Essential oils as an alternative treatment for vaginal candidiasis
Abstract
A crescente prevalência de infeções fúngicas, especialmente causadas por Candida, destaca a necessidade de terapias mais eficazes e menos tóxicas. Os antifúngicos convencionais apresentam limitações, tais como efeitos colaterais notáveis e eficácia fungicida inadequada, o que contribui para o aparecimento de espécies resistentes a medicamentos. Nesta perspetiva, surgem os óleos essenciais (OE), como alternativas promissoras. Este estudo apresenta dois métodos inovadores de aplicação de OEs: fase vapor (FV-OE) e encapsulamento em microcápsulas de queratina (OE-MCQ). Métodos que visam maximizar o potencial efeito terapêutico dos óleos. Foram avaliados diferentes OEs, incluindo árvore de chá, niaouli, tomilhos, cajeput e orégão, em espécies de Candida resistentes aos antifúngicos convencionais. Os resultados evidenciaram a eficácia dos OEs na inibição do crescimento e na prevenção de biofilmes, confirmando o seu potencial como terapias alternativas. Outro parâmetro avaliado foi a variabilidade na eficácia de diferentes OEs que pertencem ao mesmo género, o que destaca a importância de considerar as características químicas específicas de cada OE. No contexto do tratamento da candidíase vulvovaginal (CVV), o foco deste trabalho, os OEs mostraram atividade antifúngica significativa, especialmente na prevenção de biofilmes formados por espécies resistentes relacionadas à CVV. De modo a mimetizar o ambiente vaginal in vitro, foram otimizadas as condições experimentais através da utilização de fluído vaginal sintético. Adicionalmente, foi explorado o impacto da VF-OE na microbiota vaginal, evidenciando a sua eficácia contra Candida sem perturbações significativas na restante microflora, nomeadamente na espécie de Lactobacillus. O óleo essencial de orégão (OEO) destacou-se pela sua notável eficácia antifúngica contra espécies de Candida resistentes a antifúngicos, interferindo com a integridade da membrana e com a atividade metabólica. No entanto, a sua aplicação clínica pode ser desencorajada, devido à possível toxicidade. Nesta perspetiva, foram apresentadas abordagens seguras para a sua aplicação no tratamento da CVV, como a FV-EO e o EO-MCQ. A aplicação intravaginal, in vivo, de OEO-QMC num modelo animal resultou na diminuição do crescimento de Candida albicans, não afetando o crescimento da espécie Lactobacillus presente. Em conclusão, esta tese destaca o potencial dos OEs, particularmente o óleo essencial de orégão, como terapias alternativas para infeções provocadas pela espécie Candida. Os métodos de aplicação propostos, VF-EO e OE-MCQ, oferecem possibilidades promissoras para um tratamento seguro e eficaz. As características naturais dos OE apresentam vantagens como menor custo, fácil acesso e menor impacto negativo na saúde da mulher, preservando a saúde vaginal.
Full text
Liliana de Sousa Fernandes Essential oils as an alternative treatment for vaginal candidiasis abril de 2024 Essential oils as an alternative treatment for vaginal candidiasis Liliana de Sousa Fernandes UMinho|2024 Universidade do Minho Escola de Engenharia Universidade do Minho Escola de Engenharia
Liliana de Sousa Fernandes Essential oils as an alternative treatment for vaginal candidiasis abril de 2024 Tese de Doutoramento Doutoramento em Engenharia Química e Biológica Trabalho efetuado sob a orientação da Doutora Mariana Contente Rangel Henriques da Doutora Maria Elisa da Costa Rodrigues e da Doutora Ana Sofia Quinta e Costa Neves de Oliveira Universidade do Minho Escola de Engenharia
ii DIREITOS DE AUTOR E CONDIÇÕES DE UTILIZAÇÃO DO TRABALHO POR TERCEIROS Este é um trabalho académico que pode ser utilizado por terceiros desde que respeitadas as regras e boas práticas internacionalmente aceites, no que concerne aos direitos de autor e direitos conexos. Assim, o presente trabalho pode ser utilizado nos termos previstos na licença abaixo indicada. Caso o utilizador necessite de permissão para poder fazer um uso do trabalho em condições não previstas no licenciamento indicado, deverá contactar o autor, através do RepositóriUM da Universidade do Minho. Licença concedida aos utilizadores deste trabalho Atribuição-NãoComercial-SemDerivações CC BY-NC-ND h tt p s :/ / crea t ive c o mm on s .or g / lic en ses / by - nc - n d/ 4.0/
iii AGRADECIMENTOS Essência por essência, a jornada acadêmica que culmina nesta tese foi enriquecida pela influência e apoio daqueles que sempre me acompanharam e apoiaram. Cada um de vocês, as orientadoras que guiaram o caminho, aos amigos que deram cor à minha vida, a família que forneceram alicerce e apoio e as colegas que deram suporte, é como um óleo essencial distinto que deixou sua marca significativa nesta jornada acadêmica. Por isso, queria expressar os meus sinceros agradecimentos: Professora Mariana , agradeço com imenso carinho e gratidão pela orientação, aconselhamento, sugestões sempre muito relevantes e pelos excelentes ensinamentos que foram indispensáveis para o desenvolvimento deste trabalho. Não tenho palavras para agradecer por todas as oportunidades que me proporcionou e pelo incentivo ao longo deste caminho. O constante apoio ao longo destes anos foram verdadeiramente inspiradores e motivadores, impulsionando-me a superar obstáculos e a alcançar objetivos que não julgava ser capaz. Elisa, quero agradecer do fundo do meu coração todo o apoio, amizade, total disponibilidade, dedicação, a imensa paciência manifestada e motivação por encorajares sempre as minhas ideias por mais ambiciosas que fossem. Ao longo destes anos (e já lá vão 9 anos), com a tua orientação fui desenvolvendo diversas ferramentas que foram cruciais não só para a realização desta tese mas para o meu desenvolvimento profissional que será bastante útil no futuro. Professora Sofia , agradeço pela orientação, simpatia, dedicação e disponibilidade demostrada, por me ter recebido no seu laboratório e por todos os ensinamentos, e ideias ao longo deste percurso, foram cruciais para o desenvolvimento deste projeto. Sou muito grata por toda a orientação que recebi durante a realização desta tese. Gostaria de deixar uma palavra de agradecimento a todos os elementos atuais e os que passaram no laboratório LMAs , é incrível a camaradagem deste grupo. Agradeço pelas sugestões e ideias que me deram ao longo do trabalho, foram um grande contributo. Um agradecimento especial à Sónia, Isabel, Fernanda, Bruna e Daniela pela simpatia, amizade e ajuda que me disponibilizaram desde do meu primeiro dia no laboratório. Às colaborações que foram feitas, Doutora Raquel Costa, Doutora Lorena Cussó e a sua equipa, Doutor Artur Ribeiro e a equipa do INIAV agradeço por enriquecerem não só o trabalho desenvolvido, como também a minha formação profissional. Aos meus amigos, sei que posso contar com vocês para compartilhar risadas, oferecer ombros amigos e caminhar ao meu lado em todas as jornadas que a vida nos reserva. Em especial, à Ana Barbosa , umas das melhores pessoas que o LMAs me colocou na vida, obrigada pelo apoio, encorajamento e amizade incondicional . Ana Luísa, Jéssica e Alice agradeço do fundo do meu coração a vossa amizade, é muito importante ter-vos na minha vida. E às minhas meninas da Covilhã, Sofia e Inês com quem partilhei e irei sempre partilhar os melhores momentos da minha vida, agradeço pela amizade, incentivo e apoio constante, e por acreditarem sempre no meu trabalho e alegrarem os meus dias. E por último, mas não menos importante, um grande obrigada a minha família pelo apoio absoluto, motivação, por toda a confiança depositada em mim, pelo enorme carinho e compreensão não só agora mas ao longo de toda a minha vida. Um obrigada muito especial a ti Fábio pelo amor e carinho, paciência e ajuda que me deste ao longo destes anos. Estiveste lá nas conquistas e nas derrotas, sempre com um abraço reconfortante, proporcionando-me um porto seguro, que sempre me incentivou a continuar e a dar o melhor de mim. Sem vocês esta conquista não seria possível. A Todos, Muito Obrigada! “Somos do tamanho dos nossos sonhos” Fernando Pessoa
iv STATEMENT OF INTEGRITY I hereby declare having conducted this academic work with integrity. I confirm that I have not used plagiarism or any form of undue use of information or falsification of results along the process leading to its elaboration. I further declare that I have fully acknowledged the Code of Ethical Conduct of the University of Minho. Universidade do Minho, abril de 2024
v Óleos essenciais como tratamento alternativo para a candidíase vaginal | RESUMO A crescente prevalência de infeções fúngicas, especialmente causadas por Candida , destaca a necessidade de terapias mais eficazes e menos tóxicas. Os antifúngicos convencionais apresentam limitações, tais como efeitos colaterais notáveis e eficácia fungicida inadequada, o que contribui para o aparecimento de espécies resistentes a medicamentos. Nesta perspetiva, surgem os óleos essenciais (OE), como alternativas promissoras. Este estudo apresenta dois métodos inovadores de aplicação de OEs: fase vapor (FV-OE) e encapsulamento em microcápsulas de queratina (OE-MCQ). Métodos que visam maximizar o potencial efeito terapêutico dos óleos. Foram avaliados diferentes OEs, incluindo árvore de chá, niaouli, tomilhos, cajeput e orégão, em espécies de Candida resistentes aos antifúngicos convencionais. Os resultados evidenciaram a eficácia dos OEs na inibição do crescimento e na prevenção de biofilmes, confirmando o seu potencial como terapias alternativas. Outro parâmetro avaliado foi a variabilidade na eficácia de diferentes OEs que pertencem ao mesmo género, o que destaca a importância de considerar as características químicas específicas de cada OE. No contexto do tratamento da candidíase vulvovaginal (CVV), o foco deste trabalho, os OEs mostraram atividade antifúngica significativa, especialmente na prevenção de biofilmes formados por espécies resistentes relacionadas à CVV. De modo a mimetizar o ambiente vaginal in vitro, foram otimizadas as condições experimentais através da utilização de fluído vaginal sintético. Adicionalmente, foi explorado o impacto da VF-OE na microbiota vaginal, evidenciando a sua eficácia contra Candida sem perturbações significativas na restante microflora, nomeadamente na espécie de Lactobacillus . O óleo essencial de orégão (OEO) destacou-se pela sua notável eficácia antifúngica contra espécies de Candida resistentes a antifúngicos, interferindo com a integridade da membrana e com a atividade metabólica. No entanto, a sua aplicação clínica pode ser desencorajada, devido à possível toxicidade. Nesta perspetiva, foram apresentadas abordagens seguras para a sua aplicação no tratamento da CVV, como a FV-EO e o EO-MCQ. A aplicação intravaginal, in vivo , de OEO-QMC num modelo animal resultou na diminuição do crescimento de Candida albicans , não afetando o crescimento da espécie Lactobacillus presente. Em conclusão, esta tese destaca o potencial dos OEs, particularmente o óleo essencial de orégão, como terapias alternativas para infeções provocadas pela espécie Candida . Os métodos de aplicação propostos, VF-EO e OE-MCQ, oferecem possibilidades promissoras para um tratamento seguro e eficaz. As características naturais dos OE apresentam vantagens como menor custo, fácil acesso e menor impacto negativo na saúde da mulher, preservando a saúde vaginal. Palavras-chave: Aplicações fitoterapêuticas; Biofilmes de Candida ; Especies resistentes de Candida ; Fase de vapor dos óleos essenciais; Microencapsulação.
vi Essential oils as an alternative treatment for vaginal candidiasis| ABSTRACT The increasing prevalence of fungal infections, especially those caused by Candida species, underscores the need for more effective and less toxic therapies. Conventional antifungals have limitations such as notable side effects and inadequate fungicidal efficacy, contributing to the emergence of drug-resistant species. In this perspective, essential oils (EOs) emerge as promising alternatives. This study introduces two innovative methods of EOs application: vapor-phase (VP-EO) and encapsulation in keratin microcapsules (EO-KMP). These methods aim to overcome limitations of EOs, maximizing their therapeutic potential. Several EOs, including tea tree, niaouli, thyme, cajeput and oregano, were evaluated against drug-resistant Candida species. The results demonstrate the effectiveness of these EOs in inhibiting growth and preventing biofilms, confirming their potential as alternative therapies. Another investigated parameter was the variability in EO effectiveness within the same genus, emphasizing the importance of considering the specific chemical characteristics of each EO. In the context of vulvovaginal candidiasis (VVC) treatment, the focus of this work, EOs exhibited significant antifungal activity, especially in preventing biofilms formed by drug-resistant species related to VVC. In order to mimic the in vitro vaginal environment, experimental conditions were optimized using synthetic vaginal fluid. Additionally, the impact of VP-EO on the vaginal microbiota was explored, demonstrating its efficacy against Candida without significant disturbances to the remaining microflora, such as Lactobacillus species. Oregano essential oil (OEO) stood out for its remarkable antifungal efficacy against drug-resistant Candida species, interfering with membrane integrity and metabolic activity. However, its clinical application may be discouraged due to potential toxicity. In this perspective, safe approaches for its application in VVC treatment were presented, VP-EO and EO-KMP. Importantly, in vivo intravaginal application of OEO-KMP resulted in a decrease in the growth of Candida albicans while maintaining the presence of Lactobacillus species. In conclusion, this thesis underscores the potential of EOs, particularly OEO, as alternative therapies for Candida - induced infections. The proposed application methods, VP-EO and EO-KMP, offer promising possibilities for safe and effective treatment. The natural characteristics of EOs present advantages such as lower cost, easy accessibility, and fewer negative impacts on women's health, preserving vaginal health. KEYWORDS: Candida biofilms; Microencapsulation; Phytotherapeutic applications; Resistant Candida species Vapor-phase of essential oil.
vii TABLE OF CONTENTS List of figures…………………………………………………………………………………………………………………….xiv List of tables……………………………………………………………………………………………………………….…… xxii List of abbreviations, acronyms and simbols……………………………………………………………………………xxv Thesis overview………………………………………………….……………………………………….………….…….. xxviii Scope of thesis…………………………………………………………………………………………………………………xxix Aim of the thesis………………………………………………………………………………………………………….……xxx Outline of the thesis…………………………………………………………………………………………………………..xxxi Outputs……………………………………………………………………………………………………………………….. xxxiii Chapter I. General Introduction…………………………………………………………………………………………….. 1 Chapter I.1 Essential oils as alternative treatment to Candida infection: review………………….……2 1. Introduction ....................................................................................................................................... 3 2. Candidiasis, Candida species and its characteristics………………………………………………………......... 4 3. Conventional antifungal agents and Mechanism of resistance ........................................................... 9 4. Brief overview of alternative therapies for Candida infection ............................................................. 12 4.1 Alternatives treatments based on natural products…………………………………………………………13 4.1.1 Essential oil antifungal effect ............................................................................................ 15 4.1.1.1 Melaleuca alternifolia (Tea Tree Essential Oil (TTEO)) ............................................... 16 4.1.1.2 Melaleuca quinquenervia (Niaouli Essential Oil) ........................................................ 17 4.1.1.3 Melaleuca leucadendra (Cajeput Essential Oil) ......................................................... 18 4.1.1.4 Thymus species (Thyme Essential Oil) ...................................................................... 19 4.1.1.5 Origanum species (Oregano Essential Oil) ................................................................ 19 4.1.2 Encapsulated essential oil on Candida species ................................................................. 20 5. Conclusion ....................................................................................................................................... 25 General Introduction: References………………………………………………………………………………………. .. 27 Chapter II. Effect of essential oils on drug-resistant Candida strains………….…………………………………36 Chapter II.1 Essential oils as a good weapon against drug-resistant Candida auris …………… ….. 37
xiv LIST OF FIGURES Figure 1. Workflow of the thesis (Created with BioRender.com (KW26ABVIPV))……………………………. xxviii Chapter I. General Introduction Chapter I.1 Essential oils as alternative treatment to Candida infection: review Figure 2. Subchapter I.1 workflow……….…………………..………………………………………………………………2 Figure 3. Biofilm formation stages. (A) Initial adhesion; (B) Proliferation and formation of an extracellular matrix; (C) Mature biofilm with continuous growth and (D) Propagation through the release of fungal cells (adapted from Araújo et al . [35])……………………………………………………………………………………………..6 Figure 4. Biofilm Structure of Candida species. Candida albicans (A) Blastospores shaped cells and (B) Filamentous forms (hyphae or pseudo hyphae); (C) Candida glabrata ; (D) Candida tropicalis ; (E) Candida guilliermondii ; (F) Pichia kudriavzevii ; (G) Candida parapsilosis ; (H) Candida auris . Images obtained with scanning electron microscopy and adapted from Fernandes et al . [39], Araújo et al . [35] and Kean et al . [40]…………………………………………………………………………………………………………………………………..7 Figure 5. Mechanism of action of antifungals against Candida species and main mechanisms drug resistance (Adapted from Gómez-Gaviria et al . [42]). Green squares indicate mechanism of action of antifungals and red squares resistance mechanisms…………………………………………………………………..9 Figure 6. Images of plants of the genus Myrtaceae : (A) Melaleuca alternifolia , (B) Melaleuca quinquenervia and (C) Melaleuca leucadendra …………………………………………………………………………………………….16 Figure 7. Images of plants of the Lamiaceae family, (A) Thymus species and (B) Origanum species……………………………………………………………………………………………………….……………………18 Chapter II. Effect of essential oils on drug-resistant Candida strains Chapter II.1 Essential oils as a good weapon against drug-resistant Candida auris Figure 8. Subchapter II.1 workflow……………….………………….……………………………………………………37
xv Figure 9. Glass system: (A) well, (B) well and petri dishes and (C) petri dishes and glass well inside glass petri dishes.……………………………………………………………………………………………………………………...41 Figure 10. Antifungal activity of essential oils on Candida auris NCPF 8971 evaluated using the diskdiffusion assay. **** p < 0.0001 indicates a statistically different reduction in comparison with the control (Tukey`s multiple comparison test).………………………………………………………………………………………44 Figure 11. Antifungal effect of four essential oils (tea tree, niaouli, white thyme and cajeput) in (A) biofilm formation and (B) 24 h-old biofilms of Candida auris NCPF 8971 by quantification of CFUs per mL. Error bars indicate the respective standard derivation (SD). *** p < 0.001, **** p < 0.0001 indicates a statistically different reduction in comparison with the control (Tukey`s multiple comparison test).……………………………………………………………………………………………………………………………….45 Chapter II.2 Comparing the effect of Thymus species essential oils no Candida auris Figure 12. Subchapter II.2 workflow………………………………..……………………………………………………..48 Figure 13. Assessment of the susceptibility of Candida auris NCPF 8971 24 h old biofilms to different essential oils from Thymus genus by quantification of CFUs per mL. Each essential oil was tested at 100 % and at 50 % with both (A) direct and (B) indirect application. Error bars indicate the respective standard derivation (SD). Differences in mean Log10 CFU mL-1 of the different treatments were compared to the control using one-way ANOVA with a post hoc Tukey test (significance at P<0.05), with ** P< 0.01, *** P< 0.001 and **** P< 0.0001………………………….….…………………………………………………………54 Chapter II.3 Vapor-phase of essential oils as promising solution to prevent Candida vaginal biofilms caused by antifungal resistant strains Figure 14. Subchapter II.3 workflow …………………………………..……………………………………………….….57 Figure 15. Vapor-phase of essential oils (VP-EOs) cytotoxicity, expressed as the percentage of viable cells in relation to the absorbance values (OD 490 nm) of cells cultured without VP-EOs (100 % cell viability). The dashed line stands for the normative limit of 70 % metabolic activity (ISO 10993-5:2009)…………….66 Figure 16. Effect of the vapor-phase of tea tree essential oil (VP-TTEO) on the biofilm formation of antifungal-resistant Candida isolates. Biofilms of Candida albicans Ca2, Candida guilliermondii Cgi1,
xvi Candida glabrata Cg7 and Candida krusei Ck1 were developed in the absence (control) and presence of the VP-TTEO. (A) Number of cultivable cells (Log CFUs mL-1); (B) Absorbance values of Crystal Violet solutions (Abs CV) and (C) Absorbance values of XTT solutions (Abs XTT). * indicate statistical reduction of biofilms cell cultivability in comparison with the respective control (* p< 0.1, ** p< 0.01, *** p< 0.001, **** p< 0.0001). (D) Scanning electron microscope (SEM) images. The bar represents 30 µm (lower magnification image) or 10 µm (higher magnification image)………………………………………………………69 Figure 17. Effect of the vapor-phase of tea tree essential oil (VP-TTEO) on pre-formed biofilms of antifungalresistant Candida isolates. Biofilms of Candida albicans Ca2, Candida guilliermondii Cgi1, Candida glabrata Cg7 and Candida krusei Ck1 were developed in the absence (control) and presence of the VPTTEO. (A) Number of cultivable cells (Log CFUs mL-1); (B) Absorbance values of Crystal Violet solutions (Abs CV) and (C) Absorbance values of XTT solutions (Abs XTT). * indicate statistical reduction of biofilms cell cultivability in comparison with the respective control (* p< 0.1, ** p< 0.01, *** p< 0.001, **** p< 0.0001). (D) Scanning electron microscope (SEM) images. The bar represents 30 µm (lower magnification image) or 10 µm (higher magnification image)………………………………………………………70 Chapter III. Vaginal microbiota conditions Chapter III.1 Simulated Vaginal Fluid: Candida resistant strains’ biofilm characterization and vapor-phase of essential oil effect Figure 18. Subchapter III.1 workflow………………………………….……………………………………………………79 Figure 19. Simulated Vaginal Fluid (SVF) and Sabouraud Dextrose Broth (SDB) on vaginal Candida isolates planktonic cells. Planktonic growth curves of (A) Candida albicans Ca2, (B) Candida guilliermondii Cgi1, (C) Candida glabrata Cg7 and (D) Candida krusei Ck1 cells cultivated in SVF and SDB over 24 h…………85 Figure 20. Biofilm formation of antifungal-resistant Candida isolates in Simulated Vaginal Fluid (SVF) and Sabouraud Dextrose Broth (SDB). Number of cultivable cells (Log CFUs cm-2 ) for (A) 24 h and (B) 48 h. * indicate statistical reduction of biofilms cell cultivability in comparison with the respective control (* p< 0.1, ** p< 0.01, *** p< 0.001, **** p< 0.0001) (Dunnett's multiple comparisons test)……………………..86
xvii Figure 21. Scanning Electron Microscope (SEM) observations of biofilms formation structure (24 h) of antifungal-resistant Candida isolates in (A) Sabouraud Dextrose Broth (SDB) and (B) Simulated Vaginal Fluid (SVF). Magnification: 5,000×. Scale bar=30 μm………………………………………………………………86 Figure 22. Effect of the vapor-phase of essential oils (oregano (VP-OEO) and white thyme (VP-WTEO)) on (A) biofilm formation and (B) pre-formed biofilms of antifungal-resistant Candida isolates. Biofilms of Candida albicans Ca2, Candida guilliermondii Cgi1, Candida glabrata Cg7 and Candida krusei Ck1 were developed in the absence (control) and presence of the VP-EOs. * indicate statistical reduction of biofilms cell cultivability in comparison with the respective control (* p< 0.1, ** p< 0.01, *** p< 0.001, **** p< 0.0001)……………………………………………………………………………………………………………………………88 Chapter III.2 Vapor-phase of white thyme essential oil effect on Candida albicans and Lactobacillus gasseri colonization in a reconstituted human vaginal epithelium Figure 23. Subchapter III.2 workflow……………………………………….………………………………………..……90 Figure 24. The standard calibration curve of threshold cycle (CT) values vs Log number of cells………..96 Figure 25. Vapor-phase of white thyme essential oil (VP-WTEO) toxicity measured in in vivo Galleria mellonella model. Survival curves of G. mellonella larvae exposed to VP-WTEO and respective control (without exposure to VP-WTEO). There was no significant difference between control and VP-WTEO exposure…………………………………….……………………………………………………………………………………97 Figure 26. Effect of the vapor-phase of white thyme essential oils (VP-WTEO) on the biofilm formation and pre-formed biofilm of antifungal-resistant Candida albicans Ca2. (A) Biofilm biomass (Abs CV) and (B) metabolic activity (Abs XTT). * indicate statistical reduction of biofilms cell cultivability in comparison with the respective control (* p < 0.1, ** p < 0.01, *** p < 0.001, **** p < 0.0001)……………………………………99 Figure 27. Effect of the vapor-phase of white thyme essential oil (VP-WTEO) on single and co-colonization of Candida albicans with Lactobacillus gasseri of the reconstituted human vaginal epithelium (RHVE) after 24 h. (A) Number of cells (Log cells/ tissue) on single and mixed colonization in relation to the treated RHVE (VP-WTEO). * indicate statistical reduction of number of cells in comparison with the respective control (*** p< 0.001, **** p< 0.0001). (B) Relative lactate dehydrogenase (LDH) activity measured in the culture supernatants after 24 h of single and co-colonization in relation to simulated vaginal fluid (&) and VP-WTEO effect (*). */& indicate statistical reduction of LDH activity in comparison with the respective
xviii control (*/& p< 0.1, ***p< 0.001)…………………………………………………………………………………………100 Figure 28. Effect of the vapor-phase of white thyme essential oils (VP-WTEO) on single and mixed colonization of Candida albicans and Lactobacillus gasseri in reconstituted human vaginal epithelium (RHVE) after 24 h. Image acquired by epifluorescence microscopy. The bar represents 50 µm and 20 µm……..…………………………………………………………………………………………………………………………101 Chapter IV. Effect of oregano essential oil in Candida infection Chapter IV.1 Effect of vapor-phase of oregano essential oil on resistant Candida species biofilms: mechanisms of action Figure 29. Subchapter IV.1 workflow ……………………………………………………..…………………………….110 Figure 30. Toxicity of the vapor-phase of oregano essential oil (VP-OEO) measured in a Galleria mellonella model. (A) Survival curves of G. mellonella larvae exposed to VP-OEO and the respective controls (without exposure to VP-OEO). (B) Total numbers of hemocytes counted in G. mellonella larvae after 4 and 72 h of exposure and those unexposed to VP-OEO…………………………………………………………………………118 Figure 31. Effect of the vapor-phase of oregano essential oil (VP-OEO) on biofilm formation and preformed biofilms of the antifungal-resistant Candida isolates (A) Candida albicans Ca2 and (B) Candida glabrata Cg8. * indicate a statistically significant reduction in biofilm cell cultivability in comparison with the respective controls (*, P < 0.1; **, P < 0.01; ***, P < 0.001; ****, P < 0.0001)……………….……………123 Figure 32. Effects of the vapor-phase of oregano essential oil (VP-OEO) on (A) biofilm formation and (B) preformed biofilms of Candida albicans Ca2. Evaluated by a (1) time-killing assay, (2) cell viability, and (3) metabolic activity (an SI of <1 indicates metabolic activity). (C) Confocal laser scanning microscopy images of C. albicans Ca2 biofilms (biofilm formation and preformed biofilms) after 12 h of exposure to VP-OEO. CLSM images show the staining patterns for live cells (SYTO-9 [green]) and dead cells (propidium iodide [red]). * indicate a statistically significant reduction in biofilm cell cultivability compared to that at the previous time point (* p< 0.1; ** p < 0.01; *** p < 0.001; **** p< 0.0001)……………..……………..125 Figure 33. Effects of the vapor-phase of oregano essential oil (VP-OEO) on (A) biofilm formation and (B) preformed biofilms of Candida glabrata Cg8 . Evaluated by a (1) time-killing assay, (2) cell viability, and (3) metabolic activity (an SI of <1 indicates metabolic activity). (C) Confocal laser scanning microscopy
xix images of C. glabrata Cg8 biofilms (biofilm formation and preformed biofilms) after 12 h of exposure to VP-OEO. CLSM images show the staining patterns for live cells (SYTO-9 [green]) and dead cells (propidium iodide [red]). * indicate a statistically significant reduction in biofilm cell cultivability compared to that at the previous time point (* p< 0.1; ** p < 0.01; *** p < 0.001; **** p< 0.0001)……………………..……..125 Figure 34. Effect of the vapor-phase of oregano essential oil (VP-OEO) on Candida species infection of the reconstituted human vaginal epithelium (RHVE). (A) Candida albicans Ca2 and Candida glabrata Cg8 infection of the RHVE and effect of VP-OEO after 24 h. (B) C. albicans Ca2 and C. glabrata Cg8 infection of the RHVE after 24 h (Log CFU per milliliter). (C) Relative lactate dehydrogenase (LDH) activity measured in the RHVE culture supernatant after 24 h of incubation with the C. albicans Ca2 and C. glabrata Cg8 strains compared to the untreated epithelium (without VP-OEO) and effect of VP-OEO compared to simulated vaginal fluid. * indicate a statistically significant reduction in biofilm cell cultivability in comparison with that of the respective control (*** p< 0.001; ****p < 0.0001)………………………………128 Chapter IV.2 Design and evatuation of microencapsulated oregano essential oil as an alternative treatment to Candida albicans infection Figure 35. Subchapter IV.2 workflow (Created with BioRender.com (BT26ABXE9C))……………..………130 Figure 36. The standard calibration curve of oregano essential oil (OEO) in ethyl acetate………………..134 Figure 37. The standard calibration curve of oregano essential oil (OEO) in simulated fluid vaginal (SFV)………………………………………………………………………………………………………………………….…134 Figure 38. Characterization of keratin microparticles prepared in Phosphate-buffered saline (PBS) encapsulating oregano oil (OEO-KMP´s) for 5 months (155 days). (A) particle size (Z-average) and polydispersity (PDI); (B) surface charge (zeta-potential). *indicate statistical difference in particle size when compared to the results obtained at time 0 (initial conditions) (*p< 0.1, **p< 0.01, ****p< 0.0001)….140 Figure 39. In vitro release profiles of oregano essential oil from keratin-based particles in simulated vaginal and sweat fluids, over 72 h. * indicate statistical difference compared to the results obtained at time 0 h (*p< 0.1, **p< 0.01, ***p< 0.001, ****p< 0.0001)………………….………………………………………………141 Figure 40. Keratin microparticles encapsulating oregano oil (OEO-KMP´s) cytotoxicity measured in Galleria mellonella model. (A) Survival curves of G. mellonella larvae in contact with OEO-KMP´s and
xx respective controls (without exposure to OEO-KMP´s and KMP´s) during 72 h; and (B) G. mellonella larvae health index after 24, 48 and 72 h in contact with OEO-KMP´s and respective controls………143 Figure 41. Effect of the keratin microparticles encapsulating oregano oil (OEO-KMP´s) on single and mixed infection of Candida albicans with Lactobacillus gasseri . (A) Single infection of C. albicans ; (B) Mixed infection ( C. albicans) ; (C) Mixed infection ( L. gasseri). *indicate statistical reduction of biofilms cell cultivability in comparison with the respective control (**p< 0.01, *** p< 0.001, **** p< 0.0001)……144 Figure 42. Effect of OEO-KMP´s on mice model of vaginal candidiasis. (A) Timeline of Candida albicans infection and OEO-KMP´s treatment of mice; (B) Mice weight according to the timeline of infection; (C) C. albicans and Lactobacillus cells detected in mice vaginal lavage fluid (Log CFU mL-1) represented is the median with 95 % confidence interval (*p < 0.05); (D) Histological images of vaginal tissue stained with periodic acid-Schiff (PAS), increasing magnification along the column: I. Mice uninfected (negative control); II. Mice infected with C. albicans , untreated (positive control); III. Mice infected with C. albicans , treated with OEO-KMP´s for 24 h after infection. (a) layer of superficial squamous epithelial cells, (b) basal membrane, (c) lamina propria (d) vaginal lumen, (e) and (f) C. albicans cells and (g) neutrophils. The results were registered under 10x and 20x magnification. The data presented in this study are representative of at least two independent experiments……………………………………………………………146 Annex I. Material supplementary Annex I Figure 43. Chromatographic profile (polar column) obtained for the tea tree essential oil (Lot 903025).168 Figure 44. Chromatographic profile (non-polar column) obtained for the tea tree essential oil (Lot 903025)………………………………………………………………………………………………………………………..169 Figure 45. Chromatographic profile (polar column) obtained for the cajeput essential oil (Lot 801736).171 Figure 46. Chromatographic profile (non-polar column) obtained for the cajeput essential oil (Lot 801736)………………………………………………………………………………………………………………………..172 Figure 47. Chromatographic profile obtained for the niaouli essential oil (Lot 100378)…………………….174 Figure 48. Chromatographic profile (polar column) obtained for the white thyme essential oil (Lot
xxi 800180)…………………………………………………………………………………………………………………….….176 Figure 49. Chromatographic profile (non-polar column) obtained for the white thyme essential oil (Lot 800180)………………………………………………………………………………………………………………..………177 Figure 50. Chromatographic profile obtained for the oregano essential oil (Lot 10468)……………………179 Annex III Figure 51. Histological images of vaginal tissue of mice infected with C. albicans without any vaginal treatment or lavage, stained with periodic acid-Schiff (PAS), increasing magnification along the column. The results were registered under 10x and 20x magnification. The data presented in this study are representative of at least two independent experiments……………………………………………………………182
xxii LIST OF TABLES Chapter I. General Introduction Chapter I.1 Essential oils as alternative treatment to Candida infection: review Table 1. Essential oil encapsulation against Candida species, information about several factors that can influence the antifungal effect of the formulations. Encapsulation structure, particle size (nm), polydispersity (PDI), zeta potential (mV), encapsulation efficiency (% EE) an cytotoxicity………….............21 Chapter II. Effect of essential oils on drug-resistant Candida strains Chapter II.1 Essential oils as a good weapon against drug-resistant Candida auris Table 2. Identification of the component of tea tree, cajeput, niaouli and white thyme essential oils expressed as a percentage (%) of individual compound in the total essential oil sample………………….....43 Chapter II.2 Comparing the effect of Thymus species essential oils no Candida auris Table 3. Chromatography analysis of the composition of essential oils from Thymus vulgaris , Thymus zygis , Thymus satureioides and Thymus mastichina , here shown in percentage (%)………………………….52 Table 4. Diameter of the inhibition zone, in mm, of the essential oils from different plants of Thymus genus (10 µL) for Candida auris NCPF 8971…………………………………………………………………………..53 Chapter II.3 Vapor-phase of essential oils as promising solution to prevent Candida vaginal biofilms caused by antifungal resistant strains Table 5. List of vaginal isolates used in this study and respective data, including species, features of the women at the moment of sample collection and minimum inhibitory concentration (MIC) of fluconazole, ketoconazole and caspofungin for each isolate…………………………………………………………………………62 Table 6. AntiCandida activity of essential oils on drug-resistant isolates evaluated through the diskdiffusion method………………………………………………………………………………………………………………..67
xxiii Chapter III. Vaginal microbiota conditions Chapter III.2 Vapor-phase of white thyme essential oil effect on Candida albicans and Lactobacillus gasseri colonization in a reconstituted human vaginal epithelium Table 7. Primers for real time-PCR assay for quantification of Candida albicans and Lactobacillus gasseri cells in reconstituted human vaginal epithelium……………….………………………………………………………95 Table 8. AntiCandida activity of white thyme essential oil on drug-resistant vaginal isolates. Results obtained from the agar disk diffusion method and zones of inhibition measured through the diameter of the halo (Dhalo) in millimeters (mm)………………………………………………………………………………………….98 Chapter IV. Effect of oregano essential oil in Candida infection Chapter IV.1 Effect of vapor-phase of oregano essential oil on resistant Candida species biofilms: mechanisms of action Table 9. Primers for real time-PCR assay for quantification of Candida albicans and Candida glabrata cells………………………………………………………………………………………………………………………………117 Table 10. AntiCandida activity of oregano essential oil on drug-resistant isolates evaluated through the disk-diffusion method by contact direct (DC-OEO) and vapor-phase (VP-OEO)………………………………119 Table 11. Compounds identified (%) in oregano essential oil, and their characteristics, such as vapor pressure (mm Hg), water solubility (mg L-1) and Log Kow……………………………………………………..………120 Chapter IV.2 Design and evatuation of microencapsulated oregano essential oil as an alternative treatment to Candida albicans infection Table 12. Characterization of keratin microparticles prepared in Phosphate-buffered saline (PBS) encapsulating oregano oil (OEO-KMP´s) when in contact with simulated vaginal fluid and simulated sweat fluid for 72 h. * indicate statistical difference in particle size when compared to the results obtained at time 0 (Figure 38) (**** p< 0.0001)…………….………………………………………………………………………142 Table 13. Histopathological evaluation of vaginal irritation after infection and 24 h of rectovaginal application of PBS (positive group) or OEO-KMP’s. Score interpretation: minimal (1–4), mild (5–8),
xxx AIM OF THE THESIS| THESIS OVERVIEW The increasing incidence of Candidiasis, along with the associated negative consequences and the growing inefficacy of conventional antifungal drugs, make it crucial to increase knowledge about therapeutic alternatives for the treatment of vaginal Candida infections. This research aims to respond to the urgent need for a more effective and non-toxic treatment for Vulvovaginal Candidiasis (VVC), considering the limitations of current therapeutic approaches. The key hypothesis guiding this research is that essential oils (EOs) have broad-spectrum activity against drug-resistant Candida species, including when these species form more complex structures, such as biofilms. In addition, it is suggested that these EOs are safe and more effective in relieving the symptoms of candidiasis compared to common antifungal drugs. Therefore, the main goal of this thesis is the development and validation of a new, effective, and non-toxic treatment for VVC, using essential oils (EOs) in their vapor-phase or in their encapsulated form, overcoming the limitations of current antifungal medications. So, this research aligns with the current health research priorities and has significant implications for women's reproductive health and overall well-being.
xxxi OUTLINE OF THE THESIS| OVERVIEW The present thesis reports the works performed at the Centre of Biological Engineering of University of Minho integrated in the biofilm research group under the coordinated of Professor Doctor Mariana Henriques and Doctor Maria Elisa Rodrigues, with part of research carried out at the Pathology Department of the Faculty of Medicine of the University of Porto under the coordination of Doctor Ana Sofia Quinta e Costa Neves de Oliveira. This work was also guided by the suggestions and clinical evidence provided by Doctor Raquel Costa from the Costa Raquel, Aromas Aqua Spa–Health Clinic. One of the tasks developed during the thesis was carried out in collaboration with the Bioprocesses and Bionanotechnology group from the Centre of Biological Engineering, under the supervision of Doctor Artur Ribeiro. Another part of the work was developed at the National Institute of Agricultural and Veterinary Research in Vila do Conde, under the supervision of Doctor Sónia Silva. A scientific collaboration was established with Doctor Lorena Cussó from the Instituto de Investigación Sanitaria Gregorio Marañón (Madrid, Spain). The present thesis is divided into five chapters, briefly: • Chapter I: General Introduction In the first chapter is provide an overview of the latest information concerning novel alternative strategies being explored for the treatment of Candida infections. Special attention is given to natural therapies, plant extracts, and essential oils, as well as their incorporation into controlled delivery systems, such as micro and nanocapsules. • Chapter II: Effect of Essential oils on Drug-resistant Candida Strains The second chapter reports the research carried out to evaluate the effect of different essential oils against Candida auris , an emerging Candida species, and drug-resistant Candida vaginal isolates, in both planktonic and biofilm states. For this, an in vitro screening of EOs was carried out and the most effective essential oils were identified. • Chapter II.1: Impact of Essential Oils on Candida auris . The first part of this chapter outlines the experiments performed to determine the effect of four essential oils, namely tea tree, niaouli, white thyme and cajeput against Candida auris . • Chapter II.2: Variations in the Effects of Essential Oils from the Same Genus on Candida auris. Continuing with the exploration of Candida auris, the second part of this chapter investigates how essential oils derived from the same genus, such as Thymus vulgaris,
xxxii Thymus zygis, Thymus satureioides and Thymus mastichina , can exhibit diverse effects against Candida auris species. • Chapter II.3: Antifungal Activity of Essential Oils on Drug-Resistant Candida Vaginal Isolates. The third part of this chapter presents the work carried out to evaluate the antifungal properties of essentials oils (tea tree, niaouli, white thyme, and cajeput) on drug-resistant Candida vaginal isolates. • Chapter III: Optimization of the methodology to mimic the conditions of the vaginal microbiota. The third chapter consisted of optimizing the conditions in order to mimic the vaginal conditions as much as possible, providing a better understanding of the antifungal behavior of essential oils. • Chapter III.1: Simulated Vaginal Fluid. In the first part of this chapter, the most appropriate culture medium that is similar to vaginal conditions was defined and optimized. • Chapter III.2: Essential oil effect induced in Lactobacillus species. In the second part of this chapter was observed how the chosen therapeutic approach, essential oils, impacts the beneficial species within the vaginal microflora, such as Lactobacillus species. • Chapter IV: Effect of oregano essential oil in Candida infection The fourth chapter is dedicated entirely to the research conducted with oregano essential oil, as it emerged as the most promising among the several essential oils examined in this thesis. • Chapter IV.1: Impact of Oregano Essential Oil and Its Vapor-Phase on AntifungalResistant Candida Species. The initial section of this chapter focuses on evaluating the effect of oregano essential oil and its vapor-phase on antifungal-resistant Candida species ( Candida albicans and Candida glabrata ), aiming to elucidate its mode of action. • Chapter IV.2: Keratin-Loaded Nanoparticles with Oregano Essential Oil. The second part of this chapter involves the design, production and characterization of microparticles of keratin loaded with oregano essential oil as another alternative application of oregano essential oil for the treatment of Candida albicans infection. • Chapter V: General discussion, final remarks and future work. This chapter presents a general discussion and the main conclusions of this thesis and future perspectives for possible future research work.
xxxiii OUTPUTS | OVERVIEW The present dissertation resulted in the publication of six scientific papers, one manuscript is under review and two others are submitted, as described below: • Fernandes L, Ribeiro R, Costa R, Henriques M, Rodrigues ME. Essential Oils as a Good Weapon against Drug-Resistant Candida auris . Antibiotics 2022, Vol 11, Page 977 2022;11:977. • Ribeiro R, Fernandes L, Costa R, Cavaleiro C, Salgueiro L, Henriques M, Rodrigues M.E. Comparing the effect of Thymus spp. essential oils on Candida auris . Ind Crops Prod 2022; 178:114667. • Fernandes L, Ribeiro R, Henriques M, Rodrigues ME. Candida auris , a singular emergent pathogenic yeast: its resistance and new therapeutic alternatives. European Journal of Clinical Microbiology &Infectious Diseases 2022,41(12):1371-1385 • Fernandes L, Gonçalves B, Costa R, Fernandes Â, Gomes A, Nogueira-Silva C, Silva S, Rodrigues ME, Henriques M. Vapor-Phase of Essential Oils as a Promising Solution to Prevent Candida Vaginal Biofilms Caused by Antifungal Resistant Strains. Healthcare 2022, Vol 10, Page 1649 2022;10:1649. • Fernandes L, Costa R, Henriques M, Rodrigues ME. Simulated Vaginal Fluid: Candida resistant strains’ biofilm characterization and vapor phase of essential oil effect. Journal of Medical Mycology 2022:101329. • Fernandes L, Costa R, Silva S, Henriques M, Costa-de-Oliveira S, Rodrigues ME. Effect of VaporPhase Oregano Essential Oil on Resistant Candida Species Biofilms: Mechanisms of Action. Microbiol Spectr 2023;11. • Fernandes L., Costa-de-Oliveira S, Henriques M, Rodrigues ME. Nanoencapsulated essential oil as an alternative treatment for Candida infection: review (under review in the Fungal Biology Reviews) • Fernandes L, Silva I, Costa R, Silva S, Mira Pereira N, Costa-de-Oliveira S, Henriques M, Rodrigues ME. Vapor-phase of white thyme essential oil effect on Candida albicans and Lactobacillus gasseri colonization in a reconstituted human vaginal epithelium (In submission) • Fernandes L, Blázquez E, Tejada A, Ribeiro A, Silva S, Cussó L, Costa-de-Oliveira S, Rodrigues ME, Henriques M. Design and evaluation of microencapsulated oregano essential oil as alternative treatment to Candida albicans infection. (In submission)
xxxiv During the development of this thesis, the following works were presented in congresses: • Fernandes L, Costa-de-Oliveira S, Costa R, Silva S, Henriques M, Rodrigues ME. Effect of vaporphase essential oil on resistant Candida species: Mechanisms of action. Poster presented in FEMS Conference on Microbiology 2022, Belgrade, Serbia. • Fernandes L, Costa R, Silva S, Henriques M, Rodrigues ME. Efeito da fase de vapor de óleos essenciais em Candida albicans e Lactobacillus gasseri aderidos a epitélio vaginal humano reconstituído. Video presented in Congresso internacional em língua portuguesa Microbiologia 2022, Online. • Fernandes L, Costa R, Silva S, Mira Pereira N, Costa-de-Oliveira S, Henriques M, Rodrigues ME. Vapor-phase of white thyme essential oil effect on Candida albicans and Lactobacillus gasseri colonization in a reconstituted human vaginal epithelium. Oral presentation presented in 5TH Congress of Baltic Microbiologists (FEMs grant), 2023, Vilnius, Lithuania. • Fernandes L, Blázquez E, Tejada A., Ribeiro,A, Silva S, Mira N, Cussó L, Costa-de-Oliveira S, Rodrigues ME, Henriques M. Oregano Essential Oil: An Effective and Non-Toxic Approach for prevent or treat Resistant Candida Species. Poster presented in Congress of Microbiology and Biotecnology (FEMs grant),2023, Covilhã, Portugal.
1 CHAPTER I GENERAL INTRODUCTION In recent decades, the incidence of human fungal infections has increased, affecting millions worldwide, with Candida species among the main nosocomial agents. Fungal infections are commonly treated with antifungal drugs, mainly belonging to the azoles, polyenes and echinocandins categories. However, most of these antifungals have several disadvantages, such as the intensity of side effects or a lack of fungicidal efficacy. Therefore, there is a growing need to search for new drugs that are more effective and less toxic compared to those already available. In this regard, therapy based on natural products has emerged, as they have several advantages, including lower costs and adverse reactions, easy access, application in various pathologies and less negative impact on the patient's health. Among these natural products, essential oils (EOs) have been acknowledged as versatile sources for potential therapeutic products, recognized for their multifaceted properties, including antiviral, antileishmanial, anti-inflammatory, antioxidant, antitumor, hepatoprotective, and mainly for its antimicrobial properties. The antifungal activity of EO in Candida species has been the subject of several studies. However, the possible toxicity, strong taste, chemical instability, restricted administration routes and volatility of EOs limit their application. So, nanotechnology is receiving particular attention to overcome these obstacles. The incorporation of a controlled delivery system represents a promising strategy to avoid the problems, making their application safer, protecting EO degradation and prolonging the duration of the agent at the site of action. This approach proves to be a viable choice, particularly in highly complicated environments such as biofilms.
2 CHAPTER I.1 ESSENTIAL OIL AS ALTERNATIVE TREATMENT TO CANDIDA INFECTION: REVIEW Figure 2. Subchapter I.1 workflow. This first chapter aims, firstly, to present an overview of the global situation concerning fungal infections, particularly those induced by Candida species, along with the current therapeutic options available; and secondly, to provide insights into emerging alternative approaches for the treatment of Candida infections, with a specific emphasis on natural therapies, plant extracts and essential oils, as well as their integration into controlled administration systems. This chapter is based on the following manuscript: Fernandes L, Costa-de-Oliveira S, Henriques M, Rodrigues ME. Nanoencapsulated essential oil as an alternative treatment for Candida infection: review (under review in the Fungal Biology Reviews, Manuscript Number: FBR-D-23-00067)
ESSENTIAL OIL AS ALTERNATIVE TREATMENT TO CANDIDA INFECTION: REVIEW | CHAPTER I 3 1. Introduction According to the World Health Organization (WHO), infections continue to be one of the primary causes of death worldwide. Despite considerable advances in science and medicine, it has not yet been possible to control the exponential spread of infectious diseases [1]. The kingdom of fungi has approximately 1.55 million species, of which 500600 can cause infections in humans [2–4]. Following the evolution of medicine and surgical procedures, there is a growing concern regarding fungal healthcare–associated infections [5–7]. Recently, a wide variety of biological agents have been approved for the treatment of cancer or autoimmune diseases, some targeting the inhibition of various host immune response pathways [8]; however, these agents also have the potential to disrupt the body’s immune response that generally protects against pathogens, conferring greater susceptibility to infectious complications [8]. During the last decade, fungal infections induced 11.5 million severe cases and 1.5 million deaths, worldwide [4]. The global market for invasive fungal infections was valued at $ 7.13 billion in 2022 and is projected to reach $ 9.00 billion by 2028 [9]. Among all invasive fungal infections worldwide the genus Cryptococcus, Aspergillus, Mucor, Pneumocystis, Saccharomyces and Candida are responsible for more than 75 % of mortality [4,10]. Most fungi are part of the human microbiome as a commensal organism, however, in immunocompromised hosts, they become opportunistic agents since weakened immune systems cannot fight these pathogens [4]. This change in the microorganism pathogenicity can result from applying more aggressive treatments such as hematopoietic stem cell or organ transplantation, new chemotherapeutic and immunomodulatory agents and invasive devices, especially intravascular central lines [7]. Consequently, the global population of immunocompromised individuals at high risk for fungal infections is rising, accounting for approximately 3 % of the total population [7]. Therefore, the high mortality rates associated with fungal infections are a significant and pressing concern. One of the most recent factors is the COVID-19 pandemic, during which opportunistic fungal infections were documented in COVID-positive hosts [4]. Indeed, coronavirus 2 (SARS-CoV-2) has led to the widespread use of empiric broad-spectrum antimicrobial agents due to the clinical uncertainty that prevailed during the pandemic [11]. This uncontrolled use of antibiotics is a major contributing factor to the increase in microorganism resistance [12]. Fungi can cause several types of illnesses, including asthma or allergies, irritations or infections on the nails and skin, pneumonia (with symptoms resembling tuberculosis or flu), bloodstream infections and meningitis (resulting from outdoor environmental or healthcare exposure) [5,13]. These infections are often underestimated, and their diagnosis is challenging since the symptoms of fungal infections are often resemble those of viral or bacterial infections. This similarity can lead to diagnostic delays and
ESSENTIAL OIL AS ALTERNATIVE TREATMENT TO CANDIDA INFECTION: REVIEW | CHAPTER I 4 misdiagnosis, consequently resulting in delayed or incorrect treatment [5]. In fact, Dr. Hanan Balkhy, WHO Assistant Director-General, stated “Emerging from the shadows of the bacterial antimicrobial resistance pandemic, fungal infections are growing, and are ever more resistant to treatments, becoming a public health concern worldwide” [14]. In this regard, estimates indicate that mortality related to fungal infections may be five times higher than reported [5,6]. Due to the limited antifungal therapies available and the consequent emergence of drug resistance species, coupled with the aforementioned increase in the vulnerable population, morbidity and mortality caused by fungal infections are continuously rising and are an emerging problem [15]. Indeed, the current antifungal therapies are based on inhibition targets and are limited to 4 classes: azoles, polyenes, echinocandins and pyrimidine analogs [15]. So, the high incidence of fungal infections, its negative consequences and the increase of antifungal drug failure treatments make it crucial to drive knowledge on this subject and to invest in more effective and safer alternative therapies. 2. Candidiasis, Candida species and its characteristics Infections caused by Candida fungus are the most common fungal disease, being able to cause mucocutaneous infection (mouth, throat, gut, and vagina) and, in more complicated situations, deepseated or bloodstream (invasive candidiasis) infections [2,6,16]. According to the Centers for Disease Control and Prevention (CDC), the incidence of invasive candidiasis in the United States is approximately 9 cases per 100,000 people, totaling around 25,000 cases per year [9,17]. The associated in-hospital mortality is estimated to be about 25 % [9,17]. Candidiasis in the esophagus is known as Candida esophagitis or esophageal candidiasis and is one of the most common infections in individuals with HIV/AIDS. Typical symptoms of this type of candidiasis include difficulty and pain while swallowing [12]. Candidiasis affecting the throat and mouth is termed oropharyngeal candidiasis or thrush, presenting with a range of symptoms. These may include the presence of white patches on the inner tongue, cheeks, roof of the mouth, and throat, along with soreness, redness, pain, loss of taste, a cottonlike feeling in the mouth, and cracking at the corners of the mouth [18,19]. In contrast to Candida infections in the throat and mouth, invasive candidiasis represents a more severe infection capable of affecting multiple organs and systems, including the brain, bloodstream, heart, bones, and eyes [20]. Candidemia, a bloodstream infection, is a common occurrence in hospitalized patients and is associated with high morbidity and mortality rates in immunosuppressed individuals, HIV, chemotherapy and organ transplant patients [2,6,16]. In such cases, determining associated symptoms can be challenging, as
ESSENTIAL OIL AS ALTERNATIVE TREATMENT TO CANDIDA INFECTION: REVIEW | CHAPTER I 5 invasive candidiasis often occurs in patients with other medical conditions. Nevertheless, the most common symptoms include fever and chills that persist despite antibiotic treatment [20]. Compared to invasive candidiasis, vaginal candidiasis is not as dangerous; however, this infection affects millions of women every year. It is estimated that 7075 % of women experience an episode in their lifetimes [21]. Commonly known as vulvovaginal candidiasis (VVC), Candida vaginitis, or vaginal yeast infection, this condition is primarily caused by Candida species, especially Candida albicans . Infection occurs when vaginal conditions are altered in a way that favors the growth of these microorganisms. The main contributors to this change include broad-spectrum antibiotics, hormones changes, or alterations in the immune system. Pregnancy is also a critical condition for the development of VVC, as it is considered more challenging to eradicate. This may be supported by factors related to pregnancy itself, such as immunological changes, increased estrogen levels and vaginal glycogen production [22]. VCC can be sporadic or recurrent, depending on episodic frequency. Sporadic VVC includes mild to moderate clinical symptoms, such as vaginal and vulvar pruritus, thick secretion, pain, erythema, burning and/or edema, along with external dysuria and dyspareunia [22,23]. Recurrent VVC (RVVC) may be defined as four or more episodes in a 12month period, associated with more severe symptoms [22,23]. RVVC affects approximately 138 million women worldwide annually (with a range of 103– 172 million), resulting in a global annual prevalence of 3871 per 100.000 women. Over the course of their lifetime, 372 million women experience RVVC [23]. In a study conducted by our team, it was observed that women with a history of RVVC infections use non-cotton underwear, over-the-counter antifungals and oral contraceptive pills, factors considered to be significantly higher risk for the development of VVC [21]. Understanding and monitoring the epidemiology of clinically relevant species and their antimicrobial susceptibility patterns is critical to interpreting the significance of antifungal susceptibility test results and guiding the most appropriate therapy [24,25]. However, there is no national or international surveillance for Candida infections and fungal diseases are likely widely underdiagnosed, making the exact number of cases of candidiasis difficult to determine [5,26]. The genus Candida includes about 150 species and 1520 of these species are regularly reported from human infections, mainly in immunosuppressed hosts [2,27]. Candida albicans is responsible for around 8090 % of infections and is the most virulent species in the genus, although non-Candida albicans Candida (NCAC) species (such as Candida tropicalis, Candida glabrata, Candida guilliermondii, Candida parapsilosis, Candida dubliniensis, Candida auris, Candida lusitaniae, Candida nivariensis and Candida krusei ) are becoming frequently implied [2]. The incidence of Candida infection varies according to several
ESSENTIAL OIL AS ALTERNATIVE TREATMENT TO CANDIDA INFECTION: REVIEW | CHAPTER I 12 4. Brief overview of alternative therapies for Candida infection Fungal infections, including candidiasis, are recognized as significant risk factors for various pathologies, such as autoimmune diseases, diabetes, cancer, and chronic inflammatory conditions. To combat these challenges, antibiotics and traditional antifungals persist as essential tools in the battle against infectious diseases [60]. However, adverse effects associated with the use of these antifungal agents have been reported on the stability of the microbiome, and especially the increase of resistant pathogens [60]. In recent years, several investigators have worked on the discovery of more efficient therapies against Candida species, to overcome these challenges. Following this approach and drawing from the literature review conducted by Rodrigues et al . [56], new formulations with potential therapeutic effects against Candida species have been developed. Antifungal agents’ combination (e.g. AmB and pozaconazole/ caspofungin, micafungin and FLC/ voriconazole or liposomal AmB, flucytosine and voriconazole) might improve the antifungal efficacy, with several predictable advantages, which include a wider spectrum and potency of drug activity, synergy, faster antifungal effect, lower dosing of toxic drug and reduced risk of antifungal resistance [56]. In fact, the first clinical application of this therapy for invasive candidiasis involved the use of AmB and flucytosine, which was found to induce an additive effect, furthermore research suggests that it reduces the onset of flucytosine resistance [61]. Conversely, the combinations may be antagonistic or clinically indifferent with additive side effects and give a false perception of security [56,62]. In the context of combinational therapies, Hodgetts et al . [63] demonstrated the combination of a human antibody fragment, efungumab, with caspofungin enhanced the activity of this agent in vivo . From this perspective, immunotherapy, consisting of innate and cell-mediated immunity, has been recently investigated and could become a promising tool against disseminated Candida infections. The determination of host defense mechanisms against Candida infections has prompted the development of new immunotherapeutic methods to combat these infections. These methods include the use of recombinant cytokines (e.g., granulocyte-macrophage colony-stimulating factor or interferon gamma), therapeutic antibodies (e.g. efungumab or monoclonal antibodies), vaccination (e.g., diphtheria toxoid CRM197 conjugated with the algal antigen laminarin, mannan protein conjugates or adhesins Als1p and Als3p) and adoptive transfer of primed immune cells (e.g., antigen primed dendritic cells or adoptive transfer of antiCandida T cells) [56]. Another alternative antifungal strategy is photodynamic therapy (PDT). This technique combines a sensitizing drug and visible light. In this treatment, Candida cells are treated with a photosynthetic agent, making them susceptible to death by exposure to an appropriate wavelength of light, promoting a
ESSENTIAL OIL AS ALTERNATIVE TREATMENT TO CANDIDA INFECTION: REVIEW | CHAPTER I 13 phototoxic response of the cells, frequently via oxidative damage, which leads to selective destruction of microbial cells through disarrangements in the cell wall and DNA damage [64]. Also, low-level laser therapy, laser light, has been studied as an alternative antimicrobial treatment, using low doses of visible light with adequate wavelength to the generation of reactive oxygen species (ROS) by activating biological chromophores in cells [56]. Although there are few studies using this technique for the treatment of Candida species, they report a fungicidal effect [56]. In a very different approach, inhibitors application of early Candida yeast adhesion to different surfaces is an important step in the manufacture of innovative medical devices. For this purpose, proteases immobilized on polypropylene, treatment with filastin, the combination of graphene-curcuminpolyethylene glycol oxide and clioquinol have been used [65]. Nanotechnology focused on designing drugs with extended persistence and controlled release have been seen as powerful antiCandida therapeutic alternative. Nitric oxide (NO), Ag–Cu–Co trimetallic, silver, bismuth nanoparticles are some examples applied in the treatment of Candida infections [50]. Incorporation of the drug into a controlled delivery system is a promising alternative; liposomes or nanoliposomes, chitosan or sodium alginate are materials used for this purpose. Moreover, nanoemulsions, known as self-nano emulsifying drug delivery systems, have been shown as an alternative with several advantages such as drug targeting ability, protection against hydrolysis and enzymatic actions, increased drug load and provide better drug dissolution and bioavailability [66]. Despite the advances in the aforementioned alternative therapies, there has been no reduction in the incidence of candida infections worldwide. This lack of progress can be attributed to the inherent challenges associated with their application, possibly decreasing from the complexities involved. In addition, the high cost associated with these therapeutic options is a barrier, preventing their widespread accessibility and adoption, thus limiting their impact on the general population. Consequently, the expected reduction in Candida infections remains elusive, underlining the pressing need for more accessible and practical solutions to address this widespread health problem. 4.1 Alternatives treatments based on natural products The search for relevant alternatives to conventional antimicrobials based on natural products aimed the control of fungal diseases is a focal point of research due to their low toxicity, costs and adverse reactions, easy access and application to several pathologies. Besides, it reduces drastically the risk of induction of antimicrobial resistance, decreasing the negative impact on individual health and the environment [67]. In this sense, it becomes interesting and important to identify compounds and extracts
ESSENTIAL OIL AS ALTERNATIVE TREATMENT TO CANDIDA INFECTION: REVIEW | CHAPTER I 14 from medicinal plants that are active against clinically resistant Candida isolates and that present selectivity to the pathogen [56]. Over the years, many plant extracts and compounds have demonstrated antimicrobial activity against Candida species. However, the investigation of new compounds from plants, covers new, complex and diverse chemical structures, requiring a more complete study before their use as new antifungal agents [56]. In fact, there are a large number of in vitro studies showing the effect of natural compounds on Candida species. Nevertheless, the number of studies that include in vivo assays are more limited. In most of these in vivo studies, the antifungal effect is investigated against C. albicans , including the effect of seaweed ( Dictyota dichotoma ) [68]; Arthrospira platensis , topical cream application, induced mild lysis and vacuolation of cytoplasmic organelles [69] Ambrosia maritima and Bituminaria bituminosa [70]; wild shrub Calotropis procera [71]; synergistic effects of gypenosides, a class of triterpenoid saponins, combined with FLC [72]; Acorus tatarinowii Schott that inhibit biofilm formation by regulation of the C. albicans protein kinase C pathway [73]; and Amukkara Chooram , preventing the transition from yeast to hyphae [74]. Morin and aqueous extract of Tinospora cordifolia showed effect against C. albicans - associated systemic candidiasis, morin exhibited strong affinity to the Hwp-1 protein, which regulates biofilm expression and hyphae formation [75,76]; The effect of some natural compounds for oral candidiasis treatment has also been reported. For instance, the encapsulation of Erodium glaucophyllum extract in synthesized silver nanoparticles exhibited a strong inhibitory effect on the growth and morphogenesis of C. albicans [77]; Cryptocarya moschata [78]; and the hydroalcoholic extract derived from the bark of Anadenanthera colubrina, demonstrated the ability to reduce colony counts within biofilms while inducing structural changes and cellular damage [79]. In the treatment of VVC, the effect of Annona muricata L. and spilanthol, a bioactive alkylamide from Acmella oleracea , significantly reduced the proliferation and adhesion of C. albicans biofilms and their concentration of carbohydrates, proteins and DNA in the matrix [80,81]; water extract of Sapindus mukorossi Gaertn . pericarps decreased interleukin IL-1β, IL-6, IL-8 and lactate dehydrogenase (LDH) in mice infected with C. albicans [82]; a chitosan gel formulated with a methanolic extract from Mitracarpus frigidus exhibited significant efficacy in reducing vulvovaginal fungal burden and associated infections (38); and Anethum graveolens (dill) [84] was demonstrated. Moreover, the effect on several Candida species, including C. albicans, C. krusei, C. parapsilosis, C. glabrata, C. auris and C. tropicalis, has been reported: Syzygium samarangense leaf extracts and
ESSENTIAL OIL AS ALTERNATIVE TREATMENT TO CANDIDA INFECTION: REVIEW | CHAPTER I 15 ethanolic and methanolic extracts of Rosmarinus officinalis and Zingiber officinale [85,86], Salvia kronenburgii Rech. f. and Salvia euphratica Montbret [87] and Camellia sinensis crude extracts [88]. However, apart from this very limited number of studies that include in vivo experiments, studies on the application of natural therapies against more resistant structures such as Candida biofilms are few, focusing on essential oils (EOs) [89]. 4.1.1 Essential oil antifungal effect From the past until today, aromatic plants and their derivatives have been used in traditional medicine to treat several diseases [90,91]. In this sense, EOs and their main components such as thymol, carvacrol and linalool have been suggested as potential sources of new therapeutic products, with fewer side effects, less toxicity and higher biodegradability when compared to available antimicrobial agents [92]. In addition, EOs have multiple biological properties, such as anti-leishmanial, antiviral, antiinflammatory, antioxidant, hepatoprotective, anti-tumor and antimicrobial activities [93,94]. Besides that, they are also used as anti-inflammatory, analgesic, spasmolytic and local anesthetic medicine. Plants are believed to emit a wide variety of volatile organic compounds as a defense against pathogens [95]. In this way, some volatile organic compounds can be refined into EOs via steam distillation [95]. EOs are complex natural mixtures of volatile organic compounds of terpenoid or non-terpenoid origin. Indeed, an oil can contain more than 200 components, including monoterpenes, sesquiterpenes, diterpenes, phenylpropanoids, fatty acids and their esters or their decomposition products [96,97]. Each component displays a variety of mechanisms of action or cellular pathways against microorganisms [98]. The EOs composition, even with the same original species, is influenced by several factors, such as geographical and climatic conditions of production, physical-chemical and biological properties of the soil during plant growth, cultivation practices such as stress and use of fertilizers, storage conditions and light spectrum [59,99,100]. In fact, light quality and quantity during cultivation play an important role in the production and synthesis of EOs and have been shown to affect the volatile compounds in herbs [101]. EOs can be extracted from different parts of plants, such as leaves, flowers, fruits, seeds, roots, shoots, stems and wood by many methods, including expression, fermentation, enfleurage or extraction and steam distillation (most widely adopted) [93,96,98]. Caputo et al. [102] observed that the choice of drying method to obtain the EO is crucial concerning the highest yield and mainly the percentage presence of components that can direct the EO to a suitable use. Thus, the same plant or plants from the same taxon but with specific genetic characteristics can produce chemically distinct EO [103]. Some botanical species produce EOs with substantial differences in intraspecies composition, which are referred to as
ESSENTIAL OIL AS ALTERNATIVE TREATMENT TO CANDIDA INFECTION: REVIEW | CHAPTER I 16 chemotypes of that species. As chemotypes can have different biological activity, it is necessary to specify the chemotype of an EO when applicable [104]. In contrast, EOs shows several physical properties in common, including liquid state, very volatile, limpid (rarely colored), insoluble in water and soluble in organic solvents [97]. Thus, a complete characterization of the composition of EOs before their application is indispensable. Salvo et al. [105] propose multi analytical techniques, evaluation of the variation in the EO content and composition realized by GC and GC-MS analyses, the phenolic fraction analyzed by Ultraperformance liquid chromatography (UPLC) coupled to photodiode array detection (PDA) (UPLC/ PDA) and the inorganic elements by Inductively coupled plasma mass spectrometry (ICP-MS). EOs have been traditionally used for their bioactivity and may represent a valuable therapeutic alternative for Candida infections, particularly in the case of mucocutaneous infections [106,107]. The antifungal activity of EOs in Candida species has been the subject of several studies that confirmed its effect and described its mode of action. Among the commercially available EOs, tea tree (TTEO) ( Melaleuca alternifolia ) and thyme ( Thymus vulgaris ) are the most studied for their antifungal activity [108]. Rajkowska et al [109] demonstrated that although the EOs of thyme, tea tree, peppermint and clove oils have different chemical compositions, they exhibited similar modes of action. Their results indicate that EOs induced the loss of cell membrane integrity in C. albicans . The biological activity profiles indicated that the thyme was the most active regarding DNA leakage, ergosterol binding, and cytotoxicity. The genus Myrtaceae , including for example M. alternifolia , Melaleuca quinquenervia and Melaleuca leucadendra (Figure 6), is one of the most important EOs-producing species, whose EOs have several bioactivities, such as insecticide, antioxidant, antiviral, antibacterial and antifungal [110]. Figure 6. Images of plants of the genus Myrtaceae: (A) Melaleuca alternifolia, (B) Melaleuca quinquenervia and (C) Melaleuca leucadendra. 4.1.1.1 Melaleuca alternifolia (Tea Tree Essential Oil (TTEO)) Native to Australia, M. alternifolia (Figure 6.A), commonly known as tea tree, is distinguished by a diverse chemical composition. It demonstrates a wide spectrum of antimicrobial activity, encompassing
ESSENTIAL OIL AS ALTERNATIVE TREATMENT TO CANDIDA INFECTION: REVIEW | CHAPTER I 17 antifungal properties [111]. The EO from M. alternifolia is known as tea tree (TTEO) and is widely used in medicine as an antiseptic and anti-inflammatory, has a calming effect and stimulates the immune system, reducing contact dermatitis and improves wound healing [112,113]. The principal biologically active compounds of TTEO are terpenoids and terpene, including α-terpinene, terpinene-4-ol, 1,8-cineole and terpinolene [111]. In fact, TTEO can be classified into three major chemotypes: terpinen-4-ol, terpinolene, and 1,8-cineole [112]. The mechanism of action of this EO and its components is related to increasing the permeability and fluidity of the fungus cell membrane. These compounds incorporate into the lipid bilayer membrane, eventually disrupting its structure [113,114]. A recent review by Silva et al . [114] grouped several reports proving that TTEO has antifungal effects in vitro against various Candida species, including C. albicans , C. krusei , C. orthopsilosis , C. lusitaniae , C. parapsilosis and C. tropicalis. Mainly when used topically for the oral candidiasis treatment [114]. The TTEO at a concentration of 0.5 % (v/ v) (MIC50) has the capability to impede the initial adhesion of C. albicans as well as the subsequent stages of its biofilm formation on both abiotic and biotic surfaces. This inhibition includes impeding the formation of germ tubes or mycelial conversion and suppressing respiration [112–114]. In in vivo studies, the reduction of C. albicans colonization in the oral cavity occurred in different sensitivity profiles after applying TTEO [114,115]. In a mouse trial, 4 % (v/ v) of TTEO for 2 days induced a protective action against oral candidiasis by FLC-resistant C. albicans isolates [114,115]. Evidence from nearly 80 years suggests that topical use of TTEO oil is relatively safe. However, published data indicate that TTEO is toxic if ingested at higher concentrations and may also cause skin irritation. Despite this, TTEO and its components are not genotoxic [116]. 4.1.1.2 Melaleuca quinquenervia (Niaouli Essential Oil) M. quinquenervia (Figure 6.B) usually known as the broad-leaved paperbark native to Australia, New Caledonia and the French Pacific Islands, is a medicinal plant known for its applications in aromatherapy, cosmetics, food industry and pharmaceutical preparations for rheumatism, coughs, colds and neuralgia [117,118]. Furthermore, it possesses antifungal activity [118]. The EO of M. quinquenervia , known as niaouli, although less widely recognized than TTEO, has been identified as effective against both gram-positive and gram-negative bacteria, as well as a variety of fungi. Its effectiveness was observed at concentrations similar to those of TTEO [119]. Despite niaouli EO presenting a wide variation in chemical composition, chemical analysis reports 1,8-cineole, p-cymen-8-ol, p-cymene, E-nerolidol and limonene as a major component, depending on chemotypes [113,117,118]. Valková et al . [120] could conclude that the presence of 1,8-cineole (40.8 %) in niaouli EO may contribute significantly to its
ESSENTIAL OIL AS ALTERNATIVE TREATMENT TO CANDIDA INFECTION: REVIEW | CHAPTER I 18 antifungal efficacy. Niaouli EO is generally considered a safe, non-toxic, non-irritant and non-sensitizing oil [121]. 4.1.1.3 Melaleuca leucadendra (Cajeput Essential Oil) M. leucadendra (Figure 6.C), commonly known as weeping paperbark, despite being native to tropical Australia has been widely cultivated in several parts of the world showing different biological properties [122]. The leaves and bark are used in traditional medicine as sedating, tranquilizing and painrelieving agents [122]. Cajeput EO is extracted from the M. leucadendra and used for its calming properties and is also recognized for its respiratory tract cleansing properties [50]. Giang An et al . [123] observed that the EO of M. leucadendra , with α-eudesmol (24.1 %) and guaiol (11.3 %), showed good antibacterial activity against E. faecalis . Furthermore, it showed MIC’s and IC50 between 64256 µg mL-1 and 34128 µg mL-1, respectively, in C. albicans . However, Monzote et al . [122] observed that cajeput EO, with 1,8-cineole (61 %), did not exert activity on E. faecalis , Staphylococcus aureus , Escherichia coli , Aspergillus niger, Pseudomonas aeruginosa and C. parapsilosis. On the other hand, Zhang et al . [110] confirmed that M. leucadendra EO (4-Terpineol is the most abundant component) possesses fungicidal effects on C. albicans, forming mesosome-like structures around the cell membrane and spread across the whole cytoplasm. Furthermore, the synergistic effects of this EO with four drugs from azoles family were observed. This synergistic effect may result from EO-induced membrane damage and permeability alteration facilitating drug penetration [110]. The Lamiaceae family is one of the most widespread and diverse plant families in ethnomedicine (Figure 7). This species is an important source of EOs, with 10 subfamilies, more than 220 genus, and about 3500 species distributed worldwide. Many of these species, including Thymus species and Origanum species, have a wide range of pharmacological activities with the potential to be developed as an alternative to antibiotics [67]. In silico toxicity, research suggests that most of the main compounds of EOs from Lamiaceae species probably do not exhibit mutagenicity, carcinogenicity or cytotoxicity [124]. Figure 7. Images of plants of the Lamiaceae family: (A) Thymus species and (B) Origanum species.
ESSENTIAL OIL AS ALTERNATIVE TREATMENT TO CANDIDA INFECTION: REVIEW | CHAPTER I 19 4.1.1.4 Thymus species (Thyme Essential Oil) The Thymus species (thyme EO) (Figure 7.A) are native to temperate regions in North Africa, Asia and Europe being a popular medicinal plant with several pharmaceutical and therapeutic applications, including bronchiolitic, antiseptic, antispasmodic and antimicrobial, including antifungal [125–127]. Its medicinal potential is associated with its constitution of thymol, carvacrol, flavonoids, aliphatic phenols, eugenol, saponins, flavones, and tetramethoxylated luteolin [125]. Thyme EO has several advantages such as pleasant odor and flavor, low cost and side effects, and insignificant toxicity [125,126]. Thymus species, rich in carvacrol and thymol, such as Thymus pulegioides, Thymus vulgaris (the most common) and Thymus zygis , exhibited a potent antiCandida activity, classified as fungicidal [106,127]. Thymus is an oxygenated phenolic monoterpene, that interferes with the formation and viability of Candida mycelium hyphae and may cause dysfunction of enzymes on the cell membrane and wall, alterations in the cell membrane permeability of the cell membrane leading to wall disruption and, consequently, cell death [128,129]. Alshaikh et al . [125] reported that EO from T. vulgaris reduced the growth of C. albicans isolates and proved that this EO is fungistatic and fungicidal, at very low doses. Thyme EO also inhibited germ tube formation and the displacement of fungal pathogens [125]. 4.1.1.5 Origanum species (Oregano Essential Oil) The genus Origanum (Figure 7.B), which includes 43 species and 18 hybrids, is a perennial herb native to the rocky calcareous and dry soils in mountainous areas, most of which are found in the Western and Southwestern Eurasia and Mediterranean region [95,130]. Considering the naturally high volatility, biodegradability, and ephemeral characteristics of oregano EO (OEO), these compounds have been widely applied as agricultural products, food preservation agents and pharmaceuticals [131]. In contrast to the mode of action of antibiotics, OEOs can significantly reduce microbial resistance through complex mixtures of natural compounds [131]. Hao et al . [131] established a multidimensional analytical method to evaluate differences in chemical profiles and corresponding antibacterial ability from various OEOs. This study showed that OEOs exhibited wide chemodiversity, and three main groups, carvacrol, thymol, and sesquiterpene, were identified. Moreover, OEO groups rich in carvacrol and thymol showed potent inhibitory effects on the growth of common pathogenic bacteria [131]. Cid-Chevecich et al . [132] observed that OEO from O. vulgare L. inhibited morphogenesis, adhesion, and proliferation at least by 50 % for C. albicans ATCC-90029, C. albicans ATCC-10231, C. dubliniensis ATCC-CD36 and C. krusei ATCC-625. In addition, Stringaro et al . [133] demonstrated that the same EO, carvacrol, and thymol cause a reduction in fungal viability, alteration of hydrophobicity and induces damage to both cell wall (confirmed by SEM)
ESSENTIAL OIL AS ALTERNATIVE TREATMENT TO CANDIDA INFECTION: REVIEW | CHAPTER I 20 and cell biomembranes, being associated with the loss of intracellular materials. These authors suggested that these compounds can modify the yeast cell membrane structure by incorporating into the lipid monolayer, forming aggregates of molecules and lipids, and reducing their packing in the membrane monolayers [133]. Kaskatepe et al . [134] suggested that the EO from O. majorana L showed strong antifungal activities against planktonic and biofilm-forming C. albicans cells and had an influence on putative virulence factors, such as germ-tube formation, its length and on cell surface hydrophobicity. These two studies were confirmed on infected Galleria mellonella larvae, demonstrating these bioactive compounds' safety and their relevant antimicrobial activities [133,134]. Although the previously mentioned studies demonstrate that EOs has antimicrobial potential and are a possible substitute for antibiotics, the possible toxicity, strong taste, chemical instability, restricted administration routes and volatility of EO limit its application [131]. In this sense, nanotechnology is receiving particular attention to overcome these obstacles. 4.1.2 Encapsulated essential oil on Candida species The incorporation of a controlled delivery system is a promising strategy to avoid the problems associated with EOs, making their application safer. So, nanoencapsulation of bioactive compounds, such as EOs, is a promising topic of nanotechnology [135]. In fact, this technology allows EOs protection from light and temperature alterations, increasing their solubility in aqueous environments, and improving their bioaccessibility and bioavailability [135]. The methods presented in the literature for the EO encapsulation consist of phase inversion precipitation, solvent evaporation, spray drying, hydrogels and in situ polymerization in the dispersed phase, for example nanoemulsion [136]. The studies related to the EO encapsulation against Candida species are summarized in Table 1, containing information about several factors that can influence the antifungal effect of the formulations, such as encapsulation structure and efficiency, particle size, polydispersity (PDI) and zeta potential.
ESSENTIAL OIL AS ALTERNATIVE TREATMENT TO CANDIDA INFECTION: REVIEW | CHAPTER I 21 Table 1. Essential oil encapsulation against Candida species, information about several factors that can influence the antifungal effect of the formulations. Encapsulation structure, particle size (nm), polydispersity (PDI), zeta potential (mV), encapsulation efficiency ( % EE) and cytotoxicity Encapsulating structure Essential Oil/ bioactive compound Size (nm) PDI zeta potential (mV) % EE Cytotoxicity AntiCandida effect References Physically cross-linked Chitosan/dextrin cryogels Thymus vulgaris W/I W/I W/I W/I W/I ZI: 40 mm C. parapsilosis [137] Methylcellulose hydrogel Melissa officinalis W/I W/I W/I W/I W/I ZI: 17.5 mm C. albicans [138] Polyvinyl alcohol/chitosan/gelatin thermo-responsive hydrogel Zataria multiflora 1100 ± 600 W/I W/I 98.66 High cell viability (over 96 %) MIC90: 128 μL mL-1 C. albicans and C. dubliniensis ; 64 μL mL-1 C. glabrata ; 4μL mL-1 C. krusei , C. tropicalis; 14 μL mL-1 C. parapsilosis [139] Nanoemulsions: tween 20 (emulsifier), and Butanaol (co-emulsifier) Citronella 130 ± 5 0.127 -12.6 95.5 ± 4.8 W/I MIC: 125 µg mL-1 C. albicans [140] Chitosan-aloe vera films Thymol 197–389 0.2 to 0.6 22.836.4 95.3 W/I ZI: 0.51.33 cm2 C. albicans [141] Oil-in-water emulsions: mannosylerythritol lipid B (emulsifier) T. vulgaris 5000 W/I W/I W/I W/I MIC: 125 µg mL-1 C. albicans [142] Lippia sidoides MIC: 250 µg mL-1 C. albicans Cymbopogon citratos MIC: 500 µg mL-1 C. albicans Polyamide nano capsules Campsis radicans (Guaiacol) 138.7 0.23 W/I 86 W/I MIC: 0.133 μg mL-1 MFC: 0.071 μg mL-1 C. albicans [143] Oil-in-water emulsion: Chitosan-based films Lemon 1.44 ± 0.03 W/I W/I 73.8 W/I ZI: 11 mm C. albicans [144] Nanostructured Lipid L. sidoides 213.1445.5 0.3 -93.1 - -63.8 W/I Not evidence toxicity in the in vivo model MIC: 281563 µg mL-1 C. auris [145]
GENERAL INTRODUCTION | CHAPTER I 28 [21] Fernandes Â, Azevedo N, Valente A, et al . Vulvovaginal candidiasis and asymptomatic vaginal colonization in Portugal: epidemiology, risk factors and antifungal pattern. Med Mycol 2022;60. https://doi.org/10.1093/MMY/MYAC029. [22] Disha T, Haque F. Prevalence and Risk Factors of Vulvovaginal Candidosis during Pregnancy: A Review. Infect Dis Obstet Gynecol 2022;2022. https://doi.org/10.1155/2022/6195712. [23] Denning DW, Kneale M, Sobel JD, et al. Global burden of recurrent vulvovaginal candidiasis: a systematic review. Lancet Infect Dis 2018;18:e339–47. https://doi.org/10.1016/S1473-3099(18)30103-8. [24] Castanheira M, Deshpande LM, Messer SA, et al. Analysis of global antifungal surveillance results reveals predominance of Erg11 Y132F alteration among azole-resistant Candida parapsilosis and Candida tropicalis and country-specific isolate dissemination. Int J Antimicrob Agents 2020;55:105799. https://doi.org/10.1016/J.IJANTIMICAG.2019.09.003. [25] Hof H. Developments in the epidemiolgy of invasive fungal infections – implications for the empiric and targeted antifungal therapy. Mycoses 2008;51:1–6. https://doi.org/10.1111/J.14390507.2008.01522.X. [26] Candida infections of the mouth, throat, and esophagus | Fungal Diseases | CDC. https://www.cdc.gov/fungal/diseases/candidiasis/thrush/index.html (accessed May 17, 2023). [27] Gharehbolagh SA, Fallah B, Izadi A, et al . Distribution, antifungal susceptibility pattern and intraCandida albicans species complex prevalence of Candida africana : A systematic review and meta-analysis. PLoS One 2020;15:e0237046. https://doi.org/10.1371/JOURNAL.PONE.0237046. [28] Kołaczkowska A, Kołaczkowski M. Drug resistance mechanisms and their regulation in nonalbicans Candida species. Journal of Antimicrobial Chemotherapy 2016;71:1438–50. https://doi.org/10.1093/JAC/DKV445. [29] Mitchell AP. Microbiology: Fungus produces a toxic surprise. Nature 2016;532:41–2. https://doi.org/10.1038/nature17319. [30] Williams DW, Kuriyama T, Silva S, et al. Candida biofilms and oral candidosis: Treatment and prevention. Periodontol 2000 2011;55:250–65. https://doi.org/10.1111/j.1600-0757.2009.00338.x. [31] Jayatilake JAMS, Samaranayake YH, Cheung LK, et al. Quantitative evaluation of tissue invasion by wild type, hyphal and SAP mutants of Candida albicans , and nonalbicans Candida species in reconstituted human oral epithelium. Journal of Oral Pathology and Medicine 2006;35:484–491. https://doi.org/10.1111/j.1600-0714.2006.00435.x. [32] Costerton JW, Stewart PS, Greenberg EP. Bacterial biofilms: a common cause of persistent infections. Science 1999;284:1318–22. https://doi.org/10.1126/SCIENCE.284.5418.1318. [33] Hajiagha MN, Kafil HS. Efflux pumps and microbial biofilm formation. Infect Genet Evol 2023;112. https://doi.org/10.1016/J.MEEGID.2023.105459. [34] Cuéllar-Cruz M, López-Romero E, Villagómez-Castro JC, et al. Candida species: new insights into biofilm formation. Future Microbiol 2012;7:755–71. https://doi.org/10.2217/fmb.12.48. [35] Araújo D, Henriques M, Silva S. Portrait of Candida Species Biofilm Regulatory Network Genes. Trends Microbiol 2017;25:62–75. https://doi.org/10.1016/J.TIM.2016.09.004. [36] Alonso VPP, Lemos JG, Nascimento M da S do. Yeast biofilms on abiotic surfaces: Adhesion factors and control methods. Int J Food Microbiol 2023;400. https://doi.org/10.1016/J.IJFOODMICRO.2023.110265. [37] Li Y, Huang S, Du J, et al. Current and prospective therapeutic strategies: tackling Candida albicans and Streptococcus mutans cross-kingdom biofilm. Front Cell Infect Microbiol 2023;13:1106231. https://doi.org/10.3389/FCIMB.2023.1106231/BIBTEX. [38] Gaziano R, Sabbatini S, Monari C. The Interplay between Candida albicans , Vaginal Mucosa, Host Immunity and Resident Microbiota in Health and Disease: An Overview and Future Perspectives. Microorganisms 2023;11. https://doi.org/10.3390/MICROORGANISMS11051211. [39] Fernandes L, Costa R, Henriques M, et al . Simulated Vaginal Fluid: Candida resistant strains’ biofilm characterization and vapor phase of essential oil effect. J Mycol Med 2022:101329. https://doi.org/10.1016/J.MYCMED.2022.101329. [40] Kean R, Delaney C, Rajendran R, et al . Gaining Insights from Candida Biofilm Heterogeneity: One Size Does Not Fit All. J Fungi (Basel) 2018;4. https://doi.org/10.3390/JOF4010012.
GENERAL INTRODUCTION | CHAPTER I 29 [41] Takashima M, Sugita T. Taxonomy of Pathogenic Yeasts Candida, Cryptococcus, Malassezia , and Trichosporon . Med Mycol J 2022;63:119–32. https://doi.org/10.3314/MMJ.22.004. [42] Gómez-Gaviria M, Ramírez-Sotelo U, Mora-Montes HM. Nonalbicans Candida Species: Immune Response, Evasion Mechanisms, and New Plant-Derived Alternative Therapies. J Fungi 2023, Vol 9, Page 11 2022;9:11. https://doi.org/10.3390/JOF9010011. [43] de Souza CM, Moreira dos Santos M, Furlaneto-Maia L, et al. Adhesion and biofilm formation by the opportunistic pathogen Candida tropicalis : what do we know? Https://DoiOrg/101139/Cjm-2022-0195 2023. https://doi.org/10.1139/CJM-2022-0195. [44] Cooper CR. Yeasts Pathogenic to Humans. The Yeasts 2011;1:9–19. https://doi.org/10.1016/B978-0444-52149-1.00002-1. [45] Faria-Gonçalves P, Rolo J, Gaspar C, et al . Recurrent vulvovaginal Candida spp isolates phenotypically express less virulence traits. Microb Pathog 2020;148:104471. https://doi.org/10.1016/J.MICPATH.2020.104471. [46] Ghasemi R, Lotfali E, Rezaei K, et al . Meyerozyma guilliermondii species complex: review of current epidemiology, antifungal resistance, and mechanisms. Braz J Microbiol 2022;53:1761–79. https://doi.org/10.1007/S42770-022-00813-2. [47] Chu Y, Li M, Jin J, et al . Advances in the Application of the Non-Conventional Yeast Pichia kudriavzevii in Food and Biotechnology Industries. J. Fungi 2023, Vol 9, Page 170 2023;9:170. https://doi.org/10.3390/JOF9020170. [48] Daneshnia F, de Almeida Júnior JN, Ilkit M, et al . Worldwide emergence of fluconazole-resistant Candida parapsilosis : current framework and future research roadmap. Lancet Microbe 2023;4. https://doi.org/10.1016/S2666-5247(23)00067-8. [49] Branco J, Miranda IM, Rodrigues AG. Candida parapsilosis Virulence and Antifungal Resistance Mechanisms: A Comprehensive Review of Key Determinants. J Fungi (Basel) 2023;9. https://doi.org/10.3390/JOF9010080. [50] Fernandes L, Ribeiro R, Henriques M, et al. Candida auris , a singular emergent pathogenic yeast: its resistance and new therapeutic alternatives. Eur J Clin Microbiol Infect Dis 2022;41:1371–85. https://doi.org/10.1007/S10096-022-04497-2. [51] Jeffery-Smith A, Taori SK, Schelenz S, et al . Candida auris : A review of the literature. Clin Microbiol Rev 2018;31. https://doi.org/10.1128/CMR.00029-17/ASSET/A4EF16DA-232A-403D-AE90E90B9247DB73/ASSETS/GRAPHIC/ZCM0011826100009.JPEG. [52] Vandeputte P, Pineau L, Larcher G, et al . Molecular mechanisms of resistance to 5-fluorocytosine in laboratory mutants of Candida glabrata . Mycopathologia 2011;171:11–21. https://doi.org/10.1007/S11046-010-9342-1. [53] Phillips NA, Rocktashel M, Merjanian L. Ibrexafungerp for the Treatment of Vulvovaginal Candidiasis: Design, Development and Place in Therapy. Drug Des Devel Ther 2023;17:363. https://doi.org/10.2147/DDDT.S339349. [54] Bhattacharya S, Sae-Tia S, Fries BC. Candidiasis and Mechanisms of Antifungal Resistance. Antibiotics 2020;9:1–19. https://doi.org/10.3390/ANTIBIOTICS9060312. [55] Arendrup MC, Patterson TF. Multidrug-Resistant Candida : Epidemiology, Molecular Mechanisms, and Treatment. J Infect Dis 2017;216:S445–51. https://doi.org/10.1093/INFDIS/JIX131. [56] Rodrigues ME, Silva S, Azeredo J, et al. Novel strategies to fight Candida species infection. Crit Rev Microbiol 2014;7828:1–13. https://doi.org/10.3109/1040841X.2014.974500. [57] Cleveland AA, Harrison LH, Farley MM, et al . Declining incidence of candidemia and the shifting epidemiology of Candida resistance in two US metropolitan areas, 2008-2013: Results from populationbased surveillance. PLoS One 2015;10:1–12. https://doi.org/10.1371/journal.pone.0120452. [58] Rapp RP. Changing Strategies for the Management of Invasive Fungal Infections. Pharmacotherapy 2004;24:4S–28S. https://doi.org/10.1592/phco.24.3.4S.33151. [59] Raut JS, Karuppayil SM. A status review on the medicinal properties of essential oils. Ind Crops Prod 2014;62:250–264. https://doi.org/10.1016/j.indcrop.2014.05.055. [60] Al-Mijalli SH, Mrabti NN, Ouassou H, et al . Chemical Composition and Antioxidant, Antimicrobial, and AntiInflammatory Properties of Origanum compactum Benth Essential Oils from Two Regions: In Vitro and In
GENERAL INTRODUCTION | CHAPTER I 30 Vivo Evidence and In Silico Molecular Investigations. Molecules 2022, Vol 27, Page 7329 2022;27:7329. https://doi.org/10.3390/MOLECULES27217329. [61] Pappas PG, Rex JH, Sobel JD, et al . Guidelines for treatment of candidiasis. Clin Infect Dis 2004;38:161– 89. https://doi.org/10.1097/01.idc.0000130888.27859.52. [62] Vazquez J. Combination antifungal therapy against Candida species: the new frontier--are we there yet? Medical Mycology : Official Publication of the International Society for Human and Animal Mycology 2003;41:355–68. https://doi.org/10.1080/13693780310001616528. [63] Hodgetts S, Nooney L, Al-Akeel R, et al . Efungumab and caspofungin: pre-clinical data supporting synergy. Journal of Antimicrobial Chemotherapy 2008;61:1132–9. https://doi.org/10.1093/JAC/DKN075. [64] Donnelly RF, McCarron PA, Tunney MM. Antifungal photodynamic therapy. Microbiol Res 2008;163:1–12. https://doi.org/10.1016/j.micres.2007.08.001. [65] Černáková L, Light C, Salehi B, et al . Novel Therapies for Biofilm-Based Candida spp. Infections. Adv Exp Med Biol 2019;1214:93–123. https://doi.org/10.1007/5584_2019_400. [66] Hosny K, Asfour H, Rizg W, et al . Formulation, Optimization, and Evaluation of Oregano Oil Nanoemulsions for the Treatment of Infections Due to Oral Microbiota. Int J Nanomedicine 2021;16:5465–78. https://doi.org/10.2147/IJN.S325625. [67] Liu M, Luo F, Qing Z, Yang H, et al . Chemical Composition and Bioactivity of Essential Oil of Ten Labiatae Species. Molecules 2020, Vol 25, Page 4862 2020;25:4862. https://doi.org/10.3390/MOLECULES25204862. [68] Imran M, Iqbal A, Badshah SL, et al . Chemical and Nutritional Profiling of the Seaweed Dictyota dichotoma and Evaluation of Its Antioxidant, Antimicrobial and Hypoglycemic Potentials. Mar Drugs 2023;21:273. https://doi.org/10.3390/MD21050273/S1. [69] Gheda S, El-Zaher EHFA, Abou-Zeid AM, et al. Potential Activity of Arthrospira platensis as Antioxidant, Cytotoxic and Antifungal against Some Skin Diseases: Topical Cream Application. Marine Drugs 2023, Vol 21, Page 160 2023;21:160. https://doi.org/10.3390/MD21030160. [70] Ramli I, Zerizer S, Gali L, et al . In vitro and in vivo bioactivities of Ambrosia maritima and Bituminaria bituminosa organic extracts from Algeria. The Journal of Infection in Developing Countries 2022;16:1064– 74. https://doi.org/10.3855/jidc.16788. [71] Saddiq AA, Tag HM, Doleib NM, et al. Antimicrobial, Antigenotoxicity, and Characterization of Calotropis procera and Its Rhizosphere-Inhabiting Actinobacteria: In Vitro and In Vivo Studies. Molecules 2022;27. https://doi.org/10.3390/MOLECULES27103123. [72] Liu Y, Ren H, Wang D, et al. The synergistic antifungal effects of gypenosides combined with fluconazole against resistant Candida albicans via inhibiting the drug efflux and biofilm formation. Biomed Pharmacother 2020;130. https://doi.org/10.1016/J.BIOPHA.2020.110580. [73] Wang ZJ, Zhu YY, Yi X, et al . Bioguided isolation, identification and activity evaluation of antifungal compounds from Acorus tatarinowii Schott. J Ethnopharmacol 2020;261. https://doi.org/10.1016/J.JEP.2020.113119. [74] Rajamohamed BS, Siddharthan S. Modulatory effects of Amukkara Choornam on Candida albicans biofilm: in vitro and in vivo study. Mol Biol Rep 2019 46:3 2019;46:2961–9. https://doi.org/10.1007/S11033019-04757-Z. [75] Abirami G, Alexpandi R, Durgadevi R, et al. Inhibitory Effect of Morin Against Candida albicans Pathogenicity and Virulence Factor Production: An in vitro and in vivo Approaches. Front Microbiol 2020;11. https://doi.org/10.3389/FMICB.2020.561298/FULL. [76] Alrumaihi F, Allemailem KS, Almatroudi A, et al. Tinospora cordifolia Aqueous Extract Alleviates Cyclophosphamide - Induced Immune Suppression, Toxicity and Systemic Candidiasis in Immunosuppressed Mice : In vivo Study in Comparison to Antifungal Drug Fluconazole. Curr Pharm Biotechnol 2019;20:1055–63. https://doi.org/10.2174/1389201019666190722151126. [77] Abdallah BM, Ali EM. Therapeutic Effect of Green Synthesized Silver Nanoparticles Using Erodium glaucophyllum Extract against Oral Candidiasis: In Vitro and In Vivo Study. Molecules 2022;27:4221. https://doi.org/10.3390/MOLECULES27134221/S1.
GENERAL INTRODUCTION | CHAPTER I 31 [78] de Oliveira Zoccolotti J, Cavalheiro AJ, Tasso CO, et al . In vivo antifungal activity and biocompatibility of Cryptocarya moschata . Arch Microbiol 2022;204:1–9. https://doi.org/10.1007/S00203-022-031771/METRICS. [79] Silva DR, Rosalen PL, Freires IA, et al . Anadenanthera Colubrina vell Brenan: antiCandida and antibiofilm activities, toxicity and therapeutical action. Braz Oral Res 2019;33:e023. https://doi.org/10.1590/18073107BOR-2019.VOL33.0023. [80] Campos LM, Silva TP, de Oliveira Lemos AS, et al . Antibiofilm potential of Annona muricata L. ethanolic extract against multi-drug resistant Candida albicans . J Ethnopharmacol 2023;315. https://doi.org/10.1016/J.JEP.2023.116682. [81] Fabri RL, Freitas JCO, Lemos ASO, et al . Spilanthol as a promising antifungal alkylamide for the treatment of vulvovaginal candidiasis. Med Mycol 2021;59:1210–24. https://doi.org/10.1093/MMY/MYAB054. [82] Li L, Qiu J, Wei M, et al . Inhibition of Candida albicans and induced vaginitis by sapindus water extract. Nat Prod Res 2021;35:2987–91. https://doi.org/10.1080/14786419.2019.1679136. [83] Campos LM, de Oliveira Lemos AS, da Cruz LF, et al . Development and in vivo evaluation of chitosan-gel containing Mitracarpus frigidus methanolic extract for vulvovaginal candidiasis treatment. Biomedicine & Pharmacotherapy 2020;130:110609. https://doi.org/10.1016/J.BIOPHA.2020.110609. [84] Saghafi N, Karjalian M, Ghazanfarpour M, et al . The effect of a vaginal suppository formulation of dill ( Anethum graveolens ) in comparison to clotrimazole vaginal tablet on the treatment of vulvovaginal candidiasis. J Obstet Gynaeco 2018;38:985–8. https://doi.org/10.1080/01443615.2018.1432578. [85] Akroum S. Anti-microbial activity of Rosmarinus officinalis and Zingiber officinale extracts on the species of the genus Candida and on Streptococcus pneumonia . Ann Pharm Fr 2020;79:62–9. https://doi.org/10.1016/J.PHARMA.2020.06.003. [86] Raj S, Vinod V, Jayakumar J, et al. Antifungal activity of Syzygium samarangense leaf extracts against Candida . Lett Appl Microbiol 2021;73:31–8. https://doi.org/10.1111/LAM.13471. [87] Güzel S, Özay Y, Kumaş M, et al . Wound healing properties, antimicrobial and antioxidant activities of Salvia kronenburgii Rech. f. and Salvia euphratica Montbret , Aucher & Rech. f. var. euphratica on excision and incision wound models in diabetic rats. Biomedicine & Pharmacotherapy 2019;111:1260–76. https://doi.org/10.1016/J.BIOPHA.2019.01.038. [88] Akroum S. Antifungal activity of Camellia sinensis crude extracts against four species of Candida and Microsporum persicolor . J Mycol Med 2018;28:424–7. https://doi.org/10.1016/J.MYCMED.2018.06.003. [89] Alves CT, Ferreira ICFR, Barros L, et al. Antifungal activity of phenolic compounds identified in flowers from North Eastern Portugal against Candida species. Future Microbiol 2014;9:139–46. https://doi.org/10.2217/FMB.13.147. [90] Cowan MM. Plant products as antimicrobial agents. Clin Microbiol Rev 1999;12:564–582. https://doi.org/10.1128/cmr.12.4.564. [91] Lang G, Buchbauer G. A review on recent research results (2008-2010) on essential oils as antimicrobials and antifungals. A review. Flavour Fragr J 2012;27:13–39. https://doi.org/10.1002/ffj.2082. [92] Marino A, Nostro A, Mandras N, et al . Evaluation of antimicrobial activity of the hydrolate of Coridothymus capitatus (L.) Reichenb. fil. ( Lamiaceae ) alone and in combination with antimicrobial agents. BMC Complement Med Ther 2020;20:89. https://doi.org/10.1186/s12906-020-2877-x. [93] Bakkali F, Averbeck S, Averbeck D, et al. Biological effects of essential oils - A review. Food and Chemical Toxicology 2008;46:446–475. https://doi.org/10.1016/j.fct.2007.09.106. [94] Nostro A, Roccaro AS, Bisignano G, et al . Effects of oregano, carvacrol and thymol on Staphylococcus aureus and Staphylococcus epidermidis biofilms. J Med Microbiol 2007;56:519–23. https://doi.org/10.1099/jmm.0.46804-0. [95] Hao Y, Li J, Zhang W, et al . Analysis of the Chemical Profiles and AntiS. aureus Activities of Essential Oils Extracted from Different Parts of Three Oregano Cultivars. Foods 2021, Vol 10, Page 2328 2021;10:2328. https://doi.org/10.3390/FOODS10102328. [96] Baser K, Demitri FC. Chemistry of essential oils. In Flavours and Fragrances - chemistry, bioprocessing and sustainability. Berlin,Germany: Springer; 2007.
GENERAL INTRODUCTION | CHAPTER I 32 [97] Koroch AR, Rodolfo Juliani H, Zygadlo JA. Bioactivity of essential oils and their components. Flavours and Fragrances: Chemistry, Bioprocessing and Sustainability, 2007, p. 87–115. https://doi.org/10.1007/978-3-540-49339-6_5. [98] Burt S. Essential oils: Their antibacterial properties and potential applications in foods - A review. Int J Food Microbiol 2004;94:223–53. https://doi.org/10.1016/j.ijfoodmicro.2004.03.022. [99] Masotti V, Juteau F, Bessière JM, et al. Seasonal and Phenological Variations of the Essential Oil from the Narrow Endemic Species Artemisia molinieri and Its Biological Activities. J Agric Food Chem 2003;51:7115–7121. https://doi.org/10.1021/jf034621y. [100] Copetta A, Lingua G, Berta G. Effects of three AM fungi on growth, distribution of glandular hairs, and essential oil production in Ocimum basilicum L. var. Genovese. Mycorrhiza 2006;16:485–494. https://doi.org/10.1007/s00572-006-0065-6. [101] Milenković L, Ilić ZS, Šunić L, et al . Modification of light intensity influence essential oils content, composition and antioxidant activity of thyme, marjoram and oregano. Saudi J Biol Sci 2021;28:6532–43. https://doi.org/10.1016/J.SJBS.2021.07.018. [102] Caputo L, Amato G, de Bartolomeis P, et al . Impact of drying methods on the yield and chemistry of Origanum vulgare L. essential oil. Sci Rep 2022;12. https://doi.org/10.1038/S41598-022-07841-W. [103] Russo M, Serra D, Suraci F, et al. Effectiveness of electronic nose systems to detect bergamot ( Citrus bergamia Risso et Poiteau) essential oil quality and genuineness. J Essent Oil Res 2012;24:137–51. https://doi.org/10.1080/10412905.2012.659530. [104] Feyaerts AF, Mathé L, Luyten W, et al. Comparison between the vapor-phase-mediated antiCandida activity of conventional and organic essential oils. Volatiles & Essent Oils 2018;5:1–6. [105] Salvo A, La Torre GL, Rotondo A, et al . Multiple analytical approaches for the organic and inorganic characterization of Origanum vulgare L. samples. Nat Prod Res 2019;33:2815–22. https://doi.org/10.1080/14786419.2018.1503269. [106] Pina-Vaz C, Rodrigues AG, Pinto E, et al . Antifungal activity of Thymus oils and their major compounds. J. Eur. Acad. Dermatol. Venereol. 2004;18:73–8. https://doi.org/10.1111/j.1468-3083.2004.00886.x. [107] Pinto E, Pina-Vaz C, Salgueiro L, et al . Antifungal activity of the essential oil of Thymus pulegioides on Candida, Aspergillus and dermatophyte species. J Med Microbiol 2006;55:1367–73. https://doi.org/10.1099/JMM.0.46443-0. [108] Villar Rodríguez J, Pérez-Pico AM, Mingorance-Álvarez E, et al. Meta‐analysis of the antifungal activities of three essential oils as alternative therapies in dermatophytosis infections. J Appl Microbiol 2022;133:241– 53. https://doi.org/10.1111/JAM.15539. [109] Rajkowska K, Nowak A, Kunicka-Styczyńska A, et al. Biological effects of various chemically characterized essential oils: Investigation of the mode of action against: Candida albicans and HeLa cells. RSC Adv 2016;6:97199–207. https://doi.org/10.1039/c6ra21108a. [110] Zhang J, Wu H, Jiang D, et al. The antifungal activity of essential oil from Melaleuca leucadendra (L.) L. grown in China and its synergistic effects with conventional antibiotics against Candida . Nat Prod Res 2019;33:2545–8. https://doi.org/10.1080/14786419.2018.1448979/SUPPL_FILE/GNPL_A_1448979_SM3660.PDF. [111] Garzoli S, Filatov VA, Kulyak OY, et al. Chemical Composition and Antimicrobial Potential of a Plant-Based Substance for the Treatment of Seborrheic Dermatitis. Pharmaceuticals 2023, Vol 16, Page 328 2023;16:328. https://doi.org/10.3390/PH16030328. [112] Borotová P, Galovičová L, Vukovic NL, et al. Chemical and Biological Characterization of Melaleuca alternifolia Essential Oil. Plants 2022, Vol 11, Page 558 2022;11:558. https://doi.org/10.3390/PLANTS11040558. [113] Carson CF, Hammer KA, Riley T V. Melaleuca alternifolia (tea tree) oil: A review of antimicrobial and other medicinal properties. Clin Microbiol Rev 2006;19:50–62. https://doi.org/10.1128/CMR.19.1.5062.2006. [114] da Silva RA, Antonieti FMPM, Röder DVD de B, et al. Essential Oils of Melaleuca, Citrus, Cupressus , and Litsea for the Management of Infections Caused by Candida Species: A Systematic Review. Pharmaceutics 2021;13. https://doi.org/10.3390/PHARMACEUTICS13101700.
GENERAL INTRODUCTION | CHAPTER I 33 [115] de Campos Rasteiro MM, da Costa PCBP, Araújo FF, et al . Essential oil of Melaleuca alternifolia for the treatment of oral candidiasis induced in an immunosuppressed mouse model. BMC Complement Altern Med 2014;14. https://doi.org/10.1186/1472-6882-14-489. [116] Hammer KA, Carson CF, Riley TV, et al. A review of the toxicity of Melaleuca alternifolia (tea tree) oil. Food Chem Toxicol 2006;44:616–25. https://doi.org/10.1016/J.FCT.2005.09.001. [117] Thoma JL, Cantrell CL, Zheljazkov VD. Evaluation of Essential Oils as Sprout Suppressants for Potato ( Solanum tuberosum ) at Room Temperature Storage. Plants 2022;11. https://doi.org/10.3390/PLANTS11223055. [118] Siddique S, Mazhar S, Parveen Z. Chemical characterization, antioxidant and antimicrobial activities of essential oil from Melaleuca quinquenervia leaves. Indian J Exp Biol 2018;56:686–93. [119] Wilkinson JM, Cavanagh HMA. Antibacterial activity of essential oils from Australian native plants. Phytother Res 2005;19:643–6. https://doi.org/10.1002/PTR.1716. [120] Valková V, Ďúranová H, Vukovic NL, et al . Assessment of Chemical Composition and Anti-Penicillium Activity of Vapours of Essential Oils from Abies Alba and Two Melaleuca Species in Food Model Systems. Molecules 2022;27. https://doi.org/10.3390/MOLECULES27103101. [121] Tisserand R, Young R. Essential oil safety : a guide for health care professionals. 2014 Second ed. Edinburgh: Elsevier Limited. [122] Monzote L, Scherbakov AM, Scull R, et al . Essential Oil from Melaleuca leucadendra : Antimicrobial, Antikinetoplastid, Antiproliferative and Cytotoxic Assessment. Molecules 2020, Vol 25, Page 5514 2020;25:5514. https://doi.org/10.3390/MOLECULES25235514. [123] Giang An NT, Huong LT, Satyal P, et al . Mosquito Larvicidal Activity, Antimicrobial Activity, and Chemical Compositions of Essential Oils from Four Species of Myrtaceae from Central Vietnam. Plants 2020, Vol 9, Page 544 2020;9:544. https://doi.org/10.3390/PLANTS9040544. [124] Karpiński TM, Ożarowski M, Seremak-Mrozikiewicz A, et al. AntiCandida and Antibiofilm Activity of Selected Lamiaceae Essential Oils. Front Biosci (Landmark Ed) 2023;28:28. https://doi.org/10.31083/J.FBL2802028. [125] Alshaikh NA, Perveen K. Susceptibility of Fluconazole-Resistant Candida albicans to Thyme Essential Oil. Microorganisms 2021;9. https://doi.org/10.3390/MICROORGANISMS9122454. [126] Naseri N, Kalantari Khandani A, Baherimoghadam T, et al . The Effect of Thymus Vulgaris Essential Oil and Chlorhexidine on Candida Albicans Accumulated on Removable Orthodontic Appliance: A Clinical Trial. J Dent 2022;23:190–7. https://doi.org/10.30476/DENTJODS.2021.89317.1404. [127] Shanaida M, Hudz N, Białoń M, et al . Chromatographic profiles and antimicrobial activity of the essential oils obtained from some species and cultivars of the Mentheae tribe ( Lamiaceae ). Saudi J Biol Sci 2021;28:6145. https://doi.org/10.1016/J.SJBS.2021.06.068. [128] Beicu R, Alexa E, Obiștioiu D, et al . Antimicrobial potential and phytochemical profile of wild and cultivated populations of thyme ( Thymus spp.) growing in western romania. Plants 2021;10:1833. https://doi.org/10.3390/PLANTS10091833/S1. [129] Córdoba S, Vivot W, Szusz W, et al. Antifungal Activity of Essential Oils Against Candida Species Isolated from Clinical Samples. Mycopathologia 2019;184:615–23. https://doi.org/10.1007/S11046-01900364-5/TABLES/2. [130] Demirci B, Kırcı D, Öztürk G, et al. Effect of Extraction Time on Origanum onites L. Infusions and Essential Oils - Biological Evaluation, Statistical Principal Component and Hierarchial Cluster Analyses. Chem Biodivers 2022;19. https://doi.org/10.1002/CBDV.202200482. [131] Hao Y, Kang J, Yang R, et al . Multidimensional exploration of essential oils generated via eight oregano cultivars: Compositions, chemodiversities, and antibacterial capacities. Food Chem 2022;374:131629. https://doi.org/10.1016/J.FOODCHEM.2021.131629. [132] Cid-Chevecich C, Müller-Sepúlveda A, Jara JA, et al . Origanum vulgare L. essential oil inhibits virulence patterns of Candida spp. and potentiates the effects of fluconazole and nystatin in vitro . BMC Complement Med Ther 2022;22. https://doi.org/10.1186/S12906-022-03518-Z. [133] Stringaro A, Colone M, Cecchetti S, et al . “ In vivo ” and “ in vitro ” antimicrobial activity of Origanum vulgare essential oil and its two phenolic compounds on clinical isolates of Candida spp. Arch Microbiol 2023;205:1–12. https://doi.org/10.1007/S00203-022-03355-1/FIGURES/5.
GENERAL INTRODUCTION | CHAPTER I 34 [134] Kaskatepe B, Erdem SA, Ozturk S, et al . Antifungal and Anti-Virulent Activity of Origanum majorana L. Essential Oil on Candida albicans and In Vivo Toxicity in the Galleria mellonella Larval Model. Molecules 2022;27. https://doi.org/10.3390/MOLECULES27030663. [135] Kapustová M, Granata G, Napoli E, et al . Nanoencapsulated Essential Oils with Enhanced Antifungal Activity for Potential Application on Agri-Food, Material and Environmental Fields. Antibiotics (Basel) 2021;10:1– 12. https://doi.org/10.3390/ANTIBIOTICS10010031. [136] Neves JS, Lopes-Da-Silva Z, De Sousa Brito Neta M, et al . Preparation of terpolymer capsules containing Rosmarinus officinalis essential oil and evaluation of its antifungal activity. RSC Adv 2019;9:22586. https://doi.org/10.1039/C9RA02336D. [137] Dinu MV, Gradinaru AC, Lazar MM, et al . Physically cross-linked chitosan/dextrin cryogels entrapping Thymus vulgaris essential oil with enhanced mechanical, antioxidant and antifungal properties. Int J Biol Macromol 2021;184:898–908. https://doi.org/10.1016/J.IJBIOMAC.2021.06.068. [138] Serra E, Saubade F, Ligorio C, et al . Methylcellulose Hydrogel with Melissa officinalis Essential Oil as a Potential Treatment for Oral Candidiasis. Microorganisms 2020, Vol 8, Page 215 2020;8:215. https://doi.org/10.3390/MICROORGANISMS8020215. [139] Torabiardekani N, Karami F, Khorram M, et al . Encapsulation of Zataria multiflora essential oil in polyvinyl alcohol/chitosan/gelatin thermo-responsive hydrogel: Synthesis, physico-chemical properties, and biological investigations. Int J Biol Macromol 2023;243. https://doi.org/10.1016/J.IJBIOMAC.2023.125073. [140] Jawaid T, Alaseem AM, Khan MM, et al . Preparation and Evaluation of Nanoemulsion of Citronella Essential Oil with Improved Antimicrobial and Anti-Cancer Properties. Antibiotics (Basel) 2023;12:478. https://doi.org/10.3390/ANTIBIOTICS12030478. [141] Sharma K, Munjal M, Sharma RK, et al . Thymol encapsulated chitosan-Aloe vera films for antimicrobial infection. Int J Biol Macromol 2023;235:123897. https://doi.org/10.1016/J.IJBIOMAC.2023.123897. [142] Zanotto AW, Kanemaru MYS, de Souza FG, et al. Enhanced antimicrobial and antioxidant capacity of Thymus vulgaris, Lippia sidoides, and Cymbopogon citratus emulsions when combined with mannosylerythritol a lipid biosurfactant. Food Res Int 2023;163. https://doi.org/10.1016/J.FOODRES.2022.112213. [143] Ramtin M, Sharifniya F, Larypoor M, et al. Evaluation of the Active Ingredient of Campsis radicans Essential Oils and its Antimicrobial Evaluation Against Pathogenic Bacteria. Curr Microbiol 2022;79:1–12. https://doi.org/10.1007/S00284-022-03042-W/TABLES/4. [144] Odjo K, Al-Maqtari QA, Yu H, et al . Preparation and characterization of chitosan-based antimicrobial films containing encapsulated lemon essential oil by ionic gelation and cranberry juice. Food Chem 2022;397. https://doi.org/10.1016/J.FOODCHEM.2022.133781. [145] Baldim I, Paziani MH, Grizante Barião PH, et al. Nanostructured Lipid Carriers Loaded with Lippia sidoides Essential Oil as a Strategy to Combat the Multidrug-Resistant Candida auris . Pharmaceutics 2022;14. https://doi.org/10.3390/PHARMACEUTICS14010180. [146] de Alteriis E, Maione A, Falanga A, et al . Activity of Free and Liposome-Encapsulated Essential Oil from Lavandula angustifolia against Persister-Derived Biofilm of Candida auris . Antibiotics (Basel) 2021;11. https://doi.org/10.3390/ANTIBIOTICS11010026. [147] Râpă M, Gaidau C, Mititelu-Tartau L, et al . Bioactive collagen hydrolysate-chitosan/essential oil electrospun nanofibers designed for medical wound dressings. Pharmaceutics 2021;13. https://doi.org/10.3390/PHARMACEUTICS13111939/S1. [148] Mishra P, Gupta P, Pruthi V. Cinnamaldehyde incorporated gellan/PVA electrospun nanofibers for eradicating Candida biofilm. Materials Science and Engineering: C 2021;119:111450. https://doi.org/10.1016/J.MSEC.2020.111450. [149] Mishra P, Gupta P, Srivastava AK, et al. Eucalyptol/ β-cyclodextrin inclusion complex loaded gellan/PVA nanofibers as antifungal drug delivery system. Int J Pharm 2021;609. https://doi.org/10.1016/J.IJPHARM.2021.121163. [150] Kapustová M, Puškárová A, Bučková M, et al . Biofilm inhibition by biocompatible poly(ε-caprolactone) nanocapsules loaded with essential oils and their cyto/genotoxicity to human keratinocyte cell line. Int J Pharm 2021;606:120846. https://doi.org/10.1016/J.IJPHARM.2021.120846.
GENERAL INTRODUCTION | CHAPTER I 35 [151] Garcia LGS, da Rocha MG, Lima LR, et al . Essential oils encapsulated in chitosan microparticles against Candida albicans biofilms. Int J Biol Macromol 2021;166:621–32. https://doi.org/10.1016/J.IJBIOMAC.2020.10.220. [152] Fazly Bazzaz BS, Khameneh B, Namazi N, et al. Solid lipid nanoparticles carrying Eugenia caryophyllata essential oil: the novel nanoparticulate systems with broad-spectrum antimicrobial activity. Lett Appl Microbiol 2018;66:506–13. https://doi.org/10.1111/LAM.12886. [153] Mokarizadeh M, Kafil H, Ghanbarzadeh S, et al. Improvement of citral antimicrobial activity by incorporation into nanostructured lipid carriers: a potential application in food stuffs as a natural preservative. Res Pharm Sci 2017;12:409. https://doi.org/10.4103/1735-5362.213986. [154] Balaure PC, Boarca B, Popescu RC, et al . Bioactive mesoporous silica nanostructures with anti-microbial and anti-biofilm properties. Int J Pharm 2017;531:35–46. https://doi.org/10.1016/J.IJPHARM.2017.08.062. [155] Mishra N, Rai VK, Yadav KS, et al . Encapsulation of Mentha Oil in Chitosan Polymer Matrix Alleviates Skin Irritation. AAPS PharmSciTech 2016;17:482–92. https://doi.org/10.1208/S12249-015-0378-X. [156] Liakos I, Rizzello L, Scurr DJ, et al . All-natural composite wound dressing films of essential oils encapsulated in sodium alginate with antimicrobial properties. Int J Pharm 2014;463:137–45. https://doi.org/10.1016/J.IJPHARM.2013.10.046. [157] Kryeziu TL, Haloci E, Loshaj-Shala A, et al . Nanoencapsulation of Origanum vulgare essential oil into liposomes with anticancer potential. Pharmazie 2022;77:172–8. https://doi.org/10.1691/PH.2022.1230.
36 CHAPTER II EFFECT OF ESSENTIAL OILS ON DRUG-RESISTANT CANDIDA STRAINS Over the time there has been an increase in Candida strains resistant to conventional antifungals. Highlighting Candida auris, a recently found Candida species, mainly associated with nosocomial outbreaks in intensive care hospital settings, and unlike other Candida species, it can be transmitted through person-to-person or by contact with surfaces. This yeast pathogen is responsible for many invasive fungal infections due to its multidrug-resistant character and its huge transmission ability. Indeed, C. auris is described as resistant to first-line antifungals and, consequently, associated with high mortality. Despite the impact and importance that C. auris has recently demonstrated, Candida albicans remains the Candida species most frequently found and associated with vulvovaginal candidiasis (VVC). Moreover, there is also growing concern about the incidence of nonCandida albicans Candida (NCAC) species, such as Candida glabrata , Candida parapsilosis , Candida krusei or recently named Pichia kudriavzevii. VVC is a disease with high incidence, a huge impact on the quality of life and health of women, and which represents a great challenge to treat. The growing need to apply antifungal intensive therapies have contributed to an emergence of drug-resistant Candida strains. Effective therapeutic options, to meet the antifungal-resistance challenge and to control high resilient biofilms, are urgently needed. Nowadays, essential oils (EOs), obtained from several aromatic plants, are known to be effective against fungal infections. For example, Thymus species are known by their antifungal effect due to the presence of some volatile compounds in their EOs, such as carvacrol, thymol, linalool and γ-terpinene. However, the efficiency of the EOs can vary significantly even within the same genus. Therefore, the selection of natural therapies should always have in account EOs composition.
37 CHAPTER II.1 ESSENTIAL OILS AS A GOOD WEAPON AGAINST DRUG-RESISTANT CANDIDA AURIS Figure 8. Subchapter II.1 workflow. Candida auris , a recently discovered Candida species, is primarily linked to nosocomial outbreaks within intensive care hospital settings. Thus, this subchapter evaluated four specific essential oils based on clinical evidence and their individual characteristics: tea tree, niaouli, white thyme and cajeput oils. The main objective of this research was to evaluate the impact of these essential oils against planktonic growth and biofilms of Candida auris . This subchapter is based on the following publication: Fernandes L, Ribeiro R, Costa R, Henriques M, Rodrigues ME. Essential Oils as a Good Weapon against Drug-Resistant Candida auris . Antibiotics 2022, Vol 11, Page 977 2022;11:977. https://doi.org/10.3390/ANTIBIOTICS11070977.
ESSENTIAL OILS AS A GOOD WEAPON AGAINST DRUG-RESISTANT CANDIDA AURIS |Chapter II.1 44 oils. Furthermore, despite similar diameters between the tea tree and white thyme oil it, there was a marked decrease in the C. auris biomass all over the petri dish with the application of white thyme EOs (Figure 10). Figure 10. Antifungal activity of essential oils on Candida auris NCPF 8971 evaluated using the disk-diffusion assay. **** p < 0.0001 indicates a statistically different reduction in comparison with the control (Tukey`s multiple comparison test). These results are in line with several reports of high antifungal activity of thyme and tea tree oils against both susceptible and drug-resistant strains of various Candida species [18,19]. Indeed, EOs and their constituents have been used against a wide range of fungal pathogens since they have the ability to hinder the growth and development of a diverse range of pathogens [10]. After these good preliminary results, the antifungal effect of white thyme, tea tree, cajeput and niaouli EOs in biofilm formation and 24 h-old biofilms of C. auris was evaluated (Figure 11). Direct application of two drops (2.4 % (v/ v)) of EOs on biofilm formation (Figure 11.A) led to a total inhibition of biofilm growth. Moreover, the oils were also applied in pre-formed biofilms (Figure 11.B) and it was observed that the application of two drops (2.4 % (v/ v)) of white thyme and cajeput oils induced a total eradication of the 24 h-old biofilms. In addition, tea tree and niaouli oils significantly reduced viable cells of those pre-formed biofilms (p< 0.0001), with reductions of 5 Log10 CFU mL-1 and 4 Log10 CFU mL-1 (p< 0.001), respectively. Essential Oil Inhibition zone (mm) Tea tree Cajeput Niaouli White thyme C. auris NCPF 8971 20.0 ± 1.9**** 13.8 ± 1.1**** 13.3 ± 1.1**** 21.4 ± 0.5****
ESSENTIAL OILS AS A GOOD WEAPON AGAINST DRUG-RESISTANT CANDIDA AURIS |Chapter II.1 45 Figure 11. Antifungal effect of four essential oils (tea tree, niaouli, white thyme and cajeput) in (A) biofilm formation and (B) 24 h-old biofilms of Candida auris NCPF 8971 by quantification of CFUs per mL. Error bars indicate the respective standard derivation (SD). *** p < 0.001, **** p < 0.0001 indicates a statistically different reduction in comparison with the control (Tukey`s multiple comparison test). The results confirm the high ability of C. auris to form biofilms (Figure 11 – (+) control), as previously described by Horton et al . [20]. These authors demonstrated that the growth in synthetic sweat medium and in the skin of pigs allows C. auris to form dense biofilms that resist desiccation and thrive in conditions of evaporation. In addition, the draft genome that identifies several proteins involved in biofilm formation and recent descriptions of aggregative and non-aggregative phenotypes indicate the possibility of heterogeneous C. auris biofilm formation [7]. In relation to the application of EOs on biofilm formation (Figure 11.A), it was possible to verify that the application of only two drops of oil (white thyme, tea tree, cajeput or niaouli) induced to a total inhibition of biofilm growth after 24 h. Furthermore, the application of the same volume of white thyme and cajeput oils led to a total eradication of biofilms the 24 h-old (pre-formed biofilms) (Figure 11.B), showcasing their great efficacy. Besides, tea tree and niaouli oils significantly reduce viable cells of those pre-formed biofilms (p <0.0001). In fact, the good antiCandida activity of thyme was also verified in many reports [21]. Similarly, to the results obtained in this study, Asdadi et al. [21] showed that EO of T. satureioides (white thyme oil) was able to inhibit the growth of nonCandida albicans Candida (NCAC) species ( Candida krusei, Candida dubliniensis and C. glabrata ) resistant to conventional antifungal, such as FLC and amphotericine B. In this study, the major compounds of the white thyme oil are borneol, α-terpineol and carvacrol (Table 2). It has been demonstrated that oxygenated terpene compounds, such as carvacrol, are often considered the main responsible for modifying membrane permeability by chemical reaction with amino
ESSENTIAL OILS AS A GOOD WEAPON AGAINST DRUG-RESISTANT CANDIDA AURIS |Chapter II.1 46 and hydroxylamine groups of membrane proteins [8]. Indeed, carvacrol has the highest antifungal activity, inhibiting the formation of hyphae and biofilms in Candida species [6,22]. Also, terpinen-4-ol and αterpineol are recognized as potent compounds with a fungicidal effect [19]. Thus, the very good outcomes obtained in this work are justified by the important antifungal role of these compound. In turn, the major compounds of the tea tree EO are terpinen-4-ol, γ-terpinene and α-terpinene (Table 2). Tea tree oil and their components increase yeast cell permeability and membrane fluidity, and become embedded in the lipid bilayer membrane, eventually disrupting its structure [23]. Besides that, tea tree oil also inhibits the formation of germ tubes or mycelial conversion and inhibits respiration in C. albicans [23]. In addition, Mondello et al . [19] suggested that terpinen-4-ol is a likely mediator of the in vitro and in vivo activity of tea tree oil and that could control C. albicans vaginal infection. The EO of M. quinquenervia (niaouli oil) was found to be effective against bacteria as well as a range of fungi, including C. albicans [24]. Additionally, Keereedach et al . [25] found that M. cajuputi (cajeput oil) had a potent antifungal activity against clinical isolates of C. albicans resistant to FLC, where it was able to reduce the MIC of FLC and reduce the expression level of MDR1 (an important gene that plays a role in resistance to azole drugs in C. albicans ). However, so far there are few studies regarding the effect of niaouli and cajeput oils in Candida species, being this the first study to use both oils in Candida biofilms. The major compounds of these two oils are cineole, α-terpineol and linalool in cajeput oil and ρ-cymene, limonene and 1,8-cineole in niaouli oil (Table 2). 1,8-Cineole showed some antiCandida activity with a fungicidal effect [26]. In addition, linalool exerts antifungal activity by disrupting the membrane integrity and interrupting the cell cycle of planktonic C. albicans , inhibits germ tube formation and exhibits antifungal activity against C. albicans cells in biofilms. The inhibition of hyphae induction by limonene at low concentration may be responsible for the inhibition of biofilm formation. However, ρ-cymene, a thymol precursor, is generally defined as inactive [27,28]. Nevertheless, it is complicated to point the antifungal activity of a complex mixture (EOs) to specific constituents. In fact, it is believed that the antifungal activity most probably results from the combined effect of different compounds on several cellular targets [29]. In this study, the composition of the tested EOs suggests that each oil is featured by components common to the four EOs (27 %- 35 % of the total composition) and specific components (19 %- 33 %) (Table 2). So, it is reasonable to speculate that the antifungal activity of these four EOs can also be related to the presence of specific compounds, such as terpinen-4-ol, carvacrol, α-terpineol, linalool and limonene. Studies report that terpinen-4-ol, major component of the tea tree oil (42 %), have a lipophilic characteristic, probable presenting a direct action on the cell membrane structure and associated enzymes [30]. Carvacrol, present in white thyme oil (9
ESSENTIAL OILS AS A GOOD WEAPON AGAINST DRUG-RESISTANT CANDIDA AURIS |Chapter II.1 47 %), and linalool, present in the four EOs under study in a range between 0.23 %, are associated with modification of membrane permeability and inhibition of hyphae and biofilm formation [8]. The antifungal activity of α - terpineol, present in the four EOs (316 %), also occurs through the disruption of cell walls and cytoplasm, resulting in abnormal hyphae [31]. Limonene, constituent of the tea tree, niaouli and white thyme oils, acts on the genetic material yeast, leading to damage to the cell wall and intracellular structures, including nuclear alterations (condensation of genetic material and specific changes in mitochondria). This compound also induces dramatic structural changes in organelles, accompanied by cell wall disruption [32]. However, to better understand the antifungal effect of these EOs, the synergistic or antagonistic effect between the most abundant compounds and also those present in a smaller percentage in the mixture should be investigated [33]. Thus, more studies are needed in order to understand the interactions between components and consequently the mechanisms of action of EOs. 4. Conclusions C. auris is recognized as a notorious nosocomial pathogen that requires urgent efforts to develop more efficient and safer alternative treatments, due to high transmissibility, incorrect use of antifungal drugs, identification challenges and consequent treatment failures. In this sense, EOs are an alternative therapy for this important pathogen. The results of this study demonstrate a high efficacy of the four EOs tested to inhibit the planktonic growth and completely inhibiting C. auris biofilm formation. Altogether, the data suggest that the application of these four EOs, and particularly white thyme and cajeput, as an efficient alternative both for preventing and treating infections caused by C. auris biofilms, it also reduces dependence on existing conventional antimicrobials.
48 CHAPTER II.2 COMPARING THE EFFECT OF THYMUS SPECIES ESSENTIAL OILS ON CANDIDA AURIS Figure 12. Subchapter II.2 workflow. The effectiveness of essential oils can differ significantly, even when considering species within the same genus. So, the main goal of this subchapter was to compare the effect of several Thymus speciesderived essential oils, namely Thymus vulgaris , Thymus zygis , Thymus satureioides and Thymus mastichina on both planktonic cells and biofilm of Candida auris , while also examining the relationship between their activities and chemical compositions. This subchapter is based on the following publication: Ribeiro R, Fernandes L, Costa R, Cavaleiro C, Salgueiro L, Henriques M, Rodrigues M.E. Comparing the effect of Thymus spp. essential oils on Candida auris . Ind Crops Prod 2022; 178:114667. https://doi.org/10.1016/J.INDCROP.2022.114667.
COMPARING THE EFFECT OF THYMUS SPECIES ESSENTIAL OILS ON CANDIDA AURIS | Chapter II.2 49 1. Introduction In the last decade, Candida auris has emerged as fungal human pathogen that causes hospital outbreaks, especially in intensive care units (ICU) [34,35]. Since its discovery in 2009, more than 30 countries have already identified this Candida species as a frightening pathogen [36,37]. The virulence factors of C. auris include surface’s adhesion, thermo and salt tolerance, and the ability to develop biofilms, which are responsible to the enhancement of antifungal resistance [38–41]. The persistence of C. auris on several equipment and medical device’s surfaces increases the risk of transmission [42]. In hospital environment, the fungal spread may occur between patients or via contact of health care workers with patients [35,43]. The ability of C. auris to persist on the patients' skin and its complex identification make the outbreaks more difficult to contain [34,44–46]. The conventional treatment of fungal infections consists of the administration or application of antifungal drugs. However, these agents have some disadvantages, such as lack of selectivity, toxicity and high antimicrobial resistance, mainly against azoles [47,48]. Nowadays, it is well known that some plant products, such as essential oils (EOs), are effective against fungal and bacterial infections, presenting good bioactivity and low toxicity [7]. EOs are complex mixtures of several volatile compounds produced by aromatic plants that can be used as an alternative antifungal therapy. However, their antifungal properties are difficult to associate to a specific compound [49]. Generally, the antifungal activity could be a result of the principal bioactive compounds of the EOs or due to a synergistic action between the major and the minor compounds [49]. EOs of several Thymus species are recognized by their antifungal activity [49,50]. Some of these oils are widely used, such as Thymus vulgaris and Thymus zygis [1]. The mechanism of action of EOs can include disruption of the wall or membrane of fungi cells, enhancing the permeability of these structures, and inhibition of the synthesis of DNA, RNA, proteins and polysaccharides [1]. Although there are several studies on the antifungal activity of Thymus species oils, there are still no reports of the effect of these oils against C. auris . Thus, this study evaluated the antifungal properties of EOs from T. vulgaris L., T. zygis subsp. sylvestris Loefl. ex L., Thymus satureioides Coss. and Thymus mastichina L. against C. auris biofilms and related the activities with their composition. 2. Materials and Methods 2.1 Microorganisms and culture conditions C. auris NCPF 8971 was stored in broth medium with 20 % (v/ v) glycerol at - 80 ± 2 °C until required, as mentioned in subchapter II.1. Before testing, cells were activated by thawing at room
COMPARING THE EFFECT OF THYMUS SPECIES ESSENTIAL OILS ON CANDIDA AURIS | Chapter II.2 50 temperature. Then they were subcultured into Sabouraud Dextrose Agar (SDA; Liofilchem) and incubated at 37 °C for 24 h. The inoculum was prepared on Sabouraud Dextrose Broth (SDB; Liofilchem) and was incubated at 37 °C for 18 h with agitation. After, the inoculum was centrifuged (6000 rpm, 10 min, 4 °C) and washed twice with Phosphate Buffered Saline (PBS 0.1 M; pH 7.5). The concentration was adjusted in PBS to obtain 1 × 108 cells mL-1. 2.2 Essential oils This study evaluated and compared the antifungal properties of EOs from T. vulgaris (florame®, France), T. satureioides (florame®, France), T. mastichina (florame®, France), and T. zygis subsp. sylvestris ( Parque Natural das Serras de Aire e Candeeiros, Central Portugal), all with 100 % purity. All EOs samples were stored in the dark at room temperature. EO of T. zygis subsp. sylvestris was isolated by hydrodistillation during 3 h using a Clevenger-type apparatus, from flowering serial parts of the plants collected in Parque Natural das Serras de Aire e Candeeiros (Central Portugal). The rest of EOs in study were isolated by florame® (Saint-R´emy-de-Provence, France), through steam distillation of flower cups from Spain (origin of T. vulgaris and T. mastichina ), and Morocco (origin of T. satureioides ). 2.2.1 Chromatographic analysis of essential oils The compositions of the EOs were determined by combination of gas chromatography with FID detectors (GC-FID) and gas chromatography-mass spectroscopy (GC/ MS) analysis. GC-FID analysis was performed in a Hewlett-Packard 6890 gas chromatograph (Agilent Technologies, Palo Alto, CA, USA) set with a single injector and two flame ionization detectors (FID). A divider (Agilent Technologies, part no. 5021–7148) was used for simultaneous sampling on two fused silica capillary columns: a SPB-1 (polydimethylsiloxane 30 m × 0.20 mm i.d., film thickness 0.20 μm) and a SupelcoWax-10 (polyethyleneglycol 30 m × 0.20 mm i.d., film thickness 0.20 μm). Oven temperature program: 70–220 °C (3 °C/ min), 220 °C (15 min); injector temperature: 250 °C; mobile phase: helium, with flow adjusted to maintain a linear velocity of 30 cm/ s; split ratio 1: 40; detectors temperature: 250 °C. For as chromatography–mass spectrometry (GC-MS) analysis was used a Hewlett-Packard 6890 gas chromatograph interfaced with a Hewlett-Packard mass selective detector MSD 5973 (Agilent Technologies). An HP1 (Agilent Technologies) fused silica column (polydimethylsiloxane 30 m × 0.25 mm i.d., film thickness 0.25 μm) was used. GC parameters as described above; interface temperature: 250 ◦C; MSD parameters: interface temperature: 250 °C; MS source temperature: 230 °C; MS quadrupole temperature: 150 °C; ionization energy: 70 eV; ionization current: 60 μA; scan range: 35–350 units;
COMPARING THE EFFECT OF THYMUS SPECIES ESSENTIAL OILS ON CANDIDA AURIS | Chapter II.2 51 scans/ s: 4.51. The compounds were identified by considering, concurrently: 1) the acquired retention indices on both SPB-1 and SupelcoWax-10 columns determined by linear interpolation relative to the retention times of C8–C23 of n-alkanes and compared with reference data from authentic products (available in the laboratory database of the Faculty of Pharmacy, University of Coimbra) and literature data (Wallace WE); 2) the acquired mass spectra compared with reference data from the laboratory database, the Wiley / NIST library [52] and literature [53]. Relative amount of each component was calculated from GC peaks areas. 2.3 Agar disk diffusion assay The agar disk diffusion assay was performed based on European Committee on Antimicrobial Susceptibility Testing (EUCAST E.DEF 7.3.2)[54]. The C. auris suspension was spread onto SDA plates in three different directions. After the inoculum was dry, a sterile filter paper disk (6 mm) was impregnated with 10 μL of each EO from T. vulgaris, T. zygis, T. satureioides and T. mastichina . One plate with cell suspension without EO was used as a positive control. The SDA culture plates were incubated at 37 °C for 24 h. The diameter of the inhibition zone was measured in mm. All experiments were performed in triplicate, in three independent assays. 2.4 Antifungal activity of essential oil from Thymus species The antifungal activity of EOs from four Thymus species against preformed biofilms (24 h old biofilms) of C. auris NCPF 8971 was assessed. C. auris biofilms were developed according to the method described by Silva et al. [55], with some adaptations. The C. auris cell concentration, from liquid culture, was adjusted to 1 x 105 cells mL-1 in SDB. Then, under aseptic conditions, 1 mL of cell suspension was transferred to glass wells inside a glass petri plates, as referred to in subchapter II.1. The biofilm culture was incubated aerobically for 24 h at 37 °C, under agitation at 120 rpm. After 24 h of incubation, medium of the biofilm culture was renewed. The effect of the EOs (100 % or 50 %, diluted in almond oil) was evaluated directly and indirectly. For this, 10 µL of T. vulgaris, T. satureioides, T. zygis and T. mastichina EO (100 % or 50 %) were added to the glass wells in two different ways, direct application by addition in the medium (1 % or 0.5 %) and indirect application by placement, in paper discs which was placed near the wells (the set was kept inside a glass plate), respectively. Positive (biofilm without treatment) and negative (SBD medium) controls were included, as well as almond oil control. All glass petri plates were incubated for 24 h, at 37 °C and 120 rpm. All experiments were performed in triplicate, in three independent assays.
COMPARING THE EFFECT OF THYMUS SPECIES ESSENTIAL OILS ON CANDIDA AURIS | Chapter II.2 52 Cell viability was determined by colony-forming units (CFU). The biofilms were washed with PBS, then scraped from the wells with PBS (1 mL), serially diluted in PBS and plated onto SDA. After incubated for 24 h, at 37 °C, the number of grown colonies was counted. The results were presented as CFU per milliliter (Log10 (CFU mL-1)). 2.5 Statistical analysis Statistical evaluation was realized using GraphPad Software (version 6.01 for Macintosh). One-way ANOVA (analysis of variance) test was applied, and multiple comparisons of means of each treatment with EOs were done by Tukey test. The measures of central tendency and dispersion used were the mean and standard deviation, respectively. A p-value < 0.05 was considered significative. 3. Results and discussion The main compounds of the oils are shown in Table 3 (Annex II - Table 22), where the compounds are listed by order of their elution on a polydimethylsiloxane column. Briefly, T. vulgaris and T. zygis oils are mainly composed by phenolic compounds, being thymol the main compound of T. vulgaris (63.1 %) and thymol (26.5 %) and carvacrol (22.7 %) the main compounds of T. zygis oil, whereas T. satureioides oil contains high amounts of borneol (29.3 %) and α-terpineol (15.9 %), and T. mastichina is characterized by high amounts of linalool (31.9 %). Table 3. Chromatography analysis of the composition of essential oils from Thymus vulgaris , Thymus zygis , Thymus satureioides and Thymus mastichina , here shown in percentage (%) Percent (%) in oil samples RIa RIb Compound T. satureioides T. mastichina T. vulgaris T. zygis 1020 1215 1,8-cineole 2.7 8.5 10.0 7.2 1082 1543 Linalool 4.5 31.9 7.2 6.6 1145 1695 Borneol 29.3 5.8 3.4 4.9 1169 1692 α-Terpineol 15.9 10.0 0.5 1.2 1263 2183 Thymol 1.7 4.4 63.1 26.5 1277 2205 Carvacrol 7.0 0.5 5.5 22.7 Compounds listed in order of their elution on the SPB-1column. a Retention index on the SPB-1 column relative to C8 - C24 n -alkanes. b Retention indices on the SupelcoWax-10 column relative to C8 - C24 n -alkanes.
COMPARING THE EFFECT OF THYMUS SPECIES ESSENTIAL OILS ON CANDIDA AURIS | Chapter II.2 53 The in vitro antifungal activity of EOs from T. vulgaris, T. zygis, T. satureioides and T. mastichina on C. auris planktonic cells was evaluated by zones of inhibition (Dhalo) using the agar disk diffusion method. The analysis of the results obtained shows that all oils, regardless of the Thymus species, had inhibitory effects (Table 4). Table 4. Diameter of the inhibition zone, in mm, of the essential oils from different plants of Thymus genus (10 µL) for Candida auris NCPF 8971 Inhibition zone diameter, mm Thymus vulgaris Thymus zygis Thymus satureioides Thymus mastichina 42.33 ± 3.77 28.25 ± 1.09**** 20.00 ± 0.63**,*** 13.60 ± 1.36**** **P <0.01 when compared with T. mastichina, and ****P <0.0001 when compared with T. vulgaris . As previously demonstrated, Thymus species are potential antifungal agents because they have a strong action against fungal pathogenic microorganisms [48,56]. Although the EOs belong to same plant genus, their effect in C. auris is significantly different. T. vulgaris had the largest inhibition areas (42.33 ± 3.77 mm), being the tested EO with the highest activity. Some of major components of this oil are thymol (63.1 %), 1,8-cineole (10.0 %), linalool (7.2 %), and carvacrol (5.5 %) (Table 3), which could be the reason for its high antifungal activity [48]. In fact, several researchers evaluated the biological properties of T. vulgaris and verified that EO from this plant could inhibit fungal development [57,58]. These authors sustained that the remarkably antifungal potential was related to the high percentage of thymol that was the main active component of T. vulgaris EO. Thus, thymol can be the principal responsible compound for activity of T. vulgaris against C. auris . In fact, T. zygis was the second most potent oil and also contains a significant percentage of thymol (26.5 %), besides carvacrol (22.7 %), 1,8-cineole (7.2 %) and linalool (6.6 %). Previous investigations have claimed that antifungal activity of T. zygis could be related to the effect of their main compounds, thymol and p-cymene [56,59]. Even though T. satureioides and T. mastichina EOs have presented inhibition zones of 20.00 ± 0.63 mm and 13.60 ± 1.36 mm, respectively, their action against C. auris cells was not as significant as that of the other oils tested. The percentage of thymol of these oils (1.7 % and 4.4 %, respectively) is significantly lower compared to the T. vulgaris and T. zygis EOs (63.1 % and 26.5 %, respectively). The slight antifungal action may also be related to the high amount of the borneol, α-terpineol, and camphene in case of T. satureioides , and linalool, α-terpineol, and 1,8-cineole regarding T. mastichina . Although the activity of linalool, and other non-phenolic compounds is known [60], the interactions between the various
VAPOR-PHASE OF ESSENTIAL OILS TO FIGHT DRUG-RESISTANT CANDIDA VAGINAL ISOLATES | CHAPTER II.3 60 cultivation conditions described above. After 24 h of incubation, the cell cultures were treated with VPEOs, 25 µL of each EOs (100 %) were discarded in a sterile white disk that was placed next to the wells, the set was kept inside a plate of glass for another 24 h at 37 °C and 5 % CO2. After this time, the wells were washed twice with phosphate-buffered saline (PBS 1x) and then 80 µL of MTS (CellTiter 96 Aquoous One Solution Cell Proliferation Assay, Promega) with 1 % phenol-free DMEM was added to each glass well for 1 h. After this time, the absorbance (OD 490 nm) was measured in a microplate reader (HEALES “MB580”, Shenzhen, China). The VP-EOs cytotoxicity results were expressed as the percentage of viable cells in relation to the OD 490 nm of cells cultured without VP-EOs (100 % cell viability). These experiments were performed twice, and each analysis was performed in duplicate. 2.2 Microorganisms and initial culture conditions For this study, C. albicans (n=3), C. glabrata (n=8), C. krusei (n=1) and C. guilliermondii (n=1) vaginal isolates belonging to a collection of yeasts created by the Candida Research Group of Centre of Biological Engineering of University of Minho, in the scope of a large-scale recovery of vaginal specimens of Candida , carried out in Health Centers and University Campus of North of Portugal, were used [73]. The identity of all isolates was obtained by PCR-based sequencing using specific primers (ITS1 and ITS4) against the 5.8S subunit gene [73,91]. Minimum inhibitory concentration (MIC) for each species was determined by the Epsilometer-test (E-test) methodology and according to the guidelines provided by the manufacturer. Fernandes et al. [73] also tested reference strains with MICs characterized by the CLSI19 microdilution method to ensure the reliability of the E-test results. In addition, a potential interpretation of MICs based on CLSI M6022 was also performed [73]. All the isolates used are at least resistant to one of the antifungal agents (fluconazole, ketoconazole or caspofungin) [92,93]. Table 5 presents the MIC of each antifungal and also the features reported by women at the moment of vaginal sample collection, including symptoms of vaginal infection, previous vaginal infections, use of over-the-counter antifungals and relevant health conditions. This study followed the Data Protection Legislation and was approved by the Portuguese Health Ethical Commissions (SECVS-UM 092/2017, CES-S Norte 49/218, CESHB 151/2018, CES-USLAM 23/2018, CESHSOG 5/2018) [73]. Candida isolates were kept at –80 ± 2 °C in Sabouraud Dextrose Broth medium (SDB; Liofilchem) with 20 % (v/v) glycerol (Biochem). Prior to each assay, the isolates were subcultured on Sabouraud Dextrose Agar (SDA; Liofilchem) plates and incubated at 37 °C for 24 h. Then, 3-5 colonies of Candida isolates were inoculated onto SDB for 18 h at 37 °C under agitation (120 rev/ min). After that, centrifuged at 5000 g for 10 min at 4 °C and washed twice with PBS. The supernatants were discarded and the
VAPOR-PHASE OF ESSENTIAL OILS TO FIGHT DRUG-RESISTANT CANDIDA VAGINAL ISOLATES | CHAPTER II.3 61 pellets were suspended in SDB. For the subsequent analyses, the cellular density of the pre-inocula was adjusted to 1 x 108 or 1 x 105 cells mL-1, depending on the intended analysis, using a Neubauer haemocytometer (Marienfeld, Lauda-Königshofen, Germany).
VAPOR-PHASE OF ESSENTIAL OILS TO FIGHT DRUG-RESISTANT CANDIDA VAGINAL ISOLATES | CHAPTER II.3 62 Table 5. List of vaginal isolates used in this study and respective data, including species, features of the women at the moment of sample collection and minimum inhibitory concentration (MIC) of fluconazole, ketoconazole and caspofungin for each isolate Species Isolate Women’s features MIC (µg mL-1) Symptoms of infection Previous infections Use of over-the-counter antifungals Relevant conditions Fluconazole Ketoconazole Caspofungin C. glabrata Cg1 Yes Yes 96 (R) 2 (R) 0.25 (I) Cg2 Yes Yes 64 (R) 2 (R) 0.19 (I) Cg3 Yes Diabetes 16 (SDD) 1.5 (R) 0.19 (I) Cg4 Yes 4 (SDD) 0.032 (S) 0.5 (R) Cg5 Yes Yes 8 (SDD) 1.5 (R) 0.064 (S) Cg6 Yes Yes >256 (R) 1.5 (R) 0.032 (S) Cg7 Yes Cancer 16 (SDD) 1.5 (R) 0.064 (S) Cg8 Yes Yes IUD >256 (R) 6 (R) 0.047 (S) C. albicans Ca1 Yes Yes Yes 1 (S) 0.032 (S) 1 (R) Ca2 Yes Yes Pregnancy 64 (R) 32 (R) 0.064 (S) Ca3 Yes Yes Auto-immune disease >256 (R) 0.38 (S) 0.19 (S) C. krusei Ck1 Yes Yes 64 (R) 3(R) 0.38 (I) C. guilliermondii Cgi1 8 0.023 32 (R)
VAPOR-PHASE OF ESSENTIAL OILS TO FIGHT DRUG-RESISTANT CANDIDA VAGINAL ISOLATES | CHAPTER II.3 63 2.3 Evaluation of the antifungal activity of essential oils 2.3.1 Growth inhibition analysis The inhibitory activity of the EOs selected in point 2.1.1 (tea tree, niaouli and cajeput) on the growth of the drug-resistant Candida isolates was evaluated using the disk-diffusion agar method [94]. Briefly, SDA plates were inoculated by using a swab dipped in cell suspensions (pre-inocula) adjusted 1 x 108 cells mL-1. Then, 25 µL of each EO (100 %) were discarded on sterile blank disks (Liofilchem®) and placed atop of the plates (disks without EO were also included as control). The SDA plates were incubated for 24 h (at 37 °C) and then, the inhibition zones induced by the EOs were measured (mm). 2.3.2 Effect of the vapor-phase of essential oils on biofilms The effect of the VP-EOs on biofilm formation and on mature biofilms (24 h-old) of one strain of each Candida species ( C. glabrata , C. albicans, C. krusei and C. guilliermondii ) was evaluated. The strains and the EO for this assay were selected based on the results of the evaluation of the antimicrobial activity of the EOs in point 2.3.1. Biofilms were developed as described by Stepanović et al . [15], with some modifications due to the use of volatile compounds. In order to determine the effect of Tea Tree VP-EO (VP-TTEO) on biofilm formation, Candida cellular suspensions adjusted to 1 x 105 cells mL-1 were transferred to glass wells (1 mL per well) and 25 µL of tea tree EO (100 %) was discarded on a sterile blank disk which was placed near the wells (the set was kept inside a glass plate, as demonstrated in subchapter II.1). Plates were incubated for 24 h at 37 °C under agitation in an orbital shaker (120 rev min-1). Additionally, biofilms were pre-formed during 24 h and, after this time, incubated in the presence of 25 µL of tea tree EO discarded on a sterile blank disk, for additional 24 h. As control, biofilms were formed without any contact with the VP-TTEO during 24 h and 48 h. Biofilms were analyzed by the following parameters: determination of the Candida cultivable cells number through the colony-forming units (CFU) counting methodology, quantification of biofilm biomass by staining with crystal violet (CV), determination of metabolic activity by XTT reduction assay and evaluation of biofilm cell morphology by scanning electron microscope (SEM) [95,55]. 2.3.2.1 Quantification of Candida biofilm cultivable cells The number of cultivable cells in the biofilms was estimated using the CFU counting methodology. Briefly, the biofilms were washed with PBS, to remove non-adherent cells, and then scraped from the wells with 1 mL of PBS. The suspensions obtained were serially diluted to 108 in PBS and then plated on
VAPOR-PHASE OF ESSENTIAL OILS TO FIGHT DRUG-RESISTANT CANDIDA VAGINAL ISOLATES | CHAPTER II.3 64 SDA. SDA plates were incubated (24 h at 37 °C) and the number of colonies grown was counted and translated into CFU per milliliter (Log (CFU mL-1)) [95]. 2.3.2.2 Quantification of Candida biofilm biomass To quantify the biomass resulting from the EO assay, the biofilms treated with VP-TTEO and the respective controls were fixed with 1 mL of methanol, which was removed after 15 min and dried at room temperature. After, 1 mL of CV (1 %) were added to each well and incubated for 5 min. The glass wells were then gently washed with sterile, ultra-pure water and 1 mL of acetic acid (33 %) added to release and dissolve the stain. Thus, 200 µL of the solution obtained from each glass well was immediately transferred to a microtiter plate and the absorbance of each condition was read at 570 nm in triplicate, on a microtiter plate reader (Thermo Scientific™ Multiskan™ FC, Finland)[55]. 2.3.2.3 Quantification of metabolic activity of Candida biofilms cells An XTT reduction assay was used to determine the biofilm metabolic activity after contact with VPTTEO. So, the culture medium was aspirated after 24 h or 48 h, and non-adherent cells were removed by washing with PBS. Then, 200 μL of a solution containing 100 μg μL-1 of XTT (2,3-(2-methoxy-4-nitro5-sulphophenyl)-5-[(phenylamino)carbonyl]-2H-tetrazolium ydroxide) (Sigma–Aldrich, USA) and 10 μg μL1 of phenazine methosulphate (PMS) (Sigma–Aldrich, USA) was added to each well and incubated at 37 °C (120 rev min-1) for 3 h in the dark, protected by aluminum foil. Thus, 150 µL were transferred from each glass well to a microtiter plate and the colorimetric changes were measured at 490 nm using a microtiter plate reader (HEALES “MB580”, Shenzhen, China) [95,96]. 2.3.2.4 Scanning electron microscopy (SEM) To examine the morphology of the biofilm cells after contact with VP-EOs, the biofilms treated with VP-TTEO and the respective controls were analyzed by SEM. For this, biofilms formed on glass coupons, under the same conditions and as described above, for 24 h were dehydrated with ethanol (using 70 % ethanol for 10 min, 95 % ethanol for 10 min and 100 % ethanol for 20 min). The samples were kept in a desiccator for at least 48 h. Prior to observation, coupons were sputtered with gold and observed with Phenom Desktop SEM [95].
VAPOR-PHASE OF ESSENTIAL OILS TO FIGHT DRUG-RESISTANT CANDIDA VAGINAL ISOLATES | CHAPTER II.3 65 2.4 Statistical analysis The Prism software package (GraphPad Software version 6.01) was used to perform the statistical analysis of the results obtained in this study. For that, the cell cultivability of biofilms treated with VP-TTEO was compared with that of untreated biofilms using one-way ANOVA (analysis of variance) and Tukey's multiple comparisons test (confidence level of 95 % and statistical significance was assumed at p < 0.05). For all assays, three independent experiments were carried out (independent pre-inocula) and each analysis was performed in duplicate. 3. Results and Discussion This study evaluated the antifungal activity of EOs and of their VP against antifungal-resistant vaginal isolates of various Candida species. Approximately 50 % of the isolates were collected from women with symptoms of vaginal infection (with VVC) and the remaining from asymptomatic women (colonized with Candida organisms) (Table 5). Importantly, almost all women reported one or more vaginal infections prior to the collection of the drug-resistant strains, suggesting that previous antifungal treatments may have contributed to the acquisition of resistance [77,78]. Additionally, the use of over-the-counter antifungals to treat self-diagnosed VVC, which was reported by 30 % of the women of this study (Table 5), can also be suggested to contribute to the selection of low-susceptible strains [93,97]. Moreover, some women reported IUD use, pregnancy, or immunocompromised conditions (Table 5), so these women are at greater risk of developing VVC and, consequently, are more likely to fail treatment [98,99]. Of note, that all the clinical vaginal isolates used during this study are at least resistant to one of antifungal agents (fluconazole, ketoconazole and caspofungin) (Table 5). Indeed, the extremely limited options to treat VVC caused by drug-resistant strains make the development of new strategies, to meet the drug-resistance challenge, crucial [100]. EOs appear as a potential alternative, presenting low toxicity and the main advantage of natural antimicrobial agents of avoiding the development of antifungal resistance [101– 103]. The cytotoxic effect of the tea tree, niaouli, cajeput and white thyme VP-EOs was determined against the 3T3 cell line (Figure 15). Viability of the unexposed to VP-EOs cell cultures (control) was set at 100 % to compare with the responses of the cell cultures exposed to VP-EOs. In cultures exposed to VP-EOs of tea tree, cajeput and niaouli, the viability was superior to 70 %. However, the viability of cultures incubated with VP of white thyme EOs was inferior to 70 %. So, the results (Figure 15) show that VP of tea tree,
VAPOR-PHASE OF ESSENTIAL OILS TO FIGHT DRUG-RESISTANT CANDIDA VAGINAL ISOLATES | CHAPTER II.3 66 cajeput and niaouli EOs were not cytotoxic, since the relative cell viability is lower than 70 % of the control (no EOs), based on ISO 10993-5:2009 [104]. Figure 15. Vapor-phase of essential oils (VP-EOs) cytotoxicity, expressed as the percentage of viable cells in relation to the absorbance values (OD 490 nm) of cells cultured without VP-EOs (100 % cell viability). The dashed line stands for the normative limit of 70 % metabolic activity (ISO 10993-5:2009). An initial screening of the non-cytotoxic EOs in test was performed, for this the antifungal activity of tea tree, cajeput and niaouli EOs against antifungal-resistant isolates of C. albicans, C. glabrata, C. guilliermondii and C. krusei was evaluated, using the disk-diffusion agar method and the results are summarized in Table 6. The results revealed that all EOs were able to inhibit the growth of the tested isolates, although with different impacts (Table 6). Tea tree EO had the greater inhibitory effect (2039 mm of inhibition zone), followed by cajeput (1021 mm) and niaouli (1017 mm) EOs (Table 6). Among the isolates, the highest inhibition was found in C. glabrata Cg1 and the lowest in C. krusei Ck1 (Table 6). Previous studies have also reported high antifungal activity of tea tree EOs against susceptible and drug-resistant strains of various Candida species, including C. albicans, C. glabrata and C. krusei [18,105,106]. In fact, tea tree EO was found to increase yeast cell permeability and membrane fluidity and to inhibit the acidification of the medium [107]. Important, the antifungal activity of EOs has been shown to be influenced by several factors such as, original species, geographic and climatic conditions, biological and physical-chemical properties of the soil and storage conditions [108]. As such, an adequate control of these factors may allow the maximization of the antifungal activity of EOs.
VAPOR-PHASE OF ESSENTIAL OILS TO FIGHT DRUG-RESISTANT CANDIDA VAGINAL ISOLATES | CHAPTER II.3 67 Table 6.AntiCandida activity of essential oils on drug-resistant isolates evaluated through the disk-diffusion method Species Isolate Essential Oil Inhibition zone (mm) Tea tree Cajeput Niaouli C. glabrata Cg1 39.0 ± 1.7 21.0 ± 2.6 13.0 ± 2.0 Cg2 29.7 ± 0.6 18.8 ± 1.5 12.7 ± 1.2 Cg3 28.0 ± 0.0 10.3 ± 0.5 10.4 ± 0.9 Cg4 34.0 ± 1.0 14.8 ± 0.5 12.8 ± 0.5 Cg5 26.3 ± 4.9 19.3 ± 3.8 16.0 ± 1.0 Cg6 32.8 ± 3.2 19.0 ± 1.7 15.8 ± 2.2 Cg7 20.5 ± 1.0 10.5 ± 1.0 10.5 ± 1.0 Cg8 20.0 ± 0.8 10.3 ± 0.5 10.0 ± 0.0 C. albicans Ca1 22.5 ± 2.4 25.5 ± 3.5 10.8 ± 1.0 Ca2 24.8 ± 2.4 21.5 ± 1.3 12.8 ± 1.3 Ca3 23.8 ± 0.5 18.7 ± 1.5 10.8 ± 0.5 C. krusei Ck1 21.8 ± 2.1 12.3 ± 0.6 12.0 ± 1.3 C. guilliermondii Cgi1 28.0 ± 8.9 20.3 ± 2.5 17.3 ± 2.9 One of the most important virulence factors of Candida species is their ability to form biofilms, which promote the development of VVC and make its treatment extremely difficult and often ineffective [105]. Therefore, there is an urgent need for more effective, low-toxic and not expensive solutions to treat biofilm-related VVC. EOs have been suggested as a promising solution due their ability to inhibit the biofilm formation and reduce pre-formed biofilms of various Candida species, including C. albicans, C. glabrata, C. parapsilosis and C. krusei [106]. Furthermore, EOs present high volatility and their VP was shown to possess higher antimicrobial activity than the liquid phase [89,107]. Inouye et al . [108] suggested that EOs in their aqueous state, lipophilic molecules associate to form micelles and thus suppress their binding to organisms, while those in the vapor-phase allow free binding. As such, this study investigated, for the first time, the effect of the VP-EO on Candida biofilm formation and on pre-formed biofilms of antifungalresistant strains ( C. albicans Ca2, C. guilliermondii Cgi1, C. glabrata Cg7 and C. krusei Ck1). Importantly, C. albicans Ca2 and C. krusei Ck1 present an extremely high resistance to fluconazole, the most prescribed antifungal agent, C. glabrata Cg7 is resistant to ketoconazole, a less common azole, and C. guilliermondii Cgi1 present resistance to caspofungin, a highly toxic antifungal (Table 5). Tea tree EO was selected for the assays with biofilms, due their high antifungal activity against these drug-resistant isolates (Table 6).
VAPOR-PHASE OF ESSENTIAL OILS TO FIGHT DRUG-RESISTANT CANDIDA VAGINAL ISOLATES | CHAPTER II.3 68 In order to study the effect of VP-TTEO on the biofilm formation (Figure 16) and pre-formed biofilms (Figure 17) of antifungal-resistant Candida isolates ( C. albicans Ca2, C. guilliermondii Cgi1, C. glabrata Cg7 and C. krusei Ck1), the number of cultivable cells (Figure 16.A and Figure 17.A), the total biomass (Figure 16.B and Figure 17.B), metabolic activity (Figure 16.C and Figure 17.C) and cells morphology (Figure 16.D and Figure 17.D) were evaluated.
VAPOR-PHASE OF ESSENTIAL OILS TO FIGHT DRUG-RESISTANT CANDIDA VAGINAL ISOLATES | CHAPTER II.3 69 Figure 16. Effect of the vapor-phase of tea tree essential oil (VP-TTEO) on the biofilm formation of antifungalresistant Candida isolates. Biofilms of Candida albicans Ca2, Candida guilliermondii Cgi1, Candida glabrata Cg7 and Candida krusei Ck1 were developed in the absence (control) and presence of the VP-TTEO. (A) Number of cultivable cells (Log CFUs mL-1); (B) Absorbance values of Crystal Violet solutions (Abs CV) and (C) Absorbance values of XTT solutions (Abs XTT). * indicate statistical reduction of biofilms cell cultivability in comparison with the respective control (* p< 0.1, ** p< 0.01, *** p< 0.001, **** p< 0.0001). (D) Scanning electron microscope (SEM) images. The bar represents 30 µm (lower magnification image) or 10 µm (higher magnification image).
EFFECT OF ESSENTIAL OILS ON DRUG-RESISTANT CANDIDA STRAINS | CHAPTER II 76 [74] Harriott MM, Lilly EA, Rodriguez TE, et al. Candida albicans forms biofilms on the vaginal mucosa. Microbiology (Reading) 2010;156:3635–44. https://doi.org/10.1099/mic.0.039354-0. [75] Auler ME, Morreira D, Rodrigues FFO, et al . Biofilm formation on intrauterine devices in patients with recurrent vulvovaginal candidiasis. Med Mycol 2010;48:211–6. https://doi.org/10.3109/13693780902856626. [76] Ramage G, Rajendran R, Sherry L, et al. Fungal biofilm resistance. Int J Microbiol 2012;2012:1–14. https://doi.org/10.1155/2012/528521. [77] Kalaiarasan K, Singh R, Chaturvedula L. Fungal profile of vulvovaginal candidiasis in a tertiary care hospital. Journal of Clinical and Diagnostic Research 2017;11:DC06–9. https://doi.org/10.7860/JCDR/2017/23578.9475. [78] Marchaim D, Lemanek L, Bheemreddy S, et al. Fluconazole-resistant Candida albicans vulvovaginitis. Obstet. Gynecol. 2012;120:1407–14. https://doi.org/10.1097/AOG.0b013e31827307b2. [79] Nagashima M, Yamagishi Y, Mikamo H. Antifungal susceptibilities of Candida species isolated from the patients with vaginal candidiasis. J. Infect. Chemother 2016;22:124–6. https://doi.org/10.1016/j.jiac.2015.08.008. [80] Rodrigues ME, Silva S, Azeredo J, et al. Novel strategies to fight Candida species infection. Crit Rev Microbiol 2014;7828:1–13. https://doi.org/10.3109/1040841X.2014.974500. [81] Cowan MM. Plant products as antimicrobial agents. Clin Microbiol Rev 1999;12:564–582. https://doi.org/10.1128/cmr.12.4.564. [82] Sardi JCO, Almeida AMF, Mendes Giannini MJS. New antimicrobial therapies used against fungi present in subgingival sites - A brief review. Arch Oral Biol 2011;56:951–9. https://doi.org/10.1016/j.archoralbio.2011.03.007. [83] Doddanna SJ, Patel S, Sundarrao MA, et al. Antimicrobial activity of plant extracts on Candida albicans : an in vitro study. Indian J Dent Res 2013;24:401–5. https://doi.org/10.4103/0970-9290.118358. [84] Sardi JCO, Scorzoni L, Bernardi T, et al. Candida species: Current epidemiology, pathogenicity, biofilm formation, natural antifungal products and new therapeutic options. J Med Microbiol 2013;62:10–24. https://doi.org/10.1099/jmm.0.045054-0. [85] Soliman S, Alnajdy D, El-Keblawy AA, et al. Plants’ natural products as alternative promising antiCandida drugs. Pharmacogn Rev 2017;11:104–122. https://doi.org/10.4103/phrev.phrev_8_17. [86] Sharifi-Rad J, Sureda A, Tenore GC, et al . Biological activities of essential oils: From plant chemoecology to traditional healing systems. Molecules 2017;22:pii:E70. https://doi.org/10.3390/molecules22010070. [87] Hammer KA, Carson CF, Riley T V. Antifungal activity of the components of Melaleuca alternifolia (tea tree) oil. J Appl Microbiol 2003;95:853–60. https://doi.org/10.1046/j.1365-2672.2003.02059.x. [88] Cannas S, Usai D, Tardugno R, et al . Chemical composition, cytotoxicity, antimicrobial and antifungal activity of several essential oils. Nat Prod Res 2016;30:332–9. https://doi.org/10.1080/14786419.2015.1060592. [89] Mandras N, Nostro A, Roana J, et al . Liquid and vapour-phase antifungal activities of essential oils against Candida albicans and nonalbicans Candida . BMC Complement Altern Med 2016;16. https://doi.org/10.1186/s12906-016-1316-5. [90] Reyes-Jurado F, Navarro-Cruz AR, Ochoa-Velasco CE, et al. Essential oils in vapor phase as alternative antimicrobials: A review. Crit Rev Food Sci Nutr 2019;60:1641–50. https://doi.org/10.1080/10408398.2019.1586641. [91] Williams DW, Wilson MJ, Lewis MAO, et al. Identification of Candida species by PCR and restriction fragment length polymorphism analysis of intergenic spacer regions of ribosomal DNA. J Clin Microbiol 1995;33:2476–2479. https://doi.org/10.1128/jcm.33.9.2476-2479.1995. [92] Clinical and Laboratory Standards Institute (CLSI). M38 Reference method for broth dilution antifungal susceptibility testing of yeasts. Third. 2017.
EFFECT OF ESSENTIAL OILS ON DRUG-RESISTANT CANDIDA STRAINS | CHAPTER II 77 [93] Richter SS, Galask RP, Messer SA, et al. Antifungal susceptibilities of Candida species causing vulvovaginitis and epidemiology of recurrent cases. J Clin Microbiol 2005;43:2155–62. https://doi.org/10.1128/JCM.43.5.2155-2162.2005. [94] Barry AL, Brown SD. Fluconazole disk diffusion procedure for determining susceptibility of Candida species. J Clin Microbiol 1996;34:2154–7. https://doi.org/10.1128/jcm.34.9.2154-2157.1996. [95] Silva S, Henriques M, Oliveira R, et al J. In vitro biofilm activity of nonCandida albicans Candida species. Curr Microbiol 2010;61:534–40. https://doi.org/10.1007/s00284-010-9649-7. [96] Hawser S. Comparisons of the susceptibilities of planktonic and adherent Candida albicans to antifungal agents: a modified XTT tetrazolium assay using synchronised C. albicans cells. J. Med. Vet. Mycol. 1996;34:149–52. [97] Cross EW, Park S, Perlin DS. Cross-Resistance of clinical isolates of Candida albicans and Candida glabrata to over-the-counter azoles used in the treatment of vaginitis. Microb. Drug Resist. 2000;6:155–61. https://doi.org/10.1089/107662900419474. [98] Zitvogel L, Apetoh L, Ghiringhelli F, et al. Immunological aspects of cancer chemotherapy. Nat Rev Immunol 2008;8:59–73. https://doi.org/10.1038/nri2216. [99] Aguin TJ, Sobel JD. Vulvovaginal candidiasis in pregnancy. Curr Infect Dis Rep 2015;17:30. https://doi.org/10.1007/s11908-015-0462-0. [100] Sobel JD, Sobel R. Current treatment options for vulvovaginal candidiasis caused by azole-resistant Candida species. Expert Opin Pharmacother 2018;19:971–7. https://doi.org/10.1080/14656566.2018.1476490. [101] Vukovic N, Milosevic T, Sukdolak S, et al. Antimicrobial activities of essential oil and methanol extract of Teucrium montanum . Evid based Complement Altern Med 2007;4:17–20. https://doi.org/10.1093/ecam/nem108. [102] Nenoff P, Haustein UF, Brandt W. Antifungal activity of the essential oil of melaleuca alternifolia (tea tree oil) against pathogenic fungi in vitro . Skin Pharmacol Physiol 1996;9:388–94. https://doi.org/10.1159/000211450. [103] Scalas D, Mandras N, Roana J, et al . Use of Pinus sylvestris L. (Pinaceae), Origanum vulgare L. (Lamiaceae), and Thymus vulgaris L. (Lamiaceae ) essential oils and their main components to enhance itraconazole activity against azole susceptible/not-susceptible Cryptococcus neoformans strains. BMC Complement Altern Med 2018;18. https://doi.org/10.1186/S12906-018-2219-4. [104] International standard: ISO 10993-5 Biological evaluation of medical devices (Part 5): Tests for in vitro cytotoxicity, 2009. [105] Calderone RA, Fonzi WA. Virulence factors of Candida albicans . Trends Microbiol 2001;9:327–335. https://doi.org/10.1016/S0966-842X(01)02094-7. [106] Jafri H, Ahmad I. Thymus vulgaris essential oil and thymol inhibit biofilms and interact synergistically with antifungal drugs against drug resistant strains of Candida albicans and Candida tropicalis . J Mycol Med 2020;30:100911. https://doi.org/10.1016/j.mycmed.2019.100911. [107] Tyagi AK, Malik A. Liquid and vapour-phase antifungal activities of selected essential oils against Candida albicans : Microscopic observations and chemical characterization of cymbopogon citratus . BMC Complement Altern Med 2010;10:65. https://doi.org/10.1186/1472-6882-10-65. [108] Inouye S, Abe S, Yamaguchi H, et al. Comparative study of antimicrobial and cytotoxic effects of selected essential oils by gaseous and solution contacts. International Journal of Aromatherapy 2003. https://doi.org/10.1016/S0962-4562(03)00057-2. [109] Pantanella F, Valenti P, Natalizi T, et al . Analytical techniques to study microbial biofilm on abiotic surfaces: pros and cons of the main techniques currently in use. Ann Ig 2013;25:31–42. https://doi.org/10.7416/AI.2013.1904. [110] Haynes K. Virulence in Candida species. Trends Microbiol 2001;9:591–6. https://doi.org/10.1016/S0966-842X(01)02237-5.
78 CHAPTER III VAGINAL MICROBIOTA CONDITIONS Vulvovaginal candidiasis is a disease that affects millions of women worldwide. Conventional treatments often involve oral formulations, topical creams, or ointments, with an increase in drug administration through vaginal canal. The use of simulated biological fluids (e.g. vaginal fluid) in the evaluation of antifungal therapies may better replicate real biological environments, providing a better understanding of the behavior of the antifungal agents in the complex context of the female reproductive system. An essential consideration in the development of new therapies is the impact on the vaginal microbiome, a diverse community of microorganisms that naturally colonizes the vaginal mucosa. This microbiome plays a crucial role in maintaining the overall health and homeostasis of the vaginal environment. Particularly remarkable are species like Lactobacillus , which are believed to be beneficial for preserving this delicate balance. In fact, the balance of the vaginal ecosystem results from synergistic and complex interactions established between the different microorganisms that colonize the vaginal mucosa. A healthy vaginal microbiota predominantly comprises Lactobacillus species. Therefore, any therapeutic intervention, including antifungal therapies, must carefully consider not only their efficacy against Candida species but also their potential impact on the beneficial members of the microbiome. Achieving this balance is essential for women's overall well-being.
79 CHAPTER III.1 SIMULATED VAGINAL FLUID: CANDIDA RESISTANT STRAINS’ BIOFILM CHARACTERIZATION AND VAPORPHASE OF ESSENTIAL OIL EFFECT Figure 18. Subchapter III.1 workflow. The use of simulated biological fluids, such as vaginal fluid, in the assessment of antifungal therapies could offer a more realistic representation of biological environments. This approach may contribute to a better understanding of the antifungal's behavior. So, the main objective of this subchapter was to compare planktonic growth and biofilm formation of Candida species, on common growth medium and on vaginal simulation conditions, simulated vaginal fluid. Furthermore, the essential oils effect against biofilms of these Candida species was also evaluated. This subchapter is based on the following publication: Fernandes L, Costa R, Henriques M, Rodrigues ME. Simulated Vaginal Fluid: Candida resistant strains’ biofilm characterization and vapor phase of essential oil effect. J Mycol Med 2022:101329. https://doi.org/10.1016/J.MYCMED.2022.101329.
SIMULATED VAGINAL FLUID: CANDIDA RESISTANT STRAINS’ BIOFILM CHARACTERIZATION AND VAPOR-PHASE OF ESSENTIAL OIL EFFECT | CHAPTER III.1 80 1. Introduction Vulvovaginal candidiasis (VVC) is a very common disease, which affects about 70 % of women at least once during their childbearing years [1,2]. In fact, approximately 138 million women worldwide suffer up to 4 episodes of recurrent VVC (RVVC) per year, due to treatment failure [3]. The most common pathogen is Candida albicans ; however, the abundance of nonCandida albicans Candida (NCAC) has increased over time in VVC infections, particularly in RVVC [4,5]. Among the available antifungals, azoles are the most frequently used drugs in the treatment of VVC. Nevertheless, increasing rates of resistance to azoles class threaten the effectiveness of these agents, in both C. albicans and NCAC species [6]. Of the NCAC species, Candida glabrata has shown higher rates of resistance to azoles agents, Candida krusei (teleomorph Pichia kudriavzevii ) is intrinsically resistant to azoles and Candida guilliermondii , despite the low incidence of candidemia caused by this organism, has particular clinical significance as it exhibits increased resistance to antifungal agents, compared to other Candida species [7,8]. In fact, the biofilm formation, characteristic of this species, leads to high levels of resilience to common antifungal agents, requiring long and intensive therapies [9,10]. Oral formulations, topical creams or ointments are the most conventional pharmaceutical forms [11]. Indeed, drug administration to the vaginal via has gained increasing attention in past decades [11,12]. The vaginal epithelium is usually coated with a surface film of moisture, the vaginal fluid. Vaginal fluid is composed of cervical fluid (contain epithelial glycogen carbohydrates, amino acids, aliphatic acids, and proteins) and small amounts of the secretion from Bartholin’s glands (contains a variety of antimicrobial substances, including lysozyme, lactoferrin, fibronectin, polyamines such as spermine and IgA) in the vaginal wall, which serve as a protective barrier against infections [11]. So, the use of simulated biological fluids in in vitro evaluation of antifungal therapies is a promising technique which can allow a better understanding of the antifungal’s behavior within biological environments, helping to determine mechanisms of action and potentially predict in vivo behavior [13]. Essential oils (EOs) have been suggested as potential alternative treatment, with strong antiCandida effect reported combined with lower side effects, lower toxicity and better biodegradability when compared to available antimicrobial agents [14,15]. So, the administration of EOs through their vaporphase (VP-EOs) can be used for the local release of volatile and bioactive compounds from EOs directly at the local of action (vaginal epithelium). In fact, in Chapter II and Mandras et al. [16] had already shown greater activity for the growth of Candida species, avoiding direct contact of the EO with the skin. In this study, two EOs (oregano and white thyme) were selected, due to their characteristics. White thyme EO is recognized for respiratory tract cleansing and calming properties, furthermore, it is described in the
SIMULATED VAGINAL FLUID: CANDIDA RESISTANT STRAINS’ BIOFILM CHARACTERIZATION AND VAPOR-PHASE OF ESSENTIAL OIL EFFECT | CHAPTER III.1 81 literature that it was able to inhibit the growth of NCAC species resistant to conventional antifungals [17– 19]. In turn, Oregano EO has purifying and stimulating properties and it is, also, described in the literature that it was able to inhibit, in vitro , the germination and development of the filamentous form of C. albicans and to induce a significant reduction in biofilm formation [19,20]. The most important objective of this subchapter was to compare planktonic growth and biofilm formation of drug-resistant Candida species between common growth medium and under vaginal simulation conditions. For this purpose, a synthetic medium with physical and chemical properties very similar to those of vaginal secretions from health women was used. In addition, under the same conditions this study also investigated the ability of VP-EOs to inhibit biofilm formation and to destroy mature biofilms of these vaginal isolates. 2. Materials and Methods 2.1 Microorganisms and initial culture conditions For this study, C. albicans, C. glabrata, C. krusei and C. guilliermondii vaginal isolates, recovered from patients and identified as resistant to antifungal agents, belonging to a collection of yeasts created by the Candida Research Group of Centre o Biological Engineering were used [21] (Subchapter II.3). Candida isolates were stored at –80 ± 2 ºC in Sabouraud Dextrose Broth (SDB; Liofilchem) medium with 20 % (v/ v) glycerol. The isolates were subcultured from the frozen stock onto Sabouraud Dextrose Agar (SDA; Liofilchem) plates and incubated during 24 h. Then, colonies from SDA plates were used to inoculate SDB for 18 h at 37 ºC under agitation (120 rev min-1). The cellular suspensions were centrifuged at 5000 g for 10 min at 4 ºC and washed twice with Phosphate Buffered Saline (PBS x1). This study evaluated the antifungal activity of two EOs (oregano EO ( Origanum compactum , florame®, Portugal) and white thyme EO ( Thymus satureiodes ; florame®, Portugal)) with 100 % purity (chemical composition in Annex I.4 and I.5). EO’s products were stored in the dark at room temperature. 2.2 Simulated Vaginal Fluid Simulated Vaginal Fluid (SVF) was modified from Sosinska et al . and Owen & Katz [22,23], and consisted of 58 mM NaCl (Biochem), 18 mM KOH (AppliChem), 2 mM Ca(OH)2 (Frilabo), 1.75 mM glycerol (Biochem), 6.7 mM urea (Frilabo), 33 mM glucose (Biochem), and 6.7 g L-1 yeast nitrogen base (YNB) (Difco). In addition, natural compounds in the vaginal fluid as acetic acid (17 mM; pKa 54.76) and lactic acid (22 mM; pKa 53.85) were added to maintain the pH at 4.2.
SIMULATED VAGINAL FLUID: CANDIDA RESISTANT STRAINS’ BIOFILM CHARACTERIZATION AND VAPOR-PHASE OF ESSENTIAL OIL EFFECT | CHAPTER III.1 82 2.3 Effect of Simulated Vaginal Fluid and Sabouraud Dextrose Broth on vaginal Candida isolates 2.3.1 Planktonic growth Vaginal Candida isolates cells from the pre-inoculum were cultivated in SVF or SDB (pH at 5.6 measured by digital pH meter (edge®, Hanna)). Cultures of Candida cells (1 × 105 cells mL-1) were placed in 25 mL Erlenmeyer flasks, maintained at 37 °C with agitation (120 rev min-1) and the increase in optical density, at 620 nm, was measured over time using a microtiter plate reader (Thermo Scientific™ Multiskan™ FC, Finland). The results were presented as optical density along 24 h of growth, measured at every 3 h [24]. 2.3.2 Biofilm formation The biofilm’s growth and structure of the vaginal Candida isolates ( C. glabrata, C. albicans, C. krusei and C. guilliermondii ) was evaluated. For this, the biofilms were developed as described in the previous Chapter and by Stepanović et al. [25], with some modifications. Briefly, Candida cellular suspensions were adjusted to 1 x 105 cells mL-1, in SDB or SVF, and transferred, under aseptic conditions, to 96-well flat tissue culture plates (polystyrene, Orange Scientific, Braine-L’Alleud, Belgium) (200 µL per well). Culture plates were incubated for 24 h at 37 ºC under agitation in an orbital shaker (120 rev min-1) conditions, during 24 h and 48 h. Biofilms were analysed through the colony-forming units (CFUs) counting methodology and observed under scanning electron microscopy (SEM) [26,27]. The number of cultivable cells in the biofilms formed in SDB or SVF was assessed using the CFUs counting methodology. Briefly, after 24 h or 48 h, the biofilms were washed with PBS, to remove nonadherent cells, and then scraped from the wells with 1 mL of PBS. The obtained suspensions were serially diluted in PBS and plated onto SDA. The SDA plates were incubated for 24 h at 37 ºC and then, the number of grown colonies was counted. The results were presented as colony-forming units per square centimeters (Log (CFU cm-2 )). In order to examine and compare the biofilm structure of the drug-resistant Candida isolates formed in SDB or in SVF, they were observed by SEM. For that, biofilms formed in steel coupons, as described above, for 24 h, were dehydrated with ethanol (using 70 % ethanol for 10 min, 95 % ethanol for 10 min and 100 % ethanol for 20 min) and air dried for 20 min. The samples were kept in a desiccator for at least 24 h. Prior to observation, the coupons were subjected to sputter coated with gold and observed with an S-360 SEM (Leo, Cambridge, MA, USA) [28].
SIMULATED VAGINAL FLUID: CANDIDA RESISTANT STRAINS’ BIOFILM CHARACTERIZATION AND VAPOR-PHASE OF ESSENTIAL OIL EFFECT | CHAPTER III.1 83 2.4 Effect of the vapor-phase of essential oils on biofilms The effect of the VP-EOs (oregano and white thyme EOs) on biofilm formation and on mature biofilms (24 h-old) of four clinical isolates of Candida species ( C. glabrata, C. albicans, C. krusei and C. guilliermondii ) was evaluated. Biofilms were developed as described above, with some modifications due to the use of volatile compounds (Chapter II). In order to determine the effect of VP-EOs on biofilm formation, Candida cellular suspensions adjusted to 1 x 105 cells mL-1 were transferred to glass wells (1 mL per well) and 25 µL of each EOs (100 %) was discarded on a sterile blank disk, which was placed near the wells (the set was kept inside a glass plate). Plates were incubated for 24 h at 37 ºC under agitation in an orbital shaker (120 rev/ min). Additionally, biofilms were pre-formed during 24 h and, after this time, they were incubated in the presence of 25 µL of EOs placed on a sterile blank disk, for an additional 24 h. As control, biofilms were formed without any contact with the VP-EOs during 24 h and 48 h. Biofilms were analyzed through determining the number of Candida cultivable cells through CFUs counting methodology, as described above. 2.5 Statistical analysis The results obtained in this study were statistically analyzed using the Prism software package (GraphPad Software version 6.01). For that, the cell cultivability of biofilms formed in SVF or in SDB, or treated with VP-EOs was compared with that of untreated biofilms using one-way ANOVA and Dunnett's multiple comparisons test. All tests were performed with a confidence level of 95 %. For all assays, three independent experiments were carried out (independent pre-inocula) and each analysis was performed in duplicate or triplicate. Statistical significance was assumed at p < 0.05. 3. Results and Discussion The administration of drugs to the vaginal via has gained increasing attention, highlighting the need for reliable in vitro methods to evaluate the performance of new formulations or therapies [29]. Thus, in a first step, the planktonic growth of four Candida vaginal isolates under simulating vaginal environment conditions (SVF at pH 4.2) and SDB medium was monitored and compared along 24 h (Figure 19). The four Candida species used ( C. albicans Ca2, C. guilliermondii Cgi1, C. glabrata Cg7 and C. krusei Ck1) were selected from a previous work (Subchapter II.3), as antifungal-resistant strains. The SDB complex medium (pH 5.6 ± 0.2), which contains pancreatic digest of casein, peptic digest of animal tissue and dextrose, is recommended for yeast isolation, qualitative procedures and for the culture or subculture of
SIMULATED VAGINAL FLUID: CANDIDA RESISTANT STRAINS’ BIOFILM CHARACTERIZATION AND VAPOR-PHASE OF ESSENTIAL OIL EFFECT | CHAPTER III.1 84 fungi from clinical and non-clinical species [30]. The low pH and high concentration of dextrose promotes the growth of yeast while inhibiting bacterial growth [30]. On the other hand, the SVF proposed by Sosinska et al. and Owen & Katz [22,23] (with some modification), which was used in this study has been used to simulate the composition of vaginal fluids and to test the diffusion and permeation of new drug delivery systems [23,29]. SVF used as the growth medium consists of YNB with modified concentrations of calcium, potassium, chloride and sodium ions, in agreement with concentrations in the vaginal fluid of healthy premenopausal women during the non-menstrual phase [23,29]. The medium also contained glycerol, urea and glucose, which served as the main source of carbon. SVF was buffered at pH 4.2 using the physiological buffers found in the vaginal fluid, i.e lactic acid and acetic acid [23,29]. In healthy women, Lactobacillus species produces lactic acid, which act as buffer and maintains the pH of vagina between 4.0 and 5.0 (acidic), depending on a woman's menstrual cycle. Hydrogen peroxide (H2O2) and bacteriocins are also produced, which resist the overgrowth of pathogenic microbes. During pregnancy, the pH drops (3.84.4) and in post-menopause the pH increases (7.0-7.4) [11]. In planktonic conditions, all Candida isolates had a similar growth rate between both culture medium (SDB and SVF) along 24 h. Despite, the SVF had only a slight effect on the growth rate of C. albicans Ca2 (Figure 19.A), C. guilliermondii Cgi1 (Figure 19.B) and C. glabrata Cg 7 (Figure 19.C) cells. Moreover, the growth rate of C. krusei Ck1 with SDB and SVF was parallel, and after 24 h the same growth rate was observed (Figure 19.D). This led us to conclude that the SVF is also a good medium to isolate and culture or subculture the Candida species.
SIMULATED VAGINAL FLUID: CANDIDA RESISTANT STRAINS’ BIOFILM CHARACTERIZATION AND VAPOR-PHASE OF ESSENTIAL OIL EFFECT | CHAPTER III.1 85 Figure 19. Simulated Vaginal Fluid (SVF) and Sabouraud Dextrose Broth (SDB) on vaginal Candida isolates planktonic cells. Planktonic growth curves of (A) Candida albicans Ca2, (B) Candida guilliermondii Cgi1, (C) Candida glabrata Cg7 and (D) Candida krusei Ck1 cells cultivated in SVF and SDB over 24 h. After the overgrowth of the Candida species, the colonization of the vaginal epithelium occurs and consequently the transformation from asymptomatic to symptomatic, leading to biofilm formation [31]. So, the biofilm formation (24 h and 48 h) of Candida isolates under conditions simulating the vaginal environment (SVF at pH 4.2) and SDB medium was compared (Figure 20 and Figure 21). Biofilms were analyzed through determining the CFUs counting methodology (Figure 20) and by SEM (Figure 21).
VAPOR-PHASE OF WHITE THYME ESSENTIAL OIL IMPACT ON CANDIDA ALBICANS AND LACTOBACILLUS GASSERI COLONIZATION| Chapter III.2 92 2. Materials and Methods 2.1 Microorganisms and culture conditions In this study, 3 C. albicans clinical isolates resistant to one of antifungal agents (fluconazole, ketoconazole and caspofungin) belonging to a collection of yeasts created by the Candida Research Group of the Centre of Biological Engineering of University of Minho [21], and a reference strain of Lactobacillus gasseri ATCC 33323 (acquired from DSMZ), were used. The Candida isolates and L. gasseri were kept in Sabouraud Dextrose Broth (SDB; Liofilchem, Italy) and in Mann Rogosa and Sharpe broth (MRS, Liofilchem) broth, respectively, both with 20 % (v/ v) glycerol (Biochem Chemopharma, France), at -80 ± 2 ºC. These species were sub-cultured from the frozen stock onto Sabouraud Dextrose Agar (SDA; Liofilchem) ( Candida isolates) and MRS agar ( L. gasseri ) plates and incubated for 24 h at 37 ºC, L. gasseri was incubated in a 5 % CO2 environment in saturated humidity. Before the test, the pre-inoculum of C. albicans was prepared in SDB with colonies grown on SDA plates (18 h at 37 ºC and under agitation at 120 rev/ min) and L. gasseri was pre-cultured in MRS Broth twice with 1 % (v/ v) taken directly from the cryovial (24 h at 37 °C in an environment of 5 % CO2 in saturated humidity). So, the cellular suspensions were centrifuged and washed twice with Phosphate Buffered Saline (PBS) (5000 g for 10 min, at 4 ºC). The assays of this work were carried out in simulated vaginal fluid (SVF). SVF consisted of 58 mM NaCl (Biochem Chemopharma, France), 33 mM glucose (Biochem), 18 mM KOH (AppliChem), 2 mM Ca(OH)2 (Frilabo), 1.75 mM glycerol (Biochem), 6.7 g L-1 yeast nitrogen base (YNB) (Difco), 6.7 mM urea (Frilabo) and acetic acid (17 mM; pKa 54.76) and lactic acid (22 mM; pKa 53.85) were added to maintain the pH at 4.2, as described in subchapter III.1. 2.2 Essential oils The antifungal activity of VP-WTEO ( Thymus satureiodes; florame®, France) was evaluated. White thyme EO (WTEO) was tested 100 % pure and stored in the dark at room temperature. From the analysis carried out by the company florame®, it became known that the major compounds in the WTEO are borneol (31 %), α-terpineol (16 %) and carvacrol (9 %) (Subchapter II.1). For this analysis, the company used Gas Chromatography (GC) with Flame-Ionisation Detection (FID): the hydrogen carrier gas; the polar Elite-WAX column (100 % polyethylene glycol) (60 m/ 0.25 mm/ 0.25 µm) and the non-polar Elite-5 columns (5 % diphenyl, 95 % dimethylpolysiloxane) (60 m/ 0.25 mm/ 0.25 µm) (Annex I.4).
VAPOR-PHASE OF WHITE THYME ESSENTIAL OIL IMPACT ON CANDIDA ALBICANS AND LACTOBACILLUS GASSERI COLONIZATION| Chapter III.2 93 2.2.1 Essential oil cytotoxicity The cytotoxicity of the WTEO was tested using the in vivo Galleria mellonella larvae model [47]. For that, a group of 10 G. mellonella larvae was exposed to VP-WTEO for 72 h. Initially, G. mellonella larvae were raised in the dark at 25 °C, with a diet based on pollen grains. Afterward, the larvae selected according to the development stage, approximately 250 mg, were placed in glass Petri dishes in the presence of the WTEO (25 µL-placed in a glass well), allowing the diffusion of the oil without direct contact with the larvae, in a controlled atmosphere with a volume of 1.5x 106 cm3. After that, larvae were kept at 37 °C in the dark, without nutrition. As a negative control, a set of larvae was maintained under the same conditions, except for exposure to VP-WTEO. The survival and morphology of the larvae were monitored, and survival curves were constructed, as described by Araújo et al . [47]. In this type of test, larvae are considered dead when they show no movement after touch. 2.3 Susceptibility of Candida albicans to white thyme essential oil The disk diffusion method based on Barry and Brown [48] and as described in the previous chapter, was used to evaluate the effect of WTEO on drug-resistant clinical isolates of C. albicans (Ca1, Ca2, Ca3). Swabs dipped in the cell solution adjusted to 1 x 108 cells mL-1 were used to inoculate SDA plates. After the plates were completely dry, 25 µL of the WTEO (100 %) was applied in sterile white disks (Liofilchem®) on the plates. Negative (vegetable oil) and positive (cell suspension) controls were performed. The plates were incubated at 37 °C for 24 h and inhibition zone diameters were measured (mm). 2.4 Antifungal activity of vapor-phase of white thyme essential oil on biofilms The effect of the VP-WTEO on biofilm formation and on mature biofilms (24 h-old) of C. albicans (Ca2) was evaluated. Biofilms were developed as described in Chapter II in order to allow the diffusion of volatile compounds and their interaction with microorganisms. To determine the effect of VP-WTEO on biofilm formation, 1 mL of Candida cell suspension adjusted to 1 x 105 cells mL-1 was transferred to a glass well and 25 µL of WTEO (100 %) was discarded on a sterile blank disk. The set was kept inside a glass plate and the plates were incubated (24 h at 37 ºC, 120 rev/ min). Once formed, the biofilms were incubated in the presence of VP-WTEO for another 24 h. As a control, biofilms were formed without exposure to VP-WTEO for 24 h or 48 h. The VP-WTEO effect on biofilms was analysed by (2.4.1) quantification of biofilm biomass by staining with crystal violet (CV) and (2.4.2) determination of metabolic activity by XTT reduction assay [26,49].
VAPOR-PHASE OF WHITE THYME ESSENTIAL OIL IMPACT ON CANDIDA ALBICANS AND LACTOBACILLUS GASSERI COLONIZATION| Chapter III.2 94 2.4.1 Quantification of Candida biomass For biomass quantification, biofilms were fixed with 1 mL of methanol, after 15 min was removed and allowed to dry at room temperature. After drying, 1 mL of CV (1 %) was added to each well and incubated for 5 min. Then, the biofilms were washed with sterile ultrapure water and completely dry, and afterwards 1 mL of acetic acid (33 %) was added. Thus, 200 µL of this solution, from each glass well, was transferred to a microtiter plate and the absorbance of each condition was read at 570 nm in triplicate, using a microtiter plate reader (Thermo Scientific™ Multiskan™ FC, Finland). 2.4.2 Quantification of metabolic activity of Candida cells Biofilm metabolic activity was determined by the XTT (2,3-(2-methoxy-4-nitro-5-sulphophenyl)-5- [(phenylamino)carbonyl]-2H-tetrazolium hydroxide) reduction assay. For this, the culture medium was removed, and biofilms washed with PBS. Then, 200 µL of a solution containing 10 µg µL-1 of phenazine methosulfate (PMS, Sigma–Aldrich, USA) plus 100 µg µL-1 of XTT (Sigma–Aldrich) was added to each well and incubated for 3 h at 37 °C (130 rpm) in the dark. Then, similar to the previous procedure, 150 µL from each glass well was transferred to a microtiter plate and the colorimetric changes were measured at 490 nm using a microtiter plate reader (HEALES “MB580”, Shenzhen, China). 2.5 Effect of vapor-phase of white thyme essential oil in colonization of Candida albicans and Lactobacillus gasseri of a reconstituted human vaginal epithelium The commercially reconstituted human vaginal epithelium (RHVE) (0.5 cm2; SkinEthic Laboratories, France) was used as a mean to mimic an in vitro model of vaginal candidiasis to study the effect of the VP-WTEO on colonization prompted by C. albicans and/or L. gasseri [50,51]. For that, RHVE tissue inserts (0.5 cm2) were placed in glass wells. To study single species infection, 4 RHVE tissues were infected with 1 mL of standardized suspension (1x 107 cells mL-1) of C. albicans or L. gasseri strains separately, prepared as previously described in the SVF. In dual species studies, C. albicans suspension (500 µL; 2x 107 cells mL-1) was combined with L. gasseri suspension (500 µL; 2x 107 cells mL-1) and used to infected two RHVE tissues. To determine the effect of VP-WTEO on microorganisms RHVE colonization, two infected tissues of each condition were incubated in the presence of 25 µL of WTEO (100 %) on glass petri dishes. As negative control, two infected tissues of each condition were tested in the absence of the WTEO. All tissues were incubated at 37 °C in a 5 % CO2 environment in saturated humidity, with agitation of 120 rpm for 24 h.
VAPOR-PHASE OF WHITE THYME ESSENTIAL OIL IMPACT ON CANDIDA ALBICANS AND LACTOBACILLUS GASSERI COLONIZATION| Chapter III.2 95 After the incubation, the tissues were washed with PBS to remove non-adherent microorganism’s cells. Subsequently, the tissues were used for (2.5.1) histological analysis and for (2.5.2) molecular studies. Additionally, the activity of lactate dehydrogenase (LDH) was also evaluated to evaluate indirectly the damage of microorganisms caused on the epithelium (2.5.3) [51]. 2.5.1 Histological analysis and microscopic observation The part of the RHVE tissue intended for histology processing was initially fixed in 2 % (v/ v) paraformaldehyde and stored at room temperature. Using standard histological techniques, tissue was embedded in paraffin wax and 20 µm sections were cut and placed on HistoBond+ coated microscope slides. Afterwards, the sections were dewaxed by processing through xylene, immersed in ethanol and then in water and stained with the periodic acid Schiff method (staining of keratinocytes and Candida or Lactobacillus cells). Then, the sections were analyzed in bright field using an Olympus BX51 epifluorescence microscope coupled to a DP72 digital camera (Olympus Portugal SA, Portugal) and the images were acquired using Olympus Cell-B software. 2.5.2 Quantification of Candida and Lactobacillus cells in RHVE Candida’s and Lactobacillus’ DNA present in tissues under different conditions was extracted using the DNA extraction kit (DNeasy Blood & Tissue Kit, Qiagen). The DNA from each tissue was quantified using the NanoDrop 1000 Spectrophotometer (Thermo Fisher Scientific, USA). Both species were quantified using qRT-PCR (quantitative real-time PCR) employing a CF X96 qRT-PCR system (Bio-Rad, Berkeley, USA). For quantification, a final reaction volume of 10 µL was prepared, consisting of 2 µL of DNA, 5 µl of working concentration SsoFast EvaGreen Supermix, 0.1 µL of each primer (Table 7) and 2.8 µL of H2O. Negative controls were performed, replacing the DNA with nuclease-free water. Table 7. Primers for real time-PCR assay for quantification of Candida albicans and Lactobacillus gasseri cells in reconstituted human vaginal epithelium Target Primer Sequence (5´-> 3´) Candida albicans Forward GAGCGTCGTTTCTCCCTCAAACCGCTGG Reverse GGTGGACGTTACCGCCGCAAGCAATGTT Lactobacillus gasseri Forward AGGCACTAGAAGCCGATGAA Reverse CACTGCGTCTTCCTTCAACA The PCR cycling conditions for the L. gasseri and C. albicans involved of an initial denaturation step at 98 °C (2 min) or 95 °C (3 min), then 40 cycles of denaturation at 98 °C (5 s) or 95 °C (10 s)
VAPOR-PHASE OF WHITE THYME ESSENTIAL OIL IMPACT ON CANDIDA ALBICANS AND LACTOBACILLUS GASSERI COLONIZATION| Chapter III.2 96 and primer annealing at 55 °C (5 s) or 55 °C (30 s), respectively. The same PCR protocols were used to construct calibration curves (threshold cycle (CT) values vs Log of cells) for both species (Figure 24), obtained from serial dilutions of known cell concentrations, as described by Alves et al. [51]. Figure 24. The standard calibration curve of threshold cycle (CT) values vs Log number of cells. 2.5.3 Lactate dehydrogenase (LDH) assay To measure epithelial cell damage, the CytoTox-ONE Homogeneous Membrane Integrity Assay kit (Promega) was used to determine the release of LDH from the RHVE in the culture medium. LDH activity was analyzed in a spectrophotometer (FLUOstar OPTIMA; BMG Labtech, Ortenberg/Germany) at 560 nm excitation and 590 nm emission. The LDH released during infection or co-infection and treatment with VP-WTEO for both species was expressed as LDH activity in relation to the infected epithelium and the untreated epithelium. Also, the VP-WTEO effect on tissue expressed as LDH activity relative to tissue with SVF (control) was evaluated. All experiments were performed in triplicate. 2.6 Statistical analysis The results were statistically analysed using the Prism software package (GraphPad Software version 8.01). One-way ANOVA (analysis of variance) or two-way ANOVA was performed, Tukey`s multiple comparison test. Results were expressed as mean ± standard deviation (SD) and the statistical analyses performed were considered significant when p <0.05. y = -2,0745x + 35,379 R² = 0,9668 0 5 10 15 20 25 30 35 0 2 4 6 8 10 Threshold cycle (CT) Log number of cells
VAPOR-PHASE OF WHITE THYME ESSENTIAL OIL IMPACT ON CANDIDA ALBICANS AND LACTOBACILLUS GASSERI COLONIZATION| Chapter III.2 97 3. Results and Discussion Under healthy conditions, the vaginal mucosa is inhabited by several microorganisms, including bacteria and fungi, which normally coexist and interact with each other and with the host. However, several factors can upset this balance and lead to the development of diseases [41]. In fact, it is well established that the decreased of vaginal lactobacilii population is linked with the decrease in vaginal health. Thus, it is imperative the development of new therapeutic approaches for VVC, that do not cause an imbalance and disruption in the remaining microbiota. According to previous work, EOs and especially the VP-EOs have shown great antifungal activity against drug-resistant Candida species (Subchapter II.3 and III.1). Therefore, it is crucial to understand the effect induced by this new alternative (VP-EOs) in vaginal Lactobacillus species as well. For this, in the first step, the cytotoxicity of VP-WTEO was evaluated. The model of G. mellonella larvae is widely used to study the effectiveness of new antimicrobial compounds, immune responses and, in this study, cytotoxicity. Among other advantages, the wax model is suitable for these toxicological studies due to its functional and structural similarity to the innate immune response of mammals [52]. Therefore, the in vivo toxicity of VP-WTEO was evaluated from G. mellonella, where it was found that after 72 h of exposure to VP-WTEO, there was no evidence of toxicity (Figure 25). In fact, 100 % of larvae remained alive with no significant differences in larvae exposed and not exposed to VP-WTEO. Figure 25. Vapor-phase of white thyme essential oil (VP-WTEO) toxicity measured in in vivo Galleria mellonella model. Survival curves of G. mellonella larvae exposed to VP-WTEO and respective control (without exposure to VPWTEO). There was no significant difference between control and VP-WTEO exposure.
VAPOR-PHASE OF WHITE THYME ESSENTIAL OIL IMPACT ON CANDIDA ALBICANS AND LACTOBACILLUS GASSERI COLONIZATION| Chapter III.2 98 Then, the antifungal activity of WTEO against planktonic cells of resistant antifungal isolates of C. albicans (n=3) was evaluated (Table 8) through the agar disk diffusion method, evaluated by the halo diameter formed (Dhalo). Table 8. AntiCandida activity of white thyme essential oil on drug-resistant vaginal isolates. Results obtained from the agar disk diffusion method and zones of inhibition measured through the diameter of the halo (Dhalo) in millimeters (mm) Species Isolate Dhalo (mm) C. albicans Ca1 22.8 ± 0.5 Ca2 22.5 ± 1.7 Ca3 24.7 ± 0.6 The analysis of Table 8 shows that WTEO induced a large inhibitory effect in all clinical isolates, with Dhalo ranging from 22.5 mm to 24.7 mm. These results agree with other studies that also reported high antifungal activity of WTEO against drug-resistant strains of various Candida species [53–57]. The anticandidal activity of thyme has been suggested to be related to morphological changes in Candida cells including shrinkage of the cell membrane, disruption of cell membrane permeability and leakage of intracellular material [58,59]. WTEO is complex mixture of compounds extracted by steam distillation of flowering tops, characterized by high concentrations of borneol, α-terpineol and carvacrol. Hammer et al . [60] observed that the components with lower values of Minimum Inhibitory Concentration (MIC) and Minimum Fungicidal Concentration (MFC) in Candida species were terpinen-4-ol and α-terpineol. Indeed, the antimicrobial activity of terpenes, at higher concentrations has been attributed to their interactions with cell membranes and consequent total loss of homeostasis and severe membrane damage and death, and at relatively low concentrations, these interactions can result in changes such as inhibition of respiration and change in permeability [60–63]. Furthermore, these components also showed relatively rapid killing effects against C. albicans in time-of-kill assays. In addition to this compound, borneol was previously reported to disrupt C. albicans biofilm formation [63]. However, the diffusion method results are only an initial screening of the work, since the EOs effect can differ depending on the direct application or only exposure to the vapor-phase. The antifungal activity when applied directly depends on its diffusibility and solubility in the liquid phase, while the activity when only exposed to VP-EOs depends on its volatility [16, 64]. So, the VP-WTEO effect on Candida biofilm formation and on pre-formed biofilms of fluconazole and ketoconazole resistant strain ( C. albicans Ca2)
VAPOR-PHASE OF WHITE THYME ESSENTIAL OIL IMPACT ON CANDIDA ALBICANS AND LACTOBACILLUS GASSERI COLONIZATION| Chapter III.2 99 was then evaluated, this strain was selected as it presented an extremely high level of resistance to fluconazole (Subchapter II.3). In this sense, some factors were quantified to determine the VP-WTEO effect, such as the number of cultivable cells (data presented in previous subchapter III.1), biofilm biomass (Figure 26.A), and the metabolic activity of biofilm cells (Figure 26.B). Figure 26. Effect of the vapor-phase of white thyme essential oils (VP-WTEO) on the biofilm formation and preformed biofilm of antifungal-resistant Candida albicans Ca2. (A) Biofilm biomass (Abs CV) and (B) metabolic activity (Abs XTT). * indicate statistical reduction of biofilms cell cultivability in comparison with the respective control (* p < 0.1, ** p < 0.01, *** p < 0.001, **** p < 0.0001). Previous work demonstrated that VP-WTEO led to the inhibition of biofilm formation and reduction of mature biofilm of C. albicans Ca2 (Subchapter III.1). So, from this result previously obtained with the results of the biomass quantification and the metabolic activity of the biofilm cells, it was observed that the VP-WTEO has an effect against the drug resistant C. albicans biofilms. Indeed, the cell cultivability of biofilms developed in the presence of the VP-WTEO showed a significant reduction, ranging from 1 to 2 orders of magnitude (Log CFU cm-2), in comparison to the absence of VP-WTEO (Subchapter III.1). Regarding the quantification of biomass and metabolic activity, the results showed a significant reduction, ranging from 18 - 56 % (Figure 26.A) and 37 % (Figure 26.B), respectively. This set of results confirms the effectiveness of VP-WTEO in these two stages of biofilms, not only in inhibition biofilms formation, but also impacting already biofilms formed in an already organized structure. In fact, previous work has reported that the vapor generated by EOs has a greater antimicrobial impact compared to the EOs liquid phase when applied by direct contact. Furthermore, a study carried out by Wang et al . [65], demonstrated that the antiC albicans activity of borneol (major constituent of WTEO) in the vapor-phase was significantly
VAPOR-PHASE OF WHITE THYME ESSENTIAL OIL IMPACT ON CANDIDA ALBICANS AND LACTOBACILLUS GASSERI COLONIZATION| Chapter III.2 100 greater than in the liquid phase. The authors observed that concentrations lower than the MIC values of the liquid phase of borneol reduced (60 - 99 %) the germ tube formation of C albicans ATCC 10231 [65]. Germ tube formation and biofilm integrity in Candida species, mainly C. albicans , are important virulence factors. The germ tube (filamentous form) allows penetration into deeper layers of the mucosa and confers greater resistance to phagocytosis, facilitating the transition from the state of harmless symbiosis to a pathogen [63]. The fact that the antifungal activity of EO molecules in the vapor-phase does not require direct contact, suggests that such EOs can be used in the prevention and treatment of several diseases, such as VVC. The effect of new antifungal therapies on other colonizing species is extremely important. Therefore, in this work a RHVE was used and co-colonization by C. albicans and L . gasseri was induced. This procedure aimed to evaluate the effect of the developed therapy (VP-WTEO) on beneficial species of the vaginal microbiome, such as Lactobacillus . For this purpose, the species of L. gasseri was selected due to its predominance in vaginal environments and also because it was recently shown to inhibit growth of C. albicans , both in planktonic and in mixed biofilms, resulting in enhanced loss of yeast cell viability [66–68]. The infection, co-infection and subsequent VP-WTEO effect of RHVE by C. albicans and L. gasseri were evaluated after 24 h and the results confirm the efficacy of VP-WTEO against the C. albicans colonization (Figure 27 and 28). Figure 27. Effect of the vapor-phase of white thyme essential oil (VP-WTEO) on single and co-colonization of Candida albicans with Lactobacillus gasseri of the reconstituted human vaginal epithelium (RHVE) after 24 h. (A) Number
VAPOR-PHASE OF WHITE THYME ESSENTIAL OIL IMPACT ON CANDIDA ALBICANS AND LACTOBACILLUS GASSERI COLONIZATION| Chapter III.2 101 of cells (Log cells/ tissue) on single and mixed colonization in relation to the treated RHVE (VP-WTEO). * indicate statistical reduction of number of cells in comparison with the respective control (*** p< 0.001, **** p< 0.0001). (B) Relative lactate dehydrogenase (LDH) activity measured in the culture supernatants after 24 h of single and cocolonization in relation to simulated vaginal fluid (&) and VP-WTEO effect (*). */& indicate statistical reduction of LDH activity in comparison with the respective control (*/& p< 0.1, ***p< 0.001). Figure 28. Effect of the vapor-phase of white thyme essential oils (VP-WTEO) on single and mixed colonization of Candida albicans and Lactobacillus gasseri in reconstituted human vaginal epithelium (RHVE) after 24 h. Image acquired by epifluorescence microscopy. The bar represents 50 µm and 20 µm. The results obtained from the PCR analysis (Figure 27.A) show a significant decrease in the number of cells occurring both in simple colonization (p< 0.001) and in co-colonization with L. gasseri (p< 0.0001). Furthermore, this reduction on colonization, after VP-WTEO exposure is notably observed in
VAGINAL MICROBIOTA CONDITIONS | Chapter III 108 [75] Dos Santos CI, França YR, Campos CDL, et al . Antifungal and Antivirulence Activity of Vaginal Lactobacillus Spp. Products against Candida Vaginal Isolates. Pathogens 2019, Vol 8, Page 150 2019;8:150. https://doi.org/10.3390/PATHOGENS8030150. [76] Xu J, Chatterjee M, Baguley TD, et al . Inhibitor of the Tyrosine Phosphatase STEP Reverses Cognitive Deficits in a Mouse Model of Alzheimer’s Disease. PLoS Biol 2014;12:e1001923. https://doi.org/10.1371/JOURNAL.PBIO.1001923. [77] Silva S, Henriques M, Oliveira R, et al . Characterization of Candida parapsilosis infection of an in vitro reconstituted human oral epithelium. Eur J Oral Sci 2009;117:669–75. https://doi.org/10.1111/J.16000722.2009.00677.X.
109 CHAPTER IV EFFECT OF OREGANO ESSENTIAL OIL IN CANDIDA INFECTION Vulvovaginal candidiasis (VVC), one of the most prevalent vaginal infectious diseases, faces increasing challenges attributed to drug-resistant Candida strains. Considering the therapeutic limitations, essential oils (EOs) are emerging as promising alternatives due to their high antimicrobial activity. Among these, oregano essential oil (OEO) stands out for its proven efficacy against Candida species resistant to conventional treatments. Nevertheless, the direct application of OEO presents some limitations, including cytotoxicity. Interestingly, vapor-phase of essential oils (VP-EOs) have more advantages than their direct application. Therefore, focusing exclusively on the vapor-phase application seems to be particularly effective. Thus, a comprehensive study of the mode of action of the vapor-phase of the OEO becomes crucial for potential clinical applications. In addition to vapor-phase application, microencapsulation emerges as an innovative approach to address the challenges associated with the direct application of OEO. This method aims to overcome the problems associated with OEO, providing protection, and facilitating a controlled and prolonged release of the OEO. Microencapsulation serves as a strategic solution, addressing concerns about cytotoxicity and enhancing the overall therapeutic potential of OEO. These advances mark a significant step in the search for effective and safe treatments for VVC, offering a comprehensive approach to harnessing the benefits of EOs while minimizing the associated disadvantages.
110 CHAPTER IV.1 EFFECT OF VAPOR-PHASE OREGANO ESSENTIAL OIL ON RESISTANT CANDIDA SPECIES BIOFILMS: MECHANISMS OF ACTION Figure 29. Subchapter IV.1 workflow. Oregano essential oil has gained attention for its remarkable efficacy against Candida species. This suggests that OEO may offer a valuable solution for the treatment of VVC. This subchapter aims to evaluate the effect of vapor-phase of oregano essential oil (VP-OEO) on biofilms of antifungal-resistant vaginal isolates of Candida species ( Candida albicans and Candida glabrata ) and determine its mode of action. Furthermore, a reconstituted vaginal epithelium was used to mimic vaginal conditions and evaluate the effect of VP-OEO on Candida species infection. This subchapter is based on the following publication: Fernandes L, Costa R, Silva S, Henriques M, Costade-Oliveira S, Rodrigues ME. Effect of Vapor-Phase Oregano Essential Oil on Resistant Candida Species Biofilms: Mechanisms of Action. Microbiol Spectr 2023;11. https://doi.org/10.1128/SPECTRUM.05124-22. And presented as poster: Fernandes L, Costa-de-Oliveira S, Costa R, Silva S, Henriques M, Rodrigues ME. Effect of vapor-phase essential oil on resistant Candida species: Mechanisms of action. FEMS Conference on Microbiology 2022, Belgrade, Serbia. And part of this subchapter was presented as poster: Fernandes L, Blázquez E, Tejada A., Ribeiro,A, Silva S, Mira N, Cussó L, Costa-de-Oliveira S, Rodrigues ME, Henriques M. Oregano Essential Oil: An Effective and NonToxic Approach for prevent or treat Resistant Candida Species. Congress of Microbiology and Biotechnology 2023 (FEMs grant), 2023, Covilhã, Portugal.
EFFECT OF VAPOR-PHASE OREGANO ESSENTIAL OIL ON RESISTANT CANDIDA SPECIES BIOFILMS: MECHANISMS OF ACTION | CHAPTER IV.1 111 1. Introduction Antimicrobial resistance is increasing over time, threatening the effective prevention and treatment of an ever-increasing range of infectious diseases [1]. One of the most common and frequent fungal infections is candidiasis, ranging from superficial mucosal infections (oral cavity, vagina, penis, gastrointestinal tract, or other parts) to systemic and potentially fatal diseases (disseminated candidiasis) [2]. Indeed, vulvovaginal candidiasis (VVC) affects millions of women of reproductive age every year, causing physical discomfort, pain, and mental distress and representing considerable direct and indirect costs [3,4]. VVC is caused by Candida species, namely, Candida albicans and Candida glabrata , both phenotypically and genetically different [5]. Although C. albicans is more frequently associated with candidiasis, the incidence of infections caused by C. glabrata is increasing, showing overall greater resistance to common antifungal agents, especially azoles [6–8]. These species are associated with biofilm formation, one of the main virulence factors associated with increased resistance to antifungal agents [6,7]. Even though several years ago, antifungal agents exerted a potent effect, these agents are currently no longer effective [9]. Thus, discovering new and effective alternative therapies or improving/reinventing already used therapies is fundamental. From the past until today, plants and their derivatives have been employed in traditional medicine, alternative medicine, or phytotherapeutic applications for the prevention and treatment of several diseases [10]. In this sense, essential oils (EOs) have been suggested as potential sources of new therapeutic products due to their antileishmanial, antiviral, anti-inflammatory, antioxidant, hepatoprotective, antitumor, and antimicrobial activities [11,12]. Furthermore, EOs have advantages such as fewer side effects, less toxicity, and better biodegradability than available antimicrobial agents [13]. These natural products are biosynthesized by glandular trichomes and other secretory structures in plants, being liquids that are particularly rich in volatile molecules such as monoterpenes and sesquiterpenes with their oxygenated derivatives (phenols, oxides, esters, ketones, and aldehydes), phenylpropanoids (alcohols, aldehydes, phenols, and short-chain aliphatic hydrocarbon), and nitrogenous or sulfured components [14,15]. The inhibitory activities of EOs against many fungal pathogens have been widely reported [16], including EOs from the Lamiaceae family such as Origanum species and Thymus species, which have been described as being particularly effective against various microorganisms, particularly Candida species [17–21]. In fact, oregano EO (OEO) was able to inhibit, in vitro , the germination and development of the filamentous form of C. albicans [8,17,22]. Moreover, Hacioglu et al . [23] also showed previously that OEO inhibits the three phases of Candida biofilms, i.e.,
EFFECT OF VAPOR-PHASE OREGANO ESSENTIAL OIL ON RESISTANT CANDIDA SPECIES BIOFILMS: MECHANISMS OF ACTION | CHAPTER IV.1 112 their adhesion, formation, and mature state. Those authors also showed the ability to reduce biofilm formation by up to 50 % when biofilms were formed on surfaces previously coated with OEO [23]. The literature provides information about the impact of the direct application of EOs on Candida species [10,11,16], but few data are available on the antifungal effect of the vapor-phase of essential oils (VP-EOs) [24], mainly on Candida species biofilms. Despite this, studies have shown that VP-EO showed greater antimicrobial activity than its liquid phase [25,26]. The objective of this subchapter was to evaluate the abilities of the vapor-phase of oregano essential oil (VP-OEO) to inhibit biofilm formation and destroy mature biofilms of antifungal-resistant vaginal isolates of Candida species. Furthermore, the mode of action of VP-OEO against two antifungal-resistant vaginal isolates of Candida species ( C. albicans and C. glabrata ) was evaluated. 2. Materials and Methods 2.1 Oregano essential oil This study evaluated the antifungal activity of oregano ( Origanum compactum ) EO (Florame, France) with 100 % purity. OEO samples were stored at room temperature under dark conditions. Chromatographic analysis (gas chromatography [GC]) of the OEO was performed by Florame (Saint-Rémy-de-Provence, France) (Annex I.5). The OEO samples were introduced into the GC system (6890 GC and 5975 mass spectrometry [MS] systems) under the following conditions: a 1-μL injection split of 1/200 was used, an HP5 MS capillary column (30 m/ 0.25 mm) with a film thickness of 0.25 μm was used, the column temperature was 60 °C to 250 °C, helium was used as the carrier gas at a constant flow rate of 1.0 mL min-1, and the mass range was set at 40 to 450 atomic mass units (amu). The acquisition time was 100 min. 2.1.1 Oregano essential oil cytotoxicity To assess the toxicity of VP-OEO, the Galleria mellonella survival model was used, and the rate of larval survival was determined. For this, 10 G. mellonella larvae were placed into glass petri dishes containing a glass well where the oil was placed (controlled atmosphere with a volume of 1.5 × 106 cm3), allowing its diffusion without contact with the larvae (Subchapter III.2). Larvae were stored at 37 °C under dark conditions, and larval survival was monitored over 72 h. In addition, the total number of hemocytes present in the hemolymph of the larvae after exposure to VP-OEO was evaluated at 4 h and 72 h, as described previously by Araújo et al. [27]. Briefly, 5 larvae sanitized with 70 % (v/ v) ethanol were
EFFECT OF VAPOR-PHASE OREGANO ESSENTIAL OIL ON RESISTANT CANDIDA SPECIES BIOFILMS: MECHANISMS OF ACTION | CHAPTER IV.1 113 punctured in the abdomen with a sterile needle, and the hemolymph was collected into a sterile microtube and diluted 10 times in phosphate-buffered saline (PBS). Next, the hemocytes were counted with a Neubauer chamber, and the results were presented as the logarithm of the concentration (Log10). The control was carried out in the same way, without the larvae being exposed to VP-OEO. All experiments were performed in triplicate in a minimum of three independent assays. 2.2 Microorganisms and culture conditions In this study, 13 drug-resistant Candida isolates, C. albicans (n = 3), C. glabrata (n = 8), C. krusei (n = 1), and C. guilliermondii (n = 1), belonging to the Biofilm Research Group of the Centre o Biological Engineering, were used (Subchapter II.3). The clinical isolates were subcultured from a frozen stock (Sabouraud dextrose broth (SDB; Liofilchem) medium with 20 % (v/ v) glycerol at −80 °C ± 2 °C) onto Sabouraud dextrose agar (SDA; Liofilchem) plates and incubated for 24 h. Prior to testing, a preinoculum was prepared in SDB with colonies from the SDA plates for 18 h at 37 °C under agitation (120 rpm). Next, the cellular suspensions were centrifuged and washed twice with PBS (5,000 × g for 10 min at 4 °C). For biofilm assays, vaginal Candida isolates cells were cultivated in simulated vaginal fluid (SVF). SVF consisted of 58 mM NaCl (Biochem), 18 mM KOH (AppliChem), 2 mM Ca(OH)2 (Frilabo), 1.75 mM glycerol (Biochem), 6.7 mM urea (Frilabo), 33 mM glucose (Biochem), and 6.7 g L-1 yeast nitrogen base (YNB;(Difco)). In addition, natural compounds in the vaginal fluid, such as acetic acid (17 mM; pKa, 54.76) and lactic acid (22 mM; pKa, 53.85), were added to maintain the pH at 4.2 as described previously in subchapter III.1 [28,29]. 2.3 Planktonic antimicrobial susceptibilities to oregano essential oil The inhibitory effects of direct contact with OEO (DC-OEO) and VP-OEO on the growth of 13 drugresistant Candida isolates were first evaluated by the agar disk diffusion method, as described in the previous chapters and by Tran et al . [30] and Vihanova et al . [31], with some modifications. Briefly, the agar surface was inoculated using a swab dipped in a cell suspension adjusted to 1 × 108 cells mL-1. After the inoculum was dried, a sterile filter paper disk (6 mm) (Liofilchem) was impregnated with 25 μL of OEO and directly and indirectly (for vapor-phase action) applied, that is, placed on top of the plates on the cell suspension (direct application) and placed on the cover of the SDA plate, without touching the cell suspension, and incubated inverted (indirect application). Plates with disks without OEO were also included as controls. All plates were then sealed with parafilm and incubated at 37 °C, and the diameters
EFFECT OF VAPOR-PHASE OREGANO ESSENTIAL OIL ON RESISTANT CANDIDA SPECIES BIOFILMS: MECHANISMS OF ACTION | CHAPTER IV.1 114 of the zones around the disks were measured within 24 h. All experiments were performed in triplicate. The experiments were carried out in glass petri dishes due to the high corrosive power of 100 % EOs, according to Chapter II. 2.4 Effect of the vapor-phase of oregano essential oils on biofilms The antifungal effects of the VP-OEOs on both biofilm formation and mature biofilms (24 h old) of two fluconazole-resistant Candida isolates ( C. glabrata Cg8 and C. albicans Ca2) were evaluated. The Candida isolate biofilms were developed as described previously in Chapter II and III and by Stepanović et al. [32]. After the pre-inoculum was resuspended and washed twice with PBS, the initial cell concentration was adjusted to 1 × 108 cells mL-1 in SVF. Next, the cellular suspension was transferred to glass wells inside glass petri plates (1 mL/ well) (controlled atmosphere with a volume of 1.5 × 106 cm3) and incubated aerobically for 24 h (120 rpm at 37 °C). The effect of the VP-OEO was evaluated from two different perspectives: (i) prophylactic treatment, where the therapeutic agent (25 μL of OEOs [100 %]) was placed on a sterile blank disk, which was positioned near the wells (the set was kept inside a glass plate), and added at time zero, and (ii) infection treatment, where the therapeutic agent was added to preformed biofilms (24 h). After 24 h of treatment, the wells were washed with a saline solution, and the resulting biofilm-cell suspensions were then serially diluted in PBS, plated onto SDA plates, and incubated aerobically for 24 h at 37 °C. Next, the number of grown colonies was counted. The results were expressed as Log CFU per milliliter. The experiment was performed in triplicate with three independent assays. 2.4.1 Determination of the mechanism of action 2.4.1.1 Biofilm time-dependent killing assay After the above-described assays, it was decided to perform this part of the study only with C. glabrata Cg8 and C. albicans Ca2 biofilms. The effect of VP-OEO on these species was evaluated by a time-dependent killing assay. This assay was performed according to methods described previously by Sumiyoshi et al. [33], with some modifications. Candida biofilms were formed as described above. Inhibition of both biofilm formation and preformed biofilms over time after exposure to VP-OEO (0, 2, 4, 8, 12, 14, 17, 18, and 24 h) was measured. For this, after antifungal treatment and subsequent washing with a saline solution, the suspensions were serially diluted in PBS, plated onto SDA plates, and incubated
EFFECT OF VAPOR-PHASE OREGANO ESSENTIAL OIL ON RESISTANT CANDIDA SPECIES BIOFILMS: MECHANISMS OF ACTION | CHAPTER IV.1 115 aerobically (24 h at 37 °C). Afterward, the number of grown colonies was counted, and the results were expressed as Log reductions in the CFU per milliliter. Each analysis was performed in triplicate. 2.4.1.2 Flow cytometry According to the biofilm time-dependent killing assay, preformed and mature biofilms of C. glabrata Cg8 and C. albicans Ca2 after 10, 12, 14, and 18 h of exposure to VP-OEO were analyzed by flow cytometry. Biofilms were formed as described above, and samples of 1 mL were collected after VP-OEO exposure. Candida cells killed by treatment with 70 % ethanol for 20 min and Candida cells without treatment were used as controls. The cells were centrifuged at 4 °C for 3 min at 10,000 × g, the pellets were resuspended and washed twice with PBS, the suspension concentration was adjusted to 1 × 106 cells mL-1, and the cells were counted in a Neubauer chamber, as described previously by Pina-Vaz et al . [34]. Two fluorescent probes were used, propidium iodide (PI) and FUN-1 {2-chloro-4-[2,3-dihydro-3methyl-(benzo-1,3-thiazol-2-yl)-methylidene]phenylquinolinium iodide}. To evaluate cell membrane integrity, cell suspensions were incubated for 30 min in the presence of PI (1.0 μg mL-1) (Sigma-Aldrich, Munich, Germany) in the dark at room temperature. To assess the metabolic activity, the cellular suspensions were centrifuged, and the pellets were resuspended in sterilized H2O supplemented with 2 % glucose and incubated in the presence of 0.5 μM FUN-1 (Invitrogen Molecular Probes, OR, USA) for 30 min with protection from light. For each isolate, nonstained cells (autofluorescence) and the fluorescence of nontreated and dead controls were also evaluated. The samples were analyzed with a FACSCalibur cytometer (BD Biosciences, Sydney, Australia) equipped with 3 photomultipliers (PMTs), standard filters, and a 15-mW, 488-nm argon laser using CellQuest Pro software (version 4.0.2). The cell scattergram (forward scatter [FS] and side scatter [SS]) and the intensity of fluorescence at fluorescent channel FL1 (green fluorescence, 530 nm), FL2 (yellow-green fluorescence, 575 nm), and FL3 (red fluorescence, 630 nm) were logged using a logarithmic scale. PI results are expressed as a percentage of cells showing high fluorescence in FL3, and FUN-1 results are expressed as the staining index (SI), defined as the ratio between the mean fluorescence of the treated cell suspensions (VP-OEO) and the value corresponding to the control cells (no exposure to VP-OEO), in FL2 [34]. Each assay was performed in triplicate. 2.4.1.3 Confocal laser scanning microscopy analysis In order to evaluate the cell morphology and viability of C. glabrata Cg8 and C. albicans Ca2 biofilms (biofilm formation and preformed biofilms) after 12 h of exposure to VP-OEO, the Live/ Dead
EFFECT OF VAPOR-PHASE OREGANO ESSENTIAL OIL ON RESISTANT CANDIDA SPECIES BIOFILMS: MECHANISMS OF ACTION | CHAPTER IV.1 116 BacLight bacterial viability kit (Molecular Probes, Leiden, The Netherlands) was employed. Briefly, biofilms were formed on glass coupons (inserted into the glass wells, as described above) after 12 h of exposure to VP-OEO, for both biofilm formation and preformed biofilms, and the coupons were washed with 0.85 % NaCl and then stained for 15 min in the dark with a mixture of SYTO-9 ((Invitrogen Molecular Probes, OR, USA) (3 μL mL-1) and PI (3 μL mL-1). Samples were observed using an Olympus (Tokyo, Japan) BX61 model FluoView 1000 confocal scanning laser microscope. The combination of optical filters consisted of a laser excitation line at 488 nm, emission filters BA 505 to 540 nm (green fluorescence) with an excitation line at 559 nm, and emission filters BA 575 to 675 nm (red fluorescence). Images were acquired and analyzed with the FV10-Ver4.1.1.5 program (Olympus). The assay was repeated two independent times with two technical replicates. 2.5 Effect of oregano essential oil on Candida species infection of a reconstituted human vaginal epithelium To mimic human vaginal conditions, a commercially reconstituted human vaginal epithelium (RHVE) (0.5 cm2; SkinEthic Laboratories) was infected with Candida species ( C. glabrata Cg8 and C. albicans Ca2), and the effect of VP-OEO on vaginal candidiasis attenuation was evaluated. For this, epithelia were infected with a cell suspension of C. glabrata and C. albicans (initial concentration adjusted to 1 × 108 cells mL-1 in SVF). Epithelia devoid of Candida cells but with SVF exposed and unexposed to VPOEO were used as controls. All epithelia were incubated for 24 h (120 rpm at 37 °C). After incubation, the tissues were washed once with PBS to remove nonadherent Candida cells. Epithelia were then bisected, with one half being used for histological analysis (2.5.1) and the other half being used for molecular studies (2.5.2) [35]. 2.5.1 Microscopic observation RHVE tissue for microscopic analysis was fixed in 2 % (v/v) paraformaldehyde, stored at room temperature, and embedded in paraffin wax using standard histological techniques. RHVE sections (20 μm) were cut, placed onto HistoBond+-coated microscope slides, and dewaxed by processing through xylene, followed by immersion in ethanol and then in water. The prepared sections were then stained using the periodic acid-Schiff method for keratinocyte and Candida cell staining. After histological processing, samples were analyzed in bright field using an Olympus BX51 epifluorescence microscope coupled with a DP72 digital camera (Olympus Portugal SA, Portugal). All tissue images were acquired using Olympus Cell-B software.
EFFECT OF VAPOR-PHASE OREGANO ESSENTIAL OIL ON RESISTANT CANDIDA SPECIES BIOFILMS: MECHANISMS OF ACTION | CHAPTER IV.1 117 2.5.2 Quantification of Candida cells DNA present in the tissues was extracted using a DNA extraction kit (DNeasy blood and tissue kit; Qiagen). Candida cells were quantified using real-time PCR by employing a CFX96 real-time PCR system (Bio-Rad, Berkeley, CA, USA). Each reaction mixture consisted of 10 μL of a working concentration of SsoFast EvaGreen supermix, 0.2 μL of each primer (Table 9) and 4 μL of DNA, in a final reaction mixture volume of 20 μL. Table 9. Primers for real time-PCR assay for quantification of Candida albicans and Candida glabrata cells Target Primer Sequence (5´-> 3´) Candida albicans Forward GAGCGTCGTTTCTCCCTCAAACCGCTGG Reverse GGTGGACGTTACCGCCGCAAGCAATGTT Candida glabrata Forward ATTTGCATGCGCTTGCCCACGAATCC Reverse ACGTCTGATCCAATCAATGGCTGGTGA Negative controls were performed using a reaction mixture with nuclease-free water replacing the DNA template. PCR cycling conditions consisted of an initial denaturation step at 94 °C for 3 min followed by 40 cycles of denaturation at 95 °C for 10 s and primer annealing at 55 °C for 30 s. For each Candida isolate, calibration curves (CT [threshold cycle] versus Log cells) were constructed using the same PCR protocol as the one described above (Subchapter III.2), from serial dilutions of Candida cell concentrations, as described previously by Alves et al. [35]. 2.5.3 Lactate dehydrogenase assay The release of lactate dehydrogenase (LDH) from the RHVE into the culture medium was used as a measure of epithelial cell damage using the CytoTox-ONE homogeneous membrane integrity assay kit (Promega). The LDH released during infection and VP-OEO treatment for the two Candida strains was expressed as LDH activity relative to the values for untreated C. albicans Ca2 and C. glabrata Cg8. In addition, the effect of VP-OEO on tissue, expressed as the LDH activity relative to that in tissue with SVF (control), was also evaluated. LDH activity was analyzed in a spectrophotometer (FLUOstar Optima; BMG Labtech, Ortenberg, Germany) at a 560-nm excitation wavelength and a 590-nm emission wavelength. All experiments were performed in triplicate.