Bioengineering strategies for cancer therapy and modelling

Daniel Barreira Rodrigues Março de 2023 Daniel Barreira Rodrigues Minho | 2023U Universidade do MinhoI3Bs - Instituto de Investigação em Biomateriais, Biodegradáveis e Biomiméticos Bioengineering strategies for cancer therapyand modelling Bioengineering strategies for cancer therapyand modelling Universidade do Minho I3Bs - Instituto de Investigação em Biomateriais, Biodegradáveis e Biomiméticos Daniel Barreira Rodrigues Bioengineering strategies for cancer therapy and modelling Tese de Doutoramento em Engenharia de Tecidos, Medicina Regenerativa e Células Estaminais Trabalho efetuado sob a orientação Doutor Rogério Pedro Lemos de Sousa Pirraco Professor Doutor Rui Luís Gonçalves dos Reis Março de 2023 ii DIREITOS DE AUTOR E CONDIÇÕES DE UTILIZAÇÃO DO TRABALHO POR TERCEIROS Este é um trabalho académico que pode ser utilizado por terceiros desde que respeitadas as regras e boas práticas internacionalmente aceites, no que concerne aos direitos de autor e direitos conexos. Assim, o presente trabalho pode ser utilizado nos termos previstos na licença abaixo indicada. Caso o utilizador necessite de permissão para poder fazer um uso do trabalho em condições não previstas no licenciamento indicado, deverá contactar o autor, através do RepositóriUM da Universidade do Minho. Licença concedida aos utilizadores deste trabalho Atribuição CC BY https://creativecommons.org/licenses/by/4.0/ iii ACKNOWLEDGEMENTS As once said by the American ultrarunner Dean Karnazes, “If You Want To Talk To God, Run An Ultra”, I firmly believe that the I path undertook in order to achieve this body of work required a similar mental fortitude and wouldn’t have been possible without a support crew to whom I own my deepest thanks and appreciation. This all started a while back, and not without the belief deposited in me by Prof. Dr. Rui L. Reis, who allowed me to belong to this team, share the knowledge that I had to offer, and allow me to soak in all that the 3B’s Research Group had to give. My deepest thanks also go to my supervisor Dr. Rogério Pirraco, with whom prior to this journey, I shared back to back the same office space and countless hours in the animal facilities. He embraced the challenge of supervising me when I had already begun my PhD studies, having to shape his knowledge to a field that was not his own and having to put up with my stubbornness, confidence and many times risky ideas. I certainly would not be here if it had not been for you, and I have taken much in from you over these years that has shaped the researcher I am today. I could not go without a special thanks to Dr. Gil Castro, who was always present to share ideas and brainstorm and, Dr. Alexandra Marques, who took me in as one of her own. To the members of the 3Bs Research Group, who, when needed, were there to share some knowledge or give a helping hand, many of you which have already embraced other journeys elsewhere. To all my forever friends, both inside and outside work. I need not to mention each one of your names because you certainly know the contributions that you have bestowed upon me, pushing me forward in times when energy was scarce, helping develop new ideas and concepts and ridicule the notso-well-thought ones. To the moments shared over dinners, drinks, and even vacations that constantly renewed my drive. To those who that put up with my competitive nature, my racing calendar and that supported my sporting hobbies. And to whom I shared many smiles and countless hours talking, which heard the troubles that I went through, that supported me in overcoming them, that helped me put everything into perspective, relativize what in my head were major concerns, and helped boost my selfconfidence when it was lacking. A major thanks to my parents, who helped me in so many ways, spiritually, financially, and that always believed in me and that this would be attainable even when certain moments appeared to be grim. Ultimately, I would like to acknowledge the financial support from FCT for my fellowship that financed the projects behind this thesis. iv STATEMENT OF INTEGRITY I hereby declare having conducted this academic work with integrity. I confirm that I have not used plagiarism or any form of undue use of information or falsification of results along the process leading to its elaboration. I further declare that I have fully acknowledged the Code of Ethical Conduct of the University of Minho. v ABSTRACT Cancer is a global pandemic with a high incidence among the world population and effective treatments are for the most part elusive. The tumor microenvironment is a highly complex and heterotypic mixture of cells that interact to regulate central control mechanisms, driving immunosuppression and promoting both survival and invasion of cancer cells into surrounding tissues. It has been this complexity that has made finding effective therapeutics such a demanding task and therefore cancer still remains a burden worldwide in health as well as in economic terms. While the progression in the field of cancer research has been clear over the years, there are still several challenges that need to be addressed. Herein, two different sides to this disease are explored: treatment and in vitro models. Adoptive T cell therapy has shown impressive results, however not without its limitations. The use of the T cell mitogen IL-2 within culture systems is known to lead to early exhaustion of T cell subsets while high density of co-stimulating molecules has been linked to undesired immune responses. As an alternative, a nanoparticle system based on the natural polymer gellan-gum was proposed, with tailorable surface functionalization with co-stimulatory molecules. High levels of T cell expansion were observed over the studied period, with secreted IL-2 levels overcoming those of commercial alternatives. With this system, increased expression of cytotoxic molecules Granzyme B and Perforin were also detected in vitro . On the other spectrum, 3D cancer models have sustained a great number of developments observed by an increase in similarity towards native tissues; however, a requirement for even more complex architectures capable of better mimicking cellular interactions is still present. Therefore, an assembloid-based approach was proposed to develop a 3D in vitro melanoma model to further study cellular interactions. These heterotypic tumor assembloids presented a complex architecture capable of sustaining endothelial cell function as well as a high expression of stemness-related markers. These models were subjected to functionality assays where they showed a capacity for “cooperative invasion” which was coincident with an observed increased production of MMP-2. To further unravel the role of stromal cells in the invasive potential of cancer cells a 3D chemotaxis chamber was developed to study cellular interactions observed in the tumor microenvironment, where stem cells and fibroblasts showed to have a crucial role. Ultimately, this thesis allowed to explore biomedical engineering approaches to further contribute to the knowledge in the field opening new doors to be explored in the future. Keywords: nanoparticles, gellan gum, T cells, heterotypic cancer models, assembloids, chemotaxis. vi RESUMO O cancro é uma pandemia global com uma elevada incidência e cujo desenvolvimento de tratamentos eficazes continua a ser difícil. O microambiente tumoral é uma mistura altamente complexa e heterotípica de células que interagem para regular mecanismos centrais que provocam imunossupressão promovendo a sobrevivência e invasão de células tumorais para os tecidos circundantes. É esta complexidade que tem tornado desafiante encontrar terapias eficazes, tornando esta doença um fardo a nível global em termos de saúde e economia. Enquanto a progressão na área da investigação oncológica tem sido clara ao longo dos anos, existem ainda vários desafios que precisam de serem encarados para permitir futuros desenvolvimentos. Aqui, foram exploradas duas vertentes diferentes desta doença: o tratamento e os modelos in vitro . A terapia celular adotiva tem demonstrado resultados impressionantes, no entanto não sem as suas limitações. O uso do mitogénio IL-2 nestes sistemas de cultura é conhecido por levar rapidamente à exaustão das células T, enquanto o uso de moléculas co-estimulatórias em elevadas densidades está associado a respostas imunes não desejadas. Como alternativa, foi proposto um sistema de nanopartículas baseado no polímero natural goma gelana e funcionalizado com moléculas coestimulatórias. Foram observados elevados níveis de expansão de células T e quantidade de IL-2 secretada superior à de alternativas comerciais. Foi ainda verificado in vitro um aumento de expressão das moléculas citotóxicas Grazima B e Perforina. No outro espectro, têm sido desenvolvidos modelos tumorais 3D com uma cada vez maior similaridade para tecidos nativos; no entanto, a necessidade de arquiteturas ainda mais complexas capazes de melhor representar interações celulares persiste. Assim, foi proposta uma abordagem baseada em “assemblóides” para obter modelos 3D in vitro de melanoma para estudar interações celulares. Estes “assemblóides” tumorais heterotípicos apresentaram uma arquitetura complexa capaz de suportar a função de células endoteliais, bem como a elevada expressão de marcadores de pluripotência. Estes modelos foram sujeitos a ensaios de funcionalidade onde mostraram a capacidade de “invasão cooperativa” que foi coincidente com uma produção aumentada de MMP-2. Para tornar mais claro o papel das células estaminais no potencial invasivo de células tumorais, uma câmara 3D de quimiotaxia foi desenvolvida para estudar as interações celulares observadas no microambiente tumoral onde as células estaminais e fibroblastos mostraram ter um papel determinante. Em última análise, esta tese permitiu explorar abordagens da engenharia biomédica de forma a contribuir para o conhecimento da área e abrir novas portas a serem exploradas no futuro. Palavras-chave: nanopartículas, goma gelana, células T, modelos de cancro heterotípicos, assemblóides, quimiotaxia. vii TABLE OF CONTENTS ACKNOWLEDGEMENTS ............................................................................................................... iii STATEMENT OF INTEGRITY ......................................................................................................... iv ABSTRACT .................................................................................................................................. v RESUMO ..................................................................................................................................... vi TABLE OF CONTENTS ................................................................................................................ vii LIST OF ABBREVIATIONS ........................................................................................................... xiv LIST OF EQUATIONS ................................................................................................................ xviii LIST OF FIGURES ...................................................................................................................... xix LIST OF SUPPLEMENTARY FIGURES ......................................................................................... xxi LIST OF TABLES ....................................................................................................................... xxii LIST OF SUPPLEMENTARY TABLES .......................................................................................... xxiii SHORT CURRICULUM VITAE .................................................................................................... xxiv LIST OF PUBLICATIONS ........................................................................................................... xxv INTRODUCTION TO THE STRUCTURE OF THE THESIS ............................................................. xxix SECTION 1 GENERAL INTRODUCTION ..................................................................................... 33 CHAPTER I - HOW ARE NATURAL-BASED POLYMERS SHAPING THE FUTURE OF CANCER IMMUNOTHERAPY 35 I-1. Contextualization .......................................................................................................... 36 I-2. Evolution of Cancer Immunotherapy ............................................................................. 37 I-2.1. Artificial antigen presentation ............................................................................... 37 I-2.2. Adjuvants ............................................................................................................ 40 I-2.3. Microenvironment immunomodulators ................................................................. 41 I-3. Basics of natural polymers ........................................................................................... 42 I-3.1. Chitin/Chitosan ................................................................................................... 43 I-3.2. Cellulose ............................................................................................................. 43 I-3.3. Alginate ............................................................................................................... 44 xiv LIST OF ABBREVIATIONS # 2D – two dimensional 3D – three dimensional A aAPCs – Artificial antigen presenting cells Abs – Absorbance ACT - Adoptive cell transfer AICD – Activation-induced cell death a-MEM – Minimum Essential Medium ANOVA – Analysis of variance APC - Antigen presenting cells ASCs – Adipose-derived stem cells B BSA - Bovine serum albumin C CAD - Computer‐assisted design CAFs - Cancer associated fibroblasts CAMs - Cell adhesion molecules CAR - Chimeric antigen receptor CD – Cluster of differentiation CED - Convection enhanced delivery Cells/mL - Cell per milliliter CFSE - Carboxyfluorescein succinimidyl ester cm – centimeter CMC - Carboxymethyl cellulose CO2 – Carbon dioxide CSCs - Cancer stem cells CTLA - Cytotoxic T-lymphocyte-associated protein CTRL - Control CXCL - Chemokine (C-X-C motif) ligand D Da - Dalton DAPI - 4′,6-diamidino-2-phenylindole DCs – Dendritic cells DLS - Dynamic light scattering DMSO - Dimethyl sulfoxide DNA - Deoxyribonucleic acid DOX - Doxorubicin E EC – Endothelial cells ECM – Extracellular matrix EDC - 1-Ethyl-3-(3dimethylaminopropyl)carbodiimide EDTA - Ethylenediaminetetraacetic acid EGF - Epidermal growth factor EGM – Endothelial Growth Medium ELISA – Enzyme-linked immunosorbent assay EMT - Epithelial–mesenchymal transition EV - Extracellular vesicles F FAP - Fibroblast activation protein FBS - Fetal bovine serum FGF - Fibroblast growth factor FIB - Focused Ion Beam FITC - Fluorescein isothiocyanate FTIR - Fourier-transform infrared spectroscopy G G’ – Storage Modulus (Shear) xv G’’ – Loss Modulus (Shear) GB - Glioblastoma GC - Glycated chitosan GG - Gellan gum GM-CSF - Granulocyte-macrophage colonystimulating factor GOD - Glucose oxidase GrB - Granzyme B H h – Hours H&E – Hematoxylin–eosin HA - Hyaluronic acid hASCs - Human adipose derived stem cells hDFbs – Human dermal fibroblasts hDMECs – Human dermal microvascular endothelial cells HIF – Hypoxia-inducible factor HLA - Human leukocyte antigens HPMFs - Human primary mammary fibroblasts HR - Homologous recombination hTERT – Human telomerase reverse transcriptase HUVECs - human umbilical vein endothelial cells Hz – Hertz I ICOS - Inducible T cell COStimulator ID - Intradermal IDO - Indoleamine 2,3-dioxygenase IFN – Interferon IGF - Insulin-like growth factor IgG - Immunoglobulin G IL – Interleukin IMQs – Imidazoquinolines ISH - In situ hybridization ITGB - Integrin beta K kV – Kilovolt L LAG3 - Lymphocyte activation gene 3 LC - Langerhans cells LDH - Lactate Dehydrogenase LPA - Lysophosphatidic acid LPS – Lipopolysaccharide LYVE - Lymphatic vessel endothelial hyaluronan receptor M M – Molar MAGS - Reduced graphene oxide M-CSF - Macrophage Colony-Stimulating Factor MCSs - Multicellular spheroids MES - 2-(N-morpholino)ethanesulfonic acid μm – Micrometer μM – Micromolar mg/mL – Milligram per milliliter MHC - Major histocompatibility complex min - Minutes MIP - Macrophage inflammatory protein mL – Milliliters mmol/L – Millimole per liter MMPs - Matrix metalloproteinases MPL - Monophosphoryl lipid mRNA – Messenger RNA Ms - Mouse MTS – 3-(4,5-dimethylthiazol-2-yl)-5-(3carboxymethoxyphenyl)-2-(4-sulfophenyl)-2Htetrazolium xvi MW– Molecular weight N N - Newton NaV - NeutrAvidin NHS N-Hydroxysuccinimide NK - Natural killer nm – Nanometer nM – Nanomolar NOS - Nitric oxide synthases npGG - Gellan gum nanoparticles NPs – Nanoparticles O O/W - Oil-in-water O/W/O - Oil-in-water-in-oil ODN – Oligodeoxynucleotides OMS - Organotypic Multicellular Spheroids OVA – Ovalbumin P % – Percentage (w/v) – Weight/volume percentage p – Statistical level of significance Pa – Pascal PBMCs - Peripheral blood mononuclear cells PBS - Phosphate buffer saline PDGF - Platelet-derived growth factor PDI - Polydispersity index PDL - Programmed death-ligand PDX - Patient-derived xenograft Phalloidin – Phalloidin–Tetramethylrhodamine B isothiocyanate PMA - Phorbol myristate acetate PMMA - Polymethyl methacrylate POU5F1 - POU Class 5 Homeobox 1 Prf - Perforin PSR - Picro-Sirius Red PTT - Photothermal therapy PVA - Poly(vinyl alcohol) Q qPCR – quantitative real-time Polymerase Chain Reaction R Rb - Rabbit RGD - Arginylglycylaspartic acid (RGD) RHAMM - Receptor for hyaluronan-mediated motility RNA - Ribonucleic Acid RPMI - Roswell Park Memorial Institute RT – Room temperature S SD – Standard deviation SDS - PAGE - Sodium dodecyl-sulfate polyacrylamide gel electrophoresis (SDS-PAGE) SEM – Scanning electronic microscopy SOX2 - SRY-Box Transcription Factor 2 STAT - Signal transducer and activator of transcription STEM - Scanning transmission electron microscope SWNT - Single-walled carbon nanotube T TAA - Tumor associated antigens TDTSs - Tissue-derived tumor spheres TERM – Tissue engineering and regenerative medicine TGF - Transforming Growth Factor xvii TH cells – T helper cells TIL – Tumor infiltrating lymphocytes TIMP - Tissue inhibitors of metalloproteinases TLR - Toll-like receptor TME - Tumor microenvironment TNF – Tumor necrosis factor Treg – Regulatory T cells TRIS - Tris(hydroxymethyl)aminomethane TRITC - Tetramethylrhodamine B isothiocyanate U UDP-glucose - Uridine diphosphate glucose ULA - Ultra-low attachment UM - Uveal melanoma V V – Volume VEGF – Vascular endothelial growth factor (v/v) – Volume/volume percentage W W/O - Water-in-oil Wd – Dry weight Wt - Weight Ww – Wet weight xviii LIST OF EQUATIONS Equation III-1 Equation of the water uptake/content. ........................................................................ 119 xix LIST OF FIGURES Figure I-1 Immunotherapy strategies for the treatment of cancer. ....................................................... 42 Figure I-2 Natural polymer-based systems for the development of immunotherapeutics. ..................... 46 Figure I-3 Natural-based hydrogels used in immunotherapeutic strategies. ......................................... 50 Figure I-4 HA as an adjuvant for the development of nanoparticles for immunotherapy. ...................... 58 Figure II-1 Cell interactions in the tumor microenvironment shape disease progression. ..................... 76 Figure II-2 3D spheroid culture models for the in vitro recreation of the tumor microenvironment. ....... 81 Figure II-3 In vitro tumor spheroids as suitable tools to study cell adhesion molecules. ....................... 85 Figure II-4 Soluble factors play a role in intercellular communication within 3D spheroid systems. ...... 89 Figure II-5 In vitro tumor spheroid models host tumor ECM mechanics. ............................................. 92 Figure III-1 Chemical structure of (a) deacylated gellan gum and (b) native gellan gum. .................... 112 Figure III-2 Organization of individualα-chains into triple helices. ...................................................... 116 Figure IV-1 npGG production and morphological characterization. .............................................. 153 Figure IV-2 Physical and biological Characterization of npGG. ..................................................... 155 Figure IV-3 Bio-functionalization of npGG. ..................................................................................... 157 Figure IV-4 Characterization of the interaction of npGG aAPCs with murine T cells. ................... 158 Figure IV-5 α -CD3/ α -CD28 npGG can stimulate T cells activation. ............................................. 162 Figure IV-6 Cytotoxic T cell responses of murine splenocytes stimulated with npGG aAPCs. ..... 163 Figure V-1 Production of stromal MCS as building blocks for assembloid formation. ......................... 190 Figure V-2 Assembly of structured MCSs into complex melanoma models. ....................................... 193 Figure V-3 Phenotypic characterization of assembloids and of their forming subunits. ....................... 196 Figure V-4 Characterization of assembloid and CTRL MCS morphology and viability in response to doxorubicin treatment. ............................................................................................................ 197 Figure V-5 MMPs as an active agent in melanoma tumor invasion. ................................................... 199 Figure V-6 3D invasion profile of assembloids and MCSs in Matrigel®. ............................................. 201 xx Figure VI-1 Chemotaxis chamber design and characterization. ......................................................... 232 Figure VI-2 Chemotaxis chamber design and characterization. ......................................................... 235 Figure VI-3 Chemotaxis of stromal cells in a 3D tumor microenvironment model. ............................. 236 xxi LIST OF SUPPLEMENTARY FIGURES Supplementary Figure IV-1 Gating strategies for CD4+/CD8+ T cell panels in murine splenocytes. ...... 178 Supplementary Figure IV-2 Surface modification of npGG with NeutrAvidin. ...................................... 179 Supplementary Figure V-1 Formation of VMM15 melanoma assembloids and CTRL MCS over time. . 216 Supplementary Figure V-2 Proliferation gradient characterization in VMM15 melanoma assembloids.216 Supplementary Figure V-3 Gene expression of pluripotency transcription factors in 2D monocultures of the cellular constituents of the melanoma assembloid. ............................................................ 217 Supplementary Figure V-4 Gene expression of pluripotency transcription factors in 2D monocultures of the cellular constituents of the melanoma assembloid. ............................................................ 217 Supplementary Figure V-5 Characterization of assembloids and MCS morphology in response to doxorubicin treatment. ............................................................................................................ 219 Supplementary Figure V-6 Characterization of assembloids and MCSs viability in response to doxorubicin treatment. .............................................................................................................................. 219 Supplementary Figure V-7 Zymography of MMP2 and MMP9 produced by melanoma assembloids and MCSs. .................................................................................................................................... 219 Supplementary Figure V-8 Relative quantification of Active MMP-2, Pro-MMP2 and Pro-MMP9 by melanoma assembloids and MCSs. ........................................................................................ 221 Supplementary Figure V-9 Release of TIMP-1 and TIMP-2 by melanoma MCSs. ................................ 221 Supplementary Figure V-10 3D invasion profile of MCSs in Matrigel®. ............................................... 222 Supplementary Figure V-11 Area of invading edge of assembloids and MCSs in Matrigel®. ................ 222 Supplementary Figure VI-1 Computer-aided design of chemotaxis chamber master mold. ................. 244 xxii LIST OF TABLES Table III-1 Physical properties of Span 80 and Tween 20. ................................................................ 113 Table III-2 Summary of the cell types used and their tissues of origin. .............................................. 121 Table III-3 Antibodies used for flow cytometry. ................................................................................. 126 Table III-4 ELISA procedure summary. ............................................................................................. 127 Table III-5 Primer sequences. .......................................................................................................... 129 Table III-6 Taqman references. ........................................................................................................ 129 Table III-7 Antibodies used for ICC and IHC. .................................................................................... 131 Table IV-1 Surface interaction between npGG aAPCs and murine CD4+ T cells. ................................. 159 xxiii LIST OF SUPPLEMENTARY TABLES Supplementary Table IV-1 Primary and secondary antibodies used for used for immunolabelling and particle functionalization. ........................................................................................................ 176 Supplementary Table IV-2 Sequence of primers used for RT-PCR studies. ........................................ 177 xxx structured as an adapted version of each manuscript, including its main contents (abstract, introduction, materials and methods, results, discussion, conclusions and references). In Chapter IV, we describe the development of a novel platform for in vitro T cell activation. In this work, we tackled both the production of gellan gum nanoparticles as well as their functionalization with relevant co-stimulatory antibodies. We took a step further and studied their functionality in vitro in stimulating relevant T cell subpopulations. In Chapters V and VI we shift our focus to the development of a heterotypic 3D tumor in vitro model and the understanding of cellular crosstalk between stromal cells and tumor cells. To carry out these studies, melanoma was defined as our disease model. Chapter V describes how endothelial cells, fibroblasts, stem cells and melanoma cells were used to create a spherical tumor model based on the assembloid methods. Stromal compartments were produced and assembled into a more complex tumor architecture where the impact of stromal cells was studied at different levels such as 3D cell invasion. Given the obtained results, in the subsequent Chapter VI we carried on to develop a 3D culture platform that would allow inter-cellular communication and that would serve as a base to evaluate cell migration in response to paracrine signaling. This platform was characterized in its ability to allow the diffusion of biomolecules and cell recruitment between the different cell populations was assessed. Finally, in Chapter VII, we outline the accomplishments and the significance of the presented works for their respective fields and speculate on putative future developments fueled by those. xxxi Scheme illustrating the different approaches used throughout this thesis for the exploration of both novel therapeutic approaches and the creation of relevant 3D in vitro cancer models. npGG, Gellan gum nanoparticles. xxxii “If You Want To Run, Run A Mile. If You Want To Experience A Different Life, Run A Marathon. If You Want To Talk To God, Run An Ultra” Dean Karnazes 33 SECTION 1 GENERAL INTRODUCTION 34 CHAPTER I HOW ARE NATURAL-BASED POLYMERS SHAPING THE FUTURE OF CANCER IMMUNOTHERAPY Chapter I – How are natural-based polymers shaping the future of cancer immunotherapy 35 CHAPTER I Chapter I - HOW ARE NATURAL-BASED POLYMERS SHAPING THE FUTURE OF CANCER IMMUNOTHERAPY * ABSTRACT With the increasing knowledge on cancer pathophysiology, new therapeutics based on the modulation of the immune system have been developed, overcoming many of the disadvantages associated to traditional pharmaceuticals such as chemotherapeutics. Several immunotherapy systems have in fact become the preferred treatments to tackle particular types of cancer. Despite the impressive clinical results of such systems, issues such as biomolecule susceptibility to proteolytic degradation and tumor microenvironment immunosuppression need to be overcome to further increase efficacy and safety upon use in patients. Natural-based polymers have shown the potential to address some of these limitations. This type of materials, widely used in the field of tissue engineering and regenerative medicine, are being increasingly incorporated in the development of improved immunotherapeutics due to several intrinsic properties such as biocompatibility and bio-similarity. In this chapter, the novelties these polymers have brought to the field of immunotherapy and how they have been implemented to create new and more complex therapeutics is outlined. Finally, what the future may hold for natural-based polymers use in immunotherapy and identify emerging trends is discussed. * This chapter is based on the following publications: Rodrigues DB, Reis RL, Pirraco RP. How are natural-based polymers shaping the future of cancer immunotherapy: a scoping review. Submitted (2023) Chapter I – How are natural-based polymers shaping the future of cancer immunotherapy 36 I-1. CONTEXTUALIZATION The impact of the tumor’s microenvironment on the efficacy of current cancer therapeutics has become the object of increased study. It has been established that tumor extracellular matrix, intratumoral hypoxia, tumor resident cells and the immunosuppressive capacity of cancer cells may hamper currently applied treatments. Dendritic as well as T cells, responsible for conducting anti-tumoral responses, are some of the most affected cell types and this immunosuppression leads to tumor cell expansion and migration. This immunosuppressive capacity has led to the development of the concept of “Immunotherapy” which was initially introduced as a form of biological therapy in order to boost the natural immune response and to aid the host in responding against a certain pathology. This was demonstrated early on through blocking the immunosuppressive effects of cytotoxic T-lymphocyteassociated protein 4 (CTLA-4) with antibodies which in turn resulted in the rejection of tumors in immunocompetent mice models [1]. Since then, it has been widely adopted in many forms in order to stop or slow tumor growth and avoid tumor metastasis. Several different methods of immunotherapy have been developed namely immune checkpoint inhibitors, T cell transfer therapy (Adoptive Therapy), monoclonal antibodies, artificial antigen presenting systems and immunological adjuvants. The introduction of biomaterials in this field has allowed the development of novel systems comprehending greater biological similarity towards native molecules. This plays greatly in favor of increasing the biocompatibility of these systems while additionally bringing new properties to the table. Natural Polymers are among the most promising biomaterials. They are naturally occurring polymers readily available in nature or extracted from plants or animals. Some examples of these natural occurring polymers are proteins, carbohydrates or even nucleic acids. Many of these natural materials are known for their outstanding biological performance such as tensile strength, adhesive properties, superhydrophobicity, toughness, self-healing and self-assembly [2–5]. The application of biomaterials in the field of cancer immunotherapy has to some extent overlapped requirements with the field of tissue engineering and regenerative medicine. This has helped fuel the development of novel immunotherapeutics based on natural materials. Examples of these are spherical micro or nanoparticles, nano and microcapsules, micelles, artificial antigen presenting systems, hydrogels, microneedles, scaffolds and natural based immunoadjuvants. These systems have been applied in a standalone manner or in combination with more conventional therapies, such as, chemoand radiotherapy. Throughout this chapter we will address the main advantages of using natural based systems when compared to more conventional synthetic polymers, how these systems may play an important role Chapter I – How are natural-based polymers shaping the future of cancer immunotherapy 37 in overcoming certain key issues in immunotherapy and how they may aid in shaping the future of immunotherapy. I-2. EVOLUTION OF CANCER IMMUNOTHERAPY Immunotherapy may be defined as a form of treatment that utilizes the immune system, either by activation or suppression, to overcome an illness. This may encompass autoimmune diseases, hypersensitivities and different forms of cancer. Immunotherapeutics are considered a form of biological therapy, applied to direct immune responses. Some of the tools used to achieve this goal include the administration of immunomodulating agents such as interferons, interleukins, colony-stimulating factors, monoclonal antibodies and different forms of vaccines. With the field focused towards creating new more precise and effective systems, several developments have been made over the past years which can be grouped into 3 main categories: artificial antigen presenting systems, adjuvants and microenvironment immunomodulators (Figure I-1). I-2.1. Artificial antigen presentation Antigen presentation is the key mechanism of action by which the immune system develops antigen specific responses. This mechanism of action is dependent on the presentation of proteins to lymphocytes in the form of short peptide fragments or antigens. For this presentation to occur, professional antigen presenting cells (APCs) must process protein antigens, breaking these into peptides and proceed to their presentation in conjunction with either class I or class II MHC molecules on the cell surface. Once present at the cell surface, these molecules interact with the appropriate T cell receptor to generate an effective immune response. Additionally, complementary signaling is required, such as the interaction between CD80/86 on the APC and CD28 on the surface of the T cell, followed by a third signal consisting on the production of cytokines by the APC which in turn leads to the full activation of the T cell. The understanding of how antigens are presented to immune cells and the ability of the tumor microenvironment to suppress anti-tumor responses has led to the conceptualization of artificial antigen presentation. This may be performed by one of two main strategies i) an indirect approach which consists in delivering a specific antigen to circulating antigen presenting cells, for it to be presented on their surface by MHC molecules and ii) a direct method in which a delivery system is functionalized with co-stimulatory molecules such as antigen loaded MHCI or MHCII molecules and anti-CD28 antibodies for a direct Chapter I – How are natural-based polymers shaping the future of cancer immunotherapy 38 interaction with host T cells. It was based on the latter that the concept of “artificial antigen presenting cells (aAPCs)” was created. The strategies used to develop these artificial antigen presenting systems can be of cellular or acellular nature. Cell-based strategies may be based on various cell sources from autologous to xenogenic and even exosomal strategies. Adoptive T cell therapy (ACT) is one of the most common immunotherapy strategies and consists in the in vitro expansion of tumor antigen-specific T cells which are then infused back into their patients [6,7]. One of the greatest handicaps of this system is the lack of efficiency in terms of generating a great number of antitumor T cells in a short period of time. This not only renders the technique costly but also requires an exhaustive process prior to clinical application. The fate of ACT in terms of clinical efficacy is largely dependent on how the antigen-specific T cells are stimulated during the priming phase [8–10] and dependent on downstream stimulation with γ chain receptor cytokines such as IL-2, IL-7, IL-15 and IL-21 [11–13]. An inefficient priming may result in hyporesponsive or anergic T cells resulting in a lack of proliferation and/or loss of effector function when in contact with the respective antigen, rendering the treatment ineffective. However, on the contrary, excessive stimulation of the cells in vitro may also compromise treatment efficiency due to T cell induced cell death (AICD) [14,15]. Therefore, a fine balance is required in order to obtain a high number of effector T cells and this is where particle-based methods gain clear advantage as these are highly tunable systems with controllable properties. Alternative cell-based methods such as gene-engineered aAPCS have been developed to overcome some of these issues. K562 cells are a human erythroleukemic cell line that was derived from patients with chronic myelogenous leukemia in blastic crisis [16]. These cells prove interesting as they lack the expression of endogenous HLA class I, II or CD1d, as well as of co-stimulatory molecules such as CD86, CD83, OX40L, ICOSL or CD40L [17]. Another key aspect is the lack of expression of inhibitory molecules like PDL1, PDL2, B7H3 and B7H4 [17], which will allow for a continued effector function even in an immune suppressive microenvironment. Regarding cytokine expression, despite the lack of expression of common γ-chain receptor cytokines, these cells secrete M-CSF, IL-6, IL8, TGF-β and MIP-1α [17]. All these factors allow for an interesting platform in which K562 are then transduced to express HLA class I molecules and costimulatory signal 2 CD80 and/or CD86 [17]. Tumorspecific T cell expansion, through the use of autologous dendritic cells derived from patient’s peripheral blood mononuclear cells (PBMCs), is another popular method to induce tumor-specific responses. Herein, immature dendritic cells (DCs) are activated and matured by stimulation with specific factors such as polarizing cytokines GM-CSF and IL-4 [18], while additional downstream re-stimulations are required to generate enough tumor infiltrating lymphocytes (TIL). However, despite the advantages of being an Chapter I – How are natural-based polymers shaping the future of cancer immunotherapy 39 autologous method, several drawbacks are still present, namely the already mentioned difficulty in generating a sufficient number of TIL with effector function. This may have several causes, namely donor variability leading to an inconsistent generation of effector memory T cells regarding function or persistence [19]. Another strategy that has been adopted is the creation of chimeric antigen receptor redirected T cells (CAR T cells), which are genetically modified T cells that encode for transmembrane chimeric molecules with dual functions: (a) immune recognition of tumor antigens expressed on the surface of tumor cells (b) active promotion and propagation of signaling events controlling the activation of the lytic machinery [20]. In order to achieve a good clinical outcome, several parameters must be taken into consideration given their direct correlation with the efficacy of the treatment: i) choice of the target epitope; ii) architecture of the produced CAR; iii) method of administration ranging from doses to frequency; iv) efficient tumor homing and survival in the tumor microenvironment; v) patient lymphocyte depletion prior to administration of CAR-T cells [21]. Despite being a promising system due to its tunability, there are still a combination of issues which make this system far from ideal, namely, the lack of specific targetable antigens and inefficient trafficking toward the tumor foci due to the unbalanced secretion of cytokines from tumor cells such as CXCL9 and CXCL10 [21], which limit the full potential of the system. Additionally, the tumor microenvironment also presents a series of obstacles related to inhospitability and inaccessibility to immune cells due to hypoxia, low nutrients and ultimately the high concentration of acidic metabolites that hamper T cell proliferation and cytokine production [21]. Regarding particle-based aAPCS, the topic of whether nanoor micro-particles are better suited for antigen delivery to T cells has been an ongoing debate over the past years [22–25]. While this debate is highly dependent on the final application of the system, studies have reported that macroparticles mimicking APC size tend to produce better results in terms of achieving stable, tight synapse-like contacts with the ligand-displaying microparticles. On the other side of the spectrum, nanoparticles offer other advantages such as surface area to volume ratio, the capacity to deliver therapeutic cargo and the ease in crossing various anatomical niches. Together with size, particle shape variance has also been a characteristic known to promote aAPCs/T cell interactions [26–28]. However, despite size, shape and core material differences, all of them share common properties such as high tunability and reproducibility in stimulating T cells across batches, which makes them ideal candidates for the preparation of aAPCs when compared to cell-based methods, which display numerous variability issues. Strategies employing nanoparticle systems, such as biocompatible iron-dextran paramagnetic particles (50-100 nm in diameter) and avidin-coated quantum dot nanocrystals (~30 nm), have been reported and used to induce Chapter I – How are natural-based polymers shaping the future of cancer immunotherapy 46 considered how liable these peptides are to mechanical clearance and proteolytic degradation in the microenvironment, which may lead to antigen denaturation and loss of antigenicity [76]. The use of natural polymers for the development of these system has allowed not only to exploit properties such as biocompatibility and biodegradability but also other key aspects such as ionotropic gelation capability or their structural resemblance with human extracellular matrix proteins. This allowed room for the development of both microand nanoparticles and injectable hydrogel systems which can ensure the protection of key molecules from the hostile tumorigenic environment while potentiating immune-stimulatory effects, therefore increasing their half-life upon administration. Here, we will review some of the most recent developments in the field of immunotherapy involving the use of natural polymers (Figure I-2). Figure I-2 Natural polymer-based systems for the development of immunotherapeutics. Chapter I – How are natural-based polymers shaping the future of cancer immunotherapy 47 I-4.1. Gel based systems While the use of crosslinkable natural polymers in the field of TERM is widespread, this technology is fairly young in the development of immunotherapeutics. An in situ crosslinkable hydrogel for immunotherapeutic use has been described using alginate [77]. This polymer was used as a delivery system for catalase (Cat) and CpG oligonucleotides for cancer therapy. The rapid gelation of the system by intra-tumoral Ca2+ allowed for both a homogeneous distribution of 131I-Cat throughout the tumor as well as a long-term entrapment of 131I-Cat without leakage into the surrounding healthy tissues. Hence, decomposition of the tumor endogenous hydrogen peroxide (H2O2) was triggered, contributing to higher intra-tumoral oxygenation values maintained over 72 h. This originated greatly reduced levels of HIF-1α upon Cat/ALG treatment. When assessing the potential of the system in radioisotope therapy (RIT) using a 4T1 murine tumor model, 131I-Cat/ALG resulted in tumor-free animals with a prolonged survival without any deaths. A patient-derived xenograft (PDX) mouse tumor model was also used to better represent real human patient tumors where the 131I-Cat/ALG led to 100% elimination of PDX tumors. When tested in a larger animal model of rabbits bearing VX2 tumors, a similar effect was seen, where 131I-Cat/ALG injection resulted in complete tumor regression within 2 weeks and sustained survival for over 150 days. When CpG oligonucleotides were mixed with the 131I-Cat/ALG system and used in combination with intravenous administration of a CTLA-4 antibody, suppression of distant tumor growth was seen. Additionally, the ratio of CTL/Treg was significantly increased, resulting in increased TNF-α and IFN-γ secretion. Long term immunological memory was confirmed through a higher number of effector memory T cells (TEM) (CD3+CD8+CD62L-CD44+) residing in both lymphoid and non-lymphoid tissues as well as protection when animals were rechallenged with secondary tumors. Nucleic acid-based vaccines have made their way into the field of immunotherapy due to their several advantages when compared to more traditional protein-based vaccines. This was clearly evidenced recently with the use of this technology to develop two of the first FDA approved mRNA vaccines to deal with the COVID-19 pandemic, namely the vaccines developed by BioNTech [78] and Moderna [79]. The use of pDNA or mRNA-based vaccines allow the development of CD8+ T cell responses while not being subject to neutralization through immunosuppression, therefore allowing for repeated antigen challenging. Natural origin-based polymers can further contribute to develop more efficient, biocompatible and biodegradable delivery systems for these vaccines. For both BioNTech and Moderna vaccines, lipid nanoparticles consisting of ionizable lipids were used for the safe and efficient delivery of mRNA encoding Chapter I – How are natural-based polymers shaping the future of cancer immunotherapy 48 SARS-CoV-2 S(2P) [80,81]. Injectable hydrogels have also aided the administration of DNA vaccines. Injectable N-succinyl chitosan (S-CS) with oxidized alginate (O-Alg) gel scaffolds have been applied for the local delivery of ovalbumin (OVA) mRNA lipoplexes [82]. Through the introduction of hydrophilic succinic anhydride side groups onto the chitosan backbone, the water solubility of the natural polymer was significantly increased. Oxidation of alginate also led to an increased solubility of the polymer. Crosslinking between the two polymers was achieved through a Schiff-base reaction followed by a lyophilization step. The Schiff-base reaction allowed for a reasonably slow sol-to-gel phase transition which in turn translated into a rehydrated gel scaffold which could easily be injected through a needle. During the rehydration step, the mRNA can be easily loaded into the system. When mRNA was used complexed to a nanoparticle system, a slower degradation rate of the gel was seen, when compared to empty gels, where a steadier release of the nucleic acids was measured overtime. These results were justified through additional crosslinking points occurring between the mRNA and the hydrogel polymer, therefore increasing the system overall stability. Regarding in vivo local mRNA mediated protein expression, when using a Luc reporter gene, only the conditions where the injectable gel system was applied displayed local transfection in vivo . Transient expression of Luc was seen to peak at approximately 8h. Subsequently, OVA mRNA was used with the system to understand whether a relevant immune response could be triggered with the system. When looking into humoral immune responses using the injectable Chitosan-Alginate-OVA system, a significant increase in OVA-specific IgG levels were detected. An alternative injectable smart hydrogel (ISH) composed of HA functionalized with levodopaand poly(ε-caprolactone-co-lactide)ester was developed for the delivery of OVA-expressing plasmid and granulocyte-macrophage colony-stimulating factor (GM-CSF) for the local recruitment of dendritic cells (DCs) [83]. These displayed a slow degradation pattern while sustaining a controlled release of both polyplexes and GM-CSF in vitro and in vivo . The transfection efficiency assays showed that ISH were capable of effectively priming immune cells as seen through the expression of OVA in mice (Figure I-3a). Single subcutaneous injection of ISH in mice enhanced the recruitment of DCs, and of other immune cells, including macrophages and neutrophils. In turn, ISH generated strong antigen-specific humoral responses, and mice that received hydrogel-based vaccination did not develop tumors or had delayed tumor onset. Efficient expansion of T cells while avoiding T cell exhaustion has been deemed a complex task that has captured the attention of the scientific community. Natural polymers have been applied in this regard. Alginate has been recently proposed for the development of a suspended culture method consisting of microscale hydrogel tubes (AlgTubes) [84]. In order to evaluate the potential of the system, industry approved CD3/CD28 Dynabeads from Invitrogen and tetrameric anti-CD3/CD28/CD2 antibodies from Chapter I – How are natural-based polymers shaping the future of cancer immunotherapy 49 Stem Cell Technologies were selected as controls. These tubes, while capable of protecting the cells from hydrodynamic stresses and compacting cells to ensure efficient cell mass transport, also created a cellfriendly microenvironment that allowed for high viability, low DNA damage, high growth rate, high purity and high cellular yield when compared to the respective controls (Figure I-3b). Alginate has also been used for the stimulation of autologous antigen-presenting cells such as dendritic cells. Its capacity to be ionically crosslinkable has allowed for the production of 3D scaffolds embedded with reduced graphene oxide (MAGS) and loaded with OVA and granulocyte-macrophage colony-stimulation factor (GM-CSF) that have been proposed as a vaccine delivery platform for in situ longterm activation of antigen-presenting dendritic cells (DCs) (Figure I-3c). MAGS were capable of efficiently loading both OVA and GM-CSF through direct pipetting onto the surface of the scaffold and the interaction between the reduced graphene oxide and the immunomodulators was strong enough to promote a slow and sustained release over time. When implanted subcutaneously, a significantly higher CD11c+ DC recruitment was confirmed when GM-CSF-doped scaffolds were used, which was sustained over 30 days post implantation. Antigen presentation efficiency was also increased when GM-CSF and OVA were coloaded, since the number of CD11c+SIINFEKL-MHC-I+ cells was significantly greater. This in turn was translated into a larger number of activated IFN-γ+ CD8+ T cells and IFN-γ+ CD4+ T cells in the lymph nodes of stimulated C57BL/6 mice. The MAGS-GM-CSF-OVA system also showed capability as a tool for vaccination. After completing 30 days post vaccination, animals were challenged with OVA-expressing B16 melanoma (B16-OVA) cells and a delay in tumor growth was seen with high percentages of CD11c+CD86+ cells. When determining the effect of central and effector memory T cells, mice which had been vaccinated with the system produced significantly higher numbers of these cells. Similarly to alginate, which is known for its biodegradability, the MAGS scaffolds showed in vivo a gradual loss of the interconnected structure over time, contributing to its biocompatibility in an in vivo setting [85]. Chapter I – How are natural-based polymers shaping the future of cancer immunotherapy 50 Figure I-3 Natural-based hydrogels used in immunotherapeutic strategies. a) Polyplexes released from the hydrogels induce priming of DC 2.4 mouse DCs and RAW 264.7. Adapted with permission from [83]. Copyright 2020, Elsevier. b) T cells cultured in AlgTubes first associate to form small clusters that subsequently grow and until the tube is filled Adapted with permission from [84]. Copyright 2018, John Wiley and Sons. c) Characterization of alginate scaffolds containing various amounts of embedded MAGS. Adapted with permission from [85]. Copyright 2019, John Wiley and Sons. Chapter I – How are natural-based polymers shaping the future of cancer immunotherapy 51 Growth-factor and cytokine encapsulation using tools such as nanoparticle systems or drug releasing hydrogels have in fact been widely used for tumor therapeutics development. Over the past few years, however, increased focus has been placed into developing alternatives to these pre-loaded systems, such as cell encapsulation for the in situ production of cytokines at physiological concentrations. These living release systems could be used to either boost or improve immune responses or to directly combat tumors. Several of such immuno-protective cell encapsulation systems have already been reported. Alginate has been used in combination with K562 cells for the production and release of GM-CSF [86]. In other reports, for the release of IL6, genetically modified CHO cells were loaded into an alginate system to be used in a rat model of hepatocellular carcinoma [87]. Additionally, an alginate poly-L-lysinealginate (APA) copolymer was also reported for the microencapsulation of genetically modified mouse myoblasts (C2C12) for the delivery of angiostatin and IL-2 fusion protein (ssFvIL-2) [88]. HEK293 cells were transfected with several cytokines and chemokine expression vectors for GM-CSF, IFNγ and hIL-15 and encapsulated in alginate for further use in anti-tumor therapy experiments [89]. Atik et al. has described a HA-based low viscosity hydrogel to serve as a vehicle for the delivery of tumor-specific chimeric antigen receptor (CAR) T cells in convection enhanced delivery (CED) [90]. The hydrogel-based carrier presented a significantly higher CAR T cell delivery rate when compared to saline, while preserving the capacity of the CAR T cells to migrate outward of the hydrogel and therefore exhibiting a significantly superior tumor-specific killing of glioma cells versus saline after CED. Cellulose sulphate has been described as an encapsulation material for over 2 decades [91]. Cellulose when used as a mean of encapsulating mammalian cells, has shown to protect cells from immune rejection, retain cells in the site of implantation, provide long term cell survival and allow for the circulation of biomolecules [92]. A cellulose sulphate encapsulating system for Hut-78 cells to produce IL-2 for immunotherapeutic use has been reported [93]. Cellulose sulphate beads comprise a gelated membrane with interconnecting pores which restricts molecule circulation. Molecule properties such as size, structure, flexibility and charge end up playing a determinant role in their release from these particle systems. In this sense, small molecules have the upper hand regarding ease of escaping these 3D structures, while larger molecules are more dependent on their other characteristics. Salmons et al verified that upon stimulation with PMA and ionomycin, the encapsulated HUT-78 cells displayed the capacity to produce detectable levels of IL-2 as early as 3 days after encapsulation. Other authors have described similar systems comprised of gelatin hydrogels enzymatically crosslinked via microbial transglutaminase for the encapsulation of genetically engineered HEK293 to secrete human IL2 [94]. Chapter I – How are natural-based polymers shaping the future of cancer immunotherapy 52 I-4.2. Microneedles Vaccination is an established method to explore long term immunization and is used to prevent a variety of pathologies of either bacterial or viral origin or even for the sensitization against TAAs in the case of cancer. Despite the well-known advantages of vaccination, needle-based immunization still presents issues such as risk of infection due to needle reuse and low patient compliance due to pain and fear. Microneedles (MNs) have been described as an optimal system for the dermal delivery of antigens as they can easily pierce the skin and deliver the antigen in the epidermis and dermis, ultimately in a pain-free delivery manner. MNs take advantage of the several antigen presenting cells present in skin, namely Langerhans cells (LCs) and dermal dendritic cells (dDCs) [95]. These cells display the capacity to capture antigens and migrate to draining lymph nodes where they can present these antigens to T cells, triggering a phenotypical switch to antigen specific T cells and B-cell activation. Dissolving microneedles (dMNs) in particular, consist of fast-dissolving excipients which can be polymers or sugars. When inserted in the skin, these needles dissolve and proceed to release bioactive compounds previously added to the system making them a reliable system for intradermal (ID) vaccination. With this in consideration, several works have been recently proposed regarding microneedle-based approaches for vaccination. A composite microneedle comprised of a chitosan base and a sodium hyaluronate tip was designed for biphasic release of relevant antigens [96]. Upon insertion in the skin, HA dissolves within the dermis for a rapid release of the encapsulated antigen, while the Chitosan base remains within this compartment in which it sustains a controlled release over time while undergoing biodegradation. With this system, a higher and more durable antibody response was achieved when compared to traditional two-dose or double-dose subcutaneous vaccination. Additionally, a chitosan MN system with a patchdissolvable design has been reported for low-dose immunization [97]. Herein, an antigen-loaded chitosan MN was supported by an array patch of hydrophilic polyvinyl alcohol/ polyvinyl pyrrolidone in order to provide additional strength upon MN insertion, overcoming the skin’s inherent elasticity and deformation when exerting pressure. Upon complete insertion in the skin, the supporting array would then dissolve, reducing patch-induced skin irritation. This system showed that through ID implantation, a sustained release of -OVA was verified for up to 28 days. An in vivo rat model showed that a low-dose immunization with this system still led to persistently high antibody levels over an 18-week period which was deemed higher than that achieved through conventional intramuscular immunization. HA has been proposed for the development of dMNs for the ID delivery of OVA [98]. Through the fine tuning of the loaded OVA peptide and the ratios of HA, a stable system was developed with an optimal penetration efficiency Chapter I – How are natural-based polymers shaping the future of cancer immunotherapy 53 followed by gradual dissolution over a period of up to 20 min. When applied in vivo in the skin of female BALB/c (H2d) mice, an overall increase in IgG serum levels were detected. Another example of a recently developed microneedle vaccination system comprises a sodium hyaluronate (HA)/chitosan composite as the building block. This biphasic system was designed to allow for both a rapid and sustained release of antigens mimicking more conventional prime-boost immunization regimen when compared to traditional bolus injection or to the previously described chitosan MN alone. For this effect, the authors developed a MN system composed of an antigen loaded HA tip and chitosan base, which was combined with a poly(vinyl alcohol)/polyvinylpyrrolidone (PVA/PVP) supporting structure [96]. The HA/Ch composite MN when inserted in porcine cadaver skin and rat skin showed to pierce through the stratum corneum and reach the dermal layer. The dissolvable HA tip dissolved within the skin for rapid release of the encapsulated antigens, therefore priming the immune system, while the biodegradable chitosan base remained in the dermis for a prolonged antigen release over 4 weeks, further boosting the antigen driven responses for up to 16 weeks. Immunization with the HA/chitosan MN containing OVA was shown to stimulate both T helper type 1 (Th1) and Th2 immune responses in Sprague−Dawley rats when compared to more traditional two-dose or double-dose subcutaneous vaccination. I-4.3. Films As aforementioned, the intradermal delivery of proteins is a good alternative to more traditional invasive delivery methods. However, this comes not without its own setbacks, as intradermal delivery through intact skin may be rather restrictive depending on the size, stability or even hydrophilic properties of the molecules to be delivered. A method to overcome some of these issues resides in the use of fractional ablative laser microporation, in which pulsed infrared lasers are used to induce a thermal ablation of tissue in micron-sized columns with a diameter of 30–200 μm. Engelke et al described watersoluble dry films to be used as a drug delivery system in laser microporated skin. Blends of PVA with carboxymethyl cellulose (CMC) were used for the production of a hydrophilic polymer with the purpose of solubilization of the films directly on laser microporated skin, given the enhanced water transport from the tissue through the porated skin into the film under occlusion. The PVA/CMC blend films were shown to dissolve within less than 6 h when attached on top of laser-generated micropores, facilitated by the generation of a liquid depot between skin surface and the occlusive tape used for film fixation, which in turn led to an efficient delivery of both RD70 and PS-particles into and through excised pig skin [99]. Chapter I – How are natural-based polymers shaping the future of cancer immunotherapy 54 I-4.4. Carbon Nanotubes The use of chitosan as an adjuvant for photothermal therapy (PTT) was recently described [100]. A single-walled carbon nanotube (SWNT) modified with glycated chitosan (GC) system was used in combination with α-CTLA4 as an anti-tumor therapy strategy. This system was capable of significantly increasing ROS production in 4T1 tumor cells, despite not displaying any direct cytotoxic activity. However, results showed that by the combined use of the SWNT-GC with laser irradiation a significant increase in killing of 4T1 tumor cells was visible, which resulted from a more pronounced temperature increase when SWNT-GC was used in comparison to laser alone. Regarding the immunomodulatory effect of the system, when SWNT-GC were placed in culture with dendritic cells, a higher increase in the expression of CD40 and CD80 could be verified by flow cytometry. Moreover, in the presence of 4T1 tumor cells, an even higher DC activation could be verified as well as increased secretion of TNF-α. When tested in tumor bearing mice, not only did the SWNT-GC system lead to a higher temperature increase inside the tumor under laser irradiation but also lead to a significant reduction in tumor size and number of metastases. Ultimately, when combined with checkpoint inhibition, a significant increase in mice survival time was verified as well as in the production of IFN-γ by splenocytes. I-4.5. Particle-based systems One of the main features of chitosan as a base system for the development of immunotherapeutic strategies is its spontaneous self-assembly in microor nanoparticles when ionically crosslinked with charges of opposite nature. Complexes of different nature may also be formed when using anionic crosslinking substrates. Recently, the effect of chitosan nanoparticles on Vγ9Vδ2 T cells has been studied [101]. This particular subset of T cells was shown to recognize stress-induced phosphonate antigens presented by both cancer cells and pathogen-infected cells in an MHC-independent manner. Chitosan nanoparticles where shown, as a standalone system, to be capable of enhancing the killing potential of Vγ9Vδ2 T cells via upregulation of killing molecule NKG2D expression as well as of FasL and CD56. This system was also shown to have immunomodulatory properties through the enhancement of perforin secretion which is involved in cytotoxic T cell responses. Ultimately, killing potential was confirmed in vitro through direct culture with leukemia cells, which showed an increased killing rate of Vγ9Vδ2 T cells when pretreated with the chitosan nanoparticle system. Other studies used this natural polymer for the development of antigen delivery tools in the form of chitosan modified PLGA nanoparticles (CSAHPP/OVA) [102]. While retaining excellent stability, these particles were shown to induce strong cellular Chapter I – How are natural-based polymers shaping the future of cancer immunotherapy 55 immune responses as seen through the evaluation of lymphocyte proliferation, while also being capable of inducing the secretion of IFN-γ and TNF-α. T cell polarization was also assessed through the production of IgG1 and IgG2a antibodies associated respectively to Th2 and Th1-polarized immune responses. Both IgG1 and IgG2a antibodies were highly induced upon stimulation with the CS-AHPP/OVA system. The potential use of chitosan as an effective adjuvant for DNA vaccines was also explored through the development of a chitosan nanoparticle comprising human papilloma virus (HPV)-16 E7 DNA and IL-12 gene [103]. Chitosan nanoparticles as a standalone system have shown to display immunostimulatory activity [104]. Moreover, their use as co-adjuvants for cytokine therapy, was proven to increase local cytokine retention and bioactivity [105]. The chitosan-E7 DNA+IL-12 system was shown to enhance the proliferative response of T cells to the system. Moreover, an increased cytolytic activity was verified by LDH assay. Mice immunized with this system also presented a significantly higher production of IFN-γ and IL-4 and a decrease in the production of the immunosuppressive cytokine IL-10. When looking into the in vivo effect in a mouse tumor model, a reduction in tumor volume was seen upon immunization with chitosan-E7 DNA+IL-12 [103]. Additional chitosan-based adjuvant systems have been presented. Choi et al, described a Chitosan-RNA adjuvant system for immune modulation where nanoscale polyplexes of toll-like receptor 3-recognizing RNA adjuvants and high molecular weight chitosan (RA/CTS) were formed by ionic crosslinking [106]. Through the subcutaneous injection of the RA/CTS polyplexes in an ovalbumin tumor mouse model, it was possible to show that this system exerted a preventative effect upon challenge with B16-OVA cell line. A greater inhibitory effect was also verified when a second challenge was performed in comparison with other treatments, which was associated to a higher tumor antigen-specific humoral and cellular immune response and with a greater infiltration of CD4 helper T cells as well as CD8 T cells into tumor tissues. Other reports have also used chitosan as a delivery system for RNA targeting cancer therapy. Chitosan-coated selenium nanoparticles (SeNPs) with a folic acid targeting moiety were developed for Fluc mRNA delivery to cancer cells [107]. These particles were capable of not only successfully binding mRNA but also of conferring significant protection to the nucleic acids. This allowed for a stable delivery of the mRNA cargo when tested in vitro , and a further uptake of the FA-targeting system when tested in folate receptor-positive cells. Additionally, other studies have shown that chitosan may reduce the pro-oxidative activity of selenium, which was shown to lead to DNA damage. A polyethylene glycol (PEG)-chitosan-lactate (PCL) nanoparticle system has recently been developed for the delivery pf A2AR-specific mRNA [108], which is known to interfere with the differentiation and function of T cells and has also been associated with a significant tumor regression in tumor-bearing mice [109]. This A2AR siRNA delivery system displayed a high transfection efficiency in T Chapter I – How are natural-based polymers shaping the future of cancer immunotherapy 62 Jawaid M, Thariq M, Saba Fibre-Reinforced Composites and Hybrid Composites NBT-M and PT of B (Ed.), Woodhead Publishing, 123–140 (2019). 6 Restifo NP, Dudley ME, Rosenberg SA. Adoptive immunotherapy for cancer: harnessing the T cell response. Nat. Rev. Immunol. 12(4), 269–281 (2012). 7 Brenner MK, Heslop HE. Adoptive T cell therapy of cancer. Curr. Opin. Immunol. 22(2), 251–257 (2010). 8 Sprent J, Surh CD. Normal T cell homeostasis: the conversion of naive cells into memoryphenotype cells. Nat. Immunol. 12(6), 478–84 (2011). 9 Zhang N, Bevan MJ. CD8+ T Cells: Foot Soldiers of the Immune System. Immunity 35(2), 161– 168 (2011). 10 Takada K, Jameson SC. Naive T cell homeostasis: from awareness of space to a sense of place. Nat. Rev. Immunol. 9(12), 823–832 (2009). 11 Ma A, Koka R, Burkett P. DIVERSE FUNCTIONS OF IL-2, IL-15, AND IL-7 IN LYMPHOID HOMEOSTASIS. Annu. Rev. Immunol. 24(1), 657–679 (2006). 12 Malek TR. The Biology of Interleukin-2. Annu. Rev. Immunol. 26(1), 453–479 (2008). 13 Spolski R, Leonard WJ. Interleukin-21: Basic Biology and Implications for Cancer and Autoimmunity. Annu. Rev. Immunol. 26(1), 57–79 (2008). 14 Arakaki R, Yamada A, Kudo Y, Hayashi Y, Ishimaru N. Mechanism of activation-induced cell death of T cells and regulation of FasL expression. Crit. Rev. Immunol. 34(4), 301–14 (2014). 15 Green DR, Droin N, Pinkoski M. Activation-induced cell death in T cells. Immunol. Rev. 193(1), 70–81 (2003). 16 Klein E, Ben-Bassat H, Neumann H et al. Properties of the K562 cell line, derived from a patient with chronic myeloid leukemia. Int. J. cancer 18(4), 421–31 (1976). 17 Butler MO, Lee J-S, Ansen S et al. Long-Lived Antitumor CD8+ Lymphocytes for Adoptive Therapy Generated Using an Artificial Antigen-Presenting Cell. Clin. Cancer Res. 13(6), 1857–1867 (2007). 18 Paczesny S, Banchereau J, Wittkowski KM, Saracino G, Fay J, Palucka AK. Expansion of Melanoma-specific Cytolytic CD8 + T Cell Precursors in Patients with Metastatic Melanoma Chapter I – How are natural-based polymers shaping the future of cancer immunotherapy 63 Vaccinated with CD34 + Progenitor-derived Dendritic Cells. J. Exp. Med. 199(11), 1503–1511 (2004). 19 Almand B, Resser JR, Lindman B et al. Clinical significance of defective dendritic cell differentiation in cancer. Clin. Cancer Res. 6(5), 1755–66 (2000). 20 Gross G, Eshhar Z. Endowing T cells with antibody specificity using chimeric T cell receptors. FASEB J. 6(15), 3370–8 (1992). 21 D’Aloia MM, Zizzari IG, Sacchetti B, Pierelli L, Alimandi M. CAR-T cells: the long and winding road to solid tumors. Cell Death Dis. 9(3), 282 (2018). 22 Moon JJ, Huang B, Irvine DJ. Engineering Nanoand Microparticles to Tune Immunity. Adv. Mater. 24(28), 3724–3746 (2012). 23 Schmid D, Park CG, Hartl CA et al. T cell-targeting nanoparticles focus delivery of immunotherapy to improve antitumor immunity. Nat. Commun. 8(1), 1747 (2017). 24 Steenblock ER, Fahmy TM. A Comprehensive Platform for Ex Vivo T cell Expansion Based on Biodegradable Polymeric Artificial Antigen-presenting Cells. Mol. Ther. 16(4), 765–772 (2008). 25 Begines B, Ortiz T, Pérez-Aranda M et al. Polymeric Nanoparticles for Drug Delivery: Recent Developments and Future Prospects, (2020). 26 Meyer RA, Sunshine JC, Perica K et al. Biodegradable Nanoellipsoidal Artificial Antigen Presenting Cells for Antigen Specific T cell Activation. Small 11(13), 1519–1525 (2015). 27 Kumar S, Anselmo AC, Banerjee A, Zakrewsky M, Mitragotri S. Shape and size-dependent immune response to antigen-carrying nanoparticles. J. Control. Release 220, 141–148 (2015). 28 Sunshine JC, Perica K, Schneck JP, Green JJ. Particle shape dependence of CD8+ T cell activation by artificial antigen presenting cells. Biomaterials 35(1), 269–277 (2014). 29 Perica K, De León Medero A, Durai M et al. Nanoscale artificial antigen presenting cells for T cell immunotherapy. Nanomedicine 10(1), 119–29 (2014). 30 Glenny AT, Pope CG, Waddington H, Wallace U. Immunological notes. xvii–xxiv. J. Pathol. Bacteriol. 29(1), 31–40 (1926). 31 Sokolovska A, Hem SL, HogenEsch H. Activation of dendritic cells and induction of CD4+ T cell differentiation by aluminum-containing adjuvants. Vaccine 25(23), 4575–4585 (2007). Chapter I – How are natural-based polymers shaping the future of cancer immunotherapy 64 32 Desbien AL, Reed SJ, Bailor HR et al. Squalene emulsion potentiates the adjuvant activity of the TLR4 agonist, GLA, via inflammatory caspases, IL‐18, and IFN‐γ. Eur. J. Immunol. 45(2), 407– 417 (2015). 33 Ismaili J, Rennesson J, Aksoy E et al. Monophosphoryl Lipid A Activates Both Human Dendritic Cells and T Cells. J. Immunol. 168(2), 926 LP – 932 (2002). 34 Chu RS, Targoni OS, Krieg AM, Lehmann P V, Harding C V. CpG Oligodeoxynucleotides Act as Adjuvants that Switch on T Helper 1 (Th1) Immunity . J. Exp. Med. 186(10), 1623–1631 (1997). 35 Hanahan D, Weinberg RA. Hallmarks of Cancer: The Next Generation. Cell 144(5), 646–674 (2011). 36 Dunn GP, Bruce AT, Ikeda H, Old LJ, Schreiber RD. Cancer immunoediting: from immunosurveillance to tumor escape. Nat. Immunol. 3(11), 991–998 (2002). 37 Curran MA, Montalvo W, Yagita H, Allison JP. PD-1 and CTLA-4 combination blockade expands infiltrating T cells and reduces regulatory T and myeloid cells within B16 melanoma tumors. Proc. Natl. Acad. Sci. 107(9), 4275–4280 (2010). 38 Rajabi M, Mousa SA. The Role of Angiogenesis in Cancer Treatment. Biomedicines 5(2), 34 (2017). 39 Ferrara N. Vascular endothelial growth factor as a target for anticancer therapy. Oncologist 9 Suppl 1, 2–10 (2004). 40 Pugh CW, Ratcliffe PJ. Regulation of angiogenesis by hypoxia: role of the HIF system. Nat. Med. 9(6), 677–684 (2003). 41 Diaz-Gonzalez JA, Russell J, Rouzaut A, Gil-Bazo I, Montuenga L. Targeting hypoxia and angiogenesis through HIF-1alpha inhibition. Cancer Biol. Ther. 4(10), 1055–1062 (2005). 42 Zhong H, Chiles K, Feldser D et al. Modulation of Hypoxia-inducible Factor 1α Expression by the Epidermal Growth Factor/Phosphatidylinositol 3-Kinase/PTEN/AKT/FRAP Pathway in Human Prostate Cancer Cells: Implications for Tumor Angiogenesis and Therapeutics. Cancer Res. 60(6), 1541 LP – 1545 (2000). 43 Ferrara N, Hillan KJ, Novotny W. Bevacizumab (Avastin), a humanized anti-VEGF monoclonal antibody for cancer therapy. Biochem. Biophys. Res. Commun. 333(2), 328–335 (2005). 44 Ebewele RO. Polymer science and technology . CRC Press, Boca Raton (2000). Chapter I – How are natural-based polymers shaping the future of cancer immunotherapy 65 45 Kamatar A, Gunay G, Acar H. Natural and Synthetic Biomaterials for Engineering Multicellular Tumor Spheroids. Polymers (Basel). 12(11) (2020). 46 Negut I, Dorcioman G, Grumezescu V. Scaffolds for Wound Healing Applications. Polymers (Basel). 12(9) (2020). 47 Fan D, Staufer U, Accardo A. Engineered 3D Polymer and Hydrogel Microenvironments for Cell Culture Applications. Bioeng. (Basel, Switzerland) 6(4) (2019). 48 Abbasian M, Massoumi B, Mohammad-Rezaei R, Samadian H, Jaymand M. Scaffolding polymeric biomaterials: Are naturally occurring biological macromolecules more appropriate for tissue engineering? Int. J. Biol. Macromol. 134, 673–694 (2019). 49 Koide SS. Chitin-chitosan: Properties, benefits and risks. Nutr. Res. 18(6), 1091–1101 (1998). 50 Kafetzopoulos D, Martinou A, Bouriotis V. Bioconversion of chitin to chitosan: purification and characterization of chitin deacetylase from Mucor rouxii. Proc. Natl. Acad. Sci. 90(7), 2564 LP – 2568 (1993). 51 Hirano S, Zhang M, Chung BG, Kim SK. The N-acylation of chitosan fibre and the N-deacetylation of chitin fibre and chitin–cellulose blended fibre at a solid state. Carbohydr. Polym. 41(2), 175– 179 (2000). 52 Colvin JR. The biosynthesis of cellulose. In: Carbohydrates: Structure and Function . Elsevier, 543– 570 (1980). 53 Cannon RE, Anderson SM. Biogenesis of Bacterial Cellulose. Crit. Rev. Microbiol. 17(6), 435–447 (1991). 54 Marchessault RH, Sundararajan PR. 2 - Cellulose. ASPINALL GOBT-TP (Ed.), Academic Press, 11– 95 (1983). 55 Fujino T, Itoh T. Architecture of the cell wall of a green alga,Oocystis apiculata. Protoplasma 180(1), 39–48 (1994). 56 Smidsrød O, Skja G. Alginate as immobilization matrix for cells. Trends Biotechnol. 8, 71–78 (1990). 57 Haug A, Larsen B, Smidsrod O. Studies on the sequence of uronic acid residues in alginic acid. Acta chem. scand 21(3), 691–704 (1967). Chapter I – How are natural-based polymers shaping the future of cancer immunotherapy 66 58 Gombotz WR, Wee S. Protein release from alginate matrices. Adv. Drug Deliv. Rev. 31(3), 267– 285 (1998). 59 Rowley JA, Madlambayan G, Mooney DJ. Alginate hydrogels as synthetic extracellular matrix materials. Biomaterials 20(1), 45–53 (1999). 60 Fraser JRE, Laurent TC, Laurent UBG. Hyaluronan: its nature, distribution, functions and turnover. J. Intern. Med. 242(1), 27–33 (1997). 61 Price RD, Berry MG, Navsaria HA. Hyaluronic acid: the scientific and clinical evidence. J. Plast. Reconstr. Aesthetic Surg. 60(10), 1110–1119 (2007). 62 Ambrosio L, Borzacchiello A, Netti PA, Nicolais L. Rheological study on hyaluronic acid and its derivative solutions. J. Macromol. Sci. Appl. Chem. 36(7–8), 991–1000 (1999). 63 Laurent TC, Fraser JRE. The properties and turnover of hyaluronan. Presented at: Ciba Found Symp . Wiley Online Library, 1986. 64 Chen WYJ. Functions of hyaluronan in wound repair. In: Hyaluronan . Elsevier, 147–156 (2002). 65 Rayahin JE, Buhrman JS, Zhang Y, Koh TJ, Gemeinhart RA. High and low molecular weight hyaluronic acid differentially influence macrophage activation. ACS Biomater. Sci. Eng. 1(7), 481– 493 (2015). 66 Vigetti D, Karousou E, Viola M, Deleonibus S, De Luca G, Passi A. Hyaluronan: Biosynthesis and signaling. Biochim. Biophys. Acta - Gen. Subj. 1840(8), 2452–2459 (2014). 67 Misra S, Hascall VC, Markwald RR, Ghatak S. Interactions between Hyaluronan and Its Receptors (CD44, RHAMM) Regulate the Activities of Inflammation and Cancer. Front. Immunol. 6, 201 (2015). 68 Senbanjo LT, Chellaiah MA. CD44: A Multifunctional Cell Surface Adhesion Receptor Is a Regulator of Progression and Metastasis of Cancer Cells. Front. cell Dev. Biol. 5, 18 (2017). 69 Kuo JW, Prestwich GD. Materials of biological origin-Materials analysis and implant uses, Comprehensive biomaterials. Ducheyne, P (2010). 70 Della Valle F, Romeo A. Cross-linked esters of hyaluronic acid, Google Patents, (1990). 71 O’Neill MA, Selvendran RR, Morris VJ. Structure of the acidic extracellular gelling polysaccharide produced by Pseudomonas elodea. Carbohydr. Res. 124(1), 123–133 (1983). Chapter I – How are natural-based polymers shaping the future of cancer immunotherapy 67 72 Chandrasekaran R, Millane RP, Arnott S, Atkins EDT. The crystal structure of gellan. Carbohydr. Res. 175(1), 1–15 (1988). 73 Milas M, Shi X, Rinaudo M. On the physicochemical properties of gellan gum. Biopolymers 30(3‐ 4), 451–464 (1990). 74 Chauhan AS, Jain NK, Diwan PV, Khopade AJ. Solubility enhancement of indomethacin with poly (amidoamine) dendrimers and targeting to inflammatory regions of arthritic rats. J. Drug Target. 12(9–10), 575–583 (2004). 75 Gellan gum. In: Thermoreversible Networks: Viscoelastic Properties and Structure of Gels . Springer Berlin Heidelberg, Berlin, Heidelberg, 219–235 (1997). 76 Kersten G, Hirschberg H. Antigen delivery systems. Expert Rev. Vaccines 3(4), 453–462 (2004). 77 Chao Y, Xu L, Liang C et al. Combined local immunostimulatory radioisotope therapy and systemic immune checkpoint blockade imparts potent antitumour responses. Nat. Biomed. Eng. 2(8), 611– 621 (2018). 78 Polack FP, Thomas SJ, Kitchin N et al. Safety and Efficacy of the BNT162b2 mRNA Covid-19 Vaccine. N. Engl. J. Med. 383(27), 2603–2615 (2020). 79 Baden LR, El Sahly HM, Essink B et al. Efficacy and Safety of the mRNA-1273 SARS-CoV-2 Vaccine. N. Engl. J. Med. 384(5), 403–416 (2020). 80 Corbett KS, Edwards DK, Leist SR et al. SARS-CoV-2 mRNA vaccine design enabled by prototype pathogen preparedness. Nature 586(7830), 567–571 (2020). 81 Vogel AB, Kanevsky I, Che Y et al. BNT162b vaccines protect rhesus macaques from SARS-CoV2. Nature 592(7853), 283–289 (2021). 82 Yan J, Chen R, Zhang H, Bryers JD. Injectable Biodegradable Chitosan-Alginate 3D Porous Gel Scaffold for mRNA Vaccine Delivery. Macromol. Biosci. 19(2), e1800242–e1800242 (2019). 83 Duong HTT, Thambi T, Yin Y et al. Degradation-regulated architecture of injectable smart hydrogels enhances humoral immune response and potentiates antitumor activity in human lung carcinoma. Biomaterials 230, 119599 (2020). 84 Lin H, Li Q, Wang O et al. Automated Expansion of Primary Human T Cells in Scalable and CellFriendly Hydrogel Microtubes for Adoptive Immunotherapy. Adv. Healthc. Mater. 7(15), e1701297–e1701297 (2018). Chapter I – How are natural-based polymers shaping the future of cancer immunotherapy 68 85 Sinha A, Choi Y, Nguyen MH, Nguyen TL, Choi SW, Kim J. A 3D Macroporous Alginate Graphene Scaffold with an Extremely Slow Release of a Loaded Cargo for In Situ Long-Term Activation of Dendritic Cells. Adv. Healthc. Mater. 8(5), e1800571–e1800571 (2019). 86 Schwenter F, Zarei S, Luy P et al. Cell encapsulation technology as a novel strategy for human anti-tumor immunotherapy. Cancer Gene Ther. 18(8), 553–562 (2011). 87 Moran DM, Koniaris LG, Jablonski EM, Cahill PA, Halberstadt CR, McKillop IH. Microencapsulation of engineered cells to deliver sustained high circulating levels of interleukin-6 to study hepatocellular carcinoma progression. Cell Transplant. 15(8–9), 785–798 (2006). 88 Cirone P, Bourgeois JM, Shen F, Chang PL. Combined immunotherapy and antiangiogenic therapy of cancer with microencapsulated cells. Hum. Gene Ther. 15(10), 945–959 (2004). 89 Huang XQ. Depot cytokines and chemokines for antitumor therapy in a mouse model. (2005). 90 Atik AF, Suryadevara CM, Schweller RM et al. Hyaluronic acid based low viscosity hydrogel as a novel carrier for Convection Enhanced Delivery of CAR T cells. J. Clin. Neurosci. 56, 163–168 (2018). 91 Dautzenberg H, Schuldt UTE, Grasnick G et al. Development of cellulose sulfate‐based polyelectrolyte complex microcapsules for medical applications. Ann. N. Y. Acad. Sci. 875(1), 46– 63 (1999). 92 Abastado JS, Gunzburg WH, Brandtner EM. The diversity of uses for cellulose sulphate encapsulation. Bioencapsulation living cells Divers. Med. Appl. Bentham Sci. 70–92 (2013). 93 Salmons B, Gunzburg WH. Release characteristics of cellulose sulphate capsules and production of cytokines from encapsulated cells. Int. J. Pharm. 548(1), 15–22 (2018). 94 Yung CW, Bentley WE, Barbari TA. Diffusion of interleukin-2 from cells overlaid with cytocompatible enzyme-crosslinked gelatin hydrogels. J. Biomed. Mater. Res. Part A 95A(1), 25–32 (2010). 95 Engelke L, Winter G, Hook S, Engert J. Recent insights into cutaneous immunization: How to vaccinate via the skin. Vaccine 33(37), 4663–4674 (2015). 96 Chiu Y-H, Chen M-C, Wan S-W. Sodium Hyaluronate/Chitosan Composite Microneedles as a Single-Dose Intradermal Immunization System. Biomacromolecules 19(6), 2278–2285 (2018). 97 Chen M-C, Lai K-Y, Ling M-H, Lin C-W. Enhancing immunogenicity of antigens through sustained intradermal delivery using chitosan microneedles with a patch-dissolvable design. Acta Biomater. Chapter I – How are natural-based polymers shaping the future of cancer immunotherapy 69 65, 66–75 (2018). 98 Leone M, Priester MI, Romeijn S et al. Hyaluronan-based dissolving microneedles with high antigen content for intradermal vaccination: Formulation, physicochemical characterization and immunogenicity assessment. Eur. J. Pharm. Biopharm. 134, 49–59 (2019). 99 Engelke L, Winter G, Engert J. Application of water-soluble polyvinyl alcohol-based film patches on laser microporated skin facilitates intradermal macromolecule and nanoparticle delivery. Eur. J. Pharm. Biopharm. 128, 119–130 (2018). 100 Li Y, Li X, Doughty A et al. Phototherapy using immunologically modified carbon nanotubes to potentiate checkpoint blockade for metastatic breast cancer. Nanomedicine 18, 44–53 (2019). 101 Lin L, He J, Li J, Xu Y, Li J, Wu Y. Chitosan Nanoparticles Strengthen Vγ9Vδ2 T cell Cytotoxicity Through Upregulation Of Killing Molecules And Cytoskeleton Polarization. Int. J. Nanomedicine 14, 9325–9336 (2019). 102 Wusiman A, Gu P, Liu Z et al. Cationic polymer modified PLGA nanoparticles encapsulating Alhagi honey polysaccharides as a vaccine delivery system for ovalbumin to improve immune responses. Int. J. Nanomedicine 14, 3221–3234 (2019). 103 Tahamtan A, Barati M, Tabarraei A et al. Antitumor Immunity Induced by Genetic Immunization with Chitosan Nanoparticle Formulated Adjuvanted for HPV-16 E7 DNA Vaccine. Iran. J. Immunol. 15(4), 269–280 (2018). 104 Hoemann CD, Fong D. 3 - Immunological responses to chitosan for biomedical applications. Jennings JA, Bumgardner JDBT-CBBV 1 (Ed.), Woodhead Publishing, 45–79 (2017). 105 Zaharoff DA, Hance KW, Rogers CJ, Schlom J, Greiner JW. Intratumoral immunotherapy of established solid tumors with chitosan/IL-12. J. Immunother. 33(7), 697–705 (2010). 106 Choi JJ, Le Q-V, Kim D, Kim YB, Shim G, Oh Y-K. High Molecular Weight Chitosan-Complexed RNA Nanoadjuvant for Effective Cancer Immunotherapy. Pharmaceutics 11(12), E680 (2019). 107 Maiyo F, Singh M. Folate-Targeted mRNA Delivery Using Chitosan-Functionalized Selenium Nanoparticles: Potential in Cancer Immunotherapy. Pharmaceuticals (Basel). 12(4), E164 (2019). 108 Masjedi A, Hassannia H, Atyabi F et al. Downregulation of A2AR by siRNA loaded PEG-chitosanlactate nanoparticles restores the T cell mediated anti-tumor responses through blockage of PKA/CREB signaling pathway. Int. J. Biol. Macromol. 133, 436–445 (2019). Chapter I – How are natural-based polymers shaping the future of cancer immunotherapy 70 109 Arab S, Kheshtchin N, Ajami M et al. Increased efficacy of a dendritic cell–based therapeutic cancer vaccine with adenosine receptor antagonist and CD73 inhibitor. Tumor Biol. 39(3), 1010428317695021 (2017). 110 Dong Z, Kang Y, Yuan Q, Luo M, Gu Z. H(2)O(2)-Responsive Nanoparticle Based on the Supramolecular Self-Assemble of Cyclodextrin. Front. Pharmacol. 9, 552 (2018). 111 Lisanti MP, Martinez-Outschoorn UE, Lin Z et al. Hydrogen peroxide fuels aging, inflammation, cancer metabolism and metastasis: the seed and soil also needs ‘fertilizer’. Cell Cycle 10(15), 2440–2449 (2011). 112 Cai Z, Xin F, Wei Z et al. Photodynamic Therapy Combined with Antihypoxic Signaling and CpG Adjuvant as an In Situ Tumor Vaccine Based on Metal-Organic Framework Nanoparticles to Boost Cancer Immunotherapy. Adv. Healthc. Mater. e1900996–e1900996 (2019). 113 Sun W, Du Y, Liang X et al. Synergistic triple-combination therapy with hyaluronic acid-shelled PPy/CPT nanoparticles results in tumor regression and prevents tumor recurrence and metastasis in 4T1 breast cancer. Biomaterials 217, 119264 (2019). 114 Bartheldyová E, Effenberg R, Mašek J et al. Hyaluronic Acid Surface Modified Liposomes Prepared via Orthogonal Aminoxy Coupling: Synthesis of Nontoxic Aminoxylipids Based on Symmetrically αBranched Fatty Acids, Preparation of Liposomes by Microfluidic Mixing, and Targeting to Cancer Cells Expressi. Bioconjug. Chem. 29(7), 2343–2356 (2018). 115 Lee H, Park H, Yu HS, Na K, Oh KT, Lee ES. Dendritic Cell-Targeted pH-Responsive Extracellular Vesicles for Anticancer Vaccination. Pharmaceutics 11(2), 54 (2019). 116 He M, Huang L, Hou X et al. Efficient ovalbumin delivery using a novel multifunctional micellar platform for targeted melanoma immunotherapy. Int. J. Pharm. 560, 1–10 (2019). 117 Li C-X, Zhang Y, Dong X et al. Artificially Reprogrammed Macrophages as Tumor-Tropic Immunosuppression-Resistant Biologics to Realize Therapeutics Production and Immune Activation. Adv. Mater. 31(15), e1807211–e1807211 (2019). 118 Thiery J, Keefe D, Boulant S et al. Perforin pores in the endosomal membrane trigger the release of endocytosed granzyme B into the cytosol of target cells. Nat. Immunol. 12(8), 770–777 (2011). 119 Qian X, Shi Z, Qi H et al. A novel Granzyme B nanoparticle delivery system simulates immune cell functions for suppression of solid tumors. Theranostics 9(25), 7616–7627 (2019). Chapter I – How are natural-based polymers shaping the future of cancer immunotherapy 71 120 Li Q, Zhang D, Zhang J et al. A Three-in-One Immunotherapy Nanoweapon via Cascade-Amplifying Cancer-Immunity Cycle against Tumor Metastasis, Relapse, and Postsurgical Regrowth. Nano Lett. 19(9), 6647–6657 (2019). 121 Lu R, Groer C, Kleindl PA et al. Formulation and preclinical evaluation of a toll-like receptor 7/8 agonist as an anti-tumoral immunomodulator. J. Control. Release 306, 165–176 (2019). 122 Gao F, Zhang C, Qiu W-X et al. PD-1 Blockade for Improving the Antitumor Efficiency of PolymerDoxorubicin Nanoprodrug. Small 14(37), e1802403–e1802403 (2018). 123 Andres Salazar. WO2005102278A1 (2003). 124 Hammerich L, Marron TU, Upadhyay R et al. Systemic clinical tumor regressions and potentiation of PD1 blockade with in situ vaccination. Nat. Med. 25(5), 814–824 (2019). 125 Claverie M, McReynolds C, Petitpas A, Thomas M, Fernandes SCM. Marine-Derived Polymeric Materials and Biomimetics: An Overview, (2020). 126 Saeed AFUH, Su J, Ouyang S. Marine-derived drugs: Recent advances in cancer therapy and immune signaling. Biomed. Pharmacother. 134, 111091 (2021). Chapter II – Modelling the complex nature of the tumor microenvironment: 3D tumor spheroids as an evolving tool 78 growth factor that has become a biomarker for tumor cell activity is insulin-like growth factor (IGF) [69,71] which was also implicated in inhibiting tumor cell apoptosis while stimulating their proliferation [73,75]. Several other soluble proteins have been associated with the direct regulation of the tumor microenvironment, including cytokines and chemokines. These are linked to regulating the nature of immune responses and controlling immune cell trafficking. Cytokines like tumor necrosis factor alpha (TNF-α), TGF-β, IL-6, IL-10 and IL-17 secreted in either an autocrine, endocrine or paracrine manner have assumed a pivotal role in promoting tumor survival and metastasis. This is achieved by several different pathways, may it be immune-suppression, inhibition of angiogenesis, vasculogenic mimicry and cancer cell proliferation, migration and invasion, or aggravating the inflammatory process [50– 52,54,56,58,60,62]. Also crucial to the regulation of these cancer-related processes are chemokines. These are chemotactic cytokines that regulate the migration of immune cells and these have also been implicated in cancer processes [64]. Another form of soluble factor that has been tightly implicated in cancer are extracellular vesicles (EVs). EVs have gained quite some interest from the field due to their ability to transfer bioactive cargoes that have several effector functions. Linked to the transport of lipids, proteins, and nucleic acids, EVs have been implicated in the development and maintenance of tumor growth, metastasis and immune escape [66,68]. II-2.2. Cell-ECM interactions in the tumor microenvironment While cell-cell interactions are crucial in driving cancer processes, the role of ECM is also important. This non-cellular component found within all tissues and organs is not only responsible for the structural support of cellular constituents but also has a well-known role in establishing biochemical and biomechanical cues that are required for tissue morphogenesis, differentiation and homeostatis and that additionally have been involved in driving tumor progression as previously overviewed [70,72]. Different key components contribute to the role of the ECM as a determinant factor for poor prognosis in several different cancers [70,74]. Some of the most influential are metalloproteinases (MMPs) and integrins. MMPs are a family of zinc-containing endopeptidases, which are similar among themselves both structurally and functionally. These enzymes are known for their role tissue repair and remodeling, cellular differentiation, cell mobility and wound healing [76], achieved through the cleavage of ECM components [77]. Moreover, two gelatinases (MMP-2 and MMP-9) have caught the spotlight due to their implication in several mechanisms such as angiogenesis and infiltration of cancer cells as well as metastasization [78– 80]. The production of these molecules has been associated to different non-malignant stromal cells such Chapter II – Modelling the complex nature of the tumor microenvironment: 3D tumor spheroids as an evolving tool 79 as fibroblasts immediately surrounding clusters of cancer cells [81,82]. An imbalance in the production of MMP and its inhibitor TIMP has been identified as a key factor in driving poor prognosis [83,84]. Changes in the structural nature of the ECM can, in turn, alter the mechanical properties of this noncellular component and consequently lead to events such as durotaxis, in which cell migration occurs in response to gradients of extracellular stiffness [85,86]. Similarly to durotaxis, cells have been reported to undergo directed migration along aligned ECM fibers defined as alignotaxis [87]. CAFs have been implicated in this process by promoting directional cancer cell migration through the alignment of fibronectin fibers within the tumor ECM [88]. Cells interact with ECM through a series of integrins which are a class of transmembrane αβ heterodimers that are responsible for the binding of extracellular matrix ligands, cell-surface ligands, and soluble factors [89]. Several domains have been identified, and at least 18 α and eight β subunits are known in humans [90,91]. Different ligands such as the collagen, laminin, fibronectin or leukocyte-specific receptors, interact with these heterodimers in a distinct fashion. In this manner, integrin function embraces several cancer processes such as guiding tumor cell migration and invasion, cancer cell survival and anoikis suppression, extravasation and enhancement of tumor stemness. For instance, α3β1 is associated to the differentiation and maintenance of the CAF phenotype, while also supporting the invasion of pancreatic duct adenocarcinoma heterospheroids [92]. Other effects of integrins on fibroblasts have also been observed, with αbβ6 and α9β1 being implicated in CAF recruitment and in sustaining their survival [93,94]. Integrin α9β1 has additionally been linked to promoting the migration of glioblastoma and osteosarcoma cells as well as metastatic progression [95]. In addition to cell surface expression of integrins, these have also been found in extracellular vesicles [96]. In a model of colorectal cancer, β1 integrin-rich EVs are secreted into circulation by tumor cells to activate resident fibroblasts in remote organs, which in turn induces a pre-metastatic niche and promotes metastatic cancer growth through the secretion of pro-inflammatory cytokines IL-6 and IL-8 [97]. Similarly, α2β1 aided in CAF EV uptake by lung fibroblasts and consequently the activation of the TGF-β signaling pathway in these cells [98]. II-3. MODELING THE TUMOR MICROENVIRONMENT IN VITRO In order to develop 3D tumor models that are able to mimic interactions that take place within the tumor microenvironment, two key aspects come into play. The first is cell source and heterogeneity, which Chapter II – Modelling the complex nature of the tumor microenvironment: 3D tumor spheroids as an evolving tool 80 is an important differentiator for the different known spheroid tumor models, and the second is the level of recapitulation of key cell-cell and cell-ECM interactions that these models can achieve. Herein, we will briefly overview the different types of spheroid models that have already been described and the key features in terms of cellular interactions that have been recently studied. II-3.1. Currently available spheroid models The nomenclature used for 3D tumor models has been quite heterogeneous over time, with several new terms being introduced every so often. Terms like “spheroids”, “sphere”, “tumorsphere”, “oncosphere”, “organoid” or “organotypic spheroid” have been deliberately used, often making it difficult to understand the very nature of each system. These different models distinguish themselves mainly through medium composition used, culture surface, cell density, time required for formation, origin and handling. There is however one common denominator that is the architecture of these systems. While the terms “aggregate” and “spheroids” have distinct meanings, confusion has been installed in using one term or the other. The systems that we will discuss herein are all “spheres” or “spheroids” consisting in closely compacted spherical cultures. And are not to be mistaken with “aggregates” that are loose cellular aggregates that easily detach [99]. Recently, Pasca et al., has overviewed the nomenclature of such systems in the context of nervous system models [100] while Weiswald et al. divided the classification of spherical cancer models into four main groups: 1) multicellular tumor spheroids, 2) tumorspheres, 3) tissue-derived tumor spheres, and 4) organotypic multicellular spheroids [101]. Here we will take a simplistic view to what has been used to name these systems in the context of cancer 3D models, based on the cell source and culture method (Figure II-2). Chapter II – Modelling the complex nature of the tumor microenvironment: 3D tumor spheroids as an evolving tool 81 Figure II-2 3D spheroid culture models for the in vitro recreation of the tumor microenvironment. Different culture methods have been adopted to attempt to recreate tissues within in vitro culture conditions. Spherical 3D models have been a golden standard in the field. Depending on cell-source, tissue digestion and culture methods a varying degree of complexity and homology towards native tumor tissues can be achieved. II-3.1.1. Multicellular tumor spheroids The main discriminator between multicellular spheroids (MCS) and traditional 2D monolayers is that MCS are grown as spheres, which promotes enhanced cell-cell and cell-ECM adhesion. These cellular spheres are generated from single-cell suspension cultures in FBS supplemented medium without the supply of an exogenous ECM and generally originate from cancer cell lines and not from dissociated tissues. Whether cells can spontaneously aggregate into spheres in the absence of a cell attachment substrate is highly dependent on the cell type, therefore it is important to highlight that not all cell lines are capable of generating compact MCS [102]. Chapter II – Modelling the complex nature of the tumor microenvironment: 3D tumor spheroids as an evolving tool 82 While histological resemblance of these 3D culture systems with primary cancer tissues is minimal, they present metabolic and proliferative gradients seen in vivo as well as relevant chemoresistance. Several other key features make MCS desirable tumor models, such as their clonality, easy maintenance and simplicity in performing genetic manipulation. From a biological point of view, MCS can expand up to sizes between 1 to 3 mm in diameter. However, above 500 μm a distinct architecture is known to take over, comprising an outer proliferating layer followed internally by a layer of quiescent cells and housing in its center a necrotic core [101]. Growth dynamics also vary from traditional 2D cultures, where an early exponential phase is observed followed by a period of delayed growth resulting from the increase in the nonproliferating and necrotic cells [103]. Several methods have been proposed for the formation of MCS [104]; however, the most adopted among the community consists in providing conditions in which the adhesive forces between the cells are greater than between cells and the substrate on which they are cultured, as is the case of ultra-low adhesion tissue culture plates. II-3.1.2. Tissue-derived tumor spheres While MCS have aided in recreating cell-cell interactions specific to the tumor microenvironment in vitro , they are still limited in their complexity when taking into consideration the distinct cellular genotypes and phenotypes that make for heterogeneity between tumors of the same histopathological subtype. More biologically representative 3D spherical tumor models are tissue-derived tumor spheres (TDTSs) also called cancer tissue-originated spheroids. These systems are obtained from the partial digestion of cancer tissues into small fragments which then spontaneously form spherical structures within several hours under serum-free conditions [105]. One of the key advantages of these systems is that cell-cell contact is maintained throughout the preparation and culture process which yields spheroids consisting of highly purified and viable cancer cells [106]. This high yield in neoplastic cells may be explained by the strong cell-cell interactions observed between cancer cells, thus leading to the preservation of neoplastic cells during partial dissociation and the loss of non-neoplastic cells, resulting in TDTSs-deprived stromal cells [106]. Among their advantages as a biosimilar tumor model are their capacity to recapitulate avascular tumor regions as well as the maintenance of histological characteristics, gene expression profiles, mutations in relevant genes and tumorigenic and metastatic properties [101]. Chapter II – Modelling the complex nature of the tumor microenvironment: 3D tumor spheroids as an evolving tool 83 II-3.1.3. Tumorspheres Cancer stem cells (CSCs) have become a hot topic due to their important role in tumor dissemination. The capacity for self-renewal and the ability to differentiate into other specialized cell types have been identified in certain subpopulations of cells within tumors, with the added features of being capable of seeding tumors when transplanted into an animal host [107]. Tumorspheres have been created not as another model to mimic cancer tissues but to study the properties of CSCs as it has been shown that tumorspheres do not fully replicate the 3D tumor structure nor environment [108]. Tumorspheres have been known to form when CSCs are plated at low density in nonadherent conditions which promote the proliferation of these cells as clonal nonadherent spherical clusters. These cultures are usually conducted in medium devoid of FBS and supplemented with several factors that favor stem cell growth. In order to first obtain these CSCs, the mechanical and enzymatic dissociation of tumor samples into single cell suspensions is required, but ultimately CSCs culture may also be obtained through cancer cells lines. II-3.1.4. Organotypic multicellular spheroids Organotypic Multicellular Spheroids (OMS) are very distinct from the classical MCS as they are generally obtained from excised tumor tissues similarly to TDTSs but without undergoing digestion. These tissue pieces are then transferred to agar or agarose-coated tissue culture surface in order for them to develop into multicellular spheroids [109,110]. Also important to point out is the capacity of these models to be cryopreserved while retaining their histological characteristics and being subject to only minor phenotypic and genotypic changes after thawing [111]. This model sets itself apart from other tumor models because of its high similarity to native tumor tissues, achieved by avoiding any kind of dissociation process that may interfere with the tissue architecture and cellular organization. This in turn leads to a high cellular heterogeneity similar to that of the tumor by maintaining the presence of vascular, immune and stromal fractions [112] contributing to a comparable 3D model. II-3.2. Modelling cell-cell and cell-ECM interactions in current spheroid models of cancer Modeling the aforementioned cell-cell and cell-ECM crosstalk in in vitro tumor models is a requirement for the field and therefore the creation of biomimetic models capable of modeling not only Chapter II – Modelling the complex nature of the tumor microenvironment: 3D tumor spheroids as an evolving tool 84 drug behavior but also those cellular interactions within the tumor microenvironment has become a priority. In similar fashion to what is described within the tumor microenvironment, 3D tumor models must also present these cell interactions through CAMs and soluble factors while producing ECM that retains characteristics typically observed in tumor-associated ECM in vivo . II-3.2.1. Intercellular adhesion CAMs are not only crucial for the formation of spherical 3D models due to the requirement of cellular aggregation but are also one of the methods by which cells interact and communicate, which in the end becomes crucial for tumor development and invasion. Ultimately, the expression of some of these molecules may be used for targeting purposes for the delivery of novel therapeutics. P-selectin is a CAM with a proven in tumor invasion. Glioblastoma (GB) spheroids were studied to better understand how microglia could facilitate GB invasion and immunosuppression. It was found that P-selectin expression was higher in 3D cultures and in particular when microglia was co-cultured in GB spheroids in contrast to 2D cultures (Figure II-3a). This change in expression mediated the role of microglia in facilitating GB proliferation and invasion by altering the activation state of microglia/macrophages [113]. This confirms the importance of a 3D structure capable of mimicking the tumor microenvironment and associated ECM. Additionally, the expression of anti-inflammatory markers and cytokines IL-10 and TGF-β by microglia/macrophages were increased similarly to in vivo . Hematogenous metastasis is highly dependent on cell adhesion mediated by molecules like E-selectin expressed by the endothelial compartment of blood vessels. Understanding that such regulatory mechanisms also take place in 3D tumor models demonstrates their value in comparison to traditional culture systems. Homotypic and heterotypic 3D spheroids of tumorigenic (BT20 and MCF7) and nontumorigenic (MCF10A) mammary cell lines have also been studied regarding their capability to bind Eselectin [114]. Heterotypic 3D cultures were shown to be the best regarding the capacity to bind E-selectin (Figure II-3b) when compared to 2D, as well as being more invasive. Of late, several other groups have utilized 3D spherical culture systems to study interactions around cadherins and their implications in EMT and cancer cell invasion [115–118]. Cell-cell interactions through CAMs like N-cadherin and E-cadherin, ultimately impact cell contractility and hence cell dispersion or invasion. Heterotypic tumor spheroids consisting of EMT and epithelial A549 cancer cells, demonstrated these interactions through the formation of N-cadherin/E-cadherin adhesion complexes at the interface Chapter II – Modelling the complex nature of the tumor microenvironment: 3D tumor spheroids as an evolving tool 85 between highly contractile EMT cancer cells and poorly contractile epithelial cancer cells during tumor spheroid dispersion [119]. As a potential drug testing tool, multicellular spheroids of triple-negative breast cancer cells co-cultured with endothelial cells where prepared [120]. 3D culture led to an increase in the activation of the VE-cadherin pathway when endothelial cells were cultured in the presence of breast cancer cells, highlighting the importance of these models in recapitulating the tumor microenvironment in vitro . Figure II-3 In vitro tumor spheroids as suitable tools to study cell adhesion molecules. a P-selectin expression was shown to be increased in multicellular spheroids of GB cells when co-cultured with murine microglia when compared to 2D controls. Adapted under the terms of CC 4.0 license from [113]. Copyright 2021, the authors. b Confocal microscopy images of soluble E-selectin (orange) binding to whole co-culture spheroids with BT20 (blue) MCF7 (green) and MCF10A (red) cells on PDMS (A). Superimposed images of soluble E-selectin with individual cell types in co-culture indicate preferential binding of soluble E-selectin to BT20 cells in co-culture (B) when compared to MCF7 (C) or MCF10A cells (D) in co-culture. Adapted with permission from [114]. Copyright 2012, Elsevier. II-3.2.2. Soluble factors The cell relies on different mechanisms through which they inter-communicate, one of these key signaling mechanisms is through the release of soluble factors which should be similar in nature to in vivo tumors when developing spheroid tumor models. These soluble factors can play different roles in Chapter II – Modelling the complex nature of the tumor microenvironment: 3D tumor spheroids as an evolving tool 86 different pathways, one of which is the regulation of cell stemness. Given the importance of stem cell traits in cancer cells and their role in tumor development, spherical tumor models have been used to attempt to recreate the microenvironment in which these cells co-habit within the tumor. Recently, uveal melanoma (UM) cells were studied for their clonal heterogeneity in the form of non-adherent spheroid preparation [121]. Data demonstrated that ZEB1 expression levels were negatively correlated to spheroid formation from the single-cell suspension culture and to the expression of the stemness, suggesting a possible role in the suppression of cancer stem cell properties in UM (Figure II-4a i-ii). While these systems can many times mimic specific cellular interactions that take place within the tumor microenvironment, they can also be created to achieve a higher resemblance with the desired cancer tissue architecture. A recent example of this was the creation of a pancreatic ductal adenocarcinoma model through the preparation of both multicellular spheroids and stratified multicellular spheroids that were produced by a 2-step process together with pancreatic CAF-Stellate Cells [122]. It was shown that this system presented stratification between cancer and stromal cells, accompanied by the expression of several soluble factors found in human pancreatic cancer such as TGF-β, FGF-2, IL-1β, and MMP-9 (Figure II-4b). Additionally, in this model, de novo deposition of collagen and glycosaminoglycans was observed. In a similar fashion, others have attempted to address the question of how soluble factors play a part in tumor development and progression. Growth factors like IGF binding protein 3 (IGFBP3) have been studied given the role of the IGFpathway in tumor cell proliferation, metastasis, and survival. For this purpose, H1299 cell lines transfected with IGFBP3 were used to produce 3D spheroids to study both growth and invasion [123]. It was shown that IGFBP3 negatively impacted 3D spheroids growth and invasion which correlated with an inhibition in the secretion of MMP-1 and an overall decrease in total MMP activity in culture supernatants. TGF has also been long recognized as important for the tumorigenic process, leading groups to develop new 3D culture systems in order to better understand how this cytokine interacts within the tumor microenvironment. Free floating spheroids were prepared from the human gastric cancer line MKN-45, which were then used to study the role of STAT3 activation [124]. These spheroid cultures presented higher STAT3 activity, up-regulation of TGF-β and VEGF with downregulation of IL-6. Additionally, conditioned medium from these gastric cancer spheroids were shown to polarize T cells towards a higher expression of FOXP3, TGF-b, and IL-10 indicative of a Treg phenotype. Another characteristic to consider while creating different 3D culture systems is geometry. While spheroids are valuable building blocks to mimic native tumor tissues in vitro , they many times lack geometrical complexity typical of tumors. To Chapter II – Modelling the complex nature of the tumor microenvironment: 3D tumor spheroids as an evolving tool 87 address this issue, researchers have studied the effects of different geometries in free standing tumor models and the impact of TGF-β signaling [125]. TGF-β appeared to upregulate the expression of cell tension-related proteins for peripheral cells, and alter the sensitivity of cells to their environment. Other recently reported systems have also observed the effects of TGF-β in tumor-simulated microenvironments recreated by 3D spherical models [126–130]. VEGF, a key player in the tumor microenvironment, has been immensely studied in vitro through spheroid cancer models. MG-63 human osteosarcoma cells were used to develop a 3D cancer model using microfluidics in order to study the role of VEGF-A in the tumor microenvironment [131]. A distinct behavior between 3D and 2D cell culture was observed, in which VEGF-A expression decreases upon the application of external stressors (reduced serum culture and HIF inhibition) in 2D cultures but increases while in 3D. Hepatocellular carcinoma, a highly vascularized tumor, was also modelled using 3D culture models for in vitro studies. For this effect, monocellular or co-culture spheroids were produced by seeding of either human liver hepatoma Huh7 (p53mut) and liver cancer HepG2 (p53++) or the co-culture of these at a 1:1 ratio with human umbilical vein endothelial cells (HUVECs)[115]. It was observed that VEGF stimulation led to changes in both size and density of the 3D spheroids, to an increase in invasion and angiogenesis as well as an increase in the expression of EMT markers vimentin, N-cadherin 2 and Thy-1. This importance of VEGF in the tumor process has also led to different heterotypic spheroid cultures comprising tumor cells and endothelial cells. In a 3D spheroid model of malignant pleural mesothelioma, P31 epithelioid MPM cells co-cultured with HUVEC cells permitted endothelial sprouting while SPC111 co-cultured spheroids repealed endothelial sprouts leading to anisotropic sprout arborization [132]. In another heterotypic spheroid model, long-term spheroids of up to 30 days of culture were developed from HCC1954 tumor cells, human fibroblasts, and ECs [133]. This study showed that EC were maintained viable for up to 1 month of culture under agitation while maintaining the expression of key surface markers and not requiring VEGF supplementation, as this growth factor was produced endogenously. Additionally, it was shown that this long-term maintenance is tumor cell line-dependent and, in some cases, dependent on the presence of fibroblasts and agitation. Additionally, several other GFs known to play a part in the cancer microenvironment have been studied in the context of 3D spheroid tumor models in vitro . Drug resistance mechanisms have been recently studied been studied in several different spheroids of both melanoma and metastatic melanoma [134], it which it was shown that the epidermal growth factor (EGF) pathway was affected by triggering protein kinase G, as seen by lower EGFR phosphorylation and reduced activation. Others have developed spheroids of human head and neck squamous cell carcinoma (HNSCC) cell lines with OECM-1 & SAS cells [135]. When stimulating these spheroids with EGF, changes to the Chapter II – Modelling the complex nature of the tumor microenvironment: 3D tumor spheroids as an evolving tool 94 (2016). 4 Truong D, Puleo J, Llave A, Mouneimne G, Kamm RD, Nikkhah M. Breast Cancer Cell Invasion into a Three Dimensional Tumor-Stroma Microenvironment. Sci. Rep. 6, 34094 (2016). 5 Singh S, Ray LAo breast tumor model elucidates dynamic remodeling of tumor microenvironment, Shahi Thakuri P et al. Organotypic breast tumor model elucidates dynamic remodeling of tumor microenvironment. Biomaterials 238, 119853 (2020). 6 Rijal G, Li W. A versatile 3D tissue matrix scaffold system for tumor modeling and drug screening. Sci. Adv. 3(9), e1700764 (2022). 7 Yokota E, Iwai M, Yukawa T et al. Clinical application of a lung cancer organoid (tumoroid) culture system. npj Precis. Oncol. 5(1), 29 (2021). 8 Lam CRI, Wong HK, Nai S, Chua CK, Tan NS, Tan LP. A 3D biomimetic model of tissue stiffness interface for cancer drug testing. Mol. Pharm. 11(7), 2016–2021 (2014). 9 Najafi M, Farhood B, Mortezaee K. Extracellular matrix (ECM) stiffness and degradation as cancer drivers. J. Cell. Biochem. 120(3), 2782–2790 (2019). 10 Gerdes MJ, Sood A, Sevinsky C, Pris AD, Zavodszky MI, Ginty F. Emerging Understanding of Multiscale Tumor Heterogeneity , (2014). 11 Rich JN. Cancer stem cells: understanding tumor hierarchy and heterogeneity. Medicine (Baltimore). 95(1S) (2016). 12 Sutherland RM, McCredie JA, Inch WR. Growth of multicell spheroids in tissue culture as a model of nodular carcinomas. J. Natl. Cancer Inst. 46(1), 113–120 (1971). 13 Eugenin EA. Role of cell-to-cell communication in cancer: New features, insights, and directions. Cancer Rep. 2(6), e1228 (2019). 14 Schwager SC, Taufalele P V, Reinhart-King CA. Cell–Cell Mechanical Communication in Cancer. Cell. Mol. Bioeng. 12(1), 1–14 (2019). 15 Cheng G, Tse J, Jain RK, Munn LL. Micro-Environmental Mechanical Stress Controls Tumor Spheroid Size and Morphology by Suppressing Proliferation and Inducing Apoptosis in Cancer Cells. PLoS One 4(2), e4632 (2009). 16 Ivascu A, Kubbies M. Diversity of cell-mediated adhesions in breast cancer spheroids. Int J Oncol Chapter II – Modelling the complex nature of the tumor microenvironment: 3D tumor spheroids as an evolving tool 95 31(6), 1403–1413 (2007). 17 Lin R-Z, Chou L-F, Chien C-CM, Chang H-Y. Dynamic analysis of hepatoma spheroid formation: roles of E-cadherin and β1-integrin. Cell Tissue Res. 324(3), 411–422 (2006). 18 Saias L, Gomes A, Cazales M, Ducommun B, Lobjois V. Cell–Cell Adhesion and Cytoskeleton Tension Oppose Each Other in Regulating Tumor Cell Aggregation. Cancer Res. 75(12), 2426– 2433 (2015). 19 Tzanakakis ES, Hansen LK, Hu W-S. The role of actin filaments and microtubules in hepatocyte spheroid self-assembly. Cell Motil. 48(3), 175–189 (2001). 20 Yoshii Y, Waki A, Yoshida K et al. The use of nanoimprinted scaffolds as 3D culture models to facilitate spontaneous tumor cell migration and well-regulated spheroid formation. Biomaterials 32(26), 6052–6058 (2011). 21 Kang S-A, Blache CA, Bajana S et al. The effect of soluble E-selectin on tumor progression and metastasis. BMC Cancer 16(1), 331 (2016). 22 Tremblay P-L, Auger FA, Huot J. Regulation of transendothelial migration of colon cancer cells by E-selectin-mediated activation of p38 and ERK MAP kinases. Oncogene 25(50), 6563–6573 (2006). 23 Häuselmann I, Roblek M, Protsyuk D et al. Monocyte Induction of E-Selectin-Mediated Endothelial Activation Releases VE-Cadherin Junctions to Promote Tumor Cell Extravasation in the Metastasis Cascade. Cancer Res. 76(18), 5302–5312 (2016). 24 Ku AW, Muhitch JB, Powers CA et al. Tumor-induced MDSC act via remote control to inhibit Lselectin-dependent adaptive immunity in lymph nodes. Elife 5 (2016). 25 Bal N, Kocer NE, Ertorer ME, Canpolat ET, Kayaselcuk F. Maspin, E-selectin, and P-selectin expressions in papillary thyroid carcinomas and their correlation with prognostic parameters. Pathol. - Res. Pract. 204(10), 743–750 (2008). 26 Woodman N, Pinder E. S, Tajadura V et al. Two E-selectin ligands, BST-2 and LGALS3BP, predict metastasis and poor survival of ER-negative breast cancer. Int J Oncol 49(1), 265–275 (2016). 27 Tanio M, Muramoto A, Hoshino H et al. Expression of functional E-selectin ligands on the plasma membrane of carcinoma cells correlates with poor prognosis in clear cell renal cell carcinoma. Urol. Oncol. Semin. Orig. Investig. 39(5), 302.e9-302.e18 (2021). Chapter II – Modelling the complex nature of the tumor microenvironment: 3D tumor spheroids as an evolving tool 96 28 Kalluri R, Neilson EG. Epithelial-mesenchymal transition and its implications for fibrosis. J. Clin. Invest. 112(12), 1776–1784 (2003). 29 Wendt MK, Taylor MA, Schiemann BJ, Schiemann WP. Down-regulation of epithelial cadherin is required to initiate metastatic outgrowth of breast cancer. Mol. Biol. Cell 22(14), 2423–2435 (2011). 30 Aban CE, Lombardi A, Neiman G et al. Downregulation of E-cadherin in pluripotent stem cells triggers partial EMT. Sci. Rep. 11(1), 2048 (2021). 31 Burandt E, Lübbersmeyer F, Gorbokon N et al. E-Cadherin expression in human tumors: a tissue microarray study on 10,851 tumors. Biomark. Res. 9(1), 44 (2021). 32 Luo Y, Yu T, Zhang Q et al. Upregulated N-cadherin expression is associated with poor prognosis in epithelial-derived solid tumours: A meta-analysis. Eur. J. Clin. Invest. 48(4) (2018). 33 Mrozik KM, Blaschuk OW, Cheong CM, Zannettino ACW, Vandyke K. N-cadherin in cancer metastasis, its emerging role in haematological malignancies and potential as a therapeutic target in cancer. BMC Cancer 18(1), 939 (2018). 34 Cao Z-Q, Wang Z, Leng P. Aberrant N-cadherin expression in cancer. Biomed. Pharmacother. 118, 109320 (2019). 35 Kröger C, Afeyan A, Mraz J et al. Acquisition of a hybrid E/M state is essential for tumorigenicity of basal breast cancer cells. Proc. Natl. Acad. Sci. 116(15), 7353–7362 (2019). 36 Sinha D, Saha P, Samanta A, Bishayee A. Emerging Concepts of Hybrid Epithelial-to-Mesenchymal Transition in Cancer Progression, (2020). 37 Liao T-T, Yang M-H. Hybrid Epithelial/Mesenchymal State in Cancer Metastasis: Clinical Significance and Regulatory Mechanisms, (2020). 38 Yang B, Bai J, Shi R et al. TGFB2 serves as a link between epithelial-mesenchymal transition and tumor mutation burden in gastric cancer. Int. Immunopharmacol. 84, 106532 (2020). 39 Basu M, Bhattacharya R, Ray U, Mukhopadhyay S, Chatterjee U, Roy SS. Invasion of ovarian cancer cells is induced byPITX2-mediated activation of TGF-β and Activin-A. Mol. Cancer 14, 162 (2015). 40 Kim BN, Ahn DH, Kang N et al. TGF-β induced EMT and stemness characteristics are associated with epigenetic regulation in lung cancer. Sci. Rep. 10(1), 10597 (2020). Chapter II – Modelling the complex nature of the tumor microenvironment: 3D tumor spheroids as an evolving tool 97 41 Hao Y, Xiao Y, Liao X et al. FGF8 induces epithelial-mesenchymal transition and promotes metastasis in oral squamous cell carcinoma. Int. J. Oral Sci. 13(1), 6 (2021). 42 Adamczyk-Gruszka O, Horecka-Lewitowicz A, Gruszka J, Wawszczak-Kasza M, Strzelecka A, Lewitowicz P. FGFR-2 and Epithelial-Mesenchymal Transition in Endometrial Cancer. J. Clin. Med. 11(18) (2022). 43 Farajihaye Qazvini F, Samadi N, Saffari M, Emami-Razavi AN, Shirkoohi R. Fibroblast growth factor10 and epithelial-mesenchymal transition in colorectal cancer. EXCLI J. 18, 530–539 (2019). 44 Xu Q, Zhang Q, Ishida Y et al. EGF induces epithelial-mesenchymal transition and cancer stemlike cell properties in human oral cancer cells via promoting Warburg effect. Oncotarget 8(6), 9557–9571 (2017). 45 Schelch K, Vogel L, Schneller A et al. EGF Induces Migration Independent of EMT or Invasion in A549 Lung Adenocarcinoma Cells , (2021). 46 Ferrara N, Gerber H-P, LeCouter J. The biology of VEGF and its receptors. Nat. Med. 9(6), 669– 676 (2003). 47 Nagy JA, Feng D, Vasile E et al. Permeability properties of tumor surrogate blood vessels induced by VEGF-A. Lab. Investig. 86(8), 767–780 (2006). 48 Harmey JH, Bouchier-Hayes D. Vascular endothelial growth factor (VEGF), a survival factor for tumour cells: Implications for anti-angiogenic therapy. BioEssays 24(3), 280–283 (2002). 49 Dvorak HF. Reconciling VEGF With VPF: The Importance of Increased Vascular Permeability for Stroma Formation in Tumors, Healing Wounds, and Chronic Inflammation , (2021). 50 Sullivan KM, Jiang X, Guha P et al. Blockade of interleukin 10 potentiates antitumour immune function in human colorectal cancer liver metastases. Gut gutjnl-2021-325808 (2022). 51 Itakura E, Huang R-R, Wen D-R, Paul E, Wünsch PH, Cochran AJ. IL-10 expression by primary tumor cells correlates with melanoma progression from radial to vertical growth phase and development of metastatic competence. Mod. Pathol. 24(6), 801–809 (2011). 52 Mikkola T, Almahmoudi R, Salo T, Al-Samadi A. Variable roles of interleukin-17F in different cancers. BMC Cancer 22(1), 54 (2022). 53 Sasaki T, Hiroki K, Yamashita Y. The role of epidermal growth factor receptor in cancer metastasis and microenvironment. Biomed Res. Int. 2013, 546318 (2013). Chapter II – Modelling the complex nature of the tumor microenvironment: 3D tumor spheroids as an evolving tool 98 54 Zhang M, Zhang YY, Chen Y, Wang J, Wang Q, Lu H. TGF-β Signaling and Resistance to Cancer Therapy , (2021). 55 Tomas A, Futter CE, Eden ER. EGF receptor trafficking: consequences for signaling and cancer. Trends Cell Biol. 24(1), 26–34 (2014). 56 van den Bulk J, de Miranda NFCC, ten Dijke P. Therapeutic targeting of TGF-β in cancer: hacking a master switch of immune suppression. Clin. Sci. 135(1), 35–52 (2021). 57 Wiedlocha A, Haugsten EM, Zakrzewska M. Roles of the FGF-FGFR Signaling System in Cancer Development and Inflammation, (2021). 58 Yoshimatsu Y, Wakabayashi I, Kimuro S et al. TNF-α enhances TGF-β-induced endothelial-tomesenchymal transition via TGF-β signal augmentation. Cancer Sci. 111(7), 2385–2399 (2020). 59 Presta M, Chiodelli P, Giacomini A, Rusnati M, Ronca R. Fibroblast growth factors (FGFs) in cancer: FGF traps as a new therapeutic approach. Pharmacol. Ther. 179, 171–187 (2017). 60 Montfort A, Colacios C, Levade T, Andrieu-Abadie N, Meyer N, Ségui B. The TNF Paradox in Cancer Progression and Immunotherapy , (2019). 61 Cao R, Ji H, Feng N et al. Collaborative interplay between FGF-2 and VEGF-C promotes lymphangiogenesis and metastasis. Proc. Natl. Acad. Sci. 109(39), 15894–15899 (2012). 62 Jones SA, Jenkins BJ. Recent insights into targeting the IL-6 cytokine family in inflammatory diseases and cancer. Nat. Rev. Immunol. 18(12), 773–789 (2018). 63 Golfmann K, Meder L, Koker M et al. Synergistic anti-angiogenic treatment effects by dual FGFR1 and VEGFR1 inhibition in FGFR1-amplified breast cancer. Oncogene 37(42), 5682–5693 (2018). 64 Ozga AJ, Chow MT, Luster AD. Chemokines and the immune response to cancer. Immunity 54(5), 859–874 (2021). 65 Farooqi AA, Siddik ZH. Platelet-derived growth factor (PDGF) signalling in cancer: rapidly emerging signalling landscape. Cell Biochem. Funct. 33(5), 257–265 (2015). 66 Kugeratski FG, Santi A, Zanivan S. Extracellular vesicles as central regulators of blood vessel function in cancer. Sci. Signal. 15(753), eaaz4742 (2022). 67 Xue Y, Lim S, Yang Y et al. PDGF-BB modulates hematopoiesis and tumor angiogenesis by inducing erythropoietin production in stromal cells. Nat. Med. 18(1), 100–110 (2012). Chapter II – Modelling the complex nature of the tumor microenvironment: 3D tumor spheroids as an evolving tool 99 68 Lucotti S, Kenific CM, Zhang H, Lyden D. Extracellular vesicles and particles impact the systemic landscape of cancer. EMBO J. 41(18), e109288 (2022). 69 Pohlman AW, Moudgalya H, Jordano L et al. The role of IGF-pathway biomarkers in determining risks, screening, and prognosis in lung cancer. Oncotarget 13, 393–407 (2022). 70 Winkler J, Abisoye-Ogunniyan A, Metcalf KJ, Werb Z. Concepts of extracellular matrix remodelling in tumour progression and metastasis. Nat. Commun. 11(1), 5120 (2020). 71 Ma C, Wang Y, Wilson KM et al. Circulating Insulin-Like Growth Factor 1–Related Biomarkers and Risk of Lethal Prostate Cancer. JNCI Cancer Spectr. 6(1), pkab091 (2022). 72 Pickup MW, Mouw JK, Weaver VM. The extracellular matrix modulates the hallmarks of cancer. EMBO Rep. 15(12), 1243–1253 (2014). 73 Su C, Wang W, Wang C. IGF-1-induced MMP-11 expression promotes the proliferation and invasion of gastric cancer cells through the JAK1/STAT3 signaling pathway. Oncol Lett 15(5), 7000–7006 (2018). 74 Huang J, Zhang L, Wan D et al. Extracellular matrix and its therapeutic potential for cancer treatment. Signal Transduct. Target. Ther. 6(1), 153 (2021). 75 Shanmugalingam T, Bosco C, Ridley AJ, Van Hemelrijck M. Is there a role for IGF-1 in the development of second primary cancers? Cancer Med. 5(11), 3353–3367 (2016). 76 Laronha H, Caldeira J. Structure and Function of Human Matrix Metalloproteinases. Cells 9(5), 1076 (2020). 77 Bode W, Maskos K. Structural basis of the matrix metalloproteinases and their physiological inhibitors, the tissue inhibitors of metalloproteinases. Biol. Chem. basis matrix Met. their Physiol. Inhib. tissue Inhib. Met. 384(6), 863–872 (2003). 78 Fukushima R, Kasamatsu A, Nakashima D et al. Overexpression of Translocation Associated Membrane Protein 2 Leading to Cancer-Associated Matrix Metalloproteinase Activation as a Putative Metastatic Factor for Human Oral Cancer. J. Cancer 9(18), 3326–3333 (2018). 79 Miyake M, Goodison S, Lawton A, Gomes-Giacoia E, Rosser CJ. Angiogenin promotes tumoral growth and angiogenesis by regulating matrix metallopeptidase-2 expression via the ERK1/2 pathway. Oncogene 34(7), 890–901 (2015). 80 Saito T, Kasamatsu A, Ogawara K et al. Semaphorin7A Promotion of Tumoral Growth and Chapter II – Modelling the complex nature of the tumor microenvironment: 3D tumor spheroids as an evolving tool 100 Metastasis in Human Oral Cancer by Regulation of G1 Cell Cycle and Matrix Metalloproteases: Possible Contribution to Tumoral Angiogenesis. PLoS One 10(9), e0137923 (2015). 81 Polette M, Clavel C, Cockett M, Girod de Bentzmann S, Murphy G, Birembaut P. Detection and localization of mRNAs encoding matrix metalloproteinases and their tissue inhibitor in human breast pathology. Invasion & metastasis 13(1), 31–37 (1993). 82 Ziani L, Safta-Saadoun T Ben, Gourbeix J et al. Melanoma-associated fibroblasts decrease tumor cell susceptibility to NK cell-mediated killing through matrix-metalloproteinases secretion. Oncotarget 8(12), 19780–19794 (2017). 83 Bourboulia D, Stetler-Stevenson WG. Matrix metalloproteinases (MMPs) and tissue inhibitors of metalloproteinases (TIMPs): Positive and negative regulators in tumor cell adhesion. Semin. Cancer Biol. 20(3), 161–168 (2010). 84 Wen X, Wu J-Q, Peng W, Feng J-F, Tang J-H. MicroRNA-377 predicts poor clinical outcome of gastric cancer and induces tumorigenesis by targeting multiple tumor-suppressor genes. Oncol. Rep. 34(1), 203–210 (2015). 85 DuChez BJ, Doyle AD, Dimitriadis EK, Yamada KM. Durotaxis by Human Cancer Cells. Biophys. J. 116(4), 670–683 (2019). 86 Isomursu A, Park K-Y, Hou J et al. Negative durotaxis: cell movement toward softer environments. bioRxiv 2020.10.27.357178 (2020). 87 Azimzade Y, Saberi AA, Sahimi M. Regulation of migration of chemotactic tumor cells by the spatial distribution of collagen fiber orientation. Phys. Rev. E 99(6), 62414 (2019). 88 Erdogan B, Ao M, White LM et al. Cancer-associated fibroblasts promote directional cancer cell migration by aligning fibronectin. J. Cell Biol. 216(11), 3799–3816 (2017). 89 Hynes RO. Integrins: Bidirectional, Allosteric Signaling Machines. Cell 110(6), 673–687 (2002). 90 Hynes RO. Integrins: versatility, modulation, and signaling in cell adhesion. Cell 69(1), 11–25 (1992). 91 Shimaoka M, Springer TA. Therapeutic antagonists and conformational regulation of integrin function. Nat. Rev. Drug Discov. 2(9), 703–716 (2003). 92 Cavaco ACM, Rezaei M, Caliandro MF et al. The Interaction between Laminin-332 and α3β1 Integrin Determines Differentiation and Maintenance of CAFs, and Supports Invasion of Chapter II – Modelling the complex nature of the tumor microenvironment: 3D tumor spheroids as an evolving tool 101 Pancreatic Duct Adenocarcinoma Cells. Cancers (Basel). 11(1) (2018). 93 Peng C, Zou X, Xia W et al. Integrin αvβ6 plays a bi-directional regulation role between colon cancer cells and cancer-associated fibroblasts. Biosci. Rep. 38(6) (2018). 94 Ota D, Kanayama M, Matsui Y et al. Tumor-α9β1 integrin-mediated signaling induces breast cancer growth and lymphatic metastasis via the recruitment of cancer-associated fibroblasts. J. Mol. Med. (Berl). 92(12), 1271–1281 (2014). 95 Sun Z, Schwenzer A, Rupp T et al. Tenascin-C Promotes Tumor Cell Migration and Metastasis through Integrin α9β1-Mediated YAP Inhibition. Cancer Res. 78(4), 950–961 (2018). 96 Soe ZY, Park EJ, Shimaoka M. Integrin Regulation in Immunological and Cancerous Cells and Exosomes. Int. J. Mol. Sci. 22(4) (2021). 97 Ji Q, Zhou L, Sui H et al. Primary tumors release ITGBL1-rich extracellular vesicles to promote distal metastatic tumor growth through fibroblast-niche formation. Nat. Commun. 11(1), 1211 (2020). 98 Kong J, Tian H, Zhang F et al. Extracellular vesicles of carcinoma-associated fibroblasts creates a pre-metastatic niche in the lung through activating fibroblasts. Mol. Cancer 18(1), 175 (2019). 99 Mayer B, Klement G, Kaneko M et al. Multicellular gastric cancer spheroids recapitulate growth pattern and differentiation phenotype of human gastric carcinomas. Gastroenterology 121(4), 839–852 (2001). 100 Pașca SP, Arlotta P, Bateup HS et al. A nomenclature consensus for nervous system organoids and assembloids. Nature 609(7929), 907–910 (2022). 101 Weiswald L-B, Bellet D, Dangles-Marie V. Spherical Cancer Models in Tumor Biology. Neoplasia 17(1), 1–15 (2015). 102 Friedrich J, Seidel C, Ebner R, Kunz-Schughart LA. Spheroid-based drug screen: considerations and practical approach. Nat. Protoc. 4(3), 309–324 (2009). 103 M. SR. Cell and Environment Interactions in Tumor Microregions: The Multicell Spheroid Model. Science (80-. ). 240(4849), 177–184 (1988). 104 Lazzari G, Couvreur P, Mura S. Multicellular tumor spheroids: a relevant 3D model for the in vitro preclinical investigation of polymer nanomedicines. Polym. Chem. 8(34), 4947–4969 (2017). Chapter II – Modelling the complex nature of the tumor microenvironment: 3D tumor spheroids as an evolving tool 102 105 Yoshida T, Okuyama H, Endo H, Inoue M. Spheroid Cultures of Primary Urothelial Cancer Cells: Cancer Tissue-Originated Spheroid (CTOS) Method. Methods Mol. Biol. 1655, 145–153 (2018). 106 Kondo J, Endo H, Okuyama H et al. Retaining cell–cell contact enables preparation and culture of spheroids composed of pure primary cancer cells from colorectal cancer. Proc. Natl. Acad. Sci. 108(15), 6235–6240 (2011). 107 Yu Z, Pestell TG, Lisanti MP, Pestell RG. Cancer stem cells. Int. J. Biochem. Cell Biol. 44(12), 2144–2151 (2012). 108 Valent P, Bonnet D, De Maria R et al. Cancer stem cell definitions and terminology: the devil is in the details. Nat. Rev. Cancer 12(11), 767–775 (2012). 109 Rajcevic U, Knol JC, Piersma S et al. Colorectal cancer derived organotypic spheroids maintain essential tissue characteristics but adapt their metabolism in culture. Proteome Sci. 12, 39 (2014). 110 Kaaijk P, Troost D, Das PK, Leenstra S, Bosch DA. Long-term culture of organotypic multicellular glioma spheroids: a good culture model for studying gliomas. Neuropathol. Appl. Neurobiol. 21(5), 386–391 (1995). 111 Sundlisaeter E, Wang J, Sakariassen PØ et al. Primary glioma spheroids maintain tumourogenicity and essential phenotypic traits after cryopreservation. Neuropathol. Appl. Neurobiol. 32(4), 419– 427 (2006). 112 Bjerkvig R, Tønnesen A, Laerum OD, Backlund EO. Multicellular tumor spheroids from human gliomas maintained in organ culture. J. Neurosurg. 72(3), 463–475 (1990). 113 Yeini E, Ofek P, Pozzi S et al. P-selectin axis plays a key role in microglia immunophenotype and glioblastoma progression. Nat. Commun. 12(1), 1912 (2021). 114 Chandrasekaran S, Geng Y, DeLouise LA, King MR. Effect of homotypic and heterotypic interaction in 3D on the E-selectin mediated adhesive properties of breast cancer cell lines. Biomaterials 33(35), 9037–9048 (2012). 115 Rawal P, Tripathi DM, Nain V, Kaur S. VEGF-mediated tumour growth and EMT in 2D and 3D cell culture models of hepatocellular carcinoma. Oncol. Lett. 24(3), 315 (2022). 116 Teveroni E, Di Nicuolo F, Vergani E et al. PTTG1/ZEB1 Axis Regulates E-Cadherin Expression in Human Seminoma. Cancers (Basel). 14(19) (2022). Chapter II – Modelling the complex nature of the tumor microenvironment: 3D tumor spheroids as an evolving tool 103 117 Kalender M, Bulbul MV, Kolbasi B, Keskin I. In 2D and 3D Cell Culture Models, Effects of Endothelial Cells on E-cadherin / β-catenin Expression Levels and Spheroid Sizes in Ishikawa Cells. Asian Pac. J. Cancer Prev. 23(1), 39–51 (2022). 118 Perrin L, Belova E, Bayarmagnai B, Tüzel E, Gligorijevic B. Invadopodia enable cooperative invasion and metastasis of breast cancer cells. Commun. Biol. 5(1), 758 (2022). 119 Zhang Q, Lin F, Huang J, Xiong C. Mechanical transmission enables EMT cancer cells to drive epithelial cancer cell migration to guide tumor spheroid disaggregation. Sci. China Life Sci. 65(10), 2031–2049 (2022). 120 Dembélé P, Garnier O, Martin DK, Vilgrain I. Microtumor Spheroids Provide a Model for Studying Molecules Involved in Vascular Organization: An Illustrative Study for VE-cadherin. Anticancer Res. 42(10), 4689–4700 (2022). 121 Chen Y, Lu X, Gao L, Dean DC, Liu Y. Spheroid-induced heterogeneity and plasticity of uveal melanoma cells. Cell. Oncol. (Dordr). 45(2), 309–321 (2022). 122 Monteiro M V, Gaspar VM, Mendes L, Duarte IF, Mano JF. Stratified 3D Microtumors as Organotypic Testing Platforms for Screening Pancreatic Cancer Therapies. Small methods 5(5), e2001207 (2021). 123 Kuhn H, Frille A, Petersen MA et al. IGFBP3 inhibits tumor growth and invasion of lung cancer cells and is associated with improved survival in lung cancer patients. Transl. Oncol. 27, 101566 (2022). 124 Hajimoradi M, Rezalotfi A, Esmaeilnejad-Ahranjani P, Mohammad Hassan Z, Ebrahimi M. STAT3 inactivation suppresses stemness properties in gastric cancer stem cells and promotes Th17 in Treg/Th17 balance. Int. Immunopharmacol. 111, 109048 (2022). 125 Xie J, Hu X, Chen L et al. The Effect of Geometry and TGF-β Signaling on Tumor Cell Migration from Free-Standing Microtissues. Adv. Healthc. Mater. 11(12), 2102696 (2022). 126 Lee S-Y, Teng Y, Son M et al. Three-Dimensional Aggregated Spheroid Model of Hepatocellular Carcinoma Using a 96-Pillar/Well Plate. Molecules 26(16) (2021). 127 Puthdee N, Sriswasdi S, Pisitkun T, Ratanasirintrawoot S, Israsena N, Tangkijvanich P. The LIN28B/TGF-β/TGFBI feedback loop promotes cell migration and tumour initiation potential in cholangiocarcinoma. Cancer Gene Ther. 29(5), 445–455 (2022). Chapter III – Materials and methods 110 CHAPTER III Chapter III - MATERIALS AND METHODS In addition to the description of the materials and methods found in each experimental chapter of this thesis, the rationale for the selection of materials and characterization techniques is herein provided, as well as, additional and/or more detailed information. Chapter III – Materials and methods 111 III-1. MATERIALS III-1.1. Gellan gum-based nanoparticles III-1.1.1. Gellan gum Gellan gum (GG) or gellan is a natural extracellular polysaccharide composed of tetrasaccharide repeating units of 1,3-β-D-glucose, 1,4-β-D-glucoronic acid, 1,4-β-D-glucose, 1,4-α-L-rhamnose, containing one carboxyl side group [1]. This polysaccharide is produced by the Sphingomonas elodia bacterial strain through the careful inoculation of a fermentation medium with this organism. Structurally, it may be found in two distinct forms, acetylated – original form produced by the bacterial organism – and the deacylated – the most widely available and able to undergo processing [2] (Figure III-1). This polysaccharide is capable of undergoing ionotropic gelation which is dependent on chemical nature and amount of cations present in the solution, being promoted in a stronger manner in the presence of divalent cations when compared to monovalent cations [3]. Upon crosslinking through the presence of divalent cations, the gelation occurs via chemical bonding between the cation and two carboxylate groups belonging to glucuronic acid molecules in the gellan gum chain [4]. Additionally, to the ionotropic gelation, helix-to-coil transition occurs thermoreversibly upon cooling or heating. During the gelation process, antiparallel self-assembled double helices form oriented bundles called junction zones then link untwined regions of extended helical chains, leading to the formation of the hydrogel. GG has a widespread use in the food and cosmetics industry [5], while additionally having been adopted in the field of drug delivery [6] and even for the development of TERM strategies [7]. For the studies in hand, deacylated GG was purchased from SIGMA-ALDRICH® (USA) with the designation of Gelzan™ CM. Chapter III – Materials and methods 112 Figure III-1 Chemical structure of (a) deacylated gellan gum and (b) native gellan gum. III-1.1.2. Fabrication of GG hydrogel-like particles In order to create polymer-derived nanoparticles several protocols have been described, one of which being the emulsion technique. Emulsions can be performed by the mixture of two or more immiscible liquids in which one or more liquids are dispersed in another liquid. Several different forms of emulsions exist such as water-in-oil (W/O), oil-in-water (O/W), oil-in-water-in-oil (O/W/O) and water-in-oil-in-water (W/O/W) [8]. Due to their thermodynamic instability, emulsions are generally highly dependent of surfactants and stabilizers in order to stabilize the emulsion droplets, avoiding their coalescence or flocculation. Additionally, final particle properties (droplet size, stability and encapsulation efficiency) are heavily dependent on the control of homogenization conditions (temperature, pressure and cycles) [9]. For the production of GG hydrogel-like particles used, in chapter V, a W/O/W double emulsion/solvent evaporation method was chosen due to its reliability and simplicity [10]. These emulsions hierarchically are formed by the dispersion of small water droplets within larger oil droplets in an aqueous continuous phase containing a suitable emulsifier to form double emulsion (W1/O/W2). Removal of the volatile organic solvent leads to the formation of solid microparticles. For the choice in surfactants used, the hydrophilic-hydrophobic balance (HLB) balance was considered (Table III-1) and a mixture of Tween 20, which is a hydrophilic surfactant, and Span 80, a hydrophobic surfactant, was employed. Considering that these surfactants are non-ionic in nature and therefore possess no inherent Chapter III – Materials and methods 113 ionic affinity for interaction, makes them widely compatible and stable in several fluid systems such as ultrapure water, saline water, mild acids, alkaline substances and additionally they don’t react with ionic ingredients and charged substances. Low HLB Spans favor solubility in lipophilic solvents to produce stable water-in-oil emulsion system [11]. On the other hand, Tweens are used to increase HLB range and enhance hydrophilic solubility to yield oil-in-water emulsion systems [12]. Span 80 has an HLB value of 4.3, which falls within the usual range of HLB 4–6 for water-in-oil (W/O) emulsifiers, while Tween 20 has an HLB value of 15, within the range of HLB 8–18 for oil-in-water (O/W) emulsifiers. For the oil phase, chloroform was used to allow for the solubility of Span 80 while its low boiling point facilitates the removal of residual amounts. Additionally, poly(vinyl alcohol) (PVA) was chosen to act as a cosurfactant to stabilize the W/O/W emulsion based on its good water solubility and its amphiphilic nature to maintain the stability of the double emulsion droplets. Table III-1 Physical properties of Span 80 and Tween 20. Surfactant appearance HLB (unitless) Molecular weight (g.mol−1) Span 80 4.3 428.59 Tween 20 16.7 1227.54 In order to achieve nano-emulsification, one of two techniques is used, low-energy methods (e.g. spontaneous emulsification, solvent-diffusion, phase inversion temperature) or high-energy emulsification methods (high pressure homogenizers or ultrasound generators) [13]. For this work, a high speed homogenization system was used. The solid particles may be then separated by filtration or centrifugation and washed several times in order to eliminate the residual emulsifier and dried under vacuum or freezedried. In this manner, a 1 % (w/v) of GG solution was prepared in deionized water, under stirring at 90 ᵒC for 30 minutes (min). After dissolution, the solution was allowed to stabilize at 50 ᵒC. The GG solution (W1) was then emulsified with Tween-20 (Sigma-Aldrich, Germany) and added to a mixture of 0.5 % (w/v) of Span®80 (Sigma-Aldrich, Germany) in chlorophorm (Sigma-Aldrich, Germany)(O) at a ratio of 1:3. The emulsion was then prepared under high speed homogenization with a T18 BASIC Ultraturrax (IKA, NC, USA) for 3 min. W1/O was then added dropwise to 15 mL of a solution of 3.5 % (w/v) poly(vinyl alcohol) (PVA)(W2) (Sigma-Aldrich, Germany) in water under continuous stirring in order to stabilize the prepared emulsion. At this point in order to gelify GG nanoparticles, ionic crosslinking of the emulsion was performed by gradually adding W1/O/W2 to 5mL of a 60 % (w/v) solution of calcium chloride (Merck Chapter III – Materials and methods 114 Millipore, Germany) under constant stirring. In order to remove remaining chloroform still present in the emulsion, rotary evaporation of the solvent was performed (Stuart, Staffordshire, UK). Afterwards, the particles were recovered by centrifugation of 1 hour (h) at 13’000 x g (Eppendorf, Germany). Given the size dispersity and associated issues concerning coalescence or flocculation, the produced particles were selected through a series of strainers (pluriSelect, Leipzig, Germany) ranging from 10 μm down to 1 μm to limit size dispersion. In order to remove traces of PVA and CaCl2 from the resulting particles, additional washing steps were performed by centrifugation at 13’000 x g for 10 min with deionized water. GG hydrogel particles were then frozen at -210 ºC (liquid nitrogen) and then freeze-dried to remove the water content from these particles. Freeze drying was performed at -80 °C, 0 atm and for 3 days (LyoQuest, Telstar, Spain) to achieve complete sublimation of all the water. The freeze-dried particles were then stored away in a desiccator until further use. III-1.1.3. Functionalization of GG hydrogel-like particles In order to produce functional npGG, bioactive molecules capable of triggering T cell activation are required. To induce effective T cell responses, several signals have been reported as required, classically a two-signal stimulus is required in which both an antigen and secondary stimuli is required in order to achieve T cell activation. The first step is based on the recognition of a cognate peptide-MHC complex by the CD3/TCR complex which triggers the activation of kinases and phosphatases, inducing a multitude of phosphorylating and dephosphorylating events. Additionally, there is the requirement of a costimulatory second signal supplied by the engagement of the CD28 membrane protein by its ligand (CD80 or B7-1 and CD86 or B7-2) present on the antigen-presenting cell (APC) [14]. The non-existence of this costimulatory signal may lead to the induction of T cell anergy. The use of antibodies to achieve this form of activation has been reported back in 1985 by Tsoukas et al., where it was demonstrated that purified, resting (G0 phase) T cells incubated with monoclonal anti-CD3 antibodies proliferated in response to purified interleukin 2 (IL 2), in a lymphokine dose-dependent fashion [15]. The use of antibodies for the activation and proliferation of T cells has been extensively reportedly in the meantime [16–19]. This has also led to the development of commercial solutions for the in vitro expansion of T cells, such as the case of bead-based systems. Taking all of the above into consideration, we proceeded in functionalizing our npGG system with functional grade α-CD3 and α-CD28 antibodies. To carry this out, carbodiimide (EDC) and N- Chapter III – Materials and methods 115 hydroxysuccinimide (NHS) coupling chemistry was considered to tether the functional antibodies to the nanoparticle surface. This form of coupling chemistry is commonly used to alter the surface chemistry of nanoparticles by attaching pharmaceutical agents or biomolecules to the particle surface [20–24]. N-(3Dimethylaminopropyl)-N'-ethylcarbodiimide hydrochloride is a water-soluble, non-cytotoxic, and biocompatible carbodiimide which is used as a carboxyl activating agent for amide bonding with primary amines. Briefly, EDC reacts with carboxylic acid groups to form and active O-acylisourea intermediate which is easily displaced by nucleophilic attack from the primary amino groups in the reaction mixture. In turn, the primary amine forms an amide bond with the original carboxyl group, and an EDC by-product is released as a soluble urea derivative. However, EDC is not very stable in water as oxygen atoms act as a nucleophile and inactivate the cross-linker agent while failure to react with an amine also results in the hydrolysis of the O-acylisourea intermediary. Hence, N-hydroxysuccinimide (NHS) is used as a stabilizer to improve the crosslinking efficiency [20]. Given that peptides and proteins possess multiple carboxyls and amines this usually leads to random crosslinking. To overcome this concern, Biotin – Avidin was used as an alternative crosslinking methodology with the purpose of crosslinking the antibodies to the GG nanoparticles in a controlled manner. The noncovalent interaction between avidin and biotin is considered one of the strongest known interactions with a dissociation constant of 10-15 M, assuring the stability in the interaction between ligand and receptor when subjected to changes in pH, presence of chaotropes or during manipulation [25]. Both these molecules possess four binding sites which in turn allows for an amplication of the desired system. Due to these reasons, this form of non-covalent interaction has been sourced for the modification of a spectrum of different probes for commercial use such as the case of antibodies [26]. For this particular work, the main advantage in the use of this form of antibody binding would be the controlled orientation of our antibodies of interest as found possible in other works [27], otherwise unachievable simply through EDC/NHS as detailed above. Taking this into consideration, npGG were activated with EDC/NHS and then bound to Netravidin® through a 4 h reaction at RT after which biotinylated α-CD3/CD28 antibodies were bound to the nanoparticles as detailed in the following section. This in turn led to the formation of our T cell activator system. Chapter III – Materials and methods 116 III-1.2. Collagen chemotaxis chambers III-1.2.1. Collagen Collagen is a highly abundant structural protein which can be found in all animals and in humans makes up one-third of the total protein. As the most prevalent protein of the extracellular matrix (ECM) it has been wieldy resourced for the field of tissue engineering and regenerative medicine. Being a highly heterogenic protein, twenty-eight different isoforms have been identified [28], among these different types, collagen type I is the most abundant in mammals [29]. Collagen type I can be found in a variety of different tissues such as skin, tendon, bone, cornea, lung and the vasculature [30]. Additionally, and of the utmost importance for this work, is the implication of collagen type I in driving cancer cell migration [31]. Given the complex hierarchical structure of collagen, it can confer different biomechanical properties such as elasticity in skin, softness in cartilage and stiffness in bone and tendon. Structurally, collagen is a molecule composed of three polypeptide chains in which Gly is required at every third position, resulting in the repeating amino acid motif (Gly-X-Y), where X and Y can be any aminoacid [32]. This repeat occurs in all types of collagen, however, depending on the genetic type of collagen, this motif can be a major or minor part of the molecule. In terms of 3D organization, this motif allows for the chains to form a right-handed triple-helical structure which is held together in the helical conformation by hydrogen bonds (Figure III-2). Figure III-2 Organization of individual α -chains into triple helices. Bundles of these triple helices form into fibrils and ultimately into large collagen fibers. Chapter III – Materials and methods 117 III-1.2.2. Fabrication of a collagen chemotaxis chamber Herein, we were inspired by the need felt in the field of cancer biology in how to better understand the underlying cell-cell and cell-ECM interactions that drive tumor progression and invasion. While the field has advanced immensely with the introduction of highly complex heterotypic tumor models, which are a step closer to mimicking the in vivo tumor microenvironment, these models may not be the optimal system to understand how cellular interplay occurs given the constraints and limitations of live cell imaging in these models. For this effect, we conceptualized a 3D collagen-based culture chamber that would allow the culture of cancer cells as well as of stromal cells and study how they regulate cell invasion through the establishment of chemotactic gradients. For this purpose, a hydrogel molding strategy was considered, making use of commercially available μ – Slide culture chambers to facilitate manipulation during microscopic imaging. With this mold, a collagen type I hydrogel could be imprinted while undergoing gelification. The master mold was designed to imprint 4 wells per chamber, one central chamber surrounded by three equidistant ones, which in turn are equidistant among themselves. This would allow for the equal distribution of the established chemotactic gradients between the different stromal cells and to uniformly influence tumor cells in the central well. The corresponding master mold was produced in polymethyl methacrylate (PMMA) by direct micromachining (MDX-50, Roland DG) and has an overall footprint of 75 mm by 25 mm and a height of 1 cm, being each chamber 10.65 mm by 9.4 mm in which the pillars are 1.2 mm diameter each and 7 mm high. Upon imprinting the collagen hydrogel, the pillars led to the formation of microwells capable of supporting cell culture. For this current study, bovine type I collagen was purchased from SIGMAALDRICH® (USA). Within the next sections, additional detail on the preparation of the hydrogel chamber and characterization is provided. III-2. METHODOLOGY FOR MATERIAL CHARACTERIZATION III-2.1. Fourier transform infrared spectroscopy Fourier transform infrared, otherwise known as FTIR, is one of the most widely used form of infrared spectroscopy. It is commonly used to obtain the infrared spectrum of absorption, reflection, and emission of a solid, liquid or gas and therefore can be used for the identification of organic, inorganic and polymeric materials [35]. Through changes in characteristic patterns of absorption bands it is possible to identify Chapter III – Materials and methods 118 changes in the composition of a material. Within the works herein described, FTIR was used to obtain information on the functional groups present on the surface of the npGG produced in chapter V as described by [36] since PVA was used as a cosurfactant to stabilize the produced GG nanoparticles and further functionalization was dependent on the maintenance of characteristic peaks of GG. III-2.2. Micro-Bicinchoninic Acid Protein™ assay Micro-bicinchoninic acid protein (Micro-BCA) is a colorimetric assay that quantifies protein content in a sample [37,38]. This method relies on the fact of that proteins are able to catalyze the reduction of Cu2+ to Cu+ which, upon reaction with bicinchoninic acid (4,4'-dicarboxy-2,2'-bi-quinoline), forms a colored complex with bicinchoninic acid and increases in a proportional fashion over a broad range of increasing protein concentrations. Micro-BCA assay was used to determine the amount of neutravidin bound to the npGG while also being used to determine the total amount of protein in the secretome of produced assembloids and respective control spheroids prior to zymography and ELISA analysis. Quantification was preformed according to manufacturers’ instructions (Fisher Scientific, USA). III-2.3. Scanning Transmission Electron Microscopy (STEM) Scanning Electron Microscopy (SEM) is a form of electron microscopy that makes use of a focused beam of electrons to scan the surface of a sample and hence produce a 2D image of its surface topography in a high-resolution manner [39]. The electron beam is generally scanned in a rasterized pattern and the beam’s position is combined with the reflected signal detected to produce an image which can achieve a resolution better than 1 nanometer (nm). With scanning transmission electron microscopy (STEM), a highly-focused electron probe is raster-scanned across the material, and various types of scattering are collected as a function of position. Herein, the transmitted electrons (passing through the sample) at high scattering angle can be collected to form high-resolution, chemically sensitive, atomic number (Z-) contrast images [40]. Some STEM equipment’s have been capable of achieving highresolutions of up to approximately 0.14 nm. A High-Resolution Field Emission Scanning Electron Microscope with Focused Ion Beam (FIB – SEM) (AURIGA COMPACT, Zeiss, Germany) was used to analyze the morphology of the dried polymeric npGG at an accelerating voltage of 20 kV Chapter III – Materials and methods 119 III-2.4. Dynamic Light Scattering The evaluation of both size and polydispersity are considered key when characterizing nanoparticles [41,42]. Several different techniques have been developed for this purpose, nonetheless dynamic light scattering (DLS) is considered the most versatile and useful set of techniques for measuring in situ the sizes and size distributions of nanoparticles in liquids [43,44]. Throughout the work here reported, DLS has been used to characterize the developed npGG system. This technique, otherwise known as photon correlation spectroscopy relies on the fact that light scatters when a suspension of particles or molecules undergoing Brownian motion are illuminated by a laser beam [45]. The fluctuations in the intensity of scattered light are analysed over time and depend on the positions of the particles relative to the direction of the incoming and scattered light beams. Thus, at a given instant the total scattered intensity at a given scattering angle depends on the positions of the particles and their structure. Diffusion coefficient and particle size information can be obtained from the analysis of these fluctuations. III-2.5. Water content and water uptake While different aspects are essential for the complete characterization of a nanoparticle system, the most important property of a hydrogel is its total water content while in equilibrium. Water content is considered a quantitative measure of the water existing in a material at a given time [46]. At intermediate times of swelling the water content is given in the form of Equation III-1. 𝑊𝑎𝑡𝑒𝑟&𝑢𝑝𝑡𝑎𝑘𝑒/𝑐𝑜𝑛𝑡𝑒𝑛𝑡& ( % ) =𝑊 !&−&𝑊 " 𝑊 " ×100 Equation III-1 Equation of the water uptake/content. Water content of npGG was determined by measuring the weight of dried polymeric networks before (Wd) and after (Ww) hydration with ultrapure H2O, PBS or a-MEM solution at 37 ºC for 7 days. Water uptake profile was determined using the same principle, but weighting the samples at different time points along the 7 days period. Water content or water uptake were calculated using the Equation II-2. Chapter III – Materials and methods 126 Table III-3 Antibodies used for flow cytometry. Target Antibody (Brand) Ref Host Clonality, reactivity Biomolecules Perforin-APC (Biolegend, USA) 154304 Rt Monoclonal, Mouse Granzyme B-PE/ Cyanine7 (Biolegend, USA) 396410 Rt Recombinant, Mouse/Human T cells CD69-PE (Biolegend, USA) 104507 AH Monoclonal, Mouse CD4-APC-H7 (BD Biosciences, USA) 560181 Rt Monoclonal, Mouse CD8a-APC-H7 (BD Biosciences, USA) 560182 Rt Monoclonal, Mouse CD45-PerCP-Cy 5.5 (BD Biosciences, USA) 550994 Rt Monoclonal, Mouse CD4-AF647 (Biolegend, USA) 100424 Rt Monoclonal, Mouse CD3e-PE (BD Biosciences, USA) 553064 AH Monoclonal, Mouse Functionalized nanoparticles AF 488 (ThermoFisher Scientific, UK) A-21210 Rb Polyclonal, Rat Legend: Rt – Rat, Rb - Rabbit, AH – Armenian Hamster III-4.7. Enzyme-linked Immunosorbent Assay Enzyme-linked immunosorbent assay (ELISA) is an antibody-based analytical method for the quantitative/qualitative analysis of specific biomolecules [59]. In order to detect these molecules, an antigen in the fluid phase is immobilized on a solid phase, such as a microtiter plate, and allowed to react with a specific antibody that is detected by an enzyme-labeled secondary antibody. To obtain a read out, color development is obtained by means of a chromogenic substrate from which the intensity directly correlates with the presence of the antigen. The color change is measured using a spectrometer and the antigen concentration is quantified by comparison with a standard curve. This technique was used to quantify the secretion of IL-2 in murine T cells after stimulation with the developed T cell activator npGG, as well as the production of TIMP-1 and TIMP-2 from heterotypic 3D tumor models. ELISA kits, as follows (Table III-4), were performed following the manufacturers’ procedures. Chapter III – Materials and methods 127 Table III-4 ELISA procedure summary. TIMP-1 TIMP-2 IL-2 Brand Abcam, UK Elabscience, USA Reference ab187394 ab270213 E-EL-M0042 Detection range 62.5 - 4000 pg/mL 78.125 - 5000 pg/ml 15.63-1000 pg/mL III-4.8. Cell 3D Invasion Assays The analysis of 3D invasion has become an important tool in understanding key mechanisms that drive tumor cell invasion and metastasis. There is still a strong need for novel therapeutics capable of avoiding metastatic spreading which can only be developed once there has been an understanding of the basic principles behind these mechanisms. Several different procedures have been developed over time to study cell invasion [60]. Within the body of work here described, two distinct strategies were used to study cell invasion. The first consisted in the use of a basement membrane extract (BME), Matrigel™ (Corning, USA), comprised of laminins, collagen IV, heparan sulfate proteoglycan, and various growth factors, cytokines, chemokines, and proteases [61]. These ECM proteins allow for the attachment and migration of invading cells, while the soluble factors present in Matrigel™ are released upon degradation contributing to further enhance the ability of invading cells to grow and spread. In our work, this BME was used for the embedding of heterotypic assembloids in which cells can then dissociate form the spheroids and invade into the hydrogel. In the second strategy, the chemotactic effect between different stromal cells present in the tumor microenvironment and their effect of the invasion of melanoma tumor cells was object of study. As detailed above, a 3D chemotaxis chamber with equidistant wells was designed “in-house” for this effect by using 4 mg/mL type I collagen from bovine skin (Sigma, USA) as the hydrogel of choice given its mechanical properties required for templating. Different stromal cells and tumor cells were seeded in the respective wells, which upon migration would allow them to invade into the surrounding 3D matrix. The detailed description of both methods can be found in the following section. Time-lapse brightfield images were obtained over predefined time-points using an Axio Observer inverted microscope with incubation (37 ºC, 5 % of CO2), and Zen 3.2 (blue edition) software (Zeiss, Germany). Chapter III – Materials and methods 128 III-4.9. Quantitative Reverse Transcription Polymerase Chain Reaction Quantitative reverse transcription PCR (RT-qPCR) is a technique that allows for the measurement of mRNA expression levels of genes of interest [62]. For this technique to be carried out, RNA must be first transcribed into complementary DNA (cDNA) by reverse transcription from total RNA or messenger RNA (mRNA). Within the qPCR reaction a nucleic acid template undergoes a succession of amplification cycles which consist in denaturation, annealing with a specific olignonucleotide primer and extension to generate a complementary strand via a thermostable DNA polymerase. Over each cycle, the exponential increase of amplicons was monitored using a fluorescent reporter, SYBR Green, from which the fluorescence intensity is plotted against the cycle number and a quantification cycle Ct value can be determined. Taqman™, while technically similar makes use of a fluorogenic probe specific to a target gene, which accumulates during PCR [63]. Within this body of work, we have used qPCR to determine several biological responses raging from the characterization of T cell responses when stimulated with npGG activator beads to the phenotype of cells within heterotypic 3D tumor assembloids. Primers for the tested gene marker candidates and the housekeeping gene (Table III-5) were designed using Primer-Blast database (NCBI, USA) while Taqman sequences were commercially available (Table III-6). All qPCR reactions were carried out in a QuantStudioTM 5 (Applied Biosystems, Life Technologies, UK), In both cases, normalized expression values were calculated following the mathematical model proposed by Pfaffl using the formula: 2- ∆∆Ct [64]. Chapter III – Materials and methods 129 Table III-5 Primer sequences. Gene and accession number Sequence (5'-3') Amplicon size (bp) Annealing temperature (ºC) Mouse ACTB NM_007393.5 GATCAAGATCATTGCTCCTCCTG 183 60 AGGGTGTAAAACGCAGCTCA Mouse ACTG1 NM_009609.3 CTTACACTGCGCTTCTTGCC 78 60 GTGCGGCGATTTCTTCTTCC Mouse PDCD1 NM_005018.2 AACCCTGGTGGTTGGTGTC 107 55.5 TGGCTCCTATTGTCCCTCGT Mouse CTLA4 NM_005214.4 CTACCTGGGCATAGGCAACG 103 57.7 CCCCGAACTAACTGCTGCAA Mouse PRF1 NM_011073.3 GAGCATCCCTGACTTTCCCTT 84 56.4 ATGTTTACGCTTCGTGGCAG Mouse Gzmb NM_013542.3 GAAGCCAGGAGATGTGTGCT 86 56.4 GCTCAACCTCTTGTAGCGTG Human TP53BP1 NM_001141980.3 AAATCCTTCAGCCGTGTCGT 85 47 AGTCACTACGACGCAAAGCA-3 Human BRCA1 NM_007294.4 GTCCCATCTGTCTGGAGTTGA 107 49 GGCCCTTTCTTCTGGTTGAGA Human B2M NM_004048.2 TGGAGGCTATCCAGCGTACT 108 59.5 CGGATGGATGAAACCCAGACA Table III-6 Taqman references. Gene Reference 5’ Reporter Brand SOX2 Hs01053049_s1 FAM™ Applied Biosystems, Thermo Scientific, UK POU5F1 Hs00999632_g1 NANOG Hs04399610_g1 SIRT1 Hs01009006_m1 TINF2 Hs00173291_m1 TERF2 Hs00194619_m1 B2M Hs00187842_m1 Chapter III – Materials and methods 130 III-4.10. Zymography Zymography is a technique based on the previously described gel electrophoresis in which the activity of matrix metalloproteinases (MMPs) in complex biological samples can be analysed [65]. The main differentiator is that proteins are separated in non-reducing conditions in a polyacrylamide gel containing a proteolytic substrate which in this thesis was gelatin (Sigma-Aldrich, USA). The proteins are then renatured by the exchange of SDS with a nonionic detergent (2 % (v/v) Triton X-100) after which the gel is incubated in an appropriate development buffer the visualization of metalloproteinases 2 and 9 (50 mM Tris-HCL, 0.2 M NaCl and 5 mM CaCl2). The gel is ten stained with Coomassie Blue and the proteolytic activity of MMP’s are detected as clear bands against a blue background of undegraded gelatin. He we used zymography to study the activity of MMP-2 and MMP-9 in heterotypic assembloid models of melanoma. III-4.11. Immunostaining Immunostaining is a method used to determine the distribution and localization of specific proteins within individual cells or tissues using specific antibodies to detect the desired target protein [66]. This protocol makes use of a 2-step method in which a primary antibody is used against a target molecule followed by the incubation of a secondary antibody that binds to the primary antibody and is labelled with an enzyme or a fluorescent dye that allows the is detection under a fluorescence microscope or through the addition of a colored substrate. Both immunocytochemistry (ICC) and immunohistochemistry (IHC) rely on this principle. Cells were incubated with primary antibodies (Table III-7). III-4.11.1. Immunocytochemistry ICC is a method for detection and visualization of specific antigens in cells [67]. After the desired culture period, these cells are fixed to preserve the chemical and structural state of the cellular components. Depending on the localization of the molecule to be studied, these fixed samples may be required to undergo cell membrane permeabilization to allow for the antibody to penetrate the cells which is achieved by dissolving lipids from the cell membrane. This may be achieved by one of two methods: organic solvents, such as methanol and acetone, and detergents such as saponin, Triton X-100 and Tween-20 [68]. Further conditions and concentrations can be found in a more descriptive manner in the chapters ahead. In a similar fashion, immunostaining may also be performed in a whole-mount style on Chapter III – Materials and methods 131 spheroids or organs which allows for 3D visualization. This however may be challenging due to the poor laser penetration of dense, opaque tissue and to refractive index mismatch. To overcome this several different methods for optical clearing have been described [69]. For the heterotypic tumor models herein described we have opted for a hyperhydration method, more specifically Scale-A2 (4 M urea, 10 % (w/v) glycerol, 0.1 % (w/v) triton x-100). These methods make use of detergent-based removal of lipids with urea-mediated hydration (in the presence of glycerol) of the remaining tissue to achieve a clear sample. Urea here is used to penetrate and partially denature the desired sample, therefore hydrating even the hydrophobic regions of high refractive index proteins. By using this clearing protocol, it is possible to reduce the overall refractive index to 1.38 which is similar to that of water. Cells were observed with a Leica TCS SP8 confocal microscope (Leica, Germany). III-4.11.2. Immunohistochemistry While similar to ICC, IHC involves an additional sample processing step. After being chemically preserved, samples are embedded in paraffin wax. This allows for the maintenance of the original architecture of the surrounding tissue while performing histological sectioning. Fixation and crosslinking agents render the antigens undetectable by antibodies, due to the modification of tertiary and quaternary structures and therefore antigen retrieval (AR) methods are required to retrieve the loss of antigenicity [70]. In the work here mentioned, we have used heat-induced epitope retrieval (HIER) with sodium citrate buffer (10mM Sodium Citrate, 0.05 % (v/v) Tween 20, pH 6.0) Samples were processed and cut into 4 μm sections prior to immunostaining. Analysis was performed using an AxioImager Z1m fluorescence microscope (Zeiss, Germany) with Zen 3.2 (blue edition) software. Table III-7 Antibodies used for ICC and IHC. Target Antibody Brand Ref Host Dilution Clonality, reactivity T cells CD4 Novus Biologicals, USA NBP119371 Rb 1:200 Polyclonal, human/mouse Endothelial cells CD31 Dako, Denmark M0823 Ms 1:30 Monoclonal, human VMM15 tumor cells Anti-Melanoma gp100 Abcam, UK ab137078 Rb 1:200 Monoclonal, human/mouse Proliferative cells Ki67 Abcam, UK ab16667 Rb 1:50 Monoclonal human Legend: Ms - Mouse, Rb – Rabbit Chapter III – Materials and methods 132 III-4.12. Hematoxylin-Eosin and and Picrosirius Red Stainings Hematoxylin is a natural dye that colors in blue basophilic substances, such as the nuclei of cells. Eosin Y is a synthetic dye that colors in various shades of red acidophilic substances, the acidic proteins of the cytoplasm and connective tissue. Picrosirius red (PR) staining is one of the most important stains to study collagen networks. Under polarized light, collagen bundles appear green, red or yellow, and are easily differentiated from the black background, thus allowing for quantitative morphometric analysis [71] while under brightfield collagen appears as bundles of pink to red fibers which get disturbed in pathological conditions [72]. In the subsequent chapters, both these methods were used to determine the architecture, organization and ECM deposition obtained in the developed heterotypic tumor models. For this effect, samples were processed as per immunostaining and cut into 4 μm sections. Slices were stained with hematoxylin and eosin Y (H&E, Bio-Optica, Italy) and PR (Bio-Optica, Italy) following standard protocols. H&E and PR slices were analyzed using a LEICA DM750 microscope (Germany) coupled with the LEICA Application Suite 4.13.0. III-4.13. Image analysis Software-based processing and image analysis is a powerful tool that allows the analysis of large image datasets. This form of analysis allows the recognition of small variations in cell properties that occur through the activation of complex biological pathways that regulate processes as in the case of tumor invasion. Understanding these interactions and how they drive cell behaviour is important to uncover important knowledge required for the development of novel therapeutics. Over the following chapters, different image analysis techniques have been used to aid in the understanding of cellular behaviour as well as cell invasion in 3D matrices. In the body of work here detailed, we have used software-based approaches to analyse spheroid properties such as their overall area and circularity. For this effect, brightfield images of endpoint spheroids were acquired with a LEICA DM750 microscope (LEICA, Germany). For post-processing, images were uploaded to FIJI [73] and the “Analyze Spheroid Cell Invasion In 3D Matrix, RRID:SCR_021204” macro was used for spheroid segmentation and analysis. Besides these two properties, we also used post-processing techniques to evaluate spheroid invasion in Matrigel™ hydrogels and determine parameters such as the area of the spheroid core, the maximum radius of invasion and the area of the invading edge. For this particular Chapter III – Materials and methods 133 case, images acquired over the course of 0, 4 and 7 days were converted to grey-scale and organized for automatic batch processing. Spheroid segmentation and analysis was performed with the INSIDIA (INvasion SpheroID ImageJ Analysis) [74] macro for FIJI. Ultimately, in order to study cell chemotaxis in our developed collagen chemotaxis chamber, we were interested in running available software image analysis tools. However, due to the architecture of the chamber and the cell number, it was difficult to use previously reported analysis macros. Hence, for this effect we describe in the following chapter an image analysis pipeline that allowed for the assessment of axial migration of stromal cells throughout the chemotaxis hydrogel. Briefly, brightfield endpoint images of cell invasion were processed with ImageMagick 6.9.11 to obtain a 1:1 ratio image centered on each well for each time point of the experiment, which was then divided into four quadrants of identical size. Pixel classification was performed with Ilastik [75] to separate background from invading cells. CellProfiler 4.2.1 [76] was then used for the cell segmentation and the calculation of the area of invasion. Time-lapse brightfield images were obtained over pre-established time-points using an Axio Observer inverted microscope with incubation (37 ºC, 5 % of CO2), and Zen 3.2 (blue edition) software (Zeiss, Germany). III-5. STATISTICAL ANALYSIS GraphPad Prism 8.2.1 software (La Jolla, USA) was used to perform statistical analysis. Data were analyzed by Shapiro–Wilk normality test. A one-way analysis of variance (ANOVA) with a Tukey post-test was used to analyze the results with a normal distribution. Otherwise, data were analyzed with the Kruskal–Wallis test with Dunn’s multiple comparison post-test. The significance of data variability was determined with the Brown–Forsythe test. Results are presented as mean ± standard deviation (SD) and as coefficient of variation (reproducibility analysis) and the significance level between groups was set for * p < 0.05. III-6. REFERENCES 1 O’Neill MA, Selvendran RR, Morris VJ. Structure of the acidic extracellular gelling polysaccharide produced by Pseudomonas elodea. Carbohydr. Res. 124(1), 123–133 (1983). 2 Chandrasekaran R, Millane RP, Arnott S, Atkins EDT. The crystal structure of gellan. Carbohydr. Chapter III – Materials and methods 134 Res. 175(1), 1–15 (1988). 3 Milas M, Shi X, Rinaudo M. On the physicochemical properties of gellan gum. Biopolymers 30(3‐ 4), 451–464 (1990). 4 Chauhan AS, Jain NK, Diwan PV, Khopade AJ. Solubility enhancement of indomethacin with poly (amidoamine) dendrimers and targeting to inflammatory regions of arthritic rats. J. Drug Target. 12(9–10), 575–583 (2004). 5 Prajapati VD, Jani GK, Zala BS, Khutliwala TA. An insight into the emerging exopolysaccharide gellan gum as a novel polymer. Carbohydr. Polym. 93(2), 670–678 (2013). 6 Agnihotri SA, Jawalkar SS, Aminabhavi TM. Controlled release of cephalexin through gellan gum beads: Effect of formulation parameters on entrapment efficiency, size, and drug release. Eur. J. Pharm. Biopharm. 63(3), 249–261 (2006). 7 Oliveira J, Sousa R, Reis RL. WO2009/101518 (2009). 8 Tadros TF. Emulsion formation and stability . John Wiley & Sons (2013). 9 Yuan Y, Gao Y, Zhao J, Mao L. Characterization and stability evaluation of β-carotene nanoemulsions prepared by high pressure homogenization under various emulsifying conditions. Food Res. Int. 41(1), 61–68 (2008). 10 Prakash SJ, Santhiagu A, Jasemine S. Preparation, Characterization and In vitro Evaluation of Novel Gellan Gum-Raloxifene HCl Nanoparticles. J. Pharm. Biosci. 2(2), 63–71 (2014). 11 Boyd J, Parkinson C, Sherman P. Factors affecting emulsion stability, and the HLB concept. J. Colloid Interface Sci. 41(2), 359–370 (1972). 12 Apenten RKO, Zhu Q-H. Interfacial parameters for spans and tweens in relation to water-in-oil-inwater multiple emulsion stability. Food Hydrocoll. 10(2), 245–250 (1996). 13 Jasmina H, Džana O, Alisa E, Edina V, Ognjenka R. PREPARATION OF NANOEMULSIONS BY HIGH-ENERGY AND LOWENERGYEMULSIFICATION METHODS BT - CMBEBIH 2017. Springer Singapore, Singapore, 2017. 14 June CH, Bluestone JA, Nadler LM, Thompson CB. The B7 and CD28 receptor families. Immunol. Today 15(7), 321–331 (1994). 15 Tsoukas CD, Landgraf B, Bentin J et al. Activation of resting T lymphocytes by anti-CD3 (T3) Chapter III – Materials and methods 135 antibodies in the absence of monocytes. J. Immunol. 135(3), 1719 LP – 1723 (1985). 16 Walker C, Bettens F, Pichler WJ. T cell activation by cross-linking anti-CD3 antibodies with second anti-T cell antibodies: dual antibody cross-linking mimics physical monocyte interaction. Eur. J. Immunol. 17(11), 1611–1618 (1987). 17 Poltorak MP, Graef P, Tschulik C et al. Expamers: a new technology to control T cell activation. Sci. Rep. 10(1), 17832 (2020). 18 Bashour KT, Gondarenko A, Chen H et al. CD28 and CD3 have complementary roles in T cell traction forces. Proc. Natl. Acad. Sci. 111(6), 2241–2246 (2014). 19 Rudd CE, Taylor A, Schneider H. CD28 and CTLA‐4 coreceptor expression and signal transduction. Immunol. Rev. 229(1), 12–26 (2009). 20 Bartczak D, Kanaras AG. Preparation of peptide-functionalized gold nanoparticles using one pot EDC/sulfo-NHS coupling. Langmuir 27(16), 10119–10123 (2011). 21 Keleştemur S, Altunbek M, Culha M. Influence of EDC/NHS coupling chemistry on stability and cytotoxicity of ZnO nanoparticles modified with proteins. Appl. Surf. Sci. 403, 455–463 (2017). 22 Thorek DLJ, Elias DR, Tsourkas A. Comparative analysis of nanoparticle-antibody conjugations: carbodiimide versus click chemistry. Mol. Imaging 8(4), 221–229 (2009). 23 Jazayeri MH, Amani H, Pourfatollah AA, Pazoki-Toroudi H, Sedighimoghaddam B. Various methods of gold nanoparticles (GNPs) conjugation to antibodies. Sens. Bio-Sensing Res. 9, 17– 22 (2016). 24 Ehrler S, Pieles U, Wirth-Heller A, Shahgaldian P. Surface modification of resorcinarene based selfassembled solid lipid nanoparticles for drug targeting. Chem. Commun. (25), 2605–2607 (2007). 25 Diamandis EP, Christopoulos TK. The biotin-(strept) avidin system: principles and applications in biotechnology. Clin. Chem. 37(5), 625–636 (1991). 26 Wilchek M, Bayer EA. The avidin-biotin complex in bioanalytical applications. Anal. Biochem. 171(1), 1–32 (1988). 27 Chung JW, Park JM, Bernhardt R, Pyun JC. Immunosensor with a controlled orientation of antibodies by using NeutrAvidin-protein A complex at immunoaffinity layer. J. Biotechnol. 126(3), 325–333 (2006). Chapter IV – Highly tailorable gellan gum nanoparticles as a platform for the development of T cell activator systems 142 CHAPTER IV Chapter IV - HIGHLY TAILORABLE GELLAN GUM NANOPARTICLES AS A PLATFORM FOR THE DEVELOPMENT OF T CELL ACTIVATOR SYSTEMS ‡ ABSTRACT T cell priming has been shown to be a powerful immunotherapeutic approach for cancer treatment in terms of efficacy and relatively weak side effects. Systems that optimize the stimulation of T cells to improve therapeutic efficacy are therefore in constant demand. A way to achieve this is through artificial antigen presenting cells that are complexes between vehicles and key molecules that target relevant T cell subpopulations, eliciting antigen-specific T cell priming. In such T cell activator systems, the vehicles chosen to deliver and present the key molecules to the targeted cell populations are of extreme importance. In this work, a new platform for the creation of T cell activator systems based on highly tailorable nanoparticles made from the natural polymer gellan gum was developed and validated. Here, it is demonstrated that the developed system presented a more sustained T cell activation over time when compared to commercial alternatives. Concurrently, the expression of higher levels of key cytotoxic pathway molecules granzyme B/perforin was induced, suggesting a greater cytotoxic potential for future application in adoptive cancer therapy. ‡ This chapter is based on the following publications: Rodrigues DB, Moreira HR, Cerqueira MT, Marques AP, Castro AG, Reis RL, Pirraco RP. Highly tailorable gellan gum nanoparticles as a platform for the development of T cell activator systems. Biomater. Res. 26 (2022) 48. https://doi.org/10.1186/s40824-022-00297-z Rodrigues DB, Moreira HR, Gasperini L, Cerqueira MT, Marques AP, Pirraco RP, Reis RL. HYDROGEL-LIKE PARTICLES, METHODS ANS USES THEREOF, WO/2021/064678 (2021) Chapter IV – Highly tailorable gellan gum nanoparticles as a platform for the development of T cell activator systems 143 IV-1. INTRODUCTION Many advances have been made in the field of immunotherapy with the introduction of adoptive T cell therapy and CAR T cell therapies. These consist in the administration of either autologous T cells primed and expanded in vitro or genetically modified T cells that encode for transmembrane chimeric molecules with the capacity to both recognize tumor surface antigens and trigger cytotoxic machinery specifically against these tumor cells [1]. Given the significant success of these technologies, there is now a need for improved ways of expanding cells for administration. The clinical efficacy of adoptive cell transfer (ACT) is largely dependent on how the antigen-specific T cells are stimulated during the priming phase [2–4] and dependent on downstream stimulation with γ chain receptor cytokines such as IL-2, IL-7, IL-15 and IL-21 [5–7]. In fact, a fine balance when dealing with artificial T cell stimulation is required in order obtain a high number of effector T cells without jeopardizing cell effectiveness. An inefficient priming may result in hyporesponsive or anergic T cells, leading to a lack of proliferation and/or loss of effector function when in contact with the respective antigen, rendering the treatment ineffective. On the contrary, excessive stimulation of the cells in vitro may also compromise treatment efficiency due to T cell induced cell death (AICD) [8,9]. Therefore, novel methodologies to improve T cell priming are in high demand. One such novel methodology is artificial antigen presentation which has emerged as a very promising concept due to its versatility both in terms of the platform used to build the system and the T cell activation method adopted. Over the past decades, several artificial antigen presenting cells (aAPCs) based on distinct systems have been developed with promising results in the in vivo expansion of specific T cells [10–12] with further evidence provided when applied to more advanced disease models of murine experimental autoimmune encephalomyelitis, collagen induced arthritis, non-obese diabetic animals [13] and cancer [14]. The base architecture of these systems has relied on the use of iron oxide nanoparticles [13], synthetic polymers [11], liposomes [15], magnetic beads [10,14,16] and cell engineering methodologies [12,17,18]. However, one of the greatest handicaps of these systems is the difficulty in generating, within a short period of time, large numbers of modified T cells of a defined phenotype and with a specified ratio of subsets [19]. Furthermore, in some cases, inorganic nano/microparticles, while qualified for applications such as diagnostics, imaging and photothermal therapies, have limitations related to their low solubility and toxicity concerns [20]. In contrast, biomaterials present characteristics such as biodegradability, biocompatibility, half-life and mechanical properties that can be used to shape Chapter IV – Highly tailorable gellan gum nanoparticles as a platform for the development of T cell activator systems 144 interactions with T cells and drive immune cell responses [21]. As such, biomaterials have the potential to be used in the development of novel platforms more in tune with biological systems. Gellan Gum (GG) is a bacterial exopolysaccharide exhibiting properties such as biocompatibility, low production costs and reproducibility over batches. GG is produced by the bacteria Sphingomonas elodea [22] and consists of a repeating unit of α-L-rhamnose, β-D-glucose and β-D-glucoronate in the milimolar ratios 1:2:1 [23]. GG may either exist in its native form or upon alkaline hydrolysis originate the so called low-acyl GG [22], both forms retaining the capability to crosslink into hydrogels in the presence of mono- , diand trivalent cations [24,25]. This polysaccharide has been proven suitable for the production of microbeads [26–28] or for the production of formulations for the sustained delivery of relevant drugs [29–32,33–35]. Due to its resemblance with the extracellular matrix glycosaminoglycan composition [36] it has gathered also important attention in the field of tissue engineering and regenerative medicine [37– 40]. In this work, it has been proposed to use GG as the basis to create a multivalent T cell activator system for the controlled in vitro expansion of T cells. In this system, GG nano-sized particles were surfacemodified with α-CD3 and α-CD28 antibodies and used to successfully prime naïve mouse T cells, generating a high number of proliferative IL-2 producing CD4+ T cells. Additionally, the current work shows that these cells present increased levels of T cell mediated cytotoxicity mediators Perforin 1 and Granzyme B while maintaining a low state of T cell exhaustion. IV-2. MATERIALS AND METHODS IV-2.1. Gellan gum particle synthesis Gellan gum nanoparticles (npGG) were produced by the double emulsion water-in-oil-in-water technique [41]. Briefly, a 1 % (w/v) of gellan gum (Sigma-Aldrich, Germany) solution was prepared in deionized water, under stirring at 90 ᵒC for 30 min. After dissolution, the solution was allowed to stabilize at 50 ᵒC. A drop of Tween-20 (Sigma-Aldrich, Germany) was then added to the GG solution (W1) and each mL of the GG solution was emulsified in 3 mL of 0.5 % (v/v) of Span®80 (Sigma-Aldrich, Germany) in chlorophorm (Sigma-Aldrich, Germany)(O) while under stirring with a T18 BASIC Ultraturrax (IKA, NC, USA) for 3 min. W1/O was then added dropwise to a solution of 3.5 % (w/v) poly(vinyl alcohol) (PVA)(W2) (Sigma-Aldrich, Germany) in water under continuous stirring and then crosslinked by adding gradually Chapter IV – Highly tailorable gellan gum nanoparticles as a platform for the development of T cell activator systems 145 W1/O/W2 into 5 mL of a 60 % (w/v) solution of calcium chloride (Merck Millipore, Germany) under stirring. Chlorophorm was removed using a rotary vaccum evaporator at 37 ᵒC (Stuart, Staffordshire, UK). The particles were recovered by centrifugation for 1 h at 13’000 × g (Eppendorf, Germany) and by passing through a series of strainers (pluriSelect, Leipzig, Germany) ranging from 10 μm down to 1 μm to limit size dispersion. In order to remove PVA, 3 additional washing steps were performed by centrifugation at 13’000 × g for 10 min with deionized water. GG particles were then frozen [-210 ᵒC in liquid nitrogen (N2)] and then freeze-dried (LyoQuest, Telstar, Spain) to obtain dried GG particles for further modification upon rehydration. IV-2.2. npGG characterization IV-2.2.1. Chemical characterization of npGG The presence of specific functional groups in the npGG was assessed by Fourier transform infrared spectroscopy (FTIR). To obtain the FTIR spectra of npGG, transparent potassium bromide (Sigma-Aldrich, Germany) pellets were prepared containing the samples to be analyzed. The readings were performed in an infrared spectroscope (IR Prestige-21, Shimadzu, Japan) with 4 cm-1 resolution and the results are presented as the average of 32 scans. IV-2.2.2. npGG morphology The npGG size distribution and surface charge were analyzed by dynamic light scattering after preparing a 1 mg/mL suspension of rehydrated GG particles in deionized water (Zetasizer Nano ZS, Malvern Instruments, UK). Acquisition was performed with the detector positioned at a scattering angle of 173°. Particle size and morphology were analyzed with a High-Resolution Field Emission Scanning Electron Microscope with Focused Ion Beam (FIB – SEM) (AURIGA COMPACT, ZEISS, Germany). For this effect, the samples were diluted at 0.5 mg/mL in ultrapure water followed by a further dilution of 1:20 and were dispersed onto the surface of a 400-mesh carbon-coated copper grid (Ted Pella, USA) for further observation. Chapter IV – Highly tailorable gellan gum nanoparticles as a platform for the development of T cell activator systems 146 IV-2.2.3. Particle stability upon rehydration To determine the stability of the produced GG particles over time, a 1 mg/mL suspension of npGG was prepared in different solutions (culture medium, phosphate buffer saline (PBS), and deionized water) and filtered through a 0.8 µm filter (Millex, Millipore, France). Particle size and dispersity was evaluated over 7 days by dynamic light scattering (DLS) (Zetasizer Nano ZS, Malvern Instruments, UK). Between data acquisition times, samples were stored at room temperature. IV-2.2.4. Water uptake and water content quantification The dried GG particles were rehydrated with PBS up to 7 days at 37 ºC, to determine the water uptake profile. Samples were weighed prior (Wd) and after each time point (Ww) and the percentage of water uptake over time was calculated based on the Equation III-1. The water content of the hydrogel particles was determined through of the particles in their wet state (Ww) versus the weight in their dried state (Wd). IV-2.2.5. Particle functionalization with antibodies npGG in suspension were functionalized through chemical coupling by one of two methods. Briefly, 1 mg of npGG was dissolved in MES buffer at 50 mM and pH 6.5. Carboxylic groups were activated through the addition of N-(3_Dimethylaminopropyl)-N´- ethylcarbodiimide hydrochloride and Nhydroxysulfosuccinimide to achieve a final concentration of 17.3 μM and 18 μM respectively and left to stir for 1 h. The particles were then washed 3x by centrifugation at 18000 × g and afterwards either i) NeutrAvidin was added first and left to react over 4 h at RT under agitation after which the particles were washed again and 10 µg/20 µg of biotinylated α-CD3/CD28 antibodies (MyBioSource™, California, USA) were added or ii) 10 µg/20 µg of functional grade α-CD3/CD28 (Tonbo Biosciences™, California, USA) antibodies were added directly to the EDC/NHS activated particles and incubated overnight at 4 ºC. The following day, the produced activator-npGG were washed again 3× by centrifugation at 18’000 × g to remove unbound antibodies and particles were suspended in adequate medium. Chapter IV – Highly tailorable gellan gum nanoparticles as a platform for the development of T cell activator systems 147 IV-2.2.6. Density of NeutrAvidin The density of NeutrAvidin protein on the particles surface was determined using the micro bicinchoninic acid assay (Pierce, Rockford, IL) in accordance with the manufacturer's instructions. For this effect, 1 mg of GG particles was functionalized as stated above with either 0.5 mg or 1 mg of avidin by conjugation through EDC/NHS. Experimental replicates were performed for reproducibility of the chemical conjugation and elution’s resulting from washing step were stored for quantification of unbound NeutrAvidin. IV-2.2.7. Assessment of npGG functionalization To evaluate the binding of functional grade antibodies to npGG’s, SDS-PAGE (Sodium, Dodecyl, Sulfate, Polyacrylamide Gel Electrophoresis) analysis was used (Sigma-Aldrich, Germany). To achieve protein separation, two separate gels were used, a 4.7 % stacking gel and a 12 % resolving gel. In each well, an equal amount (10 µg) of either control or modified particles were loaded after being prepared by heating at 60 ºC for 30 min prior. A calibration curve of the biotinylated antibody of 0.5 µg, 1 µg and 2 µg was performed. The direct binding of the antibody to the particles was also performed and again a calibration curve of the standard antibody was equally performed 0.5 µg, 1 µg and 2 µg. The bands in each well were observed by soaking the gel with Coomassie Blue (National Diagnostics, Atlanta, USA) followed by destaining. IV-2.3. Functionality evaluation Functionality assays were carried out to determine the in vitro performance of the produced activatornpGG in terms of both surface interaction with host immune cells, as well as, the capacity to trigger T cell proliferation. IV-2.3.1. Cell lines and culture conditions Primary human dermal fibroblasts (hDFbs) (Gibco, UK) were obtained from Thermo Fischer and cultured in α-MEM, supplemented with 10 % (w/v) fetal bovine serum (FBS, Invitrogen, USA) and 1 % (v/v) antibiotic/antimycotic. Cells were kept in culture at 37 °C in a humidified atmosphere with 5 % CO2. Chapter IV – Highly tailorable gellan gum nanoparticles as a platform for the development of T cell activator systems 148 IV-2.3.2. Cell isolation All procedures were approved by the Direcção Geral de Alimentação Veterinária, the Portuguese National Authority for Animal Health, and respected the national regulations and international animal welfare rules. Murine splenocytes cells were obtained from Balb/c mice. Briefly, mouse spleens were excised and sliced into small pieces. The fragments were placed onto a strainer attached to a 50 mL conical tube. The excised spleen fragments were pressed through the strainer using the plunger end of a 5 mL syringe. The cells were washed through the strainer using excess cell culture medium. Cells were collected by centrifugation at 400 × g for 5min. The cell pellet was resuspended in 1mL of pre-warmed (37 ºC) red blood cell lysis buffer and incubated at 37 ºC for 5 min. Murine splenocytes were then washed with excess PBS and centrifuged at 400 × g for 5 min. Cells were cultured from hereon with RPMI 1640 medium (Sigma-Aldrich, Germany) supplemented with 10 % (v/v) FBS (Gibco, ThermoFisher Scientific, Paisley, UK) 1 % (v/v) HEPES (Gibco, ThermoFisher Scientific, Paisley, UK), 1 % (v/v) sodium syruvate (Gibco, ThermoFisher Scientific, Paisley, UK) and 0.05 mM Mercaptoethanol (Gibco, ThermoFisher Scientific, Paisley, UK) at 37 °C in an incubator equilibrated with 5 % CO2. IV-2.3.3. Metabolic activity in response to npGG To determine the metabolic activity of cells in response to npGG, hDFbs were stimulated with different npGG concentrations (2, 20, 100, 200 µg/mL) for 72h. Metabolic activity and cell proliferation were quantified after this period using CellTiter 96® AQueous One Solution Cell Proliferation Assay (Promega, USA) and Quant-iT PicoGreen dsDNA Assay Kit (Invitrogen, UK), respectively as recommended by the manufacturer. Metabolic activity data was expressed as the percentage of cell metabolic activity of the stimulated cells normalized to the non-stimulated hDFbs. The concentration of DNA present in each condition was determined against a standard curve. IV-2.3.4. Visualization of activator npGG-cell binding For visualizing activator npGG-splenocyte interactions, murine splenocytes were stimulated for 5 days with varying concentrations of the developed system. At different time-points, cells were collected, washed and growth medium supernatant was aspirated and replaced with PBS at a concentration of ~1 × 106 Chapter IV – Highly tailorable gellan gum nanoparticles as a platform for the development of T cell activator systems 149 cells/mL. A pipette was used to gently mix and transfer 1 mL of the cell suspension into a culture plate well holding a coverslip. The culture plate was then left stationary for 30 min at room temperature to allow for the sedimentation and adhesion of cells to the coverslip. Afterwards, the PBS suspension containing remaining non-adherent cells was gently aspirated. The adhered cells were then fixed for 15 min at room temperature with ice cold methanol (Sigma-Aldrich, Germany) pipetted along the side of the well. Fixed cells were then washed with PBS and stored at 4 ºC until immunolabeling. Primary antibody CD4 (Rabbit anti-Mouse, 1:200, NovusBiologicals, U.K.) and Alexa Fluor 488tagged Goat anti-rabbit secondary antibody (1:500, ThermoFisher Scientific, Paisley, UK.) were used for cell visualization (Supplementary Table IV-1). Nuclei were stained with DAPI (Invitrogen, U.S.) For particle visualization, a Donkey anti-rat AF594 secondary antibody (1:500, ThermoFisher Scientific, Paisley, UK) was used. An AXIOIMAGER Z1M (Carl Zeiss Microscopy GmbH, Jena, Germany) widefield microscope or a TCS SP8 Leica laser confocal microscope (Leica Microsystems, Wetzlar, Germany) were used for visualization of the samples. IV-2.3.5. Visualization of activator npGG-cell binding To quantitively determine the percentage of binding of the activator-npGG system to T cells, freshly isolated murine splenocytes were placed in culture with varying concentrations of α-CD3 antibodyfunctionalized GG particles (1 μg, 10 μg, 50 μg and 100 μg) produced either by directly coupling the antibodies to the particles or through the NeutrAvidin/Biotin immobilization. Cultures proceeded over 5 days and, ultimately, cell-bound particles were labelled in a first step with a rabbit anti-rat IgG AF488 secondary antibody (1:500, ThermoFisher Scientific, Paisley, UK) followed by a wash step. T cells were then labelled with a rat anti-mouse AF647-conjugated CD4+ antibody (2.5 μg/mL, Biolegend, London, UK) and conjugation was assessed through flow cytometery. IV-2.3.6. T cell proliferation and activation in response to functionalized npGG To monitor T cell expansion when stimulated with functionalized GG particles, previously isolated murine splenocytes were labeled with CFSE. In brief, 2-5 ×107 cells were incubated with 2.5 µM of CFSE at 37 ºC for 10 min. Cells were then washed three times with complete medium to quench and remove unbound CFSE and were then distributed (1×106/well) in 96 well flat bottom culture plate. As controls for T cell expansion, 3 conditions were set up: Dynabead Mouse T-Activator CD3/CD28 for T cell Expansion Chapter IV – Highly tailorable gellan gum nanoparticles as a platform for the development of T cell activator systems 150 and Activation (Gibco, ThermoFisher Scientific, Paisley, UK), plate bound functional grade anti-CD3 antibody (eBioscience™, ThermoFisher Scientific, Paisley, UK) (2 μg/mL) or no additional stimulator. For the coating of the 96 well plates (Cellstar M3687, Greiner Bio-One, Austria), anti-CD3 antibodies were dissolved to a concentration of 2 µg/mL and 50 µL were added per well and left to incubate for 1 h at RT. The following day, culture plate wells were washed with complete medium to block unspecific binding of antibodies still to be added. Different np-GG α-CD3/ α-CD28 concentrations were added (1 µg/mL, 10 µg/mL, 50 µg/mL and 100 µg/mL) over a period of 7 days of stimulation in a ratio of 1:1. For plate bound antibody stimulation, anti-CD28 was added to a final concentration of 2 µg/mL to each respective well. All quantifications were performed in triplicate. The proportion of dividing cells was detected by flow cytometry based on CFSE levels of gated CD4+ T cells [42]. IV-2.3.7. Enzyme-linked immunosorbent assay (ELISA) IL-2 secretion assay ELISA (Elabscience, Hubei, CN) was used to quantify the levels of IL-2 released upon stimulation with the developed activator-npGG system. Conditioned medium was collected post 7 days of stimulation with varying concentration of the npGG activator system to assess total IL-2 produced over the complete stimulation period. The procedure was carried out according to the manufacturer's instructions and the absorbance was read at 450 nm using a Synergy HT (BioTek, Vermont, USA) microplate reader. The quantity of IL-2 protein was determined by means of a standard curve. IL-2 within the control media was undetectable during the experiments and therefore was omitted from the figures. IV-2.3.8. T cell exhaustion and cytotoxic capacity Quantitative Real-Time Polymerase Chain Reaction (qPCR) was used to detect the expression of T cell exhaustion-related genes after exposure to 7 days of stimulation with either the activator-npGG system or the commercial activator beads. Primers for the tested genes and the housekeeping gene ACTβ were designed using Primer-Blast database (NCBI, Bethesda, MD, USA) (Supplementary Table IV-2). qPCR reactions were carried out in a MasterCycler Realplex4 (Eppendorf, Hamburg, Germany) and primer efficiency was tested out using serial dilutions of cDNA (1, 1:10, 1:100, 1:1000). For qPCR reactions, 1 μL of synthesized cDNA was used in a 20 μL reaction containing 10 μL of PerfeCTa® SYBR Chapter IV – Highly tailorable gellan gum nanoparticles as a platform for the development of T cell activator systems 151 Green FastMix (Quanta Biosciences, Beverly, MA, USA) and forward and reverse primers at 300 nM. Reaction conditions comprised a 2 min denaturation at 95 ºC, followed by 45 cycles of 95 ºC for 10 s, a specific annealing temperature as described in Supplementary Table IV-2, for 30 s and 72 ºC for 10 s. Products obtained from real-time PCR were subjected to melting curve analysis to check for the correct amplicon length and the absence of unspecific products. Transcript abundances were normalized to the expression of ACTB. Samples were run in triplicate in each PCR assay. Normalized expression values were calculated following the mathematical model proposed by Pfaffl using the formula: 2 −ΔΔCt (Pfaffl, 2001). IV-2.3.9. Analysis of helper and cytotoxic T cell subsets To monitor T cell activation profile, splenocytes were incubated with functionalized npGG over 7 days of stimulation. Cells were then washed, permeabilized, and stained with the following antibodies: CD45PerCP/Cy5.5, CD4-APC-H7, CD8-APC-H7 (from BD Biosciences) and Granzyme B-PE-Cy7, Perforin-APC, CD69-PE (from Biolegend) (Supplementary Figure IV-1). For intracellular staining, cells were first incubated and fixed with Reagent A-Fix and Perm™ (Thermo-scientific, Netherlands) for 15 min, and stained with the respective conjugated antibodies diluted in Reagent BFix and Perm™ (Thermoscientific, Netherlands) for 30 min at RT. After washing with PBS, cells were fixed in 1 % formalin (Sigma, USA)/PBS and then analyzed on a FACSCalibur flow cytometer (BD Biosciences, Belgium) and data was treated using Cell Quest Pro version 4.0.2 (BD Biosciences, Belgium). Cells were gated according to (Supplementary Figure IV-1). IV-2.4. Statistical analysis Graphpad software version 7.03 was used to perform statistical analysis. To determine if data sets fell in a normal distribution the Shapiro-Wilk normality test was performed. When a normal distribution was verified a one-way analysis of variance with a Tukey post-test was performed. Otherwise, data was analyzed with the Kruskal-Wallis test followed by the Dunn’s multiple comparison post-test. Results are presented as mean ± standard deviation (SD) and the significance levels between experimental groups was set for * p <0.05, ** p <0.01, *** p <0.001.