PepT1 mRNA expression levels in sea bream (Sparus aurata) fed different plant protein sources

RESEARCH Open Access PepT1 mRNA expression levels in sea bream (Sparus aurata) fed different plant protein sources Genciana Terova 1,2* , Lidia Robaina 3 , Marisol Izquierdo 3 , AnnaGiulia Cattaneo 1 , Silvia Molinari 1 , Giovanni Bernardini 1,2 and Marco Saroglia 1,2 Abstract The expression and regulation of intestinal oligopeptide transporter (PepT)-1 when vegetable sources are used as a substitute for fish meal in the diet of marine fish has not yet been explored. In the present study, as part of our ongoing work on elucidating PepT1 gene expression in relation to different dietary treatments, we have now isolated and deposited in Genbank database (accession no. GU733710) a cDNA sequence representing the PepT1 in the sea bream (Sparus aurata). The “de novo”prediction of the three-dimensional structure of PepT1 protein is presented. We also analyzed diet-induced changes in the expression of PepT1 mRNA via real-time RT-PCR using the standard curve method. Sea bream were fed for 140 days with one of the following four diet formulations (43% protein/21% lipid): a control fast growth-promoting diet (C), and three diets with the same formulation but in which 15% of the fish meal was substituted by protein concentrates either from lupine (LPC), chick pea (CPC), or green pea (PPC). Fish fed PPC had significantly (p < 0.05) lower levels of PepT1 transcripts in the proximal intestine than the controls, whereas PepT1 transcript levels in fish fed LPC or CPC were not significantly different from the controls. Although growth was similar between fish fed with different diets during the first 72 days of feeding, growth of the fish fed with PPC was reduced during the second part of the trial and was significantly (p < 0.05) lower than fish fed LPC and CPC diets by the end of the experiment. Correlation between these results and fish growth performances highlights that the intestinal PepT1 mRNA level may serve as a useful marker of the dietary protein quality and absorption efficiency. Keywords: Oligopeptide transporter PepT1, Gene expression, Real-time PCR, Fish meal substitution, Vegetable ingredients, Fish diet, Aquaculture Introduction The end products of intestinal protein digestion in both teleosts and mammals constitute a mixture of free amino acids and small peptides that are efficiently absorbed across the small intestinal epithelium (Clements & Raubenheimer 2006). Two distinct types of brush border membraneassociated transport systems are involved in this process: (1) amino acid transport, which may or may not be sodium dependent; and (2) transport of small peptides (2–3amino acids) coupled to an H + gradient. Intestinal peptide transport is of major nutritional significance in that the intraluminal products of protein digestion are predominantly diand tripeptides, not amino acids as was widely believed over 30 years ago (Adibi 2003). Cellular uptake of small peptides is mediated by H +/coupled peptide transporter (PepT1), located at the brush border membrane of intestinal epithelial cells (Yuen et al. 2007). PepT1 is a low-affinity, high-capacity transporter that mediates electrogenic uphill transport of diand tripeptides from the apical membrane of the epithelial cells into the enterocytes. The transport is energized by a transmembrane electrochemical H + gradient directed from outside to inside. PepT1 has nutritional importance due to its dual role in intestinal absorption of a remarkable range of dietary protein-derived substrates and in reabsorption of * Correspondence: [email protected] 1 Department of Biotechnology and Life Sciences, University of Insubria, Via J. H. Dunant, 3 - 21100, Varese, Italy 2 Inter-University Centre for Research in Protein Biotechnologies “The Protein Factory”- Polytechnic University of Milan and University of Insubria, Varese, Italy Full list of author information is available at the end of the article a SpringerOpen Journal © 2013 Terova et al.; licensee Springer. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Terova et al. SpringerPlus 2013, 2:17 http://www.springerplus.com/content/2/1/17 peptide-bound amino nitrogen from glomerular filtrate in kidney (Daniel & Kottra 2004). The gene encoding the proton-coupled diand tripeptide transporter PepT1 was isolated first from rabbit small intestine. Fei et al. (Fei et al. 1994) cloned it in 1994 by microinjecting mRNA isolated from rabbit intestine into Xenopus oocytes, which resulted in functional expression of the protein. In subsequent years, PepT1 was characterized in great detail in higher vertebrates [mostly in mammals, but also in birds (for a review please see (Daniel et al. 2006). In contrast, information about this protein in lower vertebrates such as teleosts is limited, with the exception of PepT1 of the zebrafish (Danio rerio), Atlantic cod (Gadus morhua), Asian weatherloach, (Misgurnus anguillicaudatus), and sea bass (Dicentrarchus labrax). The functional activity and tissue expression pattern of PepT1 have been assessed in these species (Verri et al. 2003; Rønnestad et al. 2007; Gonçalves et al. 2007; Terova et al. 2009). The affinity of PepT1 and its stereoselective capacity differ for different types of peptides, suggesting that its activity and expression may be modulated through the diet, particularly when different protein sources are utilized (Ostaszewska et al. 2010a; Ostaszewska et al. 2010b). However, to our knowledge, there is no information regarding the response at the mRNA level of such transporter when vegetable sources are used as a substitute for fish meal in the diet of marine fish. Fish meal (FM) supply has become a limiting factor for the further development of fish feed production. Total annual world FM production is about 5–6 million tons (FAO 2010) and is predicted to remain stable for the next 10 years (Mazurkiewicz 2009). Increased FM cost, together with the limited availability, has encouraged the use of alternative sustainable sources of protein in fish feeds in the last few decades (Tacon & Metian 2008; Kaushik & Seiliez 2010). Thus, high rates of several terrestrial plant meals have been successfully included in the feed without affecting fish growth and production quality (Carter & Hauler 2000; Aslaksen et al. 2007; SánchezLozano et al. 2011). Nevertheless, plant protein sources differ greatly in nutritional value, not only as regards their amino acid profiles and digestibility but also their carbohydrate content and characteristics or the processing method (Francis et al. 2001; Drew et al. 2007; Gatlin et al. 2007; Glencross et al. 2007). Therefore, the degree of success differs for different types of plant proteins. Among these sources, protein concentrates of pea (Pisum sativum), lupin (Lupinus spp.), or chick pea (Cicer arietinum) have been considered as good candidates for replacing fish meal. For instance, including up to 20% pea protein concentrate has been reported to support acceptable weight gain, feed intake, and feed conversion ratios in Atlantic salmon (Carter & Hauler 2000), rainbow trout (Thiessen et al. 2003), or sea bream (Sánchez-Lozano et al. 2011). Accordingly, in the present study we first cloned a cDNA encoding PepT1 in gilthead sea bream and then assessed the impact of different feeds in which various vegetable sources substituted the fish meal on PepT1 mRNA levels in the proximal intestine of sea bream (Sparus aurata) with the aim to relate these expression levels to fish performance during the feeding trial. Materials and methods Feeds, fish and feeding protocol Sea bream of about 92 g initial average weight were stocked into 500 litter fibreglass tanks at a density of 25 fish tank -1 . Experiment was carried out in an open circulation system under natural photoperiod of about 12/12 dark/light. Temperature and oxygen concentrations measured during the trial ranged between 19.4 to 23.5°C and 6 to 7 ppm, respectively. Fish were fed to apparent satiation in triplicate groups for 140 days with one of the experimental diets. A fast growth promoting control diet (C) was prepared according to a basal commercial formulation (Dibaq Diproteg, Segovia, Spain) containing a regular composition of about 40% fishmeal and fish oil content and a mix of products and by products from cereals and oilseeds (50%), mainly soybean and wheat, and a remaining 10% for the vitamin and mineral premixes, antioxidants and antifungal components. A 15% of the fishmeal in this basal formula was substituted by protein concentrates from lupine (diet LPC), chickpea (diet CPC) or green pea (diet PPC). All diets were produced at a commercial scale by Dibaq and were extruded throughout a 4 mm die size. Diets were isoproteic and isocaloric and their proximate composition is shown in Table 1. Feed biochemical composition analyses were conducted following standard procedures (AOAC. Available on line at: http:// www.eoma.aoac.org/methods/search.asp?string=b). Dry matter content was determined after drying the sample in an oven at 105°C to constant weight, ash was determined by combustion in a muffle furnace at 600°C for 12 h, protein content (Nx6.25) was determined by Kjeldahl method and crude lipid was extracted following the method of Folch et al. (Folch et al. 1957). Thefishwerefedad libitum 6 days a week in the following manner: food for each tank was weighed separately and placed in a container: the feed from each container was Table 1 Proximate composition of the experimental diets feed containing test ingredients LPC PPC CPC Protein (%) 46.02 45.37 45.30 Lipid (%) 20.83 20.64 20.04 Ash (%) 7.74 8.08 7.66 Moisture (%) 6.45 7.68 6.52 Terova et al. SpringerPlus 2013, 2:17 Page 2 of 14 http://www.springerplus.com/content/2/1/17 given in the morning (08:00) by hand, in small quantities until the fish ceased to respond; in the afternoon (15:00) the process was repeated; at the end of the day all the feed left in each container was weighed and the feed consumption of each tank was then registered. Feed conversion (g fish weight gain/g feed eaten) and specific feeding rates (daily fish feeding) were then calculated. All fish were individually weighted at the beginning of the feeding trial and after 35, 72, 112 and 140 days of feeding the experimental diets. Weight data were analyses statistically by using the SPSS (13.1) statistical package. The level of statistical significance was set at 0.05. At the end of the trial, 5 fish from each tank were sacrificed. For the molecular biology analysis, the whole intestine was sampled and then dissected out in 7 equal segments of about 2 cm each. In addition, other tissues such as stomach, brain, muscle, and spleen were also isolated, frozen immediately in liquid nitrogen and then stored at the temperature of −80°C until the analysis. All procedures were approved by the Animal Care Committee of the University of Las Palmas de Gran Canaria and conducted according to the guidelines of the Italian Committee on Animal Care. Preparation of total RNA, cDNA synthesis, sea bream PepT1 cloning and sequencing Total RNA was extracted from sea bream proximal intestine using PureYield RNA Midiprep System (Promega, Italy), following the protocol described in PureYield™RNA Midiprep System Technical Manual #TM279, available online at: www.promega.com/tbs. This kit isolates intact, pure total RNA from essentially any sample type for use in a wide range of applications. The use of a novel Clearing Agent enables the rapid purification of total RNA with undetectable levels of genomic DNA contamination without using DNase. A novel combination of reagents, membranes and protocol leads to yields of up to 1 mg of total RNA without organic solvents, protease digestions or alcohol precipitations. The quantity of the extracted RNA was calculated using the absorbance at 260 nm, whereas the integrity of RNA was assessed by agarose gel electrophoresis. Crisp 18S and 28S bands, detected by ethidium bromide staining were indicator of the intact RNA. After extraction, total RNA was reverse transcribed into cDNA in a mix containing oligo dT16 primer, and dNTPs. This mix was heated, chilled on ice, and then reverse transcription buffer, DTT, RNaseOUT, and Moloney murine Leukaemia virus reverse transcriptase were added, as described in the M-MLV Reverse Transcriptase kit (Invitrogen). To perform PCR, an aliquot of the resulting cDNA was amplified with GoTaq Polymerase (Promega) in a final volume containing buffer, dNTPs, and the primer set (sense + antisense) designed by us (Table 2). To design the primers, we firstly performed a BlastN search (http:// www.ncbi.nml.nih.gov/BLAST/) for orthologues of PepT1 gene in other fish/vertebrate species. A multiple nucleotide sequence alignment (http://www.ebi.ac.uk/Tools/ msa/clustalw2/) was then carried out on the sequences found and regions of strong nucleotide conservation were used to design the primers. The PCR amplifications were performed for PepT1 sense1 + antisense1, and for PepT1 sense2 + antisense2 primer sets, using an automated Thermal Cycler (Mycycler, Biorad). An aliquot of each PCR reaction was then electrophoresed on agarose gel and bands were detected by ethidium bromide staining. The PCR products from PepT1 primer amplifications were then cloned using the pGEM W -T Easy cloning vector system (Promega, Italy) and subsequently sequenced in both directions (T7 and SP6). Quantitative real-time RT-PCR Generation of in vitro-transcribed PepT1 mRNAs for standard curves The number of PepT1 gene transcript copies were absolutely quantified by comparing them with a standard graph constructed using the known copy number of mRNA of this gene. For this, a forward (PepT1_T7promoter) and a reverse (PepT1_antisense3) primer were designed based on the mRNA sequences of Sparus aurata PepT1 after its identification (accession no. GU733710) (Table 2). This primer pair was used to create templates for the in vitro transcription of mRNAs for PepT1. In vitro transcription was performed using T7 RNA polymerase and other reagents supplied in the Promega RiboProbe In Vitro Transcription System kit according to the manufacturer’sprotocol. The molecular weight (MW) of the in vitro-transcribed RNA for each gene was calculated according to the following formula: MW = (n° of A bases × 329.2) + (n° of U bases × 306.2) + (n° of C bases × 305.2) + (n° of G bases × 345.2) + 159. Table 2 Sequences of the primers used in the work Primer Sequence 5 0 –3 0 Purpose PepT1-sense1 GATGACTTCGCCACCACTA RT-PCR PepT1-antisense1 CGATCAGATGCAGACGGTG RT-PCR PepT1-sense2 AGCAGGGCTCAAGATGGAC RT-PCR PepT1-antisense2 ACATCATCGTGCTCATCGTG RT-PCR PepT1_T7promoter gtaatacgactcactataggg GGAGTGTGGTATTCACA mRNA std.curve PepT1_antisense3 AGCAGGGCTCAAGATGGAC mRNA std.curve PepT1 - sense GCTACCCTCTGGCCTTTGG Real-time PepT1 - antisense ATGGTGGTAGCTCTGATTGTGTTC Real-time Taqman PepT1 TCCCCGCTGCTCTC Real-time Terova et al. SpringerPlus 2013, 2:17 Page 3 of 14 http://www.springerplus.com/content/2/1/17 The mRNAs produced by in vitro transcription were then used as quantitative standards in the analysis of experimental samples using one-step TaqMan EZ RT-PCR Core Reagents (Life technologies, Italy). RTPCR conditions were: 2 min at 50°C, 30 min at 60°C, and 5 min at 95°C, followed by 40 cycles consisting of 20 s at 92°C, 1 min at 62°C. The Ct values obtained by amplification were used to create standard curves for target genes. Quantitation of PepT1 transcripts by one-step RT-PCR TaqMan system A hundred nanograms of total RNA extracted from the experimental samples was subjected, in parallel to 10-fold-diluted, defined amounts of standard mRNA, to real-time PCR under the same experimental conditions as for the establishment of the standard curves. Real-time Assays-by-Design SM PCR primers and gene-specific fluorogenic probes were designed by Life technologies (LT). TaqMan W PCR was performed on a StepOne Real Time PCR System (LT, Italy). Data from Taqman W PCR runs were collected with StepOne’s Sequence Detector Program. The reaction efficiency was in the range 88–90%. Furthermore, a minus-reverse transcriptase control (“No Amplification Control”or NAC) was included in qRT-PCR experiments. The NAC was a mock reverse transcription containing all the RT-PCR reagents, except the reverse transcriptase. No product was seen in the NAC, which indicates that contaminating DNA was not present in the sample. Calculation and statistical analysis The data were statistically compared using one-way analysis of variance (ANOVA). The level of statistical significance was set at p < 0.05. In silico analysis The amino acid sequence of sea bream PepT1 (GenBank accession number GU733710.1) was analyzed using the open reading frame (ORF) finder program which is available at NCBI (http://www.ncbi.nlm.nih.gov). Nucleotide sequence was compared with other sequences available at the GenBank database using the BLAST algorithm (Altschul et al. 2003). Sequences were aligned using the ClustalW program (www.ebi.ac.uk/clustalw) and Multiple Sequence Alignments Editor & Shading Utility, GeneDoc, version 2.6.002 (www.psc.edu/biomed/genedoc). Protein annotation The partial putative amino acid sequence of sea bream (Sparus aurata) PepT1 (Genbank accession no. ADE58426.1) was compared with the complete sequence of sea bass (Dicentrarchus labrax)thatwepreviouslyisolated (GenBank accession no. ACI49693.2) (Terova et al. 2009). Owing to the high similarity of the two sequences, the analyses for annotation at the MemPype server (http:// mu2py.biocomp.unibo.it/mempype) (Pierleoni et al. 2011) and at the Interpro 33.0 (https://www.ebi.ac.uk/interpro/) (Hunter et al. 2012) were performed on the primary structure of D. labrax PepT1. We also submitted the structures to the SMART service for predicting similar domains (http://smart.embl-heidelberg.de/) (Letunic et al. 2009; Schultz et al. 1998). Tertiary structure The protein sequence of sea bass PepT1 aligns partially with only one structure present in the Protein Data Bank (PDB; entry: 2XUT; E-value: 8e-46) (http://www.pdb.org/ pdb/home/home.do). As the alignment seems to be poor, especially after position 400 up to the C-terminus, its tertiary structure cannot be inferred from that of the template, and a “de novo”prediction of the tertiary structures of the putative proteins was obtained at the I-Tasser server (http://zhanglab.ccmb.med.umich. edu/I-TASSER). The four stages of the method implement a threading procedure followed by structural assembly, refinement of the model, and structurebased functional annotation. The output consists of five models, whose indexes of accuracy are the C score, the TM score, and the RMSD (Roy et al. 2010; Zhang 2007; Zhang 2008). The tertiary structure-based COFACTOR algorithm predicted functional insights, including sites for ligand binding. We used the UCSF Chimera software, release 1.5.3 (http://www.cgl.ucsf.edu/chimera/) (Pettersen et al. 2004) to visualize, analyse, and compare the structural models. Sites for post-translational modifications A) Phosphorylation and sumoylation The serine, threonine, and tyrosine phosphorylation sites were searched at the NetPhos 2.0 server (http://www. cbs.dtu.dk/services/NetPhos/) (Blom et al. 1999); sites for sumoylation were checked with the SUMOsp 2.0 program (http://sumosp.biocuckoo.org/) (Ren et al. 2009). B) Glycosylation The glycosylation sites possibly present in the proteins were searched at the server of the CBS (Center for Biological Sequence Analysis, at the Technical University of Denmark, (http://www.cbs.dtu.dk/services/). Sites for mucin-type mannosyl-O-glycosylation (Net-O-glyc 3.1) (Julenius et al. 2005), C-glycosylation (Johansen et al. 2006) and ε-glycosylation of lysine residues (Julenius 2007) were checked and searched. When sites for N-glycosylation were predicted at the CBS (Net-N-glyc 1.0) (Blom et al. 1999; Blom et al. 2004), a description of their tertiary structure was obtained with the GlyProt application at the Glycosciences server (http://www.glycosciences.de/modeling/). Terova et al. SpringerPlus 2013, 2:17 Page 4 of 14 http://www.springerplus.com/content/2/1/17 Results Sea bream PepT1 cDNA sequence Sea bream PepT1 primer design was based on the alignment of four fish PepT1 coding sequences available on the NCBI Genbank database: Dicentrarchus labrax (accession no. FJ237043), Gadus morhua, (accession no. AY621934), Sebastes nebulosus (accession no. EU160494), and Danio rerio (accession no. AY300011). These presented several conserved regions within thesequencewhereprimers could be reasonably designed. Two cDNA fragments were obtained using PepT1 sense1 + antisense1 and PepT1 sense2 + antisense 2 (Table 2). Then, by connecting the sequences of the partially overlapping clones, a partial coding sequence of 1825 bp for sea bream PepT1 was determined. The cDNA for PepT1 was subsequently deposited in GeneBank under the accession no. GU733710. The deduced amino acid sequence shows that sea bream PepT1 is 608 amino acid long with a calculated molecular mass of approximately 81 kDa. Alignment of the amino acid sequence of sea bream PepT1 with that of other teleost, avian, mammalian, andprimatespeciesisshowninFigure1.Inthesame figure are also indicated the positions of the highly conserved aminoacids. In silico analysis The% similarities for alignments of PepT1 for different species, including the sizes of protein, are presented in Table 3. The amino acid sequence identity among the species was calculated using the open reading frame. Sea bream PepT1 showed the highest sequence similarity with teleost: (Sea bass: 88%; Yellow perch: 79%; Atlantic cod: 68%; Atlantic salmon, and zebrafish: 69%; spotted green pufferfish: 65%; China rockfish: 64%;) and avian species (chicken, and turkey: 64%; zebra finch: 60%), and lower homology with mammalian species (cattle: 62%; Figure 1 Alignment of the deduced aminoacid sequence of sea bream (Sparus aurata) PepT1 (accession no. ADE58426) with the PepT1 related protein of sea bass (Dicentrarchus labrax) PepT1 (accession no. ACI49693) Atlantic cod (Gadus morhua) (accession no. AAY17354), zebrafish (Danio rerio) (accession no. AAQ65244), chicken (Gallus gallus) (accession no. NP_989696) rabbit (Oryctolagus cuniculus) (accession no. AAA21335), rat (Ratus norvegicus) (accession no. NP_476462), and human (Homo sapiens) (accession no. NP-005064). Amino acids are designated by single-letter codes and are numbered to the right side. Dots indicate conserved residues in sea bass PepT1. Dashes indicate gaps introduced to facilitate alignment. Individual amino acid residues identified by site-directed mutagenesis in PepT1 proteins from various mammalian species and found to be relevant in determining the functional characteristics of the protein are indicated (black triangle) along the sequences. Terova et al. SpringerPlus 2013, 2:17 Page 5 of 14 http://www.springerplus.com/content/2/1/17 horse, common marmoset, rat, sheep, long tail macaque, and mouse: 61%; giant panda, dog, and pig: 60%; domestic rabbit: 58%). Protein annotation Owing to the high similarity between the partial putative amino acid sequence of sea bream (Sparus aurata) PepT1 (Genbank accession no. ADE58426.1) and the complete sequence of sea bass (Dicentrarchus labrax) PepT1, the analyses for annotation at the MemPype server (http://mu2py.biocomp.unibo.it/mempype) (Pierleoni et al. 2011) and at the Interpro 33.0 (Hunter et al. 2009) were performed on the primary structure of sea bass PepT1. The complete range of bioinformatics analytical tools was used to characterize the PepT1 in this teleost. The 12 transmembrane domains of sea bass PepT1 protein, predicted by using the TMHMM program (http://www.cbs.dtu.dk/services/TMHMM/), are presented schematicallyinFigure2.TheMempypeserverclassified sea bass PepT1 as an internal membrane (confidence score = 95%). Similar entries were not found either in the SwissPro or Gene Ontology (GO) servers; therefore, we completed the search at the Interpro 3.3 server. The protein belongs to the proton/oligopeptide transporter 2 (PTR2) family. The corresponding Gene Ontology terms are: 0005215 (transporter activity); 0006857 (oligopeptide transport); and 0016020 (membrane). The PTR domain, recognized by PROSITE (http://prosite.expasy.org/), is locatedintheregionbetweenthe84 th and 627 th amino acids. It contains two subdomains: PTR2 (position: 73–97) and PTR3 (position 166–178). Sites for post-translational modifications Four sites of possible sumoylation are present at the following amino acid positions: 271, 676, 699, and 726. The PepT1 sequence contains several sites of phosphorylation along the entire chain (Ser: 68%, Thr: 11%, Tyr: 21%). No suitable sites for C-glycosylation were found. Thirteen sites of ε-glycosylation of lysine were predicted (positions 5, 6, 8, 45, 114, 143, 160, 199, 353, 362, 542, 676, and 707). The Omannosylation was predicted at positions T330, and T725, and N-glycosylation at sites 120, 227, 357, 498, and 513. Five sites of N-glycosylation were predicted in the primary structure; however, only three of them (position 120, 227 and 357) seemed to be accessible in the tertiary structure of the molecule. It must be noted that, in the absence of the signal peptide, data concerning Oand N-glycosylation must be interpreted cautiously. All the features are highlightedalongtheprimarystructureinFigure3. Tertiary structure The second model obtained at the I-TASSER server was more consistent with the spatial arrangement of the transmembrane regions and the intraand extracytoplasmic loops of PepT1 in both fish species taken into consideration. Sea bass and sea bream structural alignment (Figure 4) is largely acceptable; therefore, we used the 3D structure of PepT1 protein obtained in D. labrax as representative for both species. Sea bass Pept1, like all members of the proton-coupled oligopeptide transporter superfamily, is predicted to traverse the membrane 12 times, with amino and carboxyl termini facing the cytosol, and with an elongated extracellular loop connecting the ninth and tenth transmembrane segments (Figures 4, and 5). Several binding sites such as those for phosphate ions and two different types of iron clusters (Figure 6) were predicted based on the similarities with the binding sites of the crystallographically resolved PepT So protein from Shewanella oneidensis (Newstead et al. 2011). In Table 3 Shared identities (%) between PepT1 proteins in different teleost, avian and mammalian species Gene Species GenBank accession number Protein size (aa) Identity with S. aurata (%) Sparus aurata ADE58426 608 - Dicentrachus labrax ACI49693 727 88 Perca flavescens ACX49753 729 79 Gadus morhua AAY17354 729 71 Salmo salar BAH24102 734 69 Danio rerio XP_001919914 717 69 Sebastes nebulosus ABV82968 742 67 Tetraodon nigroviridis CAG05928 671 65 PepT1 Gallus gallus AAK39954 714 64 Meleagris gallopavo AAO16604 714 64 Taeniopygia guttata XP_002196515 790 60 Bos taurus DAA23771 707 62 Equus caballus XP_001493109 789 61 Callithrix jacchus XP_002742560 797 61 Ratus norvegicus BAA08844 710 61 Ovis aries AAK14788 707 61 Macaca fascicularis AAQ56235 708 61 Mus musculus AAI16249 709 61 Ailuropoda melanoleuca XP_002914915 707 60 Canis lupus familiaris AAL67837 708 60 Sus scrofa AAO43094 708 60 Oryctolagus cuniculus P36836 707 59 Terova et al. SpringerPlus 2013, 2:17 Page 6 of 14 http://www.springerplus.com/content/2/1/17 Figure 7 are shown three accessible sites for N-glycosylation, reconstructed “in silico”with the addition of oligomannose. Fish growth and feeding rates Including plant protein concentrates did not affect feed acceptance. Therefore, we did not find significant differences in total feed intake between diets, with specific feeding rates ranging from 1.06 to 1.18 for the entire period. Although growth was similar between fish fed with different diets during the first 72 days of feeding (Figure 8), growth of the fish fed with PPC was reduced during the second part of the trial and was significantly lower (p < 0.05) than fish fed LPC and CPC diets only at the end of the experiment (Table 4). Subsequently, average feed conversion index was significantly poorest for diet PPC (2.25), in comparison to the other 3 diets (1.90 for LPC and 1.91 for CPC, and C). Spatial distribution of PepT1 mRNAs in sea bream digestive tract Total RNA from sea bream tissues was subjected to real-time RT-PCR using the standard curve established for PepT1 mRNA to determine absolute amounts of PepT1 mRNA. To create the standard curve, the correct template length including the T7 promoter was verified by 2% agarose gel electrophoresis. Quality and purity of mRNAs were confirmed by the ratio of absorptions at 280/260 nm, i.e., 1.8-2.0 (data not shown). To obtain threshold cycle (Ct) values for the target gene, defined quantities at 10-fold dilutions of PepT1 mRNAs were subjected to a one-tube two-time real-time RT-PCR. The standard curves created for PepT1 were based on the linear relationship between the Ct value and the logarithm of the starting amount. This analysis revealed the following spatial distribution of PepT1 gene expression in sea bream digestive tract: Figure 2 Membrane spanning helices in sea bass PepT1 protein predicted with the THMM program (http://www.cbs.dtu.dk/services/). Figure 3 Summary of all the predicted sites of post-translational modification found in PepT1 of D.labrax, shown on the primary sequence. Colour code: phosphorylation indicated as: S= green, T= gray, Y= pink; glycosylation: N= blue, e= yellow and O= purple. Sumoylation sites are underlined. Terova et al. SpringerPlus 2013, 2:17 Page 7 of 14 http://www.springerplus.com/content/2/1/17 Figure 4 The tertiary structures of the putative proteins PepT1 in S.aurata (partial, blue) and D.labrax (complete, gray) are aligned with the Chimera software. Figure 5 The tertiary structure of the PepT1, predicted at the I-TASSER server, is characterized by 12 transmembrane domains, shaped as alpha helices, and longer enough to completely pass the all thickness of the lipid bilayer (60 vs 45 Å). The protein starts and ends at the inner side of the bilayer. This feature is typical of channel proteins, to which the PepT1 belongs. A long chain not embedded in the bilayer is present. The transmembrane helices are here depicted in yellow or green, being the last one located inside the PTR2 domain. Terova et al. SpringerPlus 2013, 2:17 Page 8 of 14 http://www.springerplus.com/content/2/1/17 Figure 6 A constructed 3D model of the PepT1 of D.labrax, in which the accessible N-glycosylation sites are bound to oligomannose. Prediction obtained in silico by the GlyPro (http://www.glycosciences.de/modeling/). Figure 7 The sites of binding for organic acids and metals in the PepT1 of D.labrax, as predicted by the COFACTOR algorithm. The 3D structure inside the box on the right of the figure was zoomed and rotated to be viewed from the citoplasmic side of the protein, focusing on the binding regions. Blue: residues binding metal clusters, red: residues binding phosphate. Terova et al. SpringerPlus 2013, 2:17 Page 9 of 14 http://www.springerplus.com/content/2/1/17