Serotonina y ritmos circadianos en la fisiología mamaria
Abstract
Programa de doctorado: Sanidad animal y seguridad alimentaria. Texto en inglés y español.
Full text
PROGRAMA DE DOCTORADO EN SANIDAD ANIMAL Y SEGURIDAD ALIMENTARIA INSTITUTO UNIVERSITARIO DE SANIDAD ANIMAL Y SEGURIDAD ALIMENTARIA TESIS DOCTORAL SEROTONINA Y RITMOS CIRCADIANOS EN LA FISIOLOGÍA MAMARIA Aridany Suárez Trujillo Las Palmas de Gran Canaria, julio de 2016
A Scout smiles and whistles under all circumstances Robert Baden-Powell Esta tesis ha estado parcialmente financiada por la Ayuda para Formación del Profesorado Universitario, FPU 12/06079, y el período de estancias realizado fue financiado por la Ayuda para el Traslado Temporal EST 14/0049. Ambas ayudas han sido concedidas por el Ministerio de Educación, Cultura y Deporte del Gobierno de España.
7 AGRADECIMIENTOS Este manuscrito es el culmen de cuatro años de trabajo personal y sobre todo de colaboración con otras personas. Teniendo en cuenta que nacemos sin saber, en el transcurso de nuestro proceso de aprendizaje lo que podemos aprender de los libros es mucho, pero nada comparado con lo que nos pueden enseñar nuestros semejantes. Además, siempre me ha gustado pensar que el proceso educativo se basa en tres pilares fundamentales, la academia, el entorno y la familia. Estos tres pilares se combinan para crear lo que somos. El doctorado marca el final de un proceso educativo muy importante, así que no hay momento mejor para agradecérselo a todos ellos. Para comenzar, y debido a la importancia que tiene la academia en el desarrollo de la tesis doctoral, quisiera agradecer enormemente a mis directores de tesis el tiempo y dedicación prestados en todo momento, los tres, con sus diferencias y similitudes, se han convertido en un referente en mi futuro. Un punto de inflexión en estos cuatro años se marcó cuando me permitieron salir fuera de la comodidad de la Universidad de Las Palmas de Gran Canaria y descubrir parte del mundo. Decir queda que este no es un acto muy común entre los directores de tesis, y menos si las estancias son de once meses, como fue mi caso. GRACIAS. Como ya dije, mis tres directores de tesis (sí, me gusta complicarme las cosas) son personas muy diferentes, pero se asemejan en que todo lo que me han enseñado, no lo han hecho desde un punto de vista de superior, sino de igual a igual. Gracias Tacho por dejar que me desarrolle en el ámbito que más me apasiona y dejar mi mente volar a lo más grande. Gracias Noemí por darle el punto realista, por acordarte que el becario está solo allá arriba en la granja y por los grandes momentos de “a mí no me des problemas, dame soluciones”, el “non stress, just success”, y por el “esto es muy grande…”. Por último, y no por ello menos importante, gracias Miguel, todo esto no sería posible sin ti, gracias por confiar en el estudiante de primero de veterinaria que se convertiría en lo que soy hoy. Dentro también de la academia, un grupo de personas muy importante para poder sacar esta tesis adelante han sido las personas que forman los grupos de investigación, la
8 mayoría de ellos becarios de investigación, al igual que yo. Gracias a Antonio Morales, Lorenzo E. Hernández, Davinia Sánchez, Graziano Cugno y Paula Delgado, que cuando empecé conformábamos el grupo de becarios de Producción Animal y que poco a poco se han ido marchando y resaltando en otros lados como lo que son, grandes personas. Gracias a Lorena Román y Jimena Bravo, que me enseñaron la base de la biología molecular y me aguantaron más de una rabieta con las PCRs. Gracias a los becarios del IUSA (Histología y Anatomía Patológica), a Alejandro Suárez y especialmente a Antonio Espinosa de los Monteros por haberme ayudado con la parte de histología de esta tesis. Además, como he comentado, algo que sin lugar a duda ha marcado la diferencia en estos cuatro años es el hecho de que, durante uno de ellos, en el laboratorio de Dr. Plaut de la Purdue University, se me abrieran las puertas para desarrollar gran parte del proceso de investigación. Gracias Theresa Casey por tu gran labor como mentora y por proveerme de todo tu conocimiento y pasión por lo que haces. Gracias Karen Plaut por aceptarme en tu laboratorio como uno más. Gracias Jennifer Crodian por enseñarme todas las técnicas en el laboratorio, y más importante, por ayudarme en los primeros días en un país y una ciudad nuevos. Además, agradecer a todos los alumnos del laboratorio, Shelby Cummings, Kristi Crow, Bethany Weldon, Yulu Chen y Emily Erickson, que me permitieron instruirles y descubrir lo que me gusta la enseñanza. El segundo pilar, el del entorno, está compuesto principalmente por amigos y conocidos. Hay quien dice que, durante el periodo en que desarrollará la tesis, se pierden muchos de los amigos que tenías al principio. En mi caso cuento con algunos de los mejores, que me han comprendido y empujado a continuar con esta locura. Gracias Miriam por entenderme y esperar por mí, nunca encontraré a una amiga más noble y sincera. Gracias Jésica, que aunque la distancia nos separa, seguimos confiando el uno en el otro para contarnos las penas y los éxitos, y me has demostrado que hay que perderle el miedo a salir de tu zona de confort para poder avanzar. Y gracias Moisés por los momentos de salida al campo, que me han hecho mantener en el recuerdo lo que me encanta la profesión veterinaria.
9 En mi caso, una gran parte de mi entorno es el Grupo Scout Bentaya, en el cual comencé mi andadura con tan solo seis años y que me ha ayudado a crecer como persona, sobre todo en los últimos años como scouter (monitor). La gente que conforma este grupo ha sido, en gran medida, conductor de mi desarrollo personal y me ha aportado conocimientos esenciales de trabajo en equipo, gestión, creatividad, resolución de problemas, etc… que me han sido de gran utilidad en el desarrollo de esta tesis. Además, en el mundo scout se crea un ambiente de seguridad donde los niños pueden desarrollarse sin miedo al fracaso o a la burla, eso no tiene precio. Por último, y no por ello menos importante, el pilar de la familia. En mi caso, mis padres, Javier y Mari Carmen me han dado lo mejor, una educación más allá del mero conocimiento y la protección de una familia. Me han enseñado lo que es el trabajo duro y a respetarlo, y más importante aún, viendo a mi padre trabajar, he comprendido que el altruismo es uno de los motores que mueve el mundo. En mi casa además convivo con mi hermano Echedey, que me ha demostrado, con tiempo y a su manera, el cariño que nos tenemos. Mis abuelos, Paco y Antoñita, que son el soporte de mi gran familia, que siempre se preocupan por mí y me han ayudado desde mis primeros pasos hasta hoy en día. Y por otro lado mis abuelos Pinona y Helios, que aunque se fueron muy pronto, sé que mis capacidades en la repostería y la paciencia que tengo los he heredado de ella y él, respectivamente. Gracias a mis tíos y primos, que son demasiados como para nombrarlos a todos y que este manuscrito no se extienda mucho, porque me han apoyado siempre en mis decisiones, sé que se alegran mucho de mis avances y me animan a ir hacia adelante. Y sobre todo, a Claudia, mi prima más pequeña y ahijada, de quien quiero ser un buen rol a seguir y que me recuerda que desde el punto de vista de un niño, la vida no son tantas complicaciones. Con todo esto, MUCHAS GRACIAS.
17 RESUMEN La lactación es un proceso complejo que necesita ser regulado muy bien. En el caso de los animales lecheros, el objetivo de la lactación es producir alimentos de alto valor nutricional. La industria de los pequeños rumiantes está en continuo crecimiento y es una herramienta imprescindible para los países en vías de desarrollo. En este sentido, el estudio de la fisiología mamaria en cabras y ovejas se ha convertido en un tema de importancia para la investigación. La serotonina ha sido descrita como un importante regulador de la función de las células epiteliales mamarias y es un factor para la homeostasis corporal en varias especies (vacas, ratones, ratas y humanos), pero su papel en pequeños rumiantes continúa siendo incierto su papel en pequeños rumiantes. En este trabajo varias secuencias de primers fueron diseñadas para ser capaces de detectar por PCR cuantitativa a tiempo real la presencia o no de diferentes subtipos de receptores de serotonina en el tejido mamario de cabras y ovejas y compararlo con los resultados en vacas. Tras esto, los receptores expresados en común fueron localizados entre las células que conforman el tejido mamario (epiteliales, endoteliales o mioepiteliales) lactante y en periodo de secado, usando la técnica de inmunohistoquímica. Los resultados mostraron que seis receptores se expresaron, conjuntamente, en las tres especies, otros se expresaron solo en cabras y ovejas y unos pocos solo en ovejas. El estudio inmunohistoquímico mostró una alta similitud en la distribución de los receptores entre células en cabras, ovejas y vacas y cambios dinámicos entre los dos estados fisiológicos. Esta es la primera reseña de presencia de receptores de serotonina en el tejido mamario de cabras y ovejas, y también de diferencias entre glándulas lactantes y en periodo de secado. Además del sistema serotoninérgico, la homeostasis y la homeorresis de la lactación están reguladas por los ritmos circadianos. Ambos sistemas trabajan tanto a nivel sistémico como local para orquestar la lactación, por lo que se propuso la existencia de interacciones entre ellos en el tejido mamario. Los resultados preliminares demuestran que el trasportador de serotonina (SERT) es un buen candidato para ser regulado por los relojes circadianos. Y por otro lado, la serotonina también afectó en el ritmo de expresión de los genes reloj. En conclusión, los resultados sugieren que los sistemas serotoninérgico y circadiano controlan los cambios en el tejido mamario en paralelo y hay interacciones recíprocas que necesitan ser estudiadas más en profundidad.
18 SUMMARY Lactation is a complex process, and needs to be acutely regulated. In the case of dairy animals, the objective of the lactation is to produce high quality milk. The industry of small ruminants is rising and it constitutes a great tool for the success in developing countries. The study of the mammary physiology in goats and sheep has become a trending topic for research studies. The serotonin has been described as an important regulator of mammary epithelial cell function and it is a key factor for body homeostasis in several species (cows, mice, rats and humans), although in small ruminants it is still being unknown. In this work several primer sequences were designed in order to detect by RT-qPCR analysis the presence of different serotonin receptor subtypes in mammary tissue from goats and sheep, and to compare them with the results in cows. After that, receptors commonly expressed were located in the different types of mammary cells (epithelial, endothelial or myoepithelial cells) in lactating or dry off mammary tissue using immunohistochemistry (IHC) analysis. Results showed that six receptor subtypes were expressed in the three studied species, others were expressed only in goats and sheep, and a few of them only in sheep samples. The IHC analysis showed a high similarity in receptors distribution between cell types in goats, sheep and cows, and dynamic changes between physiological stages. This is the first report about serotonin receptors presence in goats and sheep’s mammary tissue and also the first report of expression differences between lactating and dry off mammary glands of the three studied species. In addition to the serotoninergic system, lactation homeostasis and homeorhesis are also regulated by the circadian clock system. Both systems work systemically and locally to orchestrate the lactation. We proposed the existence of interaction between them within the mammary tissue. Preliminary results demonstrated that the serotonin transporter (SERT) is a good candidate to be regulated by the circadian clock. And, on the other hand, serotonin showed effect on the rhythms of expression of clock core genes. In conclusion, those results suggest that both systems drive changes in the mammary gland tissue in parallel and there are reciprocal interactions that need to be deeply studied in order to achieve a better understand of mammary gland physiology and lactation.
19
21 INTRODUCCIÓN La lactación es uno de los procesos fisiológicos que más energía y nutrientes demanda en una hembra mamífera adulta. La regulación de la lactación es llevada a cabo por complejos mecanismos que tienen lugar desde su comienzo tras el parto y hasta su cese cuando el neonato es destetado. La mayoría de estos mecanismos quedan catalogados como factores homeorréticos, estrechamente coordinados para poder soportar la demanda energética que conlleva la producción de leche (Bell, 1995). Dependiendo del espectro de acción, estos factores son a menudo diferenciados entre reguladores sistémicos y locales. En este trabajo se revisarán los sistemas serotoninérgico y circadiano en su papel como reguladores de la fisiología mamaria. Estos dos sistemas trabajan para controlar la función mamaria tanto a nivel sistémico como local. 1. El ciclo de la lactación: dinámica del desarrollo mamario La glándula mamaria es un tejido único cuya función es la de producir leche para alimentar al neonato tras el nacimiento y, además, representa la continuación del proceso reproductivo. El ciclo de la lactación está compuesto por mamogénesis, lactogénesis, calostrogénesis, galactopoyesis e involución. La mamogénesis es el crecimiento y desarrollo de la glándula mamaria. El desarrollo mamario ocurre primariamente tras el nacimiento y sufre cambios dramáticos con los distintos estadios reproductivos de la hembra (Inman et al., 2015). Cuando una hembra mamífera nace, la glándula mamaria consiste solamente en un sistema ductal epitelial rudimentario acompañado por un cúmulo de tejido graso. La glándula crece isométricamente con el resto del cuerpo hasta justo antes de la pubertad. Durante la pubertad, el crecimiento ductal se inicia y está caracterizado por la expansión de este a través del bloque de grasa. El completo desarrollo mamario solo se realizará si el animal queda gestante. Durante la gestación el proceso mamogénico termina, siendo continuado por la lactogénesis.
22 El término lactogénesis es referido a la expresión de genes específicos requeridos para la síntesis de la leche por parte de los lactocitos (células epiteliales secretoras de la mama) y ocurre en tres fases, lactogénesis I, II y III. La lactogénesis I tiene lugar durante la gestación, la lactogénesis II ocurre cerca del momento del parto y la lactogénesis III se sucede a la activación de la secreción láctea (Hartmann y Cregan, 2001). Los primeros momentos de la gestación se caracterizan por una elevada tasa de proliferación en las células epiteliales, debido a la arborización del complejo ductal y por la proliferación de las células lóbuloalveolares. A mitad de la gestación, se inicia la lactogénesis I. En esta fase, comienza la diferenciación de las células alveolares y estas empiezan a expresar β-caseínas (CSN2) y proteínas del suero. Según se acerca el momento del parto, la calostrogénesis también tiene lugar. Cambios hormonales que ocurren en el momento del parto inician la lactogénesis II o activación secretora, la cual es caracterizada morfológicamente por el cierre de las uniones estrechas (TJ) entre las células epiteliales (Nguyen y Neville, 1998; Stelwagen et al., 1999) y fisiológicamente por la abundante secreción de constituyentes de la leche (Pai y Horseman, 2008). El cierre de las uniones estrechas crea una barrera impermeable entre la sangre (o líquido intersticial) y la luz del alveolo durante la lactación. Este proceso resulta en la transición del transporte de los productos de la secreción mamaria, de mayoritariamente paracelular durante la lactogénesis I, al transporte transcelular en la lactogénesis II y III (Nguyen y Neville, 1998). Una vez se establece la actividad secretora, comienza la fase de lactogénesis III, también conocida como galactopoyesis. La lactogénesis III es el mantenimiento de la lactación por el amamantamiento continuo, el cual estimula la liberación de hormonas galactopoyéticas, y resulta en la retirada de la leche desde la glándula. El destete o el cese del ordeño inducen el final de la lactación e inicio de la involución de la glándula mamaria. Durante el proceso de involución, el tejido secretor sufre una regresión mediante la apoptosis de las células alveolares (Watson, 2006) y un crecimiento relativo del tejido conectivo y adiposo, mientras la glándula retorna a un estado de menor diferenciación. Otro ciclo de desarrollo glandular se iniciará si la hembra queda de nuevo gestante.
23 Figura 1. Representación esquemática del ciclo de desarrollo de la glándula mamaria con la relación de las principales hormonas que influyen en cada una de las fases del ciclo. Adaptada a partir de http://www.gla.ac.uk/researchinstitutes/cancersciences/research/units/pathology/tstein/ research/ 2. Regulación hormonal del desarrollo mamario y la lactación El crecimiento mamario en la pubertad es inducido por el inicio de la actividad ovárica. En particular, el comienzo de la expansión ductal es coincidente con el inicio de la secreción ovárica de estradiol y progesterona durante la pubertad (Yart et al., 2014). Una vez la expansión ductal está completa, el desarrollo mamario se mantiene relativamente quiescente, excepto por los ciclos mamarios de proliferación y regresión epitelial que tienen lugar con las sucesivas fases del ciclo estral (Inman et al., 2015). Cuando el animal queda gestante, la progesterona, los lactógenos placentarios, los estrógenos y la prolactina (PRL) conducen el desarrollo y la construcción de las estructuras lóbuloalveolares, preparando el tejido para la subsecuente lactación (Hennighausen y Robinson, 2005) (véase Figura 1).
24 Durante la transición de la gestación a la lactación, los niveles de progesterona caen de manera súbita mientras los de PRL y glucocorticoides en circulación incrementan. Estos cambios en el medio hormonal estimulan la diferenciación final de las células epiteliales mamarias (MEC) para iniciar la lactogénesis II. Stelwagen et al. (1999) demostraron que la estabilidad de las uniones estrechas entre MEC incrementan tras el tratamiento con PRL y glucocorticoides. Nguyen et al. (2001) encontraron que para el cierre completo de las TJ se requiere la retirada de progesterona que tiene lugar en la transición entre gestación y lactación. La lactogénesis III es mantenida por el estímulo de amamantamiento o por el ordeño. Ambos estimulan una respuesta neuroendocrina que resulta en la liberación de oxitocina, PRL y glucocorticoides, las cuales actúan como hormonas galactopoyéticas. La PRL estimula la actividad celular e inhibe la apoptosis (Boutinaud et al., 2012). Después de que la PRL se une a su receptor en la superficie celular, activa la ruta de señalización JAK-STAT, culminando en la activación del transductor de señal y activador de la transcripción (STAT5). La activación de STAT5 estimula el desarrollo túbuloalveolar durante la gestación (Teglund et al., 1998) y dispara la síntesis de proteínas y grasas durante la lactación (Brisken et al., 1999; Miyoshi et al., 2001; Tarulli et al., 2015). En roedores se ha observado que el tratamiento con dopamina, la cual inhibe la liberación de prolactina, suprime la producción láctea (Capuco et al., 2003; Boutinaud et al., 2012). Cuando el amamantamiento o el ordeño cesan, los niveles de hormonas galactopoyéticas y sus receptores decrecen y la glándula regresa a un estado de inactividad. 3. Regulación local del desarrollo mamario y lactación El desarrollo mamario no es regulado únicamente por hormonas sistémicas, es también regulado localmente por interacciones célula-célula y célula-ECM (matriz extracelular). Las interacciones célula-célula incluyen interacciones entre células estromales y epiteliales, así como las presentes entre células epiteliales entre sí. Las células estromales, situadas alrededor del alveolo mamario, son a menudo la diana de
25 hormonas sistémicas. Estas hormonas estimulan la expresión de factores de crecimiento celular en las células estromales, los cuales son liberados y actúan de manera paracrina, afectando a las células epiteliales adyacentes (Anderson y Clarke, 2004). Un buen ejemplo de esto es la regulación estrogénica del crecimiento ductal y desarrollo túbuloalveolar durante la pubertad y la gestación. Las células estromales en la glándula mamaria expresan receptores para estrógenos (Cunha et al., 1997). La unión de los estrógenos a su receptor estimula la producción de un factor de crecimiento de hepatocitos (HGF). El HGF se une a los receptores Met (receptores para el factor de crecimiento de hepatocitos) en las células epiteliales e inician una respuesta mitogénica, la cual estimula la proliferación celular (Di-Cicco et al., 2015). Las interacciones célula-célula entre las células epiteliales son importantes para la estabilidad del tejido epitelial, la comunicación entre células y el mantenimiento de la barrera entre dos medios. Como ejemplo de lo anterior, la formación de las uniones estrechas entre células epiteliales mamarias en el comienzo de la lactogénesis II resulta en la formación de unas uniones más fuertes entre células, las cuales crean una barrera para separar los componentes de la sangre de la secreción láctea. Las uniones estrechas son el componente más apical del complejo de unión entre células. Están compuestas por proteínas ocluidinas, las únicas proteínas transmembranales de la unión, y múltiples proteínas citoplasmáticas relacionadas, tales como ZO-1 y ZO-2 (zonula occludens proteins 1 y 2). Además de las uniones estrechas, las células epiteliales tienen otros complejos de unión: las uniones adherentes, las uniones de hendidura o gap y los desmosomas y hemidesmosomas. Todas ellas también intervienen en la comunicación célula-célula y en la homeostasis epitelial. Las cadherinas son las proteínas presentes en las uniones adherentes, una de las más conocidas es la e-cadherina. Estas proteínas crean conexiones con otras cadherinas, pero a su vez también están conectadas con proteínas citoplasmáticas (microtúbulos y actinas), interfiriendo en la comunicación entre células (Schneider y Kolligs, 2015). Las uniones gap son canales intercelulares que conectan los citoplasmas de células adyacentes. Estos canales son capaces de transportar pequeñas moléculas como iones para mantener la comunicación y homeostasis del epitelio (Stewart
32 4.2. Serotonina sistémica y lactación Algunos estudios en vacas lecheras han mostrado que los niveles de 5-HT en suero sanguíneo cambian dinámicamente desde la gestación hasta el final de la lactación. Moore et al. (2015) caracterizaron los cambios en la concentración de 5-HT en suero en vacas lecheras comenzando cinco días antes del parto y a lo largo de 300 días de lactación (las muestras fueron tomadas a diario desde los cinco días previos al parto hasta el día diez después el parto y a continuación los días 30, 60, 90, 150 y 300 de lactación). Estos autores encontraron que la serotonina en suero sanguíneo fue estable durante el preparto, decreció durante la transición entre gestación y lactación y volvió a incrementar varios días después del parto. Laporta y Hernandez (2015) muestrearon diariamente la sangre de vacas lecheras para un mayor ajuste en la caracterización de los cambios en 5-HT durante el periodo de transición (cada día desde el día -7 al 7, relativos al parto) y encontraron que la concentración de 5-HT en sangre fue relativamente constante desde el día -7 al día -5, decreció drásticamente el día -3 y se mantuvo baja hasta el día 7 postparto, cuando empezó a incrementar. La concentración de serotonina en circulación ha sido correlacionada con el metabolismo del calcio y con la captación de este por parte de la glándula mamaria. Laporta et al. (2013a) observaron la relación entre la concentración de 5-HT sérica, el calcio sérico y el péptido relacionado con la hormona paratiroidea (PTHrP) el primer día postparto. La suplementación de ratas con un precursor de 5-HT, 5-hidroxi-L-triptofano (5-HTP), incrementó los niveles séricos de 5-HT, PTHrP y calcio, así como los niveles de calcio en leche (Laporta et al., 2013b). Laporta et al. (2014) demostraron que el tejido mamario de ratones TPH1 knockout tiene menor expresión de genes relacionados con el metabolismo del calcio (PMCA2, CaSR, ORAI-1, SERCA-2, SPCA1 y 2). Además, al inyectar estos ratones knockout con 5-HTP, se observó una recuperación parcial de la expresión de estos genes relacionados con el metabolismo del calcio. Así concluyeron que la 5-HT sistémica regula la distribución del calcio durante la lactación y estimula la glándula mamaria para transferir el calcio sérico a través de las MECs en la leche. La
33 misma suplementación de roedores con 5-HTP, la cual incrementa los niveles séricos de 5-HT, resultó además en el incremento de la transcripción de genes relacionados con la gluconeogénesis, glicólisis y metabolismo energético en el hígado (Laporta et al., 2013c) e incrementó el mARN para los transportadores de glucosa 1 y 8 (GLUT 1 y 8) en la glándula mamaria. Todo esto secunda la teoría sobre la función de la 5-HT sistémica como regulador homeorrético (Bell, 1995; Bell y Bauman, 1997) de la lactación a través de su función en la movilización del calcio y energía. 4.3. Regulador local de la fisiología mamaria Las células epiteliales mamarias, como otras células epiteliales, expresan TPH1 y, por ende, son capaces de sintetizar 5-HT y liberarla con la secreción láctea. Matsuda et al. (2004) describieron que TPH1 es expresada en el tejido de ratones en distintos estadios de desarrollo mamario (nulíparo, gestación, lactación e involución), pero los mayores niveles son expresados en el último tercio de la gestación (tras el día 15 de gestación), seguido por el día 10 de lactación. La 5-HT mamaria tiene función paracrina-autocrina. Los primeros estudios sobre la función de la 5-HT mamaria mostraron que esta molécula se comportaba como inhibidor de la lactación (Matsuda et al., 2004; Stull et al., 2007; Hernandez et al., 2008; Hernandez et al., 2011). Sin embargo, posteriores estudios secundan la idea de un marco de acción más amplio, incluyendo la regulación de la función y morfología de las MECs (Pai y Horseman, 2008; Pai et al., 2015), así como la iniciación de la señal mamotrópica para la movilización del calcio desde el hueso, aumentando su biodisponibilidad en sangre (Hernandez et al., 2012). La 5-HT induce la producción por parte de las MECs de PTHrP, la cual viaja a través de la circulación hasta el hueso e induce una mayor actividad osteoclástica y mayor reabsorción del calcio. Este efecto de 5-HT es llevado a cabo a través de los receptores de serotonina tipo 2, presentes en la membrana basolateral del lactocito. Laporta et al. (2014) mostraron que la 5-HT también incrementa el tráfico de calcio a través de MEC para aumentar la liberación del calcio en la secreción láctea.
34 La acción de 5-HT en las MECs parece ser bifásica y dependiente de la concentración de esta. Pai y Horseman (2008) mostraron que niveles relativamente bajos de 5-HT incrementan la expresión del mARN que traduce para distintas proteínas de la leche y, al contrario, altos niveles de 5-HT redujeron la producción de proteínas de la leche (véase Figura 5). Así, el sistema serotoninérgico es mantenido en homeostasis, debido al equilibrio entre la síntesis y liberación, recaptación celular (por SERT) y posterior degradación, o por retirada de la leche tras el ordeño o amamantamiento (Hernandez et al., 2011). Durante la lactación, la 5-HT es mantenida en bajas concentraciones y el efecto de esta baja cantidad favorece la actividad de las MECs y promueve la síntesis de los componentes de la leche. Además, Pai et al. (2015) describieron que la pérdida de 5-HTR tipo 7 desemboca en la pérdida de la función mamaria y fallo en la morfología del epitelio mamario. Así, el efecto de la 5-HT no está solo relacionado con la producción de proteínas lácteas, sino también con la integridad del epitelio. Figura 5. Efecto de la fluexetina (molécula bloqueadora de SERT) en la expresión de mARN de βcaseína en células epiteliales primarias de bovino. Las células fueron tratadas a distintas concentraciones de fluexetina (de 5µM a 1,4mM). Collier et al. (2012). El papel de la 5-HT es muy evidente cuando la leche se acumula en el interior de la glándula en el destete (en los animales lactantes) o por el cese del ordeño (en animales de producción). La acumulación de la leche crea un aumento de la presión sobre las MECs y esta señal mecánica aumenta la producción de serotonina y su liberación en la luz alveolar, debido a un aumento de la expresión de TPH1 (Matsuda et al., 2004; Horseman
35 y Collier, 2014). La alta concentración de serotonina en la luz alveolar produce la rotura de las uniones estrechas entre MECs (Stull et al., 2007) e inicio de la apoptosis celular (Hernandez et al., 2011), produciendo el inicio de la primera fase del proceso de involución (Hernandez et al., 2008). Pai y Horseman (2008) observaron la ruta molecular para la rotura de las uniones estrechas por parte de la serotonina, la cual es llevada a cabo a través de los receptores de serotonina tipo 7. La unión de la serotonina a los 5-HTR7 incrementa los niveles de cAMP. Estos altos niveles de cAMP resultan en menores niveles de PKA activado (fosforilado-PKA, pPKA) y activación del P38, a través también de su fosforilación (pP38). La pérdida de pPKA disminuye la cantidad de depósito de las proteínas ZO-1 y 2 en las uniones estrechas y la mayor cantidad de pP38 promueve la apoptosis. Además, Matsuda et al. (2004) encontraron que largos periodos de exposición (10 días) a la serotonina, en explantes de tejido mamari provenientes de ratones gestantes, induce pérdida de la diferenciación morfológica y un mayor número de cuerpos apoptóticos, comparado con el tejido control (tratado con hidrocortisona, insulina y prolactina solamente). En contraste, también demostraron que tratando los explantes con agentes bloqueantes de los receptores de serotonina (Methysergide) o con supresores de TPH1 (PCPA, p-clorofenilalanina), se produjo el mantenimiento de la diferenciación mamaria. En una serie de estudios llevados a cabo por Matsuda et al. (2004) se observó que cultivos en monocapa sobre plástico de células epiteliales mamarias de ratón, denominadas HC-11, no expresaron TPH1 y, por lo tanto, no sintetizaron 5-HT. Posteriormente, estos autores aislaron células primarias de ratón a partir de animales gestantes y fueron cultivadas en presencia de ECM (matrigel) para establecer cultivos en tres dimensiones que se trataron con medio lactogénico (suplementado con prolactina y glucocorticoides). Estos cultivos sí expresaron TPH1, concluyéndose que la presencia de ECM y lactógenos era necesaria para la expresión de TPH1. Utilizando explantes de tejido mamario proveniente de animales gestantes, que mantenían la ECM y las interacciones célula-célula, TPH1 se expresó. Estos explantes respondieron a varias moléculas que bloqueaban o favorecían diferentes componentes del sistema serotoninérgico. Finalmente,
36 Matsuda et al. (2004) compararon el efecto del sellado del orificio del pezón en la morfología mamaria, en ratones lactantes de tipo normal y en animales TPH1 knockout (TPH1-/-). En los modelos que usaron el sellado del orificio del pezón, se mantuvo la descarga de hormonas lactogénicas en todas las glándulas y la estimulación neuroendocrina (liberación de oxitocina, prolactina y glucocorticoides) en las glándulas no selladas, lo cual estimula la lactación. Estos autores encontraron que, tras tres días de acumulación, en las glándulas de pezones sellados de los ratones tipo natural, se presentaron patrones de involución mamaria en incremento de la expresión de TPH1 (véase Figura 6). En contraste, en los animales TPH1-/- no se desarrollaron procesos involutivos. Todo esto respalda la idea de que 5-HT producida por la TPH1 mamaria es una biomolécula relacionada con la involución de la glándula mamaria y que es la acumulación y la presión ejercida por la leche (mecanoseñalización) sobre el tejido mamario, la que induce la sobreexpresión de TPH1. Otros autores (Hernandez et al., 2008, 2009, 2011) descubrieron que la adición de una matriz de colágeno a cultivos primarios de células epiteliales mamarias de bovino era necesaria para la inducción de los componentes del sistema serotoninérgico (TPH1 y 5-HTR). En conclusión, ha sido demostrado por varios autores que la expresión de la serotonina en MECs es dependiente de la mecanoseñalización, y esta señal está provista de la respuesta al estiramiento entre la ECM y las MECs (Silver y Siperko, 2003). Figura 6. Efecto del sellado de pezones en la expresión de TPH1 mARN. La expresión de TPH1 en el tejido mamario fue calculada como el porcentaje de la expresión del gen de referencia GPDH. Los resultados de expresión entre glándulas selladas y abiertas fueron calculados usando un test t de student pareado y fueron significativamente diferentes (*p<0,02). Matsuda et al. (2004).
37 5. Sistema circadiano 5.1. Función y organización Todos los organismos, desde los unicelulares como las cianobacterias hasta los más complejos como los vertebrados superiores, tienen un sistema circadiano temporizador, el cual genera ritmos que organizan temporalmente y sincronizan la fisiología interna del organismo con el medio ambiente. Este sistema debe organizarse para optimizar la adaptación y supervivencia de los organismos (Albrecht, 2012). Los componentes de los ritmos circadianos orquestan los procesos fisiológicos y de comportamiento para la mejor adaptación con los cambios predecibles del medio ambiente (Panda et al., 2002). Los cambios son realizados a lo largo de horas, meses, años o durante toda la vida del organismo. El cambio más recurrente y perceptible es el que se produce cada 24 horas que dura el ciclo solar. Estos cambios en luz-oscuridad hacen que los mamíferos tengan fases de actividad/sueño a lo largo del día, produciendo internamente cambios alternativos en los estados de anabolismo y catabolismo en el cuerpo(Hastings et al., 2007). En mamíferos, todos los órganos forman una estructura jerarquizada para los ritmos circadianos, organizados en dos niveles: el sistémico y el tisular. El nivel sistémico es coordinado por el reloj maestro, situado en el núcleo supraquiasmático (SCN) del hipotálamo, el cual manda señales a los otros órganos para coordinar la totalidad del organismo(Weaver, 1998; Dunlap, 1999). Y a nivel tisular, todas las células contienen un pequeño reloj, basado en un mecanismo molecular, que trabaja por sí mismo (Balsalobre et al., 1998). Los mecanismos moleculares de las células dentro de un mismo tejido deben estar coordinados para estar sincronizados en la misma fase. Para la sincronización del sistema circadiano, los relojes celulares necesitan ser capaces de responder a estímulos procedentes de otras células (señales de entrada), integrar la información a través de cambios en la fase del mecanismo molecular del reloj celular (cambios en la amplitud y longitud del ritmo) y transferir la información del reloj interno a otras células vecinas (señales de salida). El sistema circadiano debe estar en continua
38 adaptación y sincronización con el medio ambiente y con las señales internas del cuerpo para poder organizar los relojes celulares y combinar las redes subtisulares en una red orgánica funcional que regule la fisiología y el comportamiento(Albrecht, 2012) (véase Figura 7). Figura 7. Representación esquemática de cómo los ritmos circadianos coordinan la fisiología interna con el medio ambiente. El reloj maestro, en el núcleo supraquiasmático, está influenciado por los cambios en la luz solar a través de la retina y, a partir de aquí, sincroniza y mantiene el ritmo de los relojes periféricos a través de señales hormonales, autonómicas y de comportamiento. Plaut y Casey (2011). El mecanismo molecular de los relojes circadianos es un bucle de feedback basado en transcripción-traducción entre los genes núcleo del reloj circadiano (véase Figura 8). El Receptor Nuclear Translocador de Aril Hidrocarburos 1 (ARNTL o BMAL1), Circadian Locomotor Output Cycles Kaput (CLOCK), Period 1, 2 y 3 (PER1, PER2 y PER3) y Criptocromo 1 y 2 (CRY1 y CRY2) (Lee et al., 2011). BMAL y CLOCK forman el componente positivo del bucle. Tras formar un heterodímero (Reick et al.,
39 2001) la función de BMAL-CLOCK como factor de transcripción es la de unirse a los segmentos E-boxes de las regiones promotoras (CACGTG). Las regiones promotoras Ebox están presentes en los genes controlados por relojes circadianos (CCGs) para favorecer su expresión (Lyons et al., 2000). Dos de esos CCGs son los genes del núcleo molecular Period (PER) y Criptocromo (CRY), los cuales conforman el componente negativo del reloj molecular (Darlington et al., 1998). Las familias de genes PER y CRY son traducidas y acumuladas como factores PER y CRY en el citoplasma. Desde allí, forman un heterodímero y son translocados de vuelta al núcleo, donde pararán la actividad de BMAL1-CLOCK. BMAL1 es también regulado por dos de sus dianas, los receptores nucleares REV-ERBα y RORα, los cuales desactivan o activan, respectivamente, la transcripción de BMAL1 (Guillaumond et al., 2005). El mecanismo molecular está influenciado por muchos factores, como el sistema nervioso autónomo, la temperatura corporal, hormonas y ciclos de alimentación/ayuno, que producen cambios en metabolitos como carbohidratos, ácidos grasos, NAD+/NADH y AMP/ATP. Este bucle de feedback basado en transcripción-traducción tiene una periodicidad de 24 horas que resulta en la expresión con un ritmo circadiano de más o menos el 10% de los genes expresados en un tejido (Panda et al., 2002).
40 Figura 8. Bucle de feedback basado en transcripción-traducción que regula los ritmos circadianos en el interior de las células. La porción positiva del bucle consiste en el producto de los genes BMAL1 y CLOCK o BMAL1 y NPAS2. La porción negativa del bucle consiste en los productos de las familias de genes PER y CRY. Las proteínas BMAL1 y CLOCK forman un heterodímero que activa la transcripción de los genes diana, incluyendo sus propios supresores, PERs y CRYs. BMAL1 es además regulado por dos de sus dianas, los receptores nucleares REV-ERBα y RORα, los cuales lo inducen o suprimen, respectivamente. Plaut y Casey (2012). El núcleo supraquiasmático es influenciado por factores muy diferentes, tales como luz-oscuridad, cambios en la temperatura, ingestión de alimentos, ejercicio, etc.; que lo estimulan directa o indirectamente activando distintas rutas de señalización en el cerebro (van Esseveldt et al., 2000). Las rutas de entrada para señales al SCN son el tracto retinohipotalámico (RHT), el tracto geniculohipotalámico (GHT) y las señales serotoninérgicas desde el núcleo dorsal del rafe (Dibner et al., 2010) (véase Figura 9). El RHT envía información visual desde la retina al SCN (Moore y Lenn, 1972). El GHT envía ambas señales, visuales (influenciado por el RHT) y no visuales (a partir de señales desde el núcleo dorsal del rafe). Finalmente, es aceptado que el tracto de 5-HT participa en la regulación no visual, como es el caso de los cambios debidos al ejercicio y a la actividad locomotriz (van Esseveldt et al., 2000). El SCN reacciona a estas señales de entrada cambiando el patrón de expresión del mecanismo molecular de los relojes, en el interior de las neuronas del SCN. La expresión de esos genes se incrementará o se reducirá
41 dependiendo del tipo de señal que reciban. Estos cambios en el mecanismo molecular producen señales de salida a los relojes periféricos para sincronizarlos. Las señales de salida se traducen en una gran variedad de señales sistémicas, principalmente mensajes nerviosos u hormonales que llegan hasta las células diana. Figura 9. Principales rutas aferentes al SCN en el cerebro de rata. Las flechas en color naranja representan señales luminosas y las azules representan señales no luminosas. 5-HT, serotonina; DRN, núcleo dorsal del rafe; IGL, tracto intergeniculado; GABA, ácido gamma-aminobutírico; GHT, tracto genicoluhipotalámico; Glu, glutamato; MRN, núcleo medio del rafe; NPY, neuropéptido Y; PACAP, péptido pituitario activado por adenilato ciclasa; RHT, tracto retinohipotalámico; SCN, núcleo supraquiasmático. Dibner et al. (2010). Los relojes periféricos están presentes en todos los tejidos. Estudios de la transcriptómica de distintos tejidos periféricos sugieren que muchas de las funciones celulares son reguladas con un patrón circadiano (Akhtar et al., 2002). Los relojes periféricos reciben información desde el SCN principalmente por vía neuroendocrina, pero su función puede ser modificada también por cambios metabólicos sistémicos presentes en la sangre, como las concentraciones de glucosa, ácidos grasos, NAD + /NADH y AMP/ATP. Todas estas señales hacia diferentes órganos hacen que se coordinen para mantener la homeostasis de la totalidad del cuerpo. Por ejemplo, con el comienzo del día, el SCN estimula la secreción de glucosa por parte del hígado, al mismo tiempo que estimula la captación de glucosa por otros tejidos (la Fleur et al., 2001). Las señales de salida de los órganos periféricos son genes expresados con un patrón circadiano. El perfil de expresión temporal global del SCN, el hígado, el tejido adiposo y el tejido cardiaco de
48 tasa de crecimiento y una mayor expresión de genes relacionados con el avance en el ciclo celular como es CCDN1 y, por otro lado, también mostraron una menor expresión de genes relacionados con la replicación del ADN, como la proteína tumoral 63 (TP63). Tras aplicar medio lactogénico a las células shCLOCK para inducir la diferenciación de estas, la expresión de marcadores de diferenciación (CDH1 y FASN) fue menor que en las células de tipo natural. Estos resultados mostraron que la pérdida del componente positivo del reloj circadiano, CLOCK, está relacionado con una mayor proliferación celular y con una menor capacidad de las células epiteliales mamarias para diferenciarse. En conclusión, la combinación de los resultados de distintos autores demuestra que los relojes circadianos en el tejido mamario presentan un gran abanico de funciones. Específicamente en las células epiteliales mamarias, este sistema está altamente relacionado con la proliferación y diferenciación celular. Cambios en los componentes circadianos entre la gestación y la lactación determinan la elevada tasa de proliferación celular en los primeros momentos de la gestación, y la diferenciación celular y síntesis de los componentes de la leche durante la lactación.
49 Figura 13. Cambios estoiquiométricos ocurridos en los componentes del reloj molecular mamario tras la diferenciación in vitro tras inducir con hormonas lactogénicas. Inducción con tratamiento lactogénico (DIP, dexametasona, insulina y prolactina) de células HC11. La tinción con anticuerpo anti-E-cadherina indica el incremento de esta proteína de adhesión (A) en la membrana lateral de las células HC11-DIP con respecto a las HC11. (B) Western blot mostrando la inducción de beta-caseína en las células HC11-DIP. Western blot para determinar la expresión de CLOCK (C), ARNTL (D), y PER2 (E). Se muestra cómo tras 72 h de tratamiento de diferenciación, CLOCK y ARNTL se incrementaron y PER2 decreció. Casey et al. (2014).
50 6. La glándula mamaria de los pequeños rumiantes La industria de los pequeños rumiantes ha crecido significativamente durante los últimos años, principalmente en países en vías de desarrollo, en los que ha supuesto una alternativa económicamente más rentable para proveer de productos lácteos destinados al consumo humano. En estos países, dicha industria se ha considerado como una herramienta esencial para sortear problemas económicos y sociales, como la pobreza o la malnutrición (McDermott et al., 2010). Por el contrario, en los países desarrollados, donde los problemas sociales no son un factor limitante para la compra de productos, el consumo de productos lácteos elaborados con leche proveniente de cabras y ovejas ha aumentado, ya que estos han sido considerados una opción más sana que los procedentes de leche de vacas. Por tanto, el estudio de la fisiología mamaria en estos animales constituye un aspecto importante a fin de entender mejor cómo incrementar las producciones y cómo luchar contra las posibles patologías desarrolladas a partir de la lactación, como es el caso de las mastitis. El tiempo en el que se extiende la lactación en pequeños rumiantes difiere de otras especies domésticas y también es distinto entre cabras (Capra hircus) y ovejas (Ovis aries). En el caso de ovinos, la lactación tiene una duración de cinco meses (150 días), con el pico de lactación entre las tres y cuatro semanas tras el parto (Zamiri et al., 2001; Oravcova et al., 2006). En el caso del caprino, la lactación tiene una duración media de diez meses, con el pico de lactación entre la semana 5 y 10 de lactación (Salama et al., 2005). Ambas especies presentan una gran variabilidad en los parámetros de persistencia de la lactación, dependientes de la raza y el individuo. El desarrollo de la lactación en caprinos y ovinos es regulado por el mismo complejo hormonal que en el resto de las especies mamíferas, pero las diferencias anatómicas y los siglos de domesticación a los que han sido sometidas estas especies, han hecho que la influencia de las hormonas lactogénicas sobre el tejido mamario difiera con respecto al bovino lechero. Durante la gestación, una de las hormonas implicadas en el desarrollo mamario es el lactógeno placentario, el cual es producido en la placenta y
51 estimula el crecimiento tisular de la mama. Las cabras y ovejas son animales multíparos y ha sido descrita la relación entre el tamaño de la camada y la producción lechera, habiendo una correlación positiva entre ambas (Hayden et al., 1979; Servely et al., 1983). La supresión de la secreción de prolactina no tuvo efecto en la lactación de cabras (Hart, 1973) y solo tuvo efecto parcial en la lactación de ovejas (Hooley et al., 1978). En cabras, la mayor parte de la leche se acumula en los voluminosos compartimentos cisternales de la ubre, la cual puede ser retirada aplicando succión en el pezón (Capote et al., 2006; Lérias et al., 2014) (véase Figura 14). Sin embargo, el reflejo de eyección producido por la oxitocina en esta especie parece no ser esencial para la bajada de la leche, pero puede ayudar (Olsson y Hogberg, 2009; Torres et al., 2014). Así, es posible encontrar cabras con un alto rendimiento lechero, pero un inapreciable aumento de oxitocina en plasma cuando son ordeñadas (Marnet y McKusick, 2001). Figura 14. Sección sagital de la mama caprina. Vista lateral. a) parénquima mamario; b) porción cisternal del seno lactífero; c) porción papilar del seno lactífero; d) papila mamaria; e) nódulos linfáticos mamarios; f) conducto y orificio papilar; g) conductos lactíferos colectores. Adaptado a partir de Sandoval (2003). La secreción de los componentes de la leche es llevada a cabo de distintas maneras y puede ser clasificada en merocrina y apocrina. La secreción merocrina es la
52 resultante de la apertura de vacuolas con componentes de la secreción láctea en la membrana apical de las células. Por el contrario, en la secreción apocrina estas vacuolas protruyen en la membrana apical, la cual se estrangula en la base y se desprende. A diferencia de la secreción merocrina, la secreción apocrina conlleva pérdida de la membrana y citoplasma celular, así como la aparición en la leche de partículas citoplasmáticas (véase figura 15). En bovinos se ha descrito que la secreción mamaria tiene un componente mayoritariamente merocino y, en el caso de los pequeños rumiantes, el más frecuente es el componente apocrino (Wooding et al., 1970; Paape et al., 2001). Paape et al., (2001) describieron que la presencia de partículas citoplasmáticas en pequeños rumiantes es mayor que en vacas y la leche de cabra presenta diez veces más partículas que la leche de oveja. Figura 15. Micrografía de microscopio electrónico a partir de una biopsia de glándula mamaria de cabra. El lumen alveolar está enmarcado por células alveolares que presentan en su membrana apical microvellosidades (M) y acumulación granular interna del retículo endoplasmático, las cuales se parecen a las encontradas en el interior de las partículas citoplasmáticas (CP) en la leche. Paape et al. (2001). Debido a la gran variedad de razas y a las distintas rutinas de manejo realizadas con cada una de ellas, el estudio de la influencia de la frecuencia de ordeño en la lactación
53 del ganado caprino ha sido un tema de gran importancia (Capote et al., 2006; SuárezTrujillo et al., 2013; Torres et al., 2013; Torres et al., 2016). En general, con una menor frecuencia de ordeño se reduce el peso de la ubre y la concentración de ARN, lo cual está directamente relacionado con la actividad celular, el número de células epiteliales, el tamaño alveolar y el número de células epiteliales por alveolo (Lérias et al., 2014). Li et al. (1999) además encontraron la presencia de cuerpos apoptóticos, demostrando que a menor frecuencia de ordeño, también se induce apoptosis celular. Muchos autores han trabajado para entender por qué la acumulación de la leche en el interior de la ubre produce inhibición de la lactación. Henderson y Peaker (1984) propusieron que en la leche debía haber una molécula con capacidad para la inhibición de la lactación. Posteriormente esta molécula fue denominada como FIL (feedback inhibitor of lactation) (Peaker, 1995). En estudios llevados a cabo en vacas por Silanikove et al. (2000) se describió que, ante un factor estresante, se produce la rotura de un fragmento de la β-caseína y este fragmento puede bloquear los canales de potasio, creando un desequilibrio iónico en los lactocitos, produciendo la inhibición de la síntesis de la leche y rotura de las uniones estrechas entre células. Finalmente, como se ha comentado en anteriores apartados, la alta concentración de serotonina acumulada en periodos largos sin ordeño produce la involución de la glándula mamaria. Sin embargo, la influencia de 5-HT como inhibidor de la lactación en pequeños rumiantes no ha sido aún descrita.
54 REFERENCIAS Akhtar, R. A., A. B. Reddy, E. S. Maywood, J. D. Clayton, V. M. King, A. G. Smith, T. W. Gant, M. H. Hastings, y C. P. Kyriacou. 2002. Circadian cycling of the mouse liver transcriptome, as revealed by cDNA microarray, is driven by the suprachiasmatic nucleus. Current Biology 12(7):540-550. Albrecht, U. 2012. Timing to Perfection: The Biology of Central and Peripheral Circadian Clocks. Neuron 74(2):246-260. Anderson, E. y R. B. Clarke. 2004. Steroid receptors and cell cycle in normal mammary epithelium. Journal of Mammary Gland Biology and Neoplasia 9(1):3-13. Ando, H., H. Yanagihara, Y. Hayashi, Y. Obi, S. Tsuruoka, T. Takamura, S. Kaneko, y A. Fujimura. 2005. Rhythmic messenger ribonucleic acid expression of clock genes and adipocytokines in mouse visceral adipose tissue. Endocrinology 146(12):5631-5636. Balsalobre, A., F. Damiola, y U. Schibler. 1998. A serum shock induces circadian gene expression in mammalian tissue culture cells. Cell 93(6):929-937. Barrett, P. y M. Bolborea. 2012. Molecular pathways involved in seasonal body weight and reproductive responses governed by melatonin. Journal of Pineal Research 52(4):376-388. Bell, A. W. 1995. Regulation of organic nutrient metabolism during transition form late pregnancy to early lactation. Journal of Animal Science 73(9):2804-2819. Bell, A. W. y D. E. Bauman. 1997. Adaptations of Glucose Metabolism During Pregnancy and Lactation. Journal of Mammary Gland Biology and Neoplasia 2(3):265-278.
55 Boutinaud, M., V. Lollivier, L. Finot, R. M. Bruckmaier, y P. Lacasse. 2012. Mammary cell activity and turnover in dairy cows treated with the prolactinrelease inhibitor quinagolide and milked once daily. Journal of Dairy Science 95(1):177-187. Brisken, C., S. Kaur, T. E. Chavarria, N. Binart, R. L. Sutherland, R. A. Weinberg, P. A. Kelly, y C. J. Ormandy. 1999. Prolactin controls mammary gland development via direct and indirect mechanisms. Developmental Biology 210(1):96-106. Brunton, P. J., J. A. Russell, y A. J. Douglas. 2008. Adaptive responses of the maternal hypothalamic-pituitary-adrenal axis during pregnancy and lactation. Journal of Neuroendocrinology 20(6):764-776. Buijs, R. M., C. G. van Eden, V. D. Goncharuk, y A. Kalsbeek. 2003. The biological clock tunes the organs of the body: timing by hormones and the autonomic nervous system. Journal of Endocrinology 177(1):17-26. Capuco, A. V., S. E. Ellis, S. A. Hale, E. Long, R. A. Erdman, X. Zhao, y M. J. Paape. 2003. Lactation persistency: Insights from mammary cell proliferation studies. Journal of Animal Science 81:18-31. Capote, J., A. Arguello, N. Castro, J. L. Lopez, y G. Caja. 2006. Short communication: Correlations between udder morphology, milk yield, and milking ability with different milking frequencies in dairy goats. Journal of Dairy Science 89(6):20762079. Casey, T., O. Patel, K. Dykema, H. Dover, K. Furge, y K. Plaut. 2009. Molecular Signatures Reveal Circadian Clocks May Orchestrate the Homeorhetic Response to Lactation. Plos One 4(10).
56 Casey, T. M., J. Crodian, E. Erickson, K. K. Kuropatwinski, A. S. Gleiberman, y M. P. Antoch. 2014. Tissue-Specific Changes in Molecular Clocks During the Transition from Pregnancy to Lactation in Mice. Biology of Reproduction 90(6). Casper, R. F. y B. Gladanac. 2014. Introduction: Circadian rhythm and its disruption: impact on reproductive function. Fertility and Sterility 102(2):319-320. Challet, E. 2015. Keeping circadian time with hormones. Diabetes Obesity & Metabolism 17:76-83. Chapman, R. S., P. C. Lourenco, E. Tonner, D. J. Elint, S. Selbert, K. Takeda, S. Akira, A. R. Clarke, y C. J. Watson. 1999. Suppression of epithelial apoptosis and delayed mammary gland involution in mice with a conditional knockout of Stat3. Genes & Development 13(19):2604-2616. Clarkson, R. W. E. y C. J. Watson. 2003. Microarray analysis of the involution switch. Journal of Mammary Gland Biology and Neoplasia 8(3):309-319. Cunha, G. R., P. Young, Y. K. Horn, P. S. Cooke, J. A. Taylor, y D. B. Lubahn. 1997. Elucidation of a Role for Stromal Steroid Hormone Receptors in Mammary Gland Growth and Development Using Tissue Recombinants. Journal of Mammary Gland Biology and Neoplasia 2(4):393-402. Darlington, T. K., K. Wager-Smith, M. F. Ceriani, D. Staknis, N. Gekakis, T. D. L. Steeves, C. J. Weitz, J. S. Takahashi, y S. A. Kay. 1998. Closing the circadian loop: CLOCK-induced transcription of its own inhibitors per and tim. Science 280(5369):1599-1603. Di-Cicco, A., V. Petit, A. Chiche, L. Bresson, M. Romagnoli, V. Orian-Rousseau, M. D. Vivanco, D. Medina, M. M. Faraldo, M. A. Glukhova, y M. A. Deugnier. 2015. Paracrine Met signaling triggers epithelial-mesenchymal transition in mammary luminal progenitors, affecting their fate. Elife 4.
57 Dibner, C., U. Schibler, y U. Albrecht. 2010. The Mammalian Circadian Timing System: Organization and Coordination of Central and Peripheral Clocks. Pages 517-549 in Annual Review of Physiology. Vol. 72. Dolatshad, H., E. A. Campbell, L. O'Hara, E. S. Maywood, M. H. Hastings, y M. H. Johnson. 2006. Developmental and reproductive performance in circadian mutant mice. Human Reproduction 21(1):68-79. Dunlap, J. C. 1999. Molecular bases for circadian clocks. Cell 96(2):271-290. Farrelly, N., Y. J. Lee, J. Oliver, C. Dive, y C. H. Streuli. 1999. Extracellular matrix regulates apoptosis in mammary epithelium through a control on insulin signaling. Journal of Cell Biology 144(6):1337-1347. Feng, Z. W., A. Marti, B. Jehn, H. J. Altermatt, G. Chicaiza, y R. Jaggi. 1995. Glucocorticoid and progesterone inhibit involution and programed cell-death in the mouse mammary gland. Journal of Cell Biology 131(4):1095-1103. Guillaumond, F., H. Dardente, V. Giguere, y N. Cermakian. 2005. Differential control of Bmal1 circadian transcription by REV-ERB and ROR nuclear receptors. Journal of Biological Rhythms 20(5):391-403. Hart, I. C. 1973. Effect of 2-bromo-alpha-ergocryptine on milk yield and level of prolactin and growth-hormone in blood of goat at milking. Journal of Endocrinology 57(1):179-180. Hartmann, P. y M. Cregan. 2001. Lactogenesis and the effects of insulin-dependent diabetes mellitus and prematurity. Journal of Nutrition 131(11):3016S-3020S. Hastings, M., J. S. O'Neill, y E. S. Maywood. 2007. Circadian clocks: regulators of endocrine and metabolic rhythms. Journal of Endocrinology 195(2):187-198.
64 Plaut, K. y T. Casey. 2012. Does the circadian system regulate lactation? Animal 6(3):394-402. Reick, M., J. A. Garcia, C. Dudley, y S. L. McKnight. 2001. NPAS2: An analog of clock operative in the mammalian forebrain. Science 293(5529):506-509. Reist, M., M. W. Pfaffl, C. Morel, M. Meylan, G. Hirsbrunner, J. W. Blum, y A. Steiner. 2003. Quantitative mRNA analysis of eight bovine 5-HT receptor subtypes in brain, abomasum, and intestine by real-time RT-PCR. Journal of Receptors and Signal Transduction 23(4):271-287. Reiter, R. J., H. Tamura, D. X. Tan, y X.-Y. Xu. 2014. Melatonin and the circadian system: contributions to successful female reproduction. Fertility and Sterility 102(2):321-328. Roth, B. L. 1994. Multiple serotonin receptors: clinical and experimental aspects. Annals of clinical psychiatry : official journal of the American Academy of Clinical Psychiatrists 6(2):67-78. Salama, A. A. K., G. Caja, X. Such, R. Casals, y E. Albanell. 2005. Effect of pregnancy and extended lactation on milk production in dairy goats milked once daily. Journal of Dairy Science 88(11):3894-3904. Sandoval, J. 2003. Tratado de Anatomía Veterinaria, Tomo IV: “Tegumento, Órganos de los Sentidos, Sistema Nervioso Cantral y Anatomía de las Aves”. Imprenta Sorbes, León. 281pp. Sargeant, T. J., B. Lloyd-Lewis, H. K. Resemann, A. Ramos-Montoya, J. Skepper, y C. J. Watson. 2014. Stat3 controls cell death during mammary gland involution by regulating uptake of milk fat globules and lysosomal membrane permeabilization. Nature Cell Biology 16(11):1057.
65 Schedin, P. y P. J. Keely. 2011. Mammary Gland ECM Remodeling, Stiffness, and Mechanosignaling in Normal Development and Tumor Progression. Cold Spring Harbor Perspectives in Biology 3(1). Schneider, M. R. y F. T. Kolligs. 2015. E-cadherin's role in development, tissue homeostasis and disease: Insights from mouse models. Bioessays 37(3):294-304. Servely, J. L., M. N. Emane, L. M. Houdebine, J. Djiane, C. Delouis, y P. A. Kelly. 1983. Comparative measurement of the lactogenic activity of ovine placentallactogen in rabbit and ewe mammary-gland. General and Comparative Endocrinology 51(2):255-262. Silanikove, N., A. Shamay, D. Shinder, y A. Moran. 2000. Stress down regulates milk yield in cows by plasmin induced beta-casein product that blocks K+ channels on the apical membranes. Life Sciences 67(18):2201-2212. Silver, F. H. y L. M. Siperko. 2003. Mechanosensing and mechanochemical transduction: how is mechanical energy sensed and converted into chemical energy in an extracellular matrix? Critical reviews in biomedical engineering 31(4):255-331. Stelwagen, K., H. A. McFadden, y J. Demmer. 1999. Prolactin, alone or in combination with glucocorticoids, enhances tight junction formation and expression of the tight junction protein occludin in mammary cells. Molecular and Cellular Endocrinology 156(1-2):55-61. Stewart, M. K. G., J. Simek, y D. W. Laird. 2015. Insights into the role of connexins in mammary gland morphogenesis and function. Reproduction 149(6):R279-R290. Storch, K. F., O. Lipan, I. Leykin, N. Viswanathan, F. C. Davis, W. H. Wong, y C. J. Weitz. 2002. Extensive and divergent circadian gene expression in liver and heart. Nature 417(6884):78-83.
66 Streuli, C. H., N. Bailey, y M. J. Bissell. 1991. Control of mammary epithelial differentiation - basement-membrane induces tissue-specific gene-expression in the absence of cell cell-interaction and morphological polarity. Journal of Cell Biology 115(5):1383-1395. Streuli, C. H., C. Schmidhauser, N. Bailey, P. Yurchenco, A. P. N. Skubitz, C. Roskelley, y M. J. Bissell. 1995. Laminin mediates tissue-specific geneexpression in mammary epithelia. Journal of Cell Biology 129(3):591-603. Stull, M. A., V. Pai, A. J. Vomachka, A. M. Marshall, G. A. Jacob, y N. D. Horseman. 2007. Mammary gland homeostasis employs serotonergic regulation of epithelial tight junctions. Proceedings of the National Academy of Sciences of the United States of America 104(42):16708-16713. Suárez-Trujillo, A., J. Capote, A. Argüello, N. Castro, A. Morales-DelaNuez, A. Torres, J. Morales, y M. A. Rivero. 2013. Effects of breed and milking frequency on udder histological structures in dairy goats. Journal of Applied Animal Research 41(2):166-172. Taniyama, K., N. Makimoto, A. Furuichi, Y. Sakurai-Yamashita, Y. Nagase, M. Kaibara, y T. Kanematsu. 2000. Functions of peripheral 5-hydroxytryptamine receptors, especially 5-hydroxytryptamine(4) receptor, in gastrointestinal motility. Journal of Gastroenterology 35(8):575-582. Tarulli, G. A., G. Laven-Law, R. Shakya, W. D. Tilley, y T. E. Hickey. 2015. Hormone-Sensing Mammary Epithelial Progenitors: Emerging Identity and Hormonal Regulation. Journal of Mammary Gland Biology and Neoplasia 20(12):75-91. Teglund, S., C. McKay, E. Schuetz, J. M. van Deursen, D. Stravopodis, D. M. Wang, M. Brown, S. Bodner, G. Grosveld, y J. N. Ihle. 1998. Stat5a and Stat5b proteins have essential and nonessential, or redundant, roles in cytokine responses. Cell 93(5):841-850.
67 Torres, A., N. Castro, L. E. Hernandez-Castellano, A. Argueello, and J. Capote. 2013. Effects of milking frequency on udder morphology, milk partitioning, and milk quality in 3 dairy goat breeds. Journal of Dairy Science 96(2):1071-1074. Torres, A., J. Capote, A. Argueello, D. Sanchez-Macias, A. Morales-delaNuez, and N. Castro. 2014. Effects of oxytocin treatments on milk ejection in dairy goats traditionally milked once a day. Small Ruminant Research 120(2-3):231-233. Torres, A., N. Castro, A. Suárez-Trujillo, A. Argüello, and J. Capote. 2016. Interrelationships among the length of milk stasis, tight junction permeability to lactose and monovalent cations, rate of milk secretion and composition in dairy goats traditionally milked once a day. Small Ruminant Research 137:85-90. Uejyo, T., C. Kuki, S. Oyama, H. Kumura, y K. Kobayashi. 2015. Early downregulation of milk production after weaning by pup removal and prior to involution in mouse mammary glands. Cell and Tissue Research 359(2):643-653. Van Esseveldt, L. K. E., M. N. Lehman, y G. J. Boer. 2000. The suprachiasmatic nucleus and the circadian time-keeping system revisited. Brain Research Reviews 33(1):34-77. Vernon, R. G. y E. Taylor. 1988. Insulin, dexamethasone and their interactions in the control of glucose-metabolism in adipose-tissue from lactating and non-lactating sheep. Biochemical Journal 256(2):509-514. Walther, D. J., J. U. Peter, S. Bashammakh, H. Hortnagl, M. Voits, H. Fink, y M. Bader. 2003. Synthesis of serotonin by a second tryptophan hydroxylase isoform. Science 299(5603):76-76. Watson, C. J. 2006. Key stages in mammary gland development - Involution: apoptosis and tissue remodelling that convert the mammary gland from milk factory to a quiescent organ. Breast Cancer Research 8(2).
68 Watson, C. J. y P. A. Kreuzaler. 2011. Remodeling mechanisms of the mammary gland during involution. International Journal of Developmental Biology 55(7-9):757762. Weaver, D. R. 1998. The suprachiasmatic nucleus: A 25-year retrospective. Journal of Biological Rhythms 13(2):100-112. Wharfe, M. D., P. J. Mark, y B. J. Waddell. 2011. Circadian Variation in Placental and Hepatic Clock Genes in Rat Pregnancy. Endocrinology 152(9):3552-3560. Wooding, F. B. P., M. Peaker, y J. L. Linzell. 1970. Theories of milk secretion - evidence from electron microscopic examination of milk. Nature 226(5247):762- &. Yart, L., V. Lollivier, P. G. Marnet, y F. Dessauge. 2014. Role of ovarian secretions in mammary gland development and function in ruminants. Animal 8(1):72-85. Zamiri, M. J., A. Qotbi, y J. Izadifard. 2001. Effect of daily oxytocin injection on milk yield and lactation length in sheep. Small Ruminant Research 40(2):179-185.
71 HIPÓTESIS Hipótesis 1: Tras conocer los resultados de estudios previos, en los que el sistema serotoninérgico está presente y tiene una función activa en el tejido mamario de especies tan distintas como vacas, ratones, ratas y humanos, proponemos como hipótesis inicial que en el tejido mamario de los pequeños rumiantes, cabras y ovejas, se encuentran presentes componentes del sistema serotoninérgico, en especial, los distintos subtipos de receptores de serotonina. Hipótesis 2: Los sistemas serotoninérgico y de ritmos circadianos se expresan dinámicamente en la glándula mamaria, coincidente con los distintos estadíos de desarrollo de la mama y son a la vez componentes importantes de la homeostasis corporal. Estos sistemas provocan cambios metabólicos en múltiples órganos para gestionar el flujo de nutrientes, energía y metabolitos ante los cambios homeorréticos sucedidos con la lactación. Por ello, hipotetizamos que ambos sistemas, en la regulación local de la glándula mamaria, se encuentran interconectados. Primero, proponemos que alguno o todos los genes de los componentes del ritmo circadiano (TPH1, SERT, 5-HTR y DDC) presentan regiones promotoras (E-boxes) y por lo tanto, el aumento en la expresión de éstos es debido a una estimulación por parte del reloj circadiano celular. Y además, proponemos que estos se expresarán en base a un ritmo circadiano. Por otra parte, hipotetizamos que el incremento de serotonina inducida por la acumulación de leche y que inicia la involución del tejido mamario, junto con los efectos comentados anteriormente, también actúa como señal para la inhibición de la expresión de los componentes BMAL1 y CLOCK.
73
80 SUMMARY 25 This Technical Research Communication describes the development of primer sequences 26 for serotonin receptors coding DNA sequences and able to amplify in goat, sheep and cow 27 samples. The role of serotonin (5-HT) as a regulator of lactation in cows has been studied 28 over the last decade. The action of this hormone is mediated by serotonin receptors (5-29 HTR). The bovine udder expresses several subtypes of 5-HTR with different functions 30 and distribution in the mammary tissue. The small ruminant dairy industry is increasing, 31 and the understanding of the mammary gland physiology is necessary to improve dairy 32 production in these species. RNA extracted from cow, goat and sheep hypothalamic 33 tissues was used to test DNA primers that targeted 5-HTR1A, 5-HTR1B, 5-HTR1D, 5-34 HTR1E, 5-HTR1F, 5-HTR2A, 5-HTR2B, 5-HTR2C, 5-HTR3A, 5-HTR4, 5-HTR5a, 5-35 HTR6 and 5-HTR7 to measure mRNA expression using RT-qPCR. Amplification 36 products were run out on 2% agarose gel to check size and then DNA band was cut from 37 gel and sequenced using Sanger. Sequences were compared to those published by 38 National Center for Biotechnology Information (NCBI). The sequencing demonstrated 39 that these primers can amplify successfully the same region of the CDS (coding DNA 40 sequences) for the three studied species. Primers developed in this work could be used to 41 study the impact and function of serotonin and its receptors in the small ruminants’ 42 mammary gland. 43 Key words: Primer, RT-qPCR, serotonin receptor, ruminant udder 44 45
81 Introduction 46 Serotonin (5-HT) is a monoamine neurotransmitter that regulates multiple biological 47 processes such as maintenance of homeostasis in complex organisms, including 48 mammals. At the cellular level, the action of 5-HT is mediated by serotonin receptors (5-49 HTR). Serotonin receptors are classified in seven classes (5-HTR1 to 5-HTR7), and these 50 classes are divided in fourteen subtypes (Roth, 1994). Serotonin receptors are a group of 51 G protein-coupled receptors (GPCRs) and ligand-gated ion channels (5-HTR3) of the Cys 52 loop family (Hannon & Hoyer, 2008). The GPCRs activate two intracellular second-53 messenger pathways, adenylate cyclase and phospholipase C (Reist et al. 2003) that 54 include 5-HTR1, 5-HTR2, 5-HTR4, 5-HTR6 and 5-HTR7. The 5-HTR1 family is 55 negatively coupled to adenylate cyclase activation, while 5-HTR2 family is positively 56 coupled to phospholipase C. Families 4, 6 and 7 are positively coupled to adenylate 57 cyclase activation. 58 Serotonin receptors are distributed across multiple tissues and organs where they regulate 59 diverse functions. In the central and peripheral nervous system, 5-HT functions as a 60 neurotransmitter to regulate sleep, appetite, mood, aggression, perception, memory and 61 anxiety (Roth, 1994). However, 95% of the 5-HT found in mammals is produced in the 62 gastrointestinal tract, where it is synthesized by enterochromaffin cells and released into 63 the lumen to control gastrointestinal motility (Taniyama et al. 2000; Reist et al. 2003; 64 Engel et al. 2006). 65 In late pregnancy and during lactation the mammary gland is a significant source of 66 serotonin (Matsuda et al. 2004). In the mammary gland, 5-HT functions as a feed-back 67 inhibitor to lactation through an autocrine-paracrine mechanisms (Hernandez et al. 2008; 68 Hernandez et al. 2011; Collier et al. 2012), acting through 5-HTRs (1A, 1B, 1D, 1E, 1F, 69 2A, 2B, 2C, 3A, 4, 5a, 6 and 7). Moreover, 5-HT regulates calcium mobilization from 70 bone, by stimulating parathyroid hormone-related protein production following binding 71 to the 5-HTR2 during lactation. Finally, Pai et al. (2015) showed in 5-HTR7 knock out 72 mice, the necessity of this receptor for the normal mammary gland function and 73 morphology. 74
82 Hernandez et al. (2009) found that dairy cattle expresses 5-HTR subtypes 1B, 2A, 2B, 4 75 and 7 in mammary tissue, but the distribution of 5-HTR in more closely related dairy 76 species such as goats and sheep is still unknown. To study whether differences or 77 similarities in milk production regulation among dairy species in the future, expression of 78 several 5-HTR receptors should be analyzed, and for this reason the objective of this work 79 was to design primers for q-PCR analysis in caprine, ovine and bovine tissues. To the best 80 of our knowledge this is the first report of CDS (coding DNA sequences) for these genes 81 in goats and sheep. 82 Material and methods 83 Samples of hypothalamic tissue were obtained from one Holstein cow (Bos Taurus), one 84 Majorera goat (Capra hircus) and one Canarian sheep (Ovis aries) at the slaughterhouse 85 of Gran Canaria, Canary Islands, Spain. Hypothalamus is one of the tissues were all 5-86 HTR subtypes are represented. The heads were dissected at the slaughterhouse, and each 87 hypothalamus was chopped and divided in three portions (approximately 25 mg). Samples 88 were kept in 1 mL of RNAlater (Thermo-Scientific, Massachusetts, USA) at 4ºC for 24 89 h. After that, RNAlater was removed and the samples were stored at -80ºC until 90 subsequent RNA extraction. 91 RNA extraction was performed using a combination between TriPure reagent (Hoffmann-92 La Roche Ltd, Switzerland) and E.N.Z.A. ® total RNA kit (Omega Bio-tek, Georgia, 93 USA) protocols. For each sample, 1 mL of TriPure reagent was poured into the tube and 94 was homogenized with an UltraTurrax® (T10 basic, IKA-Werke, Staufen, Germany). 95 Mixes were incubated during 5 min in ice after addition of 100 µL chloroform and 96 vortexing for 5 s. After incubation, the tubes were centrifuged at 21,000 x g during 15 97 min at 4ºC. RNA (in the aqueous phase) was carefully pipetted into a 1.5 mL tube and 98 700 µL of 70% cold ethanol was added. At this point, the solutions were transferred to an 99 extraction column provided by the E.N.Z.A. ® total RNA kit. The second part of the 100 extraction protocol was performed following the kit recommendations. In last step, each 101 RNA extraction was diluted in 60 µL RNA-free water. 102
83 RNA concentration, purity and integrity were determined using a NanoDrop 103 Spectrophotometer (ND-100, Thermo-Scientific, Massachusetts, USA). After RNA 104 evaluation, each sample was diluted in RNA-free water to a final concentration of 100 105 ng/µL. 2 µg of RNA were DNase-treated at 37ºC during 20 min with 0.5 µL of DNase I 106 (2U, #7326828, BioRad Laboratories S.L., Madrid, Spain). The inactivation of DNase 107 was made at 65ºC for 10 min before to cDNA synthesis, all samples were loaded in 1.4% 108 agarose gel, running at 60V during 60 min in order to check RNA integrity. cDNA 109 synthesis was conducted using iScript cDNA synthesis kit (BioRad Laboratories S.L., 110 Madrid, Spain). 5 µL of 100ng/µL RNA solution were used in 25 µL reaction to obtain a 111 final concentration of 20 ng/µL cDNA. 112 Primers used in this study for 5-HT receptor subtypes 1B, 1F, 2A, 2B, 2C, 4, 5a and 7 and 113 for Hypoxanthine phosphosibosyltransferase 1 (HPTR1) were obtained from Hernandez 114 et al. (2009) and Reist et al. (2003). Primers for 5-HT receptor subtypes 1A, 1D, 1E, 3A 115 and 6, Ribosomal Protein S18 (RPS18), β-Actin and Glyceraldehyde 3-Phosphate 116 Dehydrogenase (GAPDH) were designed from Bos taurus and Capra hircus CDSs 117 sequences, published at the National Center for Biotechnology Information (NCBI). 118 Primer design was performed using Primer 3 v.0.4.0 (Koressaar & Remm, 2007; 119 Untergasser et al. 2012). Primer sequences, PCR product length, and primers origin are 120 summarized in Table 1. 121 Table 1 near here 122 For the real time PCR analysis, 1 µL of cDNA, 10 µL of iQ™ SYBR®Green Supermix 123 (BioRad Laboratories S.L., Madrid, Spain), 0.5 µL of forward primer (10µM), 0.5 µL of 124 reverse primer (10µM) and RNA-free water were mixed in a 25 µL total reaction mix. 125 Analysis was performed using a MyiQ™ Single Color Real-Time PCR Detection System 126 (BioRad Laboratories S.L., Madrid, Spain). The following conditions were used for PCR 127 reaction: 95°C for 5 min followed by 40 cycles of 95°C for 30 s, 30 s of the corresponding 128 annealing temperature for each primer (Table 2) and 72ºC for 1 min. HPRT1, GAPDH, 129 RPS18 and β-Actin genes were used as housekeeping to control the gene expression levels 130 in each cDNA sample. Control genes efficiency percentage was between 90 and 105%. 131 Table 2 near here 132
84 To check the PCR product, for each gene and species, melting curves were observed. 133 Furthermore, molecular weight of the PCR amplifications were checked running them in 134 a 2% agarose gel. Otherwise, the sequence of each gene in each species was determined 135 to compare the differences between CDSs. The sequencing was performed in both 136 directions of the sequence (forward and reverse), by Macrogen INC (Amsterdam, The 137 Netherlands) using Sanger method in an Applied Biosystems 3730xl DNA Analyzer. 138 Results and discussion 139 At the first approach, all the RT-qPCR products showed a similar melting curve and the 140 same molecular weight in the gel picture, between species. After sequencing the 141 amplicons, the results demonstrated that the primers designed for each 5-HT receptor, 142 amplified the same region in the three studied species. 143 The partial CDS of the thirteen caprine and ovine 5-HTR subtypes described in this study 144 can be downloaded from U.S. National Center for Biotechnology Information145 (http://www.ncbi.nlm.nih.gov//Entrez//index.html). The accession numbers for caprine 146 and ovine are represented in Table 3. 147 Table 3 near here 148 Results of this technical communication showed that primers developed in this work are 149 able to amplify the coding DNA sequences for thirteen serotonin receptors in goats, sheep 150 and cows. 151 ACKNOWLEDGEMENTS 152 This work has been supported by FPU 12/06079 Scholarship from Ministry of Education, 153 Culture and Sports of the Spanish Government (Madrid, Spain). The authors appreciate 154 the assistance of the veterinary service at the slaughterhouse of Gran Canaria (Canary 155 Islands, Spain). Finally, thanks to Theresa M. Casey for review the English style in 156 this article. 157 References 158 Collier RJ, Hemandez LL & Horseman ND. 2012. Serotonin as a homeostatic regulator 159 of lactation. Domestic Animal Endocrinology 43(2):161-170. 160
85 Engel L, Kobel B, Ontsouka EC, Graber HU, Blum JW, Steiner A & Meylan M. 2006. 161 Distribution of mRNA coding for 5-hydroxytryptamine receptor subtypes in the intestines 162 of healthy dairy cows and dairy cows with cecal dilatation-dislocation. American Journal 163 of Veterinary Research 67(1):95-101. 164 Hannon J & Hoyer D. 2008. Molecular biology of 5-HT receptors. Behavioural Brain 165 Research 195(1):198-213. 166 Hernandez LL, Collier JL, Vomachka AJ, Collier RJ & Horseman ND. 2011. Suppression 167 of lactation and acceleration of involution in the bovine mammary gland by a selective 168 serotonin reuptake inhibitor. Journal of Endocrinology 209(1):45-54. 169 Hernandez LL, Gregerson KA & Horseman ND. 2012. Mammary gland serotonin 170 regulates parathyroid hormone-related protein and other bone-related signals. American 171 Journal of Physiology-Endocrinology and Metabolism 302(8):E1009-E1015. 172 Hernandez LL, Limesand SW, Collier JL, Horseman ND & Collier RJ. 2009. The bovine 173 mammary gland expresses multiple functional isoforms of serotonin receptors. Journal of 174 Endocrinology 203(1):123-131. 175 Hernandez LL, Stiening CM, Wheelock JB, Baumgard LH, Parkhurst AM & Collier RJ. 176 2008. Evaluation of serotonin as a feedback inhibitor of lactation in the bovine. Journal 177 of Dairy Science 91(5):1834-1844. 178 Hoyer D, Hannon JP & Martin GR. 2002. Molecular, pharmacological and functional 179 diversity of 5-HT receptors. Pharmacology Biochemistry and Behavior 71(4):533-554. 180 Koressaar T & Remm M. 2007. Enhancements and modifications of primer design 181 program Primer3. Bioinformatics 23(10):1289-1291. 182 Matsuda M, Imaoka T, Vomachka AJ, Gudelsky GA, Hou ZY, Mistry M, Bailey JP, 183 Nieport KM, Walther DJ, Bader M & Horseman ND. 2004. Serotonin regulates mammary 184 gland development via an autocrine-paracrine loop. Developmental Cell 6(2):193-203. 185 Pai VP, Hernandez LL, Stull MA & Horseman ND. 2015. The type 7 serotonin receptor, 186 5-HT 7 , is essential in the mammary gland for regulation of mammary epithelial structure 187 and function. BioMed research international 2015:364746. 188 Reist M, Pfaffl MW, Morel C, Meylan M, Hirsbrunner G, Blum JW & Steiner A. 2003. 189 Quantitative mRNA analysis of eight bovine 5-HT receptor subtypes in brain, abomasum, 190 and intestine by real-time RT-PCR. Journal of Receptors and Signal Transduction 191 23(4):271-287. 192 Roth BL. 1994. Multiple serotonin receptors: clinical and experimental aspects. Annals 193 of clinical psychiatry : official journal of the American Academy of Clinical Psychiatrists 194 6(2):67-78. 195 Taniyama K, Makimoto N, Furuichi A, Sakurai-Yamashita Y, Nagase Y, Kaibara M & 196 Kanematsu T. 2000. Functions of peripheral 5-hydroxytryptamine receptors, especially 197 5-hydroxytryptamine(4) receptor, in gastrointestinal motility. Journal of Gastroenterology 198 35(8):575-582. 199 Untergasser A, Cutcutache I, Koressaar T, Ye J, Faircloth BC, Remm M & Rozen SG. 200 2012. Primer3-new capabilities and interfaces. Nucleic Acids Research 40(15). 201 202
86 Table 1. Primer forward (f) and reverse (r) sequences for 5-HTR and Housekeeping genes. Primers Sequences Length1Reference2 5-HTR1A f GCAGAACGTGGCGAACTATC 108 AJ491858.1* 5-HTR1A r GTCCACTTGTTGAGCACCTG 5-HTR1B f TGCTCCTCATCGCCCTCTATG 259 Hernandez et al. (2009) Reist et al. (2003) 5-HTR1B r CTAGCGGCCATGAGTTTCTTCTT 5-HTR1D f GCCTTTGTGCTTACCACCAT 199 AJ491860.1* 5-HTR1D r TGCAGCATGTGATGTCAGAA 5-HTR1E f TCCACCTCAGACCCTACCAC 178 NM_001112674.1* 5-HTR1E r ATGGCAGCCAGGATAAGATG 5-HTR1F f TGTGAGAGAGAGCTGGATTATGG 248 Hernandez et al. (2009) Reist et al. (2003) 5-HTR1F r TAGTTCCTTGGTGCCTCCAGAA 5-HTR2A f AGCTGCAGAATGCCACCAACTAT 322 Hernandez et al. (2009) Reist et al. (2003) 5-HTR2A r GGTATTGGCATGGATATACCTAC 5-HTR2B f AAACAAGCCACCTCAACGCCT 411 Hernandez et al. (2009) Reist et al. (2003) 5-HTR2B r TCCCGAAATGTCTTATTGAAGAG 5-HTR2C f TTCTTAATGTCCCTAGCCATTGC 257 Hernandez et al. (2009) Reist et al. (2003) 5-HTR2C r GCAATCTTCATGATGGCCTTAGT 5-HTR3A f CGAGGTCCAGAACTACAAGC 192 NM_001193169.1* 5-HTR3A r CCCTGGTTCATGAAGACACT 5-HTR4 f ATGGACAAACTTGATGCTTAATGTGA 220 Hernandez et al. (2009) Reist et al. (2003) 5-HTR4 r TCACCAGCACCGAAACCAGCA 5-HTR5a f ACAACGGGGACATCTAGGG 119 Hernandez et al. (2009) Reist et al. (2003) 5-HTR5a r TTGGGACATGGTAAGTACTAGGG 5-HTR6 f TTCTTCCTCGTGTCGCTCTT 204 NM_001205717.1* 5-HTR6 r CGAGAGGATGAGCAGGTAGC 5-HTR7 f GTTTTATATCCCCATGTCCGTCA 174 Hernandez et al. (2009) Reist et al. (2003) 5-HTR7 r TTTGCACACTCCTCTACCTCCT HPRT1 f GAGAAGTCCGAGTTGAGTTTGGAA 191 Hernandez et al. (2009) Reist et al. (2003) HPRT1 r GGCTCGTAGTGCAAATGAAGAGT GAPDH f GGGTCATCATCTCTGCACCT 176 NM_001034034.1* GAPDH r GGTCATAAGTCCCTCCACGA S18 f ACATCGACCTCACCAAGAGG 186 EF564275.1* S18 r GGTCTTCGCGGAGTTTATTG β-Actin f CTCTTCCAGCCTTCCTTCCT 178 NM_173979.3* β-Actin r GGGCAGTGATCTCTTTCTGC 1 PCR product length. 2 Origin of the primer sequences. References anoted with * are accession numbers of the DNA sequences from NCBI (http://www.ncbi.nlm.nih.gov/) 203
87 Table 2. Annealing and melting temperatures (ºC), and Ct average for each 5-HTR amplicon in the three studied species Amplicon Anneling Temperature Melting temperature Bos taurus Melting Temperature Capra hircus Melting Temperature Ovis aries Ct average Bos taurus Ct average Capra hircus Ct average Ovis aries 5-HTR1A 57.5 87.5 88.0 88.0 33.0 32.2 29.9 5-HTR1B 57.5 90.0 90.0 90.0 30.6 28.5 27.5 5-HTR1D 59 89.0 89.0 89.0 35.1 33.1 30.8 5-HTR1E 57.5 87.0 86.0 86.0 32.1 28.2 31.0 5-HTR1F 57.5 86.0 86.0 86.0 33.8 32.4 31.4 5-HTR2A 57.5 88.5 88.5 88.5 32.2 28.8 29.1 5-HTR2B 57.5 85.5 85.5 86.0 32.4 29.0 31.0 5-HTR2C 57.5 85.5 85.5 85.5 33.9 31.0 30.3 5-HTR3A 57.5 88.0 88.0 88.0 37.5 33.4 36.3 5-HTR4 57.5 87.0 87,5 87.0 32.8 30.2 29.6 5-HTR5a 57.5 85.5 85.5 86.0 29.5 26.9 33.9 5-HTR6 59 93.0 93.0 93.0 37.9 33.8 34.3 5-HTR7 57.5 89.0 89.0 90.0 32.0 31.0 30.0 204
88 Table 3. Accession numbers for caprine and ovine sequences at the U.S. National Center for Biotechnology Information. 5-HTR subtype Capra hircus Ovis aries 1A JZ844994 JZ845007 1B JZ844995 JZ845008 1D JZ844996 JZ845009 1E JZ844997 JZ845010 1F JZ844998 JZ845011 2A JZ844999 JZ845012 2B JZ845000 JZ845013 2C JZ845001 JZ845014 3A JZ845002 JZ845015 4 JZ845003 JZ845016 5a JZ845004 JZ845017 6 JZ845005 JZ845018 7 JZ845006 JZ845019 205
89
96 For immunohistochemistry analysis, in addition to the hypothalamus and lactating 134 mammary tissue samples from Holstein cows, Majorera goats and Canarian sheep (n=3 135 of each species); mammary tissue of three dry off Holstein cows, three dry Majorera goats 136 and three dry Canarian sheep was also collected. These animals were at least one month 137 dry off before slaughter. All tissues for immunohistochemistry were formalin fixed for 24 138 h. Animal health status was checked and animals were found to be healthy and each tissue 139 was evaluated for signs of pathology using hematoxylin and eosin stained histology. 140 Hypothalamus samples were used as positive controls for RT-qPCR and 141 immunohistochemistry techniques. 142 Real time quantitative PCR (RT-qPCR) analysis 143 RNA extraction was performed using a combination between TriPure reagent (Hoffmann-144 La Roche Ltd, Switzerland) and E.N.Z.A. ® total RNA kit (Omega Bio-tek, Georgia, 145 USA) protocols. For each sample, 1 mL of TriPure reagent was poured into the tube and 146 was homogenized with an UltraTurrax® (T10 basic, IKA-Werke, Staufen, Germany). 147 Mixes were incubated during 5 min on ice after addition of 100 µL chloroform and 148 vortexing for 5 s. After incubation, the tubes were centrifuged at 21,000 x g during 15 149 min at 4ºC. RNA (in the aqueous phase) was carefully pipetted into a 1.5 mL tube and 150 700 µL of 70% cold ethanol was added. At this point, the solutions were transferred to an 151 extraction column provide by the E.N.Z.A. ® total RNA kit. The second part of the 152 extraction protocol, was performed following kit protocol. In the last step, each RNA 153 extraction was diluted in 60 µL RNA-free water. 154 RNA concentration, purity and integrity were determined by NanoDrop 155 Spectrophotometer (ND-100, Termo-Scientific, Massachusetts, USA) as either 1.4% 156 agarose gel, running at 60V during 60 min. After RNA evaluation, each sample was 157 diluted RNA-free water to a final concentration of 100 ng/µL. 20 µL of RNA was DNase-158 treated at 37ºC during 20 min with 0.5 µL of DNase I. The inactivation of DNase was 159 made at 65ºC for 10 min. cDNA synthesis was conducted using iScript cDNA synthesis 160
97 kit (BioRad Laboratories S.L., Madrid, Spain). 5 µL of 100ng/µL RNA solution was used 161 in 25 µL reaction to obtain a final concentration of 20 ng/µL cDNA. 162 For the Real-Time PCR analysis, 2 µL of cDNA, 10 µL of iQ™ SYBR®Green Supermix 163 (BioRad Laboratories S.L., Madrid, Spain), 0.5 µL of forward primer (10 µM), 0.5 µL of 164 reverse primer (10 µM) and RNA-free water were mixed in a 25 µL total reaction mix. 165 Analysis was performed using a MyiQ™ Single Color Real-Time PCR Detection System 166 (BioRad Laboratories S.L., Madrid, Spain). Primers used for this work were adapted from 167 (Suárez-Trujillo et al., unpublished) and are shown in Table 1. HPRT1, GAPDH, S18 and 168 β-Actin genes were used as housekeeping to control the gene expression levels in each 169 cDNA sample. Resulting gene expression data (Ct values) were calculated using GAPDH 170 expression as reference gene and intra-species normalization was performed. 171 Immunohistochemistry (IHC) 172 Serotonin receptors detected in the three studied species by qPCR (5-HTR1B, 1E, 2A, 173 2B, 4 and 7) were located by IHC in the mammary tissue. Formalin fixed tissue was 174 paraffin embedded, and 4µm sections were cut. Sections in paraffin were baked on slides 175 at 37ºC overnight, deparaffinized in xylene, rehydrated through a graded series of ethanol 176 washes (100%, 96%, and 70%) and rinsed in PBS. Endogenous peroxidases were 177 quenched for 15 min with 3% hydrogen peroxide in methanol. Antigen-retrieval was 178 performed by incubating slides in 9.3 mM sodium citrate and 2.0 mM citric acid solution 179 for 10 min at 95ºC and pH 6. Slides were allowed to cool at room temperature in sodium 180 citrate, and then washed with PBS. Non-specific binding was blocked by covering tissue 181 sections with 10% solution of non-immune horse normal serum (s-2000, Vector 182 Laboratories, California, USA) and incubating for 30 min at RT in a humidified chamber. 183 Excess blocking agent was blotted off slides. Tissues were incubated overnight at 4°C 184 with primary rabbit anti-5-HTR antibodies in PBS. A 1:75 dilution was used for all the 185 primary antibodies (orb10008 for 5-HTR1B, orb155529 for 5-HTR1E, orb155531 for 5-186 HTR2A, orb11593 for 5-HTR2B, orb13228 for 5-HTR4 and orb155538 for 5-HTR7; 187 Biorbyt Ltd., Cambridge, United Kingdom). Negative controls were incubated with PBS 188
98 overnight. Slides were washed with PBS, and then incubated with a biotinylated horse 189 anti-rabbit IgG as secondary antibody (ba-1100, Vector Laboratories, California, USA), 190 conjugated to horseradish peroxidase. Presence of antibody was visualized using DAB 191 substrate for staining. In order to highlight myoepithelial cells situation, calponin 192 immunohistochemistry was performed. Images of tissue staining were captured at 200 193 magnifications with a camera mounted to a light microscope. Five random fields from 194 each slide were taken in order to identify the cell type positive to each serotonin receptor. 195 Statistical analysis 196 Results from qPCR, after normalization, were analyzed based on 2-ΔΔCt (Livak and 197 Schmittgen, 2001). Statistical analysis was performed using SAS 9.4 software (SAS 198 Institute Inc., North Carolina, USA). ANOVA was used to analyze differences in 199 expression between species for each 5-HT receptor subtype. A Tukey’s test was used for 200 post hoc pairwise comparisons. Significance was considered P ≤ 0.05. 201 RESULTS 202 Table 2 summarizes the RT-qPCR analysis from thirteen serotonin receptors subtypes in 203 mammary tissue of cows, goats and sheep are summarized in Table 2. Receptors 1B, 1E, 204 2A, 2B, 4 and 7 were detected in the three studied species. Receptors 1D and 5a were 205 expressed in, goats and sheep. Although 1A and 1F receptors were detected only in sheep. 206 Conversely, subtypes 2C, 3A and 6 were not detected in any of the three studied species. 207 Gene expression analysis is represented in Figure 1. The statistical analysis demonstrated 208 that the expression of each 5-HTR subtype was not different between species (P>0.05). 209 Immunohistochemistry results for 5-HT receptors in different cells of the lactating 210 mammary tissue (epithelial, endothelial or myoepithelial cells) are compiled in Table 3. 211 All the 6 receptors were expressed in epithelial cells of cows, goats and sheep. Vascular 212 endothelial cells were positive stained for receptor subtypes 1B, 2A, 2B and 7 in the three 213 studied species and for 5-HTR1E only in cows. Serotonin receptor 1E was stained in 214
99 myoepithelial cells in the three species. Moreover, cows and sheep were positively stained 215 for 5-HTR4 receptor in myoepithelial cells. 216 Figure 2 shows some images of the 5-HTR7 IHC in the three species and the two 217 mammary development stages (lactating and dry off). The reaction for all the studied 218 receptors by IHC had a cytoplasmic disposition in lactating mammary epithelial cells. 219 After dry period, mammary tissue had a higher infiltration of connective tissue and the 220 lower amount of alveoli was less differentiated, with a smaller lumen. Epithelial cells in 221 dry udder showed reaction for all the receptors in the apical membrane of the lactocyte. 222 DISCUSSION 223 Serotonin receptor subtypes detected in cow mammary tissue were the same than those 224 previously described by Hernandez et al. (2009), with the exception of 5-HTR1E. Those 225 receptors detected in cows were also detected in goats and sheep in the present study. The 226 results demonstrated that the presence of these receptors is conserved along the 227 phylogenetic tree. In cows, 5-HTR1B genotype was associated with milk production traits 228 (Zhang et al., 2008). This fact, may also be assume in goats and sheep, although further 229 studies will be necessary. As in goats and sheep, 5-HTR 2A and 2B were previously found 230 by Hernandez et al. (2012) in mouse, cows and humans. 5-HTR2 was related with the 231 synthesis of parathyroid hormone-related protein (PTHrP). Probably, the function of 5-232 HT as regulator of calcium homeostasis through receptors 2A and 2B, could be preserved 233 along all mammalians. 5-HTR7 was found in the three studied species and it was 234 previously reported in humans (Stull et al., 2007) and mouse (Matsuda et al., 2004). It is 235 known that this receptor is related with the stability of the tight junctions (Stull et al., 236 2007), milk protein synthesis (Pai and Horseman, 2008; Hernandez et al., 2009) and 237 mammary gland morphology and function (Pai et al., 2015). The high importance of 238 receptor 7 on the mammary gland function makes fundamental the presence in goats and 239 sheep, but the role in these species has not been studied yet. The function of other 240 receptors detected in goats and sheep, but not in cows, needs also to be studied in order 241 to elucidate their role in the mammary gland physiology. Secretion of milk components 242
100 synthesized in MEC into the alveolar lumen follows mainly two ways, merocrine and 243 apocrine. Merocrine secretion is based on the release of the secretion vacuoles on the 244 apical membrane without loss of any membrane portion. On the contrary, apocrine 245 secretion is realized when a vacuole moves to the apical membrane, apical portion of the 246 cell pinches off and gets free in the lumen. Apocrine secretion produces loss of cell 247 membrane and cytoplasm (Wooding et al., 1970). In goats and sheep milk secretion is 248 mainly apocrine compared to cows (Paape et al. 2001). Maybe this difference in milk 249 components secretion between small ruminants and cows was a key factor in goats and 250 sheep’s evolution to induce tissue expression of more serotonin receptors subtypes. This 251 is the first report about the presence of 5-HT receptors in goat and sheep mammary tissue 252 and demonstrates that the serotoninergic system plays also a role in the lactation of the 253 small ruminants. 254 Distribution of the different serotonin receptors in the cow mammary tissue by IHC was 255 the same than the distribution showed by Hernandez et al. (2009) using in situ hybridation. 256 Receptors 1B, 2A, 2B and 7 found in endothelial cells could function as a blood flow 257 regulator in the mammary gland. Serotonin has been described as a vasoactive in lactating 258 sows (Busk et al., 1999). The action of 5-HT on the blood vessels produces constriction 259 of them. High levels of 5-HT in the mammary gland induces involution (Matsuda et al., 260 2004; Hernandez et al., 2008) and at the same time that 5-HT induces the turnover of the 261 mammary epithelial cells, it could produce a decrease of the blood flow to the tissue, 262 reducing nutrients support to the mammary tissue. For myoepithelial cells, receptor 1E 263 was positive stained in the three species and subtype 4 only in cows and sheep. 5-HT has 264 been described as molecule that increases the contractibility of myoepithelial cells (Oguro 265 et al., 1982). Contraction of myoepithelial cells produces milk let down from the alveolar 266 lumen to the cistern of the udder. Previously it has been demonstrated that one of the 267 factors that increase 5-HT levels is milk accumulation and the pressure produced on the 268 lactocytes (Horseman and Collier, 2014). In order to reduce this pressure, high levels of 269 5-HT could bind its receptors on the myoepithelial cells and produce alveoli contraction, 270 moving the milk down into the cistern. 271
101 This is the first report of serotonin receptors arrangement in mammary tissue of lactating 272 and dry off udders. Matsuda et al. (2004) demonstrated that TPH1 is expressed in different 273 mammary development stages in mouse (nulliparous, pregnancy, lactation and 274 involution), but the presence of 5-HTR in mammary glands during involution has not been 275 previously described. Serotonin receptors staining in the cytoplasm of the mammary 276 epithelial cells, is contrary to Stull et al. (2007). They found the expression of 5-HTR7 in 277 MCF10A cells (human normal mammary epithelial cell line) in the basolateral 278 membranes, when they are culture in a transwell permeable support. Serotonin receptors 279 are transmembrane proteins, but during lactation, high rate of expression of 5-HTR could 280 be the reason of a more intense immune reaction. In addition, all the receptors change 281 their distribution during the involution process from cytoplasmic to apical membrane. 282 These changes must be related to what happens during the involution process. During 283 involution the main facts are loss of the mammary lactating phenotype, cell apoptosis and 284 tissue restructuration, due to connective tissue infiltration (Green and Streuli, 2004; 285 Watson and Kreuzaler, 2011). After involution and during the dry period in dairy animals, 286 metabolism and activity of the mammary epithelium decrease and all functions related 287 with lactation homeostasis play a less important role. This maybe this is one of reasons 288 why 5-HTRs after reduce the influence of lactogenic hormones, appear to change the 289 disposition in the whole cytoplasm to the apical membrane only. 290 In conclusion, small ruminants’ mammary tissue expresses serotonin receptors, as well as 291 cows. There are receptors in common between small ruminants and cows (5-HTR 1B, 2A, 292 2B, 4 and 7), some of them expressed in both sheep and goats (5-HTR 1D and 5a), and a 293 few specific of sheep tissue (5-HTR 1A and 1F). All common receptors in the three 294 studied species, were positive stained in epithelial cells, showing that likely serotonin also 295 plays an important role in goats and sheep lactation. Further studies must be performed to 296 elucidate 5-HT function in small ruminants’ mammary gland, in order to explain 297 differences between goat and sheep lactation and milk secretion, compared to cows. 298 299
102 ACKNOWLEDGEMENTS 300 This work has been supported by FPU 12/06079 Scholarship from Ministry of Education, 301 Culture and Sports of the Spanish Government (Madrid, Spain). The authors appreciate 302 the assistance of the veterinary service at the slaughterhouse of Gran Canaria (Canary 303 Islands, Spain). 304 REFERENCES 305 Bell, A. W. 1995. Regulation of organic nutrient metabolism during transition form late 306 pregnancy to early lactation. Journal of Animal Science 73(9):2804-2819. 307 Bell, A. W. and D. E. Bauman. 1997. Adaptations of Glucose Metabolism During 308 Pregnancy and Lactation. Journal of Mammary Gland Biology and Neoplasia 2(3):265-309 278. 310 Busk, H., M. T. Sorensen, E. O. Mikkelsen, M. O. Nielsen, and K. Jakobsen. 1999. 311 Responses to potential vasoactive substances of isolated mammary blood vessels from 312 lactating sows. Comparative Biochemistry and Physiology C-Pharmacology Toxicology 313 & Endocrinology 124(1):57-64. 314 Green, K. A. and C. H. Streuli. 2004. Apoptosis regulation in the mammary gland. 315 Cellular and Molecular Life Sciences 61(15):1867-1883. 316 Hannon, J. and D. Hoyer. 2008. Molecular biology of 5-HT receptors. Behavioural Brain 317 Research 195(1):198-213. 318 Hernandez, L. L., J. L. Collier, A. J. Vomachka, R. J. Collier, and N. D. Horseman. 2011. 319 Suppression of lactation and acceleration of involution in the bovine mammary gland by 320 a selective serotonin reuptake inhibitor. Journal of Endocrinology 209(1):45-54. 321 Hernandez, L. L., K. A. Gregerson, and N. D. Horseman. 2012. Mammary gland serotonin 322 regulates parathyroid hormone-related protein and other bone-related signals. American 323 Journal of Physiology-Endocrinology and Metabolism 302(8):E1009-E1015. 324 Hernandez, L. L., S. W. Limesand, J. L. Collier, N. D. Horseman, and R. J. Collier. 2009. 325 The bovine mammary gland expresses multiple functional isoforms of serotonin 326 receptors. Journal of Endocrinology 203(1):123-131. 327 Hernandez, L. L., C. M. Stiening, J. B. Wheelock, L. H. Baumgard, A. M. Parkhurst, and 328 R. J. Collier. 2008. Evaluation of serotonin as a feedback inhibitor of lactation in the 329 bovine. Journal of Dairy Science 91(5):1834-1844. 330 Horseman, N. D. and R. J. Collier. 2014. Serotonin: A Local Regulator in the Mammary 331 Gland Epithelium. Annual Review of Animal Biosciences, Vol 2 2:353-374. 332 Horseman, N. D. and L. L. Hernandez. 2014. New concepts of breast cell communication 333 to bone. Trends in Endocrinology and Metabolism 25(1):34-41. 334 Hoyer, D., J. P. Hannon, and G. R. Martin. 2002. Molecular, pharmacological and 335 functional diversity of 5-HT receptors. Pharmacology Biochemistry and Behavior 336 71(4):533-554. 337
103 Laporta, J. and L. L. Hernandez. 2015. Serotonin receptor expression is dynamic in the 338 liver during the transition period in Holstein dairy cows. Domestic Animal Endocrinology 339 51:65-73. 340 Lérias, J. R., L. E. Hernandez-Castellano, A. Suárez-Trujillo, N. Castro, A. Pourlis, and 341 A. M. Almeida. 2014. The mammary gland in small ruminants: major morphological and 342 functional events underlying milk production - a review. Journal of Dairy Research 343 81(3):304-318. 344 Livak, K. J. and T. D. Schmittgen. 2001. Analysis of relative gene expression data using 345 real-time quantitative PCR and the 2(T)(-Delta Delta C) method. Methods 25(4):402-408. 346 Marshall, A. M., L. A. Nommsen-Rivers, L. L. Hernandez, K. G. Dewey, C. J. Chantry, 347 K. A. Gregerson, and N. D. Horseman. 2010. Serotonin Transport and Metabolism in the 348 Mammary Gland Modulates Secretory Activation and Involution. Journal of Clinical 349 Endocrinology & Metabolism 95(2):837-846. 350 Matsuda, M., T. Imaoka, A. J. Vomachka, G. A. Gudelsky, Z. Y. Hou, M. Mistry, J. P. 351 Bailey, K. M. Nieport, D. J. Walther, M. Bader, and N. D. Horseman. 2004. Serotonin 352 regulates mammary gland development via an autocrine-paracrine loop. Developmental 353 Cell 6(2):193-203. 354 McDermott, J. J., S. J. Staal, H. A. Freeman, M. Herrero, and J. A. Van de Steeg. 2010. 355 Sustaining intensification of smallholder livestock systems in the tropics. Livestock 356 Science 130(1-3):95-109. 357 Oguro, K., H. Hashimoto, and M. Nakashima. 1982. Pharmacological effects of several 358 drugs on the myoepithelium and vascular smooth-muscle of the lactating mammary-gland 359 in goats. Archives Internationales De Pharmacodynamie Et De Therapie 256(1):108-122. 360 Paape, M. J., B. Poutrel, A. Contreras, J. C. Marcos, and A. V. Capuco. 2001. Milk 361 somatic cells and lactation in smal ruminants. Journal of Dairy Science 84(E. 362 Suppl.):E237-E244 363 Pai, V. P., L. L. Hernandez, M. A. Stull, and N. D. Horseman. 2015. The type 7 serotonin 364 receptor, 5-HT 7 , is essential in the mammary gland for regulation of mammary epithelial 365 structure and function. BioMed research international 2015:364746. 366 Pai, V. P. and N. D. Horseman. 2008. Biphasic Regulation of Mammary Epithelial 367 Resistance by Serotonin through Activation of Multiple Pathways. Journal of Biological 368 Chemistry 283(45):30901-30910. 369 Pai, V. P. and N. D. Horseman. 2011. Multiple Cellular Responses to Serotonin 370 Contribute to Epithelial Homeostasis. Plos One 6(2). 371 Pai, V. P. and A. M. Marshall. 2011. Intraluminal volume homeostasis: A common 372 sertonergic mechanism among diverse epithelia. Communicative & integrative biology 373 4(5):532-537. 374 Reist, M., M. W. Pfaffl, C. Morel, M. Meylan, G. Hirsbrunner, J. W. Blum, and A. Steiner. 375 2003. Quantitative mRNA analysis of eight bovine 5-HT receptor subtypes in brain, 376 abomasum, and intestine by real-time RT-PCR. Journal of Receptors and Signal 377 Transduction 23(4):271-287. 378 Roth, B. L. 1994. Multiple serotonin receptors: clinical and experimental aspects. Annals 379 of clinical psychiatry : official journal of the American Academy of Clinical Psychiatrists 380 6(2):67-78. 381
104 Stull, M. A., V. Pai, A. J. Vomachka, A. M. Marshall, G. A. Jacob, and N. D. Horseman. 382 2007. Mammary gland homeostasis employs serotonergic regulation of epithelial tight 383 junctions. Proceedings of the National Academy of Sciences of the United States of 384 America 104(42):16708-16713. 385 Watson, C. J. and P. A. Kreuzaler. 2011. Remodeling mechanisms of the mammary gland 386 during involution. International Journal of Developmental Biology 55(7-9):757-762. 387 Weaver, S. R. and L. L. Hernandez. 2016. Autocrine-paracrine regulation of the 388 mammary gland. Journal of Dairy Science 99(1):842-853. 389 Wooding, F. B. P., M. Peaker, and J. L. Linzell. 1970. Theories of milk secretion - 390 evidence from electron microscopic examination of milk. Nature 226(5247):762-&. 391 Zhang, C. L., H. Chen, Y. H. Wang, R. F. Zhang, X. Y. Lan, C. Z. Lei, L. Zhang, A. L. 392 Zhang, and S. R. Hu. 2008. Serotonin receptor 1B (HTR1B) genotype associated with 393 milk production traits in cattle. Research in Veterinary Science 85(2):265-268. 394
105 Table 1. Primer forward (f) and reverse (r) sequences for 5-HTR and Housekeeping genes. Primers Sequences Anneling temperature (ºC) 5-HTR1A f GCAGAACGTGGCGAACTATC 57.5 5-HTR1A r GTCCACTTGTTGAGCACCTG 5-HTR1B f TGCTCCTCATCGCCCTCTATG 57.5 5-HTR1B r CTAGCGGCCATGAGTTTCTTCTT 5-HTR1D f GCCTTTGTGCTTACCACCAT 59 5-HTR1D r TGCAGCATGTGATGTCAGAA 5-HTR1E f TCCACCTCAGACCCTACCAC 57.5 5-HTR1E r ATGGCAGCCAGGATAAGATG 5-HTR1F f TGTGAGAGAGAGCTGGATTATGG 57.5 5-HTR1F r TAGTTCCTTGGTGCCTCCAGAA 5-HTR2A f AGCTGCAGAATGCCACCAACTAT 57.5 5-HTR2A r GGTATTGGCATGGATATACCTAC 5-HTR2B f AAACAAGCCACCTCAACGCCT 57.5 5-HTR2B r TCCCGAAATGTCTTATTGAAGAG 5-HTR2C f TTCTTAATGTCCCTAGCCATTGC 57.5 5-HTR2C r GCAATCTTCATGATGGCCTTAGT 5-HTR3A f CGAGGTCCAGAACTACAAGC 57.5 5-HTR3A r CCCTGGTTCATGAAGACACT 5-HTR4 f ATGGACAAACTTGATGCTTAATGTGA 57.5 5-HTR4 r TCACCAGCACCGAAACCAGCA 5-HTR5a f ACAACGGGGACATCTAGGG 57.5 5-HTR5a r TTGGGACATGGTAAGTACTAGGG 5-HTR6 f TTCTTCCTCGTGTCGCTCTT 59 5-HTR6 r CGAGAGGATGAGCAGGTAGC 5-HTR7 f GTTTTATATCCCCATGTCCGTCA 57.5 5-HTR7 r TTTGCACACTCCTCTACCTCCT HPRT1 f GAGAAGTCCGAGTTGAGTTTGGAA 57.5 HPRT1 r GGCTCGTAGTGCAAATGAAGAGT GAPDH f GGGTCATCATCTCTGCACCT 57.5 GAPDH r GGTCATAAGTCCCTCCACGA S18 f ACATCGACCTCACCAAGAGG 57.5 S18 r GGTCTTCGCGGAGTTTATTG β-Actin f CTCTTCCAGCCTTCCTTCCT 57.5 β-Actin r GGGCAGTGATCTCTTTCTGC 395
112
113 Serotoninergic and circadian systems: driving mammary 1 gland development and function 2 3 Running title: Serotoninergic and circadian systems 4 5 Aridany Suárez Tujillo1 and Theresa Casey2 6 1 Animal Production and Biotechnology Group, Institute of Animal Health and Food 7 Safety, Universidad de Las Palmas de Gran Canaria, Arucas, Canary Islands, Spain. 8 2 Department of Animal Sciences, Purdue University, West Lafayette, IN, USA 9 10 Corresponding author: Theresa Casey. Department of Animal Sciences, Purdue 11 University, BCHM 326, 175 S. University Street, West Lafayette, IN 47907, USA 12 [email protected] 13 14 15 16 17 More information and results about the influence of CLOCK in mammary 18 epithelial cells growth and differentiation are compiled in appendix 3 19 Results about influence of serotonin in mammary circadian clocks are 20 presented in appendix 4 21 22
114 Abstract 23 Since lactation is one of the most metabolically demanding states in adult female 24 mammals, beautifully complex regulatory mechanisms are in place to time lactation to 25 begin after birth and cease when the neonate is weaned. Lactation is regulated by 26 numerous different homeorhetic factors, all of them tightly coordinated with the demands 27 of milk production. Emerging evidence support that among these factors are the 28 serotonergic and circadian clock systems. Here we review the serotoninergic and 29 circadian clock systems and their roles in the regulation of mammary gland development 30 and lactation physiology. We conclude by presenting our hypothesis that these two 31 systems interact to accommodate the metabolic demands of lactation and thus adaptive 32 changes in these systems occur to maintain mammary and systemic homeostasis through 33 the reproductive cycles of female mammals. 34 Key words: serotonin, circadian clocks, mammary gland, lactation, homeostasis, 35 homeorhesis 36 1. Introduction 37 In order to keep the body in homeostasis, animals evolved multiple systems to coordinate 38 tissue physiology. Two of these are the serotoninergic and circadian clock systems. There 39 is growing evidence that these systems also play important roles in regulating homeorhetic 40 adaptations to lactation, orchestrating physiological changes across the entire body around 41 the time of birth to provide energy and nutrients to the mammary gland to support milk 42 synthesis. Serotoninergic and circadian clock systems are both present in the central 43 nervous system (CNS), where connections and reciprocal regulation among these systems 44 are clear and well documented. Serotonergic factors and circadian clocks also exist in 45 peripheral tissues, and function to regulate homeostatic processes. Recent studies support 46 that peripheral serotoninergic and circadian systems act systemically to regulate energy 47 mobilization during lactation, and locally within the mammary to mediate epithelial 48 development and homeostasis. In this manuscript we review the lactation cycle and 49
115 emerging understanding of the roles of serotonergic and circadian clock systems in its 50 regulation. We conclude by presenting our hypothesis that similar to the reciprocal 51 regulation of these systems in the CNS, circadian and serotonergic systems interact in the 52 mammary gland to regulate metabolic homeostasis and mediate adaptive changes needed 53 as the animal transitions through the lactation cycle. 54 2. Lactation Cycle 55 In mammals lactation represents a continuation of the reproductive process, with 56 mammary glands functioning to produce nutritional support for the offspring after birth. 57 The lactation cycle in most placental species consists of mammogenesis, lactogenesis, 58 colostrogenesis, galactopoiesis and involution. Mammogenesis is the growth and 59 development of the mammary gland. Mammary development occurs primarily post-natal, 60 and changes dynamically with reproductive state of the female (Inman et al., 2015). 61 Completion of mammary development is only fully realized if the animal becomes 62 pregnant. During pregnancy mammogenesis is completed and lactogenesis is initiated. 63 Lactogenesis refers to the expression of specific genes required for the synthesis of milk 64 by the lactocytes (mammary secretory epithelial cells) and occurs in three stages. 65 Lactogenesis I occurs during pregnancy, whereas lactogenesis II occurs close to birth, and 66 finally lactogenesis III commences when lactation is established (Hartmann and Cregan, 67 2001). 68 Early pregnancy is marked by a high rate of epithelial cell proliferation as ductal tree 69 arborizes through mammary fat pad and lobulo-alveoli form. In mid-pregnancy, 70 lactogenesis I is initiated. In this phase, alveolar cell differentiation commences and they 71 begin to express β-casein (CSN2) and whey proteins. As parturition approaches 72 colostrogenesis begins. Hormonal changes that occur around the time of birth initiate 73 lactogenesis II or secretory activation, which is represented morphologically by tight 74 junction (TJ) closure among alveolar cells (Nguyen and Neville, 1998; Stelwagen et al., 75 1999), and physiologically by copious secretion of milk (Pai and Horseman, 2008). 76 Closure of tight junctions creates an impermeable barrier between blood and alveolar 77
116 lumen during lactation, and results in transition from primarily paracellular transport to 78 transcellular transport of mammary secretory product (Nguyen and Neville, 1998). Once 79 milk secretion is established, lactogenesis III, also known as galactopoiesis, begins. 80 Lactogenesis III is the maintenance of lactation through the homeostatic process of 81 suckling that stimulates release of galactopoietic hormones and removal of milk from the 82 gland. Weaning or cessation of milking stimulates the end of the lactation and initiates 83 involution of the mammary gland. During involution, secretory tissue regresses through 84 apoptosis of alveolar cells (Watson, 2006), and a relative increase in connective and 85 adipose tissues as the gland returns to a less differentiated state. Another cycle of 86 mammary development is initiated when the animal becomes newly pregnant. 87 2.1. Hormonal regulation of mammary development and lactation 88 Peri-pubertal mammary growth is induced with the initiation of ovarian activity. In 89 particular, initiation of ductal expansion is coincident with initiation of ovarian secretion 90 of estradiol and progesterone (Yart et al., 2014). Once ductal tree expansion is complete, 91 mammary development remains relatively quiescent, except for cycles of mammary 92 epithelial proliferation and regression that occur with successive phases of the 93 estrous/menstrual cycle (Inman et al., 2015). When the animal becomes pregnant, 94 progesterone, placental lactogens, estrogens and prolactin (Hennighausen and Robinson, 95 2005) drive development and construction of lobulo-alveolar structures in preparation for 96 lactation. Around the time of birth progesterone levels drop dramatically and levels of 97 circulating prolactin (PRL) and glucocorticoids increase, these changes in hormonal 98 milieu stimulate final mammary epithelial cell (MEC) differentiation to initiate 99 lactogenesis II (Stelwagen et al., 1999; Nguyen et al., 2001). Prolactin regulates milk 100 synthesis by binding to its cell surface receptor and activating janus kinase (JAK). JAK 101 in turn activates signal-transducer and activator-STAT proteins 5a and 5b by 102 phosphorylation. Activated STAT5 regulates transcription of milk proteins by binding to 103 DNA at STAT-response elements. Glucocorticoids interact with cytoplasmic receptors, 104 which undergo allosteric change that enables the hormone-receptor complex to bind to 105 glucocorticoid response elements, also in promoter regions of milk protein genes. Ligand 106
117 bound glucocorticoid receptors can also act as a transcriptional co-activator for STAT5 107 and enhance STAT5-dependent transcription (Stöcklin et al., 1996). Lactogenesis III is 108 maintained by the suckling stimulus. Suckling stimulates a neuroendocrine response that 109 results in oxytocin, prolactin and glucocorticoid release, which function as galactopoietic 110 hormones that maintain milk synthesis. When suckling ceases levels of galactopoietic 111 hormones and their receptors drop and the gland regresses to a non-lactating state (Capuco 112 et al., 2003). 113 114 2.2. Local regulation of mammary development and lactation 115 Mammary development is also regulated locally through cell-cell and cell-ECM 116 interactions. Cell-cell interactions include interactions between stromal and epithelial 117 cells as well as between epithelial cells themselves. Stromal cells, situated around the 118 alveoli, are often the target of systemic hormones, which stimulate production of growth 119 factors that in turn act in a paracrine manner to elicit effects in the adjacent epithelial 120 structures (Anderson and Clarke, 2004). A good example of this, is estrogen regulation 121 of ductal growth and lobulo-alveolar development during puberty and pregnancy. 122 Stromal cells in the mammary gland express estrogen receptors (Cunha et al., 1997), and 123 binding of estrogen to its receptor stimulates stromal cells to produce hepatocyte growth 124 factor (HGF). HGF binds Met receptors (hepatocyte growth factor receptor) on epithelial 125 cells, which initiates a mitogenic response that stimulates epithelial cell proliferation (Di-126 Cicco et al., 2015). 127 128 Cell-cell interactions among epithelial cells are important to epithelial tissue stability, 129 communication among cells, and in the maintenance of a barrier between two milieus. As 130 an example of the latter, at the onset of lactogenesis II, stronger junctions are formed 131 between cells by closure of tight-junctions, which creates a barrier to separate blood 132 constituents from the milk secretion. Tight junctions are the most apical component of 133 cell-cell junctional complexes, and are composed of occludin proteins, and several 134 junction-related cytoplasmic proteins, such as zona occludens -1 and 2 (ZO-1 and ZO-2). 135 In addition to tight junctions, epithelial cells have other junctional complexes including: 136
118 adherens junctions, gap junctions and desmosomes, which also mediate cell-cell 137 communication and epithelium homeostasis. Cadherins are transmembrane proteins 138 present in the adherens junctions. E-cadherin (CDH1) creates connections with other 139 cadherins, but also with cytoskeletal protein (microtubules and actins) (Schneider and 140 Kolligs, 2015). GAP junctions are intercellular channels linking the cytoplasm of 141 adjacent cells. These channels transport small molecules such as ions, thus enabling 142 epithelial communication and homeostasis (Stewart et al., 2015). Desmosomes (or 143 macula adherens) are cell structures specialized in cell-cell adhesion and attach surface 144 cell adhesion proteins to cytoskeletal keratin. In mammary epithelial cells, hormones 145 including estrogens regulate expression of desmosomal proteins (Maynadier et al., 2012). 146 147 Differentiation of mammary epithelium is also affected by the extracellular matrix 148 (ECM). Epithelial tissues lie on specialized ECM referred to as the basal membrane 149 (BM). The BM is synthesized by epithelial cells, and functions to impart cell polarity 150 (basal and luminal sides). The BM is primarily composed of collagen IV, laminins, 151 entactin, and proteoglycans, and its composition changes dynamically with mammary 152 development and these changes affect the activity of cells (Schedin and Keely, 2011). For 153 example, laminin mediates the capacity of MEC to synthesize several milk proteins by 154 cooperating with prolactin to synergistically activate STAT5 (Streuli et al., 1991; Streuli 155 et al., 1995; Farrelly et al., 1999). 156 157 Cell-ECM interactions are mediated in part, by integrins, which are membrane proteins 158 that connect extracellular and cytoplasmic milieus. Activation of integrins is integral to 159 the regulation of branching morphogenesis of the gland and lactation phenotype in MECs 160 (Streuli et al., 1991; Silver and Siperko, 2003). In a process referred as mechanochemical 161 transduction, mechanical stresses induced by internal (for example growth) or external 162 (for example gravity) forces result in conformational changes in the extracellular 163 component and a direct stretching of the protein-cell surface. This stretching alters 164 integrins on the cell surface and consequently activates secondary messenger pathways, 165 and results in regulation of target genes. Stretching also causes a deformation of GAP 166
119 junctions between MECs and the activation of calcium-sensitive stretch receptors which 167 trigger secondary messenger pathways (Schedin and Keely, 2011). Activation of 168 integrins and secondary messenger pathways in turn activate cellular metabolic activity, 169 proliferation, differentiation and/or death. 170 171 In the mammary gland, the accumulation of milk that occurs with weaning stimulates 172 signaling pathways to activate the involution process (Feng et al., 1995). Horseman and 173 Collier (2014) proposed that locally the accumulation of milk evokes two distinct 174 mechanisms. The first is through the accumulation of a regulatory factor in milk that 175 binds to its cellular receptor; one of these factors is likely serotonin. The second is 176 initiation of mechanochemical signal transduction pathway which is triggered through a 177 stretch-sensing mechanism. Once these pathways are initiated, involution of the gland 178 occurs in two phases (Lund et al., 1996). The first phase encompasses the first 48 hours 179 in rodents and is reversible. The second phase commences after those 48 hours, is non-180 reversible and results in regression of secretory tissue. Morphologically, early involution 181 is characterize by the detachment of epithelial cells from the alveolar structures, which is 182 due, in part, to the tight junction break down and reduction of ZO-1 proteins. The second 183 phase of involution, is represented by alveolar lumen area reduction and increase of inter-184 alveolar connective tissue (Hurley, 1987), and adipocytes (Watson, 2006). 185 186 3. Systemic control of homeostasis and homeorhesis by serotonin and circadian 187 clocks 188 Homeostatic processes maintain physiological equilibrium in response to, or regardless 189 of, changes in external conditions. In contrast, homeorhesis refers to the orchestrated or 190 coordinated changes in metabolism of body tissues necessary to support a dominant 191 physiological state (Bauman and Currie, 1980). Homeostasis is primarily maintained by 192 negative feedback. Where homeorhetic processes are regulated by positive feedback 193 loops, which are characterized by their ability to maintain the direction of a stimulus and 194 can even accelerate its effect. Pregnancy and lactation represent physiological states that 195 homeorhetic processes are initiated. These physiological states require a huge amount of 196
120 nutrients and energy to support fetal development and milk synthesis, respectively, and 197 they challenge the equilibrium of nutrients and energy flux. Thus pregnancy and lactation 198 require coordinated changes in metabolism to be supported (Bell, 1995; Bell and Bauman, 199 1997). 200 201 Among the feedback loops that control energy homeostasis centrally is the reciprocal 202 regulation of the serotonergic and circadian systems. In the brain, serotonin is produced 203 in the dorsal and medial raphe nuclei (DRN and MRN), and the central-master clock is 204 located in the suprachiasmatic nuclei of the hypothalamus. The SCN receives direct 205 serotoninergic innervation from the raphe nuclei and also indirect through intergeniculate 206 tract (Lovenberg et al., 1993; Prosser et al., 1993; Amir et al., 1998). In reciprocal, 207 nervous and humoral outputs from the SCN result in circadian rhythms of serotonin levels 208 in several brain regions including the pineal gland and raphe nuclei (Versteeg et al., 2015), 209 with expression of the key central serotonergic gene (TPH2) in the raphe nuclei regulated 210 in a circadian manner (Malek et al., 2007). Likewise, clock genes are expressed in 211 serotonergic neurons (Ciarleglio et al., 2011). 212 213 The function of the circadian system is to temporally coordinate internal physiology and 214 synchronize the organism’s physiology with the environment (Froy, 2010). The central 215 clock in the SCN acts as a master clock by temporally organizing a diverse range of 216 physiological processes, including metabolism across the body. Temporal input to the 217 SCN include both photic (light) and non-photic cues, with light-dark information being 218 the most important environmental cue for entraining the SCN. Light information is sent 219 to the SCN via the retinohypothalamic and the geniculohypothalamic tracts (Reppert and 220 Weaver, 2002). Serotonin is a neurotransmitter that mediates sleep, locomotor activity, 221 and feeding behavior (Lucki, 1998), and non-photic temporal information, to include 222 fasting/feeding and locomotor activity, is sent from serotonergic tracts to SCN. 223 224 The immediate outflow of SCN information is primarily to the medial hypothalamus, and 225
121 here the SCN signal is translated into hormonal and autonomic signals for peripheral 226 clocks located in every tissue of the body including other areas of the brain (Kalsbeek et 227 al., 2010a; Kalsbeek et al., 2010b; Kalsbeek et al., 2011a; Kalsbeek et al., 2011b). Outputs 228 from the SCN to the paraventricular nuclei (PVN) result in the circadian patterns of 229 corticotropin-releasing hormone secretion. Corticotropin-releasing hormone in turn 230 stimulates ACTH release form the pituitary which stimulates synthesis of cortisol in the 231 adrenal gland. Circadian oscillation of plasma cortisol communicates time of day to 232 peripheral tissues. Expression rhythms of mRNA that encodes the rate limiting enzyme 233 of serotonin synthesis (TPH2) in dorsal and medial raphe nuclei is dependent upon daily 234 fluctuations of glucocorticoids (Malek et al., 2007). Neurons emanating from the SCN 235 also stimulate sympathetic neurons that innervate the pineal gland, and here melatonin is 236 synthesized form the same precursor as serotonin, the amino acid tryptophan, according 237 to the length of the photoperiod (Tan et al., 2014). Specifically, light acutely decreases 238 melatonin secretion, such that melatonin secretion occurs in the dark phase of a light-dark 239 cycle. On the contrary, serotonin is high during the daytime and low during the dark phase. 240 Melatonin in turn functions as a biochemical transducer of photoperiodic information to 241 all cells in the body (Simonneaux and Ribelayga, 2003). Importantly, since melatonin is 242 a lipophilic molecule, it can penetrate cerebral spinal fluid, and reach the dorsal raphe 243 nuclei where it binds to melatonin receptor 1 (MT1) to influence the activity of serotonin 244 neurons. The secretion of serotonin in the SCN by the raphe terminals as well as the 245 diurnal serotonin rhythms in MRN and DRN change over the light-dark cycles, and in 246 hamsters and rats is characterized by a sharp increase in release during late midday to 247 peak levels at the light-dark transition (Versteeg et al., 2015). Thus homeostatic 248 information interchanged between the systems include the serotonergic system sending 249 locomotor activity and fasting/feeding information to the SCN (van Esseveldt et al., 250 2000), and the SCN sending temporal information to serotonergic system. 251 252 Homeorhetic processes are also mediated through interrelated changes in central circadian 253 and serotonergic system dynamics, with physiological changes associated with day-length 254 being a canonical example. Animals synchronize their physiology to seasonal changes in 255
128 peripheral clocks receive these inputs of temporal information, integrate it into the 435 molecular clock, and translate it into circadian rhythms of gene and protein expression. 436 The specific outputs of peripheral clocks are less well defined than that of the SCN, 437 although global temporal expression profiles of liver, adipose, mammary and heart tissues 438 revealed that 3-10% of genes expressed in these tissues exhibited circadian patterns, and 439 were found to be involved in rate-limiting steps critical for organ function (Akhtar et al., 440 2002; Panda et al., 2002; Storch et al., 2002; Ando et al., 2005; Maningat et al., 2009). 441 442 The molecular mechanism of circadian clocks is a transcription-translation feedback loop 443 of core clock genes (Figure 3). Among circadian core clock genes are: Aryl hydrocarbon 444 receptor nuclear translocator-like protein 1 (ARNTL, aka BMAL1), Circadian Locomotor 445 Output Cycles Kaput (CLOCK), Neuronal PAS Domain Protein 2 (NPAS2), Period 1, 2 446 and 3 (PER1, PER2, PER3) and Cryptochrome 1 and 2 (CRY1, CRY2) (Lee et al., 2011). 447 BMAL1 and CLOCK or BMAL1 and NPAS2 form the positive loop of the molecular 448 clock. As a heterodimer (Reick et al., 2001), BMAL1-CLOCK functions as a 449 transcription factor which binds E-Boxes promoter elements (CACGTG, canonical 450 sequence or CANNTG, non-canonical sequences) present in clock-controlled genes 451 (CCGs) to drive their expression (Lyons et al., 2000). Among CCGs are the core clock 452 Period (PER1, PER2, PER3) and Cryptochrome (CRY1 AND CRY2) genes, which make 453 up the negative arm of the molecular clock (Darlington et al., 1998). PER and CRY genes 454 are translated, and their proteins accumulate in the cytoplasm where they form 455 heterodimers that are translocated into the nucleus. In the nucleus PER-CRY prevent the 456 promoter binding activity of BMAL1-CLOCK. The transcription-translation feedback 457 loop occurs in a 24 h periodicity, resulting in circadian rhythms of core clock genes. 458 BMAL1 expression is regulated by two of its transcriptional targets, nuclear receptors 459 REV-ERBα and RORα, which repress or activate, respectively, BMAL1 transcription 460 (Guillaumond et al., 2005). 461 462 There is reciprocal regulation among circadian timing and metabolic systems, and is 463 evident in the fact that circulating levels of metabolites such as glucose, fatty acids, 464
129 NAD+/NADH and AMP/ATP are able to regulate clock molecular mechanism. 465 Peroxisome proliferator-activated receptor α (PPARα) is a transcription factor that 466 reciprocally regulates BMAL1 expression. Specifically, PPARα is a member of the 467 nuclear receptor family that functions as a transcription factor when bound by free fatty 468 acid and regulates expression of genes that control lipid and glucose metabolism. 469 Expression of PPARα is mediated by the BMAL1-CLOCK heterodimer. In turn, PPARα 470 binds to the peroxisome-proliferator response element (PPRE) to activate Bmal1 471 expression (Froy, 2012). Thus the integration of the circadian and metabolic system 472 occurs in part through the reciprocal regulation of BMAL1 and PPARα. Furthermore, the 473 hormone ghrelin, which is synthesized in the stomach after feeding, is able to go through 474 the brain-blood barrier and affect SCN metabolic activity (Carlini et al., 2004). In 475 addition, timing of food intake is an input to circadian clocks in peripheral tissues 476 (Damiola et al., 2000; Stokkan et al., 2001; Eckel-Mahan and Sassone-Corsi, 2013). 477 Rodent studies have shown that timing of food intake is a stronger input to peripheral 478 clocks than temporal cues on light-dark cycle, as restricting food intake to normal times 479 of rest, shifted circadian rhythms of peripheral clocks in liver, kidney, heart, and pancreas 480 to time of food availability, making them out phase with the clock in the SCN, which 481 remained synchronized to the light-dark cycle (Froy, 2010). 482 483 Similar to the reciprocal regulation of the circadian and metabolic systems of the body, 484 reproductive and circadian processes appear to be integrated and reciprocally regulated. 485 Reproduction is orchestrated by multiple hormones that exhibit circadian rhythms of 486 secretion. This mediation occurs in part through SCN outputs to the paraventricular nuclei 487 of the hypothalamus (PVN) (Challet, 2015). The PVN neuroendocrine neurons secrete 488 neurotransmitters and neuropeptides that are transported through hypophyseal portal 489 system to the pituitary gland (Buijs et al., 2003), and from there, pituitary hormonal 490 secretion activates secondary glandular organs such as adrenal and thyroid glands and 491 gonads. The influence of the circadian timing system on reproduction is most evident in 492 seasonal breeders such as sheep, for which melatonin acts within the hypothalamus to 493 mediate control of seasonal changes in gonadotrophin secretion and gonadal activity 494
130 (Lincoln and Richardson, 1998; Harrison et al., 2008). In this way, seasonal animals can 495 regulate their reproductive cycle to optimize the season young are born (Barrett and 496 Bolborea, 2012). 497 498 In reproducing females (i.e. pregnant and lactating) the survival of offspring becomes a 499 priority, and thus cues emanating from the conceptus during pregnancy and the neonate 500 during lactation likely play an important role in coordinating maternal functions. For 501 example, Wharfe et al. (2011) demonstrated that although circadian core clock genes are 502 expressed in rat placenta, and positive core clock genes were increased during late 503 gestation, they did not exhibit robust circadian rhythms of expression. Investigators 504 speculated that attenuated rhythms of clock genes’ expression in placenta may ensure 505 around-the-clock activation of downstream genes that mediate metabolic processes, 506 vascular growth and/or substrate supply. During the transition from pregnancy to 507 lactation changes occur in core clock genes’ expression across multiple tissues (Casey et 508 al., 2009; Casey et al., 2014). In particular robustness of core clock genes’ expression 509 rhythms is increased in hepatic tissue and the SCN during lactation. Amplitude of the 510 core clock gene PER2 expression rhythm in the SCN was greater in lactating versus 511 pregnant mouse dams. The PER2 gene, which is one of the major transcriptional targets 512 of CLOCK-BMAL1 complex, is involved in this central clock resetting (Nagano et al., 513 2009). Moreover, the hypothalamus-pituitary-adrenal (HPA) axis also changes 514 responsiveness in late pregnancy and lactation, these changes maintain relatively high 515 basal levels of glucocorticoids with an attenuation of circadian oscillation (Brunton et al., 516 2008; Windle et al., 2013). Thus similar to serotoninergic system, circadian clocks 517 regulate metabolic homeostasis, and changes in molecular clocks and rhythms during 518 pregnancy and lactation likely reflect adaptive changes to support these physiological 519 states. 520 521 4.5. Inputs and outputs in mammary gland clocks 522 Mammary tissue expresses circadian core clock genes, and their relationship with 523 mammary development and lactation is beginning to be elucidated. Temporal analysis of 524
131 core circadian clock genes’ expression at different stages in the mouse mammary gland 525 (virgin, pregnant, lactation and involution), showed dynamic changes in core clock genes’ 526 expression with phase of reproduction (Metz et al., 2006; Casey et al., 2014). Particularly 527 interesting is that Bmal1 steady state mRNA levels across the circadian cycle are reduced 528 in mammary tissue from virgin and early pregnant mice, and then increase in glands from 529 late gestation and lactating mice. In contrast Per2 expression patterns were relatively 530 reduced in lactating versus pregnant glands. Furthermore, during involution, the 531 expression of BMAL1 was reduced and PER2 increased (Metz et al., 2006). Together the 532 studies demonstrate that mammary circadian clock follows a cycle of changes in its 533 components along the gestation/lactation/involution cycle. 534 535 During lactation there is an attenuation of multiple core clocks genes’ expression rhythms 536 in the mammary gland, and an increase in abundance of BMAL1 and CLOCK protein 537 levels across the entire circadian cycle (Casey et al., 2014). Circulating and 538 glucocorticoid and prolactin levels during lactation exhibit circadian rhythms that are 539 superimposed by suckling response release, and together likely influence mammary clock 540 dynamics. Using the HC11 cell culture model, it was found that treatment with 541 glucocorticoids impacted core clock gene expression (Casey et al., 2014). Moreover, 542 prolactin treatment alone significantly increased amplitude of BMAL1 expression, but 543 had no effect on period length. In addition prolactin induced bi-directional phase shifts 544 in BMAL1 expression, which depended on the phase at which it was administered. Thus 545 these data indicated that prolactin and glucocorticoids affect mammary clock dynamics, 546 and timing of prolactin stimulus can shift the phase of the clock. In addition, continuous 547 exposure to prolactin and glucocorticoids in culture (versus 2 h treatment), caused an 548 attenuation of core circadian clocks’ gene expression. Together suggesting that the 549 attenuation of core clock gene’s expression during lactation in mice is due in part to 550 frequent suckling in early lactation, resulting in relatively continuous exposure to potent 551 inputs to molecular clocks, glucocorticoids and prolactin. Timing of food intake also 552 appears to be an input to the mammary clock during lactation. A study conducted by Ma 553 et al. (2013) showed that restricting feeding times in rodents caused shifts in mammary 554
132 clocks genes’ expression and circadian variations of milk fat synthesis by affecting 555 lipogenic regulators (SREBP1c and Spot 14) and milk fat synthetic enzymes (FASN and 556 SCD1). Further, core clocks genes temporal expression patterns were responsive to the 557 timing of food intake in rodents and circadian pattern of milk synthesis in the dairy cow 558 (Ma et al., 2013; Rottman et al., 2014). Although, normally driven by the SCN, under 559 certain physiological conditions peripheral clocks may function independently and 560 synchronize their activity with a stimulus that is more important for physiological function 561 of that particular tissue. These studies support that during lactation the clock in the 562 mammary gland is responsive to suckling cues from the neonate as well as substrate 563 availability 564 565 Mammary gland clock function is widely unknown, but studies, including photoperiod 566 studies, support a potential role in regulation of development as well as metabolic output, 567 i.e. milk synthesis. Temporal transcriptome analysis revealed that 7% of the genes 568 expressed in lactating breast exhibited circadian oscillation (Maningat et al., 2009). In 569 addition to core circadian clocks genes, those genes were involved in cell development, 570 growth, and proliferation, apoptosis, and intra-cellular signaling cascade. Work with 571 HC11 cells, have demonstrated changes in expressions of the clock core genes between 572 undifferentiated and differentiated states (untreated or treated with lactogen media, 573 respectively). Similar to what is evident in vivo with transition from pregnancy to 574 lactation, upon differentiation HC11 cells express a greater abundance of BMAL1 and 575 CLOCK proteins and PER2 protein level is reduced relative to undifferentiated cultures. 576 Studies from our laboratory, showed that reducing levels of CLOCK protein in HC-11 577 cells using shRNA (shCLOCK cells) caused higher rates of growth compared to wild-578 type cultures. Consistent with higher growth rate was a higher expression of cell cycle 579 regulator cyclin D1 and lower expression of tumor protein 63 (P63) in shCLOCK 580 transfected HC11 cells versus wild-type controls (Casey et al., in revision). Studies of 581 CLOCK mutant mice support a role of the circadian system in regulation of lactation 582 competency. Clock-Δ19 mice have an ENU-induced mutation that affects transactivation 583 properties of CLOCK, and results in disruption of behavioral rhythmicity, loss of 584
133 rhythmic gene expression, and down-regulation of CLOCK-BMAL1 target genes (Antoch 585 et al., 1997; King et al., 1997; Panda et al., 2002). Studies of circadian regulation of 586 reproduction in the Clock-Δ19 line of mice found this mutation has minimal effects on 587 growth and development of pups during gestation, however litter growth and survival is 588 significantly decreased postnatally (Kennaway DJ, 2004; Dolatshad et al., 2006; Hoshino 589 et al., 2006). Hoshino et al. (2006) reported altered maternal nursing behavior and serum 590 prolactin content in the Clock-∆19 line of mice, however these differences do not likely 591 account for decreased lactation competency, as frequency of nursing bouts increased and 592 there was no difference in basal prolactin levels. Studies in our lab showed that alveolar 593 differentiation in mammary glands from late pregnant Clock-Δ19 mice was impaired 594 compared to WT. Thus suggesting that circadian clocks affect lactation competency in 595 part through regulation of mammary development (Casey, T.; unpublished results). 596 Moreover, this idea of mammary clock driving mammary gland development is supported 597 also by photoperiod effects on mammary function, as exposure to short day photoperiod 598 (SDPP; 8 h light:16 h dark) versus long day photoperiod (LDPP) during the dry period 599 increases milk production in the subsequent lactation, in part, by increasing mammary 600 cell proliferation (Mabjeesh et al., 2007; Dahl, 2008). 601 602 There is also evidence that the mammary clock regulates expression of genes related to 603 milk synthesis. Analysis of effect of decreased levels of CLOCK on HC11 differentiation 604 found that after 96 h of culture with prolactin, glucocorticoids and insulin to induce 605 differentiation, shCLOCK transfected cells expressed significantly lower levels of fatty 606 acid synthase (FASN) and the adherens junction protein CDH1 than wild type HC-11 607 cells (Casey et al., in revision). In vivo studies revealed Bmal1 and Per2 showed circadian 608 patterns of expression in RNA isolated from milk fat globules of lactating sheep which 609 correlated with circadian changes in expression of acetyl-CoA carboxylase (ACACA) as 610 well as percent milk fat (Schmitt et al., 2014). In mice, mammary expression of LALBA 611 (alpha-lactalbumin), SREBF1 (sterol regulatory-element-binding protein 1) and FASN 612 (fatty acid synthase) genes all showed circadian rhythms during lactation (Casey et al., 613 2014). Circadian rhythms of lactose synthesis is well characterized and known to be 614
134 mediated by circadian changes of expression in lactose synthesis enzymes (Kuhn et al., 615 1980). Together, these findings support that circadian clocks regulate metabolic output 616 (milk synthesis) during lactation. 617 618 A growing body of literature supports that mammary circadian clocks have two primary 619 functions in the gland. First, circadian rhythms of expression of genes that regulate 620 proliferation and differentiation in combination with dynamic changes in core clock 621 dynamics along the lactation cycle support a role for the mammary clock in regulation of 622 gland development. Secondly, circadian rhythms of genes that regulate milk synthesis, 623 and responsiveness of mammary clock to suckling cues support a role for clock in 624 regulation of synthesis of milk components. 625 626 5. Connections between serotonin and circadian clocks 627 As reviewed above, both systems, serotoninergic and circadian, are present in the brain 628 where they function as principle regulatory networks of homeostatic and homeorhetic 629 processes. These master regulatory systems are extensively intertwined, with neuronal 630 connections, and expression of key genetic elements for serotonin signaling in clock 631 neurons and expression of key clock genes in serotonergic neurons (Ciarleglio et al., 632 2011). Outside the central nervous system, circadian and serotoninergic factors regulate 633 key peripheral tissue functions that affect homeostatic and homeorhetic processes, 634 including in the mammary gland. We propose that similar to central reciprocal regulation 635 of serotoninergic and circadian systems, these systems are connected in the systemic and 636 local regulation of the mammary gland development and lactation performance. 637 Circadian clock dynamics and serotonin components both exhibit dynamic changes in the 638 gland with reproductive-developmental state (Matsuda et al., 2004; Metz et al., 2006; 639 Casey et al., 2014). These changes likely reflect in part their reciprocal regulation, and 640 initial investigations in our laboratory and others support interactions among the circadian 641 and serotonergic systems in the mammary gland. Among these investigations was 642 bioinformatics analysis of the 2,000 bp upstream sequences of serotonergic genes: TPH1, 643 SLC6A4, AADC AND HTR7 in mouse genome, which revealed that all four genes have 644
135 multiple non-canonical E-box sequences (CANNTG). SLC6A4 (SERT) also had a 645 canonical sequence (CACGTG) in this region (Table 1). Temporal analysis of steady 646 state levels of SLC6A4 in total RNA samples isolated from sheep milk fat globules 647 showed the gene exhibits a circadian rhythm of expression. In addition, SLC6A4 pattern 648 of expression was similar to the rhythm founded for PER2 and out-of-phase from BMAL1 649 expression rhythm (Figure 4). Comparison of PER2 and SERT temporal expression 650 patterns in wild-type HC11 cells, and cultures that carry shRNA which targeted CLOCK, 651 showed SLC6A4 expression was decreased across all the time points in lines with 652 decreased CLOCK abundance relative to controls. Moreover, as with in vivo findings, 653 PER2 and SLC6A4 expression patterns were similar in both cell lines, WT and shCLOCK 654 (Figure 5). Thus suggesting direct, or indirect, regulation of SERT expression by 655 BMAL1-CLOCK. Further, a recent study by Laporta et al. (Laporta et al., 2015) showed 656 that 5-HT levels corresponded to expression levels of the clock core gene PER2 in mouse 657 mammary glands. This group found a 4-fold increase in mammary PER2 mRNA 658 expression when TPH1 knockout mice were treated with exogenous 5-HTP (5-659 hydrotriptophan, a serotonin precursor) compared with untreated wild-type mice. Studies 660 in our lab found the addition of 5HT to mammary explants from lactating mice cultured 661 in prolactin, hydrocortisone and insulin shifted temporal expression patterns of BMAL1, 662 CLOCK, PER1 and PER2 relative to controls cultured in prolactin, hydrocortisone and 663 insulin alone. Together suggesting that 5-HT acts as a direct or indirect input to mammary 664 clocks. 665 666 In conclusion, both the circadian and serotonergic systems regulate homeostatic and 667 homeorhetic process along the lactation cycle. Preliminary evidence support that similar 668 to central mechanisms circadian clocks and peripheral serotoninergic system interact to 669 mediate homeorhetic and homeostatic processes that support lactation. Each system 670 drives developmental changes in the gland as the female transitions through the lactation 671 cycle, and both systems function as homeorhetic regulators to support changes in 672 metabolic demands with changes in reproduction state (pregnancy-lactation-weaning). 673
136 Further studies are needed to elucidate mechanism of interactions among the systems in 674 the gland and the role of these interactions in the regulation of the lactation cycle. 675 676 Funding 677 This work has been supported by FPU 12/06079 Scholarship, and by the scholarship EST 678 14/00493 both from the Ministry of Education, Culture and Sports of the Spanish 679 Government (Madrid, Spain). 680 681 References 682 Akhtar, R.A., Reddy, A.B., Maywood, E.S., Clayton, J.D., King, V.M., Smith, A.G., et 683 al. (2002). Circadian cycling of the mouse liver transcriptome, as revealed by 684 cDNA microarray, is driven by the suprachiasmatic nucleus. Current Biology 685 12(7), 540-550. doi: 10.1016/s0960-9822(02)00759-5. 686 Amir, S., Robinson, B., Ratovitski, T., Rea, M.A., Stewart, J., and Simantov, R. (1998). 687 A role for serotonin in the circadian system revealed by the distribution of 688 serotonin transporter and light-induced Fos immunoreactivity in the 689 suprachiasmatic nucleus and intergeniculate leaflet. Neuroscience 84(4), 1059-690 1073. doi: 10.1016/s0306-4522(97)00575-7. 691 Anderson, E., and Clarke, R.B. (2004). Steroid receptors and cell cycle in normal 692 mammary epithelium. Journal of Mammary Gland Biology and Neoplasia 9(1), 693 3-13. doi: 10.1023/b:jomg.0000023584.01750.16. 694 Ando, H., Yanagihara, H., Hayashi, Y., Obi, Y., Tsuruoka, S., Takamura, T., et al. (2005). 695 Rhythmic messenger ribonucleic acid expression of clock genes and 696 adipocytokines in mouse visceral adipose tissue. Endocrinology 146(12), 5631-697 5636. doi: 10.1210/en.2005-0771. 698 Antoch, M.P., Song, E.-J., Chang, A.-M., Vitaterna, M.H., Zhao, Y., Wilsbacher, L.D., et 699 al. (1997). Functional Identification of the Mouse Circadian Clock Gene by 700 Transgenic BAC Rescue. Cell 89(4), 655-667. 701 Barrett, P., and Bolborea, M. (2012). Molecular pathways involved in seasonal body 702 weight and reproductive responses governed by melatonin. Journal of Pineal 703 Research 52(4), 376-388. doi: 10.1111/j.1600-079X.2011.00963.x. 704 Bauman, D.E., and Currie, W.B. (1980). Partitioning of nutrients during pregnancy and 705 lactation - a review of mechanisms involving homeostasis and homeorhesis. 706 Journal of Dairy Science 63(9), 1514-1529. 707 Bell, A.W. (1995). Regulation of organic nutrient metabolism during transition form late 708 pregnancy to early lactation. Journal of Animal Science 73(9), 2804-2819. 709 Bell, A.W., and Bauman, D.E. (1997). Adaptations of Glucose Metabolism During 710 Pregnancy and Lactation. Journal of Mammary Gland Biology and Neoplasia 711 2(3), 265-278. doi: 10.1023/a:1026336505343. 712
137 Brunton, P.J., Russell, J.A., and Douglas, A.J. (2008). Adaptive responses of the maternal 713 hypothalamic-pituitary-adrenal axis during pregnancy and lactation. Journal of 714 Neuroendocrinology 20(6), 764-776. doi: 10.1111/j.1365-2826.2008.01735.x. 715 Buijs, R.M., van Eden, C.G., Goncharuk, V.D., and Kalsbeek, A. (2003). The biological 716 clock tunes the organs of the body: timing by hormones and the autonomic 717 nervous system. Journal of Endocrinology 177(1), 17-26. doi: 718 10.1677/joe.0.1770017. 719 Capuco, A.V., Ellis, S.E., Hale, S.A., Long, E., Erdman, R.A., Zhao, X., et al. (2003). 720 Lactation persistency: Insights from mammary cell proliferation studies. Journal 721 of Animal Science 81, 18-31. 722 Carlini, V.P., Varas, M.M., Cragnolini, A.B., Schioth, H.B., Scimonelli, T.N., and de 723 Barioglio, S.R. (2004). Differential role of the hippocampus, amygdala, and 724 dorsal raphe nucleus in regulating feeding, memory, and anxiety-like behavioral 725 responses to ghrelin. Biochemical and Biophysical Research Communications 726 313(3), 635-641. doi: 10.1016/j.bbrc.2003.11.150. 727 Casey, T., Patel, O., Dykema, K., Dover, H., Furge, K., and Plaut, K. (2009). Molecular 728 Signatures Reveal Circadian Clocks May Orchestrate the Homeorhetic Response 729 to Lactation. Plos One 4(10). doi: 10.1371/journal.pone.0007395. 730 Casey, T.M., Crodian, J., Erickson, E., Kuropatwinski, K.K., Gleiberman, A.S., and 731 Antoch, M.P. (2014). Tissue-Specific Changes in Molecular Clocks During the 732 Transition from Pregnancy to Lactation in Mice. Biology of Reproduction 90(6). 733 doi: 10.1095/biolreprod.113.116137. 734 Challet, E. (2015). Keeping circadian time with hormones. Diabetes Obesity & 735 Metabolism 17, 76-83. doi: 10.1111/dom.12516. 736 Ciarleglio, C.M., Resuehr, H.E., and McMahon, D.G. (2011). Interactions of the serotonin 737 and circadian systems: nature and nurture in rhythms and blues. Neuroscience 738 197, 8-16. doi: 10.1016/j.neuroscience.2011.09.036. 739 Cunha, G.R., Young, P., Horn, Y.K., Cooke, P.S., Taylor, J.A., and Lubahn, D.B. (1997). 740 Elucidation of a Role for Stromal Steroid Hormone Receptors in Mammary Gland 741 Growth and Development Using Tissue Recombinants. Journal of Mammary 742 Gland Biology and Neoplasia 2(4), 393-402. doi: 10.1023/a:1026303630843. 743 Dahl, G.E. (2008). Effects of short day photoperiod on prolactin signaling in dry cows: a 744 common mechanism among tissues and environments? Journal of Animal 745 Science 86(13 Suppl), 10-14. 746 Damiola, F., Le Minh, N., Preitner, N., Kornmann, B., Fleury-Olela, F., and Schibler, U. 747 (2000). "Restricted feeding uncouples circadian oscillators in peripheral tissues 748 from the central pacemaker in the suprachiasmatic nucleus", in: Genes and 749 Development.). 750 Darlington, T.K., Wager-Smith, K., Ceriani, M.F., Staknis, D., Gekakis, N., Steeves, 751 T.D.L., et al. (1998). Closing the circadian loop: CLOCK-induced transcription 752 of its own inhibitors per and tim. Science 280(5369), 1599-1603. doi: 753 10.1126/science.280.5369.1599. 754 Di-Cicco, A., Petit, V., Chiche, A., Bresson, L., Romagnoli, M., Orian-Rousseau, V., et 755 al. (2015). Paracrine Met signaling triggers epithelial-mesenchymal transition in 756
144 Stull, M.A., Pai, V., Vomachka, A.J., Marshall, A.M., Jacob, G.A., and Horseman, N.D. 1017 (2007). Mammary gland homeostasis employs serotonergic regulation of 1018 epithelial tight junctions. Proceedings of the National Academy of Sciences of the 1019 United States of America 104(42), 16708-16713. doi: 10.1073/pnas.0708136104. 1020 Tan, D.-X., Zheng, X., Kong, J., Manchester, L.C., Hardeland, R., Kim, S.J., et al. (2014). 1021 Fundamental Issues Related to the Origin of Melatonin and Melatonin Isomers 1022 during Evolution: Relation to Their Biological Functions. International Journal 1023 of Molecular Sciences 15(9), 15858-15890. doi: 10.3390/ijms150915858. 1024 Taniyama, K., Makimoto, N., Furuichi, A., Sakurai-Yamashita, Y., Nagase, Y., Kaibara, 1025 M., et al. (2000). Functions of peripheral 5-hydroxytryptamine receptors, 1026 especially 5-hydroxytryptamine(4) receptor, in gastrointestinal motility. Journal 1027 of Gastroenterology 35(8), 575-582. doi: 10.1007/s005350070056. 1028 van Esseveldt, L.K.E., Lehman, M.N., and Boer, G.J. (2000). The suprachiasmatic 1029 nucleus and the circadian time-keeping system revisited. Brain Research Reviews 1030 33(1), 34-77. doi: 10.1016/s0165-0173(00)00025-4. 1031 Versteeg, R.I., Serlie, M.J., Kalsbeek, A., and la Fleur, S.E. (2015). Serotonin, a possible 1032 intermediate between disturbed circadian rhythms and metabolic disease. 1033 Neuroscience 301, 155-167. doi: 1034 http://dx.doi.org/10.1016/j.neuroscience.2015.05.067. 1035 Watson, C.J. (2006). Key stages in mammary gland development - Involution: apoptosis 1036 and tissue remodelling that convert the mammary gland from milk factory to a 1037 quiescent organ. Breast Cancer Research 8(2). doi: 10.1186/bcr1401. 1038 Weaver, D.R. (1998). The suprachiasmatic nucleus: A 25-year retrospective. Journal of 1039 Biological Rhythms 13(2), 100-112. doi: 10.1177/074873098128999952. 1040 Wharfe, M.D., Mark, P.J., and Waddell, B.J. (2011). Circadian Variation in Placental and 1041 Hepatic Clock Genes in Rat Pregnancy. Endocrinology 152(9), 3552-3560. doi: 1042 10.1210/en.2011-0081. 1043 Windle, R.J., Wood, S.A., Kershaw, Y.M., Lightman, S.L., and Ingram, C.D. (2013). 1044 Adaptive Changes in Basal and Stress-Induced HPA Activity in Lactating and 1045 Post-Lactating Female Rats. Endocrinology 154(2), 749-761. doi: 1046 10.1210/en.2012-1779. 1047 Yadav, V.K., Balaji, S., Suresh, P.S., Liu, X.S., Lu, X., Li, Z., et al. (2010). 1048 Pharmacological inhibition of gut-derived serotonin synthesis is a potential bone 1049 anabolic treatment for osteoporosis. Nat Med 16(3), 308-312. doi: 1050 http://www.nature.com/nm/journal/v16/n3/suppinfo/nm.2098_S1.html. 1051 Yadav, V.K., Ryu, J.-H., Suda, N., Tanaka, K.F., Gingrich, J.A., Schuetz, G., et al. 1052 (2008a). Lrp5 Controls Bone Formation by Inhibiting Serotonin Synthesis in the 1053 Duodenum. Cell 135(5), 825-837. doi: 10.1016/j.cell.2008.09.059. 1054 Yadav, V.K., Ryu, J., Suda, N., Ducy, P., and Karsenty, G. (2008b). Gut-derived 1055 Serotonin Is an Inhibitor of Bone Formation. Journal of Bone and Mineral 1056 Research 23, S390-S390. 1057 Yart, L., Lollivier, V., Marnet, P.G., and Dessauge, F. (2014). Role of ovarian secretions 1058 in mammary gland development and function in ruminants*. Animal 8(1), 72-85. 1059 doi: 10.1017/s1751731113001638. 1060
145 Figure legends 1061 Figure 1. Serotoninergic system in mammary epithelial cells. Serotonin, 5-1062 hydroxytryptamine (5-HT) is synthesized from L-tryptophan by the rate limiting enzyme 1063 tryptophan hydroxylase 1 (TPH1) into 5-hydroxyl-L-tryptophan. Aromatic aminoacid 1064 descarboxylase (AADC) converts 5-hydroxyl-L-tryptophan into 5-HT. After synthesis, 5-1065 HT is released in the alveolar lumen. Serotonin is either transported across cellular 1066 membrane into cytoplasm by SERT (solute carrier family 6 member 4, SLC6A4) where 1067 it is degraded by monoamine oxidase (MAO) in inactive metabolites (5-HIAA), or binds 1068 to one of its G protein coupled receptors (serotonin receptors, 5-HTR) in the cell 1069 membrane. At high levels of 5-HT, binds to receptors and increases cAMP concentration 1070 in the cell, which in turn results in decreased PKA phosphorylation (pPKA) and increased 1071 phosphorylated P38. Decrease of pPKA interferes with tight junction (TJ) integrity. 1072 Figure 2. Hierarchical organization of circadian timing system in mammals. The 1073 master clock in the suprachiasmatic nuclei (SCN) of the hypothalamus, receives external 1074 and internal temporal information, integrates it, and then sends outputs (hormonal or 1075 neuronal cues) to the peripheral clocks that exist in every tissue of the body to coordinate 1076 internal physiology and synchronize it to the environment. 1077 Figure 3. Schema of cellular clocks’ molecular mechanism. A) Circadian clock 1078 molecular mechanism is based on a transcription-translation feedback loop, in which Aryl 1079 hydrocarbon receptor nuclear translocator-like protein 1 (ARNTL, aka BMAL1), 1080 Circadian Locomotor Output Cycles Kaput (CLOCK) and Neuronal PAS Domain Protein 1081 2 (NPAS2) constitute the positive limb. The heterodimers BMAL1-CLOCK or BMAL1-1082 NPAS2 bind the promoter regions (E-boxes) of clock-controlled genes (CCGs). Among 1083 CCGs are Cryptochrome (Cry 1 and 2) and Period (Per 1, 2 and 3) genes, which encode 1084 for CRY 1 and 2, and PER 1, 2 and 3 factors, the negative limb of the loop. CRY and 1085 PER factors prevent BMAL1-CLOCK and BMAL1-NPAS2 binding activity in promoter 1086 regions of on CCGs. BMAL1 is also regulated by two other CCGs, REV-ERVα and 1087 RORα, which repress or activate, respectively BMAL1 expression. B) Every cell has a 1088
146 self-sustained molecular clock that promotes CCGs oscillating expression based on a 1089 circadian rhythm. Inputs of temporal information produce changes in temporal expression 1090 of clock core genes (BMAL1, CLOCK, NPAS2, CRY or PER), which is translated in 1091 temporal expression patterns of CCGs. 1092 Figure 4. SLC6A4, BMAL1 and PER2 expression in sheep milk fat globules in a 24 1093 hours period. Total RNA was isolated from milk fat globules collected from lactating 1094 sheep every 4 h during a 24 h period the first week postpartum and used for temporal 1095 analysis of gene expression. Relative gene expression is expressed as the log base 2 of 1096 the 2-ΔΔCt calculations of the gene expression, using the mean across time points within an 1097 animal as the normalizer and 18S as the reference gene. Black, grey and dashed lines 1098 represent SLC6A4 (SERT), PER2 and BMAL1 expression, respectively. 1099 Figure 5. SLC6A4 and PER2 expression in HC11 and shCLOCK cells. Cells were 1100 plated, grown to confluence and media was changed to synchronize clocks. Samples for 1101 mRNA extraction were taken every 4 hours over a 24 hour period. A) Expression of 1102 SLC6A4 in HC11 (black line) and shCLOCK (gray line) cells. B) Expression of PER2 1103 (black line) and SLC6A4 (grey line) in HC11 cells. C) Expression of PER2 (black line) 1104 and SLC6A4 (grey line) in shCLOCK cells. Expression of SCL4A4 and PER2 was 1105 analyzed by qPCR. Ct results were analyzed using the 2-ΔΔCt method, and CT0 1106 normalization was done. 1107 1108
147 Table 1. Upstream location of canonical (CACGTG) and non-canonical (CANNTG) E-box nucleotide sequences of TPH1, SLC6A4, DDC and HTR7 transcription start sites TPH1 SLC6A4 DDC HTR7 CACGTG -1282 CAAGTG -874 -71 -943 CAAATG -1557 CAACTG -1051 -1922 -1327 CACATG -82 CACTTG -721 -1924 -1935 -383 -682 CACCTG -1072 -1436 -1305 -1753 CAGGTG -93 -314 CAGATG -269 -613 -1263 CAGCTG -136 -1024 -1720 -1776 -887 CAGTTG -666 -702 CATATG -608 -741 -1954 CATCTG -1706 CATGTG -335 -42 -605 * CAATTG and CATTTG sequences were not present in 2kb region upstream from analyzed gene start site. 1109
148 Figure 1 1110 1111
149 Figure 2 1112 1113 1114
150 Figure 3 1115 1116 1117 1118 1119 1120 1121 1122 1123 1124 1125 1126 1127 1128 1129 1130 1131 1132 1133 A B
151 Figure 4 1134 1135 1136 1137
152 Figure 5 1138 1139 1140 1141 ‐8 ‐6 ‐4 ‐2 0 2 0 4 8 12 16 20 24 Logbase2 A ‐3 ‐2 ‐1 0 1 2 3 4 0 4 8 12 16 20 24 Logbase2 B ‐8 ‐6 ‐4 ‐2 0 2 4 0 4 8 12 16 20 24 Logbase2 C
153