiol. Rev. 2004,84, 767–801. [CrossRef] 41. Ellulu, M.S.; Patimah, I.; Khaza’ai, H.; Rahmat, A.; Abed, Y.; Ali, F. Atherosclerotic cardiovascular disease: A review of initiators and protective factors. Inflammopharmacology 2016,24, 1–10. [CrossRef] 42. Wang, Q.; Zou, M.H. Measurement of reactive oxygen species (ROS) and mitochondrial ROS in AMPK knockout mice blood vessels. In Methods in Molecular Biology; Humana Press: New York, NY, USA, 2018. © 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).