scieee AI-readable full text Open interactive document viewer

Comprehensive molecular landscape of cetuximab resistance in head and neck cancer cell lines

Gomes, Izabela N. F.; Silva-Oliveira, Renato J. da; Silva, Luciane Sussuchi da; Martinho, Olga; Evangelista, Adriane F.; Helvoort Lengert, André van; Leal, Letícia Ferro; Silva, Viviane Aline Oliveira; Santos, Stéphanie Piancenti dos; Nascimento, Flávia

Abstract

Cetuximab is the sole anti-EGFR monoclonal antibody that is FDA approved to treat head and neck squamous cell carcinoma (HNSCC). However, no predictive biomarkers of cetuximab response are known for HNSCC. Herein, we address the molecular mechanisms underlying cetuximab resistance in an in vitro model. We established a cetuximab resistant model (FaDu), using increased cetuximab concentrations for more than eight months. The resistance and parental cells were evaluated for cell viability and functional assays. Protein expression was analyzed by Western blot and human cell surface panel by lyoplate. The mutational profile and copy number alterations (CNA) were analyzed using whole-exome sequencing (WES) and the NanoString platform. FaDu resistant clones exhibited at least two-fold higher IC<sub>50</sub> compared to the parental cell line. WES showed relevant mutations in several cancer-related genes, and the comparative mRNA expression analysis showed 36 differentially expressed genes associated with EGFR tyrosine kinase inhibitors resistance, RAS, MAPK, and mTOR signaling. Importantly, we observed that overexpression of KRAS, RhoA, and CD44 was associated with cetuximab resistance. Protein analysis revealed EGFR phosphorylation inhibition and mTOR increase in resistant cells. Moreover, the resistant cell line demonstrated an aggressive phenotype with a significant increase in adhesion, the number of colonies, and migration rates. Overall, we identified several molecular alterations in the cetuximab resistant cell line that may constitute novel biomarkers of cetuximab response such as mTOR and RhoA overexpression. These findings indicate new strategies to overcome anti-EGFR resistance in HNSCC.

Full text

  Citation: Gomes, I.N.F.; da Silva-Oliveira, R.J.; da Silva, L.S.; Martinho, O.; Evangelista, A.F.; van Helvoort Lengert, A.; Leal, L.F.; Silva, V.A.O.; dos Santos, S.P.; Nascimento, F.C.; et al. Comprehensive Molecular Landscape of Cetuximab Resistance in Head and Neck Cancer Cell Lines. Cells 2022,11, 154. https://doi.org/ 10.3390/cells11010154 Academic Editor: Zhixiang Wang Received: 22 November 2021 Accepted: 31 December 2021 Published: 4 January 2022 Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. Copyright: © 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https:// creativecommons.org/licenses/by/ 4.0/). cells Article Comprehensive Molecular Landscape of Cetuximab Resistance in Head and Neck Cancer Cell Lines Izabela N. F. Gomes 1,† , Renato J. da Silva-Oliveira 1,2,†, Luciane Sussuchi da Silva 1, Olga Martinho 3, Adriane F. Evangelista 1, Andrévan Helvoort Lengert 1, Letícia Ferro Leal 1,2 , Viviane Aline Oliveira Silva 1, Stéphanie Piancenti dos Santos 4, Flávia Caroline Nascimento 3, AndréLopes Carvalho 1 and Rui Manuel Reis 1,3,4,5,* 1Molecular Oncology Research Center, Barretos Cancer Hospital, Barretos 14784-400, Brazil; [email protected] (I.N.F.G.); [email protected] (R.J.d.S.-O.); [email protected] (L.S.d.S.); [email protected] (A.F.E.); [email protected] (A.v.H.L.); leticiaferr[email protected] (L.F.L.); [email protected] (V.A.O.S.); [email protected] (A.L.C.) 2Barretos School of Medicine Dr. Paulo Prata—FACISB, Barretos 14785-002, Brazil 3Life and Health Sciences Research Institute (ICVS), Medical School, University of Minho, 4710-057 Braga, Portugal; [email protected] (O.M.); [email protected] (F.C.N.) 4Laboratory of Molecular Diagnosis, Barretos Cancer Hospital, Barretos 14784-400, Brazil; [email protected] 53ICVS/3B’s-PT Government Associate Laboratory, 4710-057 Braga, Portugal *Correspondence: r[email protected] † These authors contributed equally to this work. Abstract: Cetuximab is the sole anti-EGFR monoclonal antibody that is FDA approved to treat head and neck squamous cell carcinoma (HNSCC). However, no predictive biomarkers of cetuximab response are known for HNSCC. Herein, we address the molecular mechanisms underlying cetuximab resistance in an in vitro model. We established a cetuximab resistant model (FaDu), using increased cetuximab concentrations for more than eight months. The resistance and parental cells were evaluated for cell viability and functional assays. Protein expression was analyzed by Western blot and human cell surface panel by lyoplate. The mutational profile and copy number alterations (CNA) were analyzed using whole-exome sequencing (WES) and the NanoString platform. FaDu resistant clones exhibited at least two-fold higher IC 50 compared to the parental cell line. WES showed relevant mutations in several cancer-related genes, and the comparative mRNA expression analysis showed 36 differentially expressed genes associated with EGFR tyrosine kinase inhibitors resistance, RAS, MAPK, and mTOR signaling. Importantly, we observed that overexpression of KRAS, RhoA, and CD44 was associated with cetuximab resistance. Protein analysis revealed EGFR phosphorylation inhibition and mTOR increase in resistant cells. Moreover, the resistant cell line demonstrated an aggressive phenotype with a significant increase in adhesion, the number of colonies, and migration rates. Overall, we identified several molecular alterations in the cetuximab resistant cell line that may constitute novel biomarkers of cetuximab response such as mTOR and RhoA overexpression. These findings indicate new strategies to overcome anti-EGFR resistance in HNSCC. Keywords: EGFR; cetuximab; drug resistance; head and neck tumors; biomarkers; in vitro ; pre-clinical 1. Introduction Head and neck squamous cell carcinoma (HNSCC) is the eighth most common neoplasia worldwide, accounting for 377,000 new cases and 177,000 deaths from this disease every year [ 1 ]. HNSCC can be associated with tobacco and alcohol consumption, representing 75% of all cases. However, infection with the Human Papilloma Virus (HPV) high-risk types are increasingly detected and currently considered one oncogenic driver in a subset of cases [ 2 ]. HNSCCs also harbor a high genetic heterogeneity, with mutations in tumor Cells 2022,11, 154. https://doi.org/10.3390/cells11010154 https://www.mdpi.com/journal/cells Cells 2022,11, 154 2 of 20 suppressor genes such as TP53 and p16INK4a and activation of oncogenes, such as the epidermal growth factor receptor (EGFR) and PIK3CA [3–5]. EGFR is a transmembrane protein that belongs to the HER/ErbB family of tyrosine kinases receptors (RTK), including ErbB2/Neu/Her2, ErbB3/Her3, and ErbB4/Her4 [ 6 ]. Ligand binding triggers homo/heterodimerization with other HER phosphorylation, activating downstream signaling pathways promoting proliferation members and subsequent cell cycle differentiation, survival, angiogenesis, invasion, and metastasis in cancer [ 3 , 6 ]. Moreover, EGFR can translocate to the nucleus and acts as a transcriptional factor [ 7 ]. EGFR is overexpressed in 90% of all HNSCCs and correlates with poor survival and treatment outcomes [3,8]. Currently, the only anti-EGFR therapy FDA approved for HNSCC is Cetuximab [ 3 ]. Cetuximab is a chimeric monoclonal antibody that targets EGFR by competitively inhibiting their natural ligands, fostering EGFR internalization, and altering EGFR-dependent signaling [ 6 , 9 ]. Cetuximab demonstrated a 13% response rate in recurrent or metastatic HNSCC as monotherapy [10]. The combination of cetuximab and the first-line chemotherapy (platinum–fluorouracil) also improves response rates, progression-free survival (PFS), and overall survival (OS) (10.1 months versus 7.4 months; p= 0.04) in recurrent or metastatic HNSCC patients [ 11 ]. Moreover, in patients with advanced locoregionally disease, cetuximab plus radiotherapy improves OS compared with radiotherapy alone (49.0 months versus 29.3 months; p= 0.03) [ 12 ]. In addition, the locoregional control of HNSCC patients was 24.4 months among patients treated with cetuximab plus radiotherapy and 14.9 months among those given radiotherapy alone [ 12 ]. Despite encouraging response rates, cetuximab has shown high recurrence levels in HNSCC. Although PIK3CA and RAS mutations and PTEN expression were previously related as potentially biomarkers [ 13 ], the molecular mechanisms underlying cetuximab resistance remain unclear [14]. Herein, to identify new biomarkers related to the acquired cetuximab resistance in HNSCC, we developed a cetuximab-resistant in vitro model, performed an integrated molecular investigation and compared the newly acquired features with the parental cells to uncover particular genes or pathways involved in the acquired cetuximab resistance that could be related to the disease development. 2. Materials and Methods 2.1. Cell Lines and Cetuximab Resistance Model Development FaDu cell line was obtained from American Type Culture Collection (ATCC catalog number HTB-43). The cells were maintained in Dulbecco’s modified Eagle’s medium (DMEM 1X, high glucose; Gibco, Invitrogen, Grand Island, NY, USA) supplemented with 10% Fetal Bovine Serum (FBS, Gibco, Invitrogen Grand Island, NY, USA) and 1% penicillin/streptomycin solution (P/S, Sigma-Aldrich, San Luis, MO, USA), at 37 ◦ C and 5% CO 2 . The Department of Molecular Diagnostics, Barretos Cancer Hospital performed authentication of cells in June 2019, as previously reported [ 15 ]. Moreover, all cell lines were tested for mycoplasma through MycoAlertTm Mycoplasma Detection Kit (Lonza, Basel, Switzerland), following the manufacturer’s instructions. The cetuximab resistance model was developed by growing the sensitive cell line FaDu in increasing (200–3200 µ g/mL) sub-lethal concentrations of cetuximab (Merck, Darmstadt, Germany ) in the growth medium. The starting dose was approximately the IC 50 (inhibitory concentration, 50%) of the cell line for 72 h. The medium was then removed to allow the cells to recover for a further 72 h. This development phase was conducted for approximately eight months, and each clone was removed from the culture at a specific concentration, and then the cell viability assay was re-assessed. In the end, we obtained seven stable resistant clones. The resistant cell obtained (FaDu resistant) was cultivated in the same conditions as the parental cell line. Fadu Parental (FaDu P) was used as nonresistant control for all experiments. The stock solutions of cetuximab were prepared in phosphate-buffered saline (PBS, Sigma-Aldrich, San Luis, MO, USA) and stored at 4 ◦C. Cells 2022,11, 154 3 of 20 2.2. Chromosome Preparation and G-Banding The karyotyping analysis was performed as described previously [ 16 ]. Fadu parental and FaDu resistant were incubated with 120 ng/mL colcemid (Life Technologies–Gibco, Invitrogen Grand Island, NY, USA) for 120 min. The cells were harvested by treatment with 0.025% acutase, suspended in KCl 0.075 M solution at 37 ◦ C temperature for 8 min, and fixed with methanol/acetic acid (3:1) five times. The G banding was obtained using 0.0125 g/mL trypsin and 4% Giemsa solution. Twenty metaphases were analyzed using the Olympus BX61, BandView 7.2.7 (Applied Spectral Imaging/Genasis), and the result was described according to the International Human Cytogenetic Nomenclature System (ISCN 2016). 2.3. DNA Isolation and Whole Exome Sequencing (WES) Analysis The DNA from FaDu parental and FaDu resistant was used for WES, with the input of 1 µ g on the Illumina NovaSeq ™ System by a commercial company (Sophia Genetics, Switzerland). Sequence reads were aligned using human reference genome build 37 (hs37d5-decoy) applying BWA-MEM with Burrows–Wheeler Aligner version 0.7.10789 [ 17 ]. Duplicate reads were marked with Picard-Tools 1.92 (http://broadinstitute. github.io/picard/, accessed on 19 October 2021). MuTect version 1.1.4; (http://www. broadinstitute.org/cancer/cga/mutect, accessed on 19 October 2021) and Varscan2 [ 18 ] were used to call somatic SNVs and indels parental cell line, respectively. MuTect was run using default parameters with files from COSMIC version 54 and dbSNP version 132 included as input [ 19 , 20 ]. We used Ensembl Variant Effect Predictor (VEP) [ 21 ] to annotate and determine tumor-specific variants’ functional effects. The results from SIFT, Polyphen-2, ClinVar were considered. It also excluded variants likely to be germline, i.e., listed in ESP6500 (http://evs.gs.washington.edu/EVS/, accessed on 19 October 2021), 1000 Genome, or ExAC [ 22 , 23 ]. The candidate mutations were manually curated using the Integrated Genomics Viewer (IGV) [ 24 ]. Copy number abnormalities (CNA) were identified using Nexus Copy Number version 9.0 (BioDiscovery; El Segundo, CA, USA; https: //www.biodiscovery.com/products/Nexus-Copy-Number, accessed on 19 October 2021 ) with a default parameter for BAM ngCGH (matched) input with homozygous frequency threshold and value at 0.97 and 0.8, respectively, hemizygous loss threshold at − 0.18, single copy gain at 0.18 and high copy gain at 0.6. 2.4. Copy Number Alterations (CNA) CNA was analyzed using the nCounter ® v2 Cancer CN Assay panel (NanoString Technologies, Seattle, WA, USA). This panel counts the Copy Number Variation (CNV) of 87 involved genes commonly amplified or deleted in several cancers (www.nanostring.com/ products/CNV, accessed on 19 October 2021). As a control, the genomic DNA from FaDu parental was used. First 600 ng of genomic DNA was submitted to DNA fragmentation by AluI digestion followed by a denaturation step, which yields single-stranded templates. Then, single-stranded DNA templates were submitted to hybridization with a reporter probe, which carries the color-code, and a capture probe, which allows the immobilization of the targets over the cartridge for data capture. After hybridization, samples were transferred to the nCounter ® Prep Station, an automated platform, to remove probes excess and probe/target complexes alignment and immobilization over the nCounter ® cartridge. Then, cartridges were placed in the nCounter ® Digital Analyzer for data capture. Raw data was captured by the nSolverAnalysis Software v4.0®(NanoString Technologies) and normalized by the average of 54 probes targeting invariant regions (invariant controls). For final data estimation, CNA estimated twice the ratio of the average probe count per gene in the resistant cell line than the parental cell line as previously described [25]. 2.5. Cell Surface Markers Screening The cell surface markers were analyzed according to the manufacturers’ instructions. BD Lyoplate ™ Human Cell Surface Marker Screening Panel was utilized (cat. 560747; Cells 2022,11, 154 4 of 20 BD Biosciences, Franklin Lakes, NJ, USA) containing 242 purified monoclonal antibodies and corresponding isotype controls following the manufacturer’s instructions. Briefly, 5 × 10 3 cells were seeded in a 96-well plate in fluorescence-activated cell sorting (FACS) buffer containing 10 mg/mL DNAse. Primary antibody incubation was carried out in 27 mL volume for 30 min on ice, followed by two washes in FACS buffer washes. Next, cells were incubated with biotinylated secondary antibodies (goat anti-mouse 1:200, goat anti-mouse 1:200). The cells were fixed in 1000 µ L of 4% paraformaldehyde in 1 × PBS and washed in FACS buffer washes. FACS analysis gating allowed the elimination of debris. The analysis was performed using the BD ACCURI ™ C6 flow cytometer using at least 10,000 events per well. 2.6. Western Blot, Human RTK, Subcellular Fraction Separation, and Cytokines Arrays To assess the effect of cetuximab resistance in the intracellular signaling pathways and RTKs, the cells were cultured in DMEM 10% FBS in T25 culture flasks, which grew to 85% confluence and then serum starved for 2 h. The cells were washed and scraped in cold PBS and lysed in a buffer containing 50 mM Tris (pH 7.6–8), 150 mM NaCl, 5 mM EDTA, 1 mM Na3VO4, 10 mM NaF, 10 mM sodium pyrophosphate, and 1% NP-40 and protease cocktail inhibitors. Western blot analysis was performed using a standard 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis, loading 20 µ g of protein per lane. All the antibodies were used as recommended by the manufacturer. All the antibodies were used as recommended by the manufacturer (Supplementary Table S3). We used the Cell Fractionation Kit (cell signaling; #9038) for subcellular fraction separation according to the manufacturer’s instructions. Concerning the RTK phosphorylation assessment, a proteome human RTK Phosphorylation Antibody Array (ab193662; Abcam, Cambridge, UK) and Human XL Cytokine Array Kit (ARY022; R&D systems, Minneapolis, MM, USA) was used according to the manufacturer’s instructions. A total of 500 µ g of fresh protein lysates was briefly incubated overnight at 4 ◦ C with nitrocellulose membranes dotted with duplicated spots for 71 anti-RTK, 102 anti-Cytokines, and control antibodies. Bound phospho-RTKs and cytokines were incubated with a pan anti-phosphotyrosine-HRP antibody for 2 h at room temperature. Blot detection was performed by chemiluminescence (ECL Western Blotting Detection Reagents, RPN2109; GE Healthcare, Piscataway, NJ, USA) in ImageQuant LAS 4000 mini (GE Healthcare, Chicago, IL, USA). The bands were quantified by densitometry using the Image J software (1.49v). For subcellular fraction assay first, the total protein was normalized by the loading control ( β -actin) or by loading control for each cellular compartment (lamin B1 for nuclear and FADD for cytoplasm). Additionally, relative ratios (phospho/total) were determined. 2.7. mRNA NanoStringTM Analysis Gene expression analysis on FaDu parental and FaDu resistant was performed using the NanoString nCounter PanCancer Pathways panel (730 gene transcripts) according to the manufacturers’ instruction (NanoString Technologies, Seattle, WA, USA ). This panel assesses thirteen canonical pathways (Notch, Wnt, Hedgehog, Chromatin modification, Transcriptional Regulation, DNA Damage Control, TGF-beta, MAPK, STAT, PI3K, RAS, Cell Cycle and Apoptosis). Briefly, 100 ng aliquots of RNA were hybridized with probe pools, hybridization buffer, and codeset reagents in a total volume of 30 µ L and incubated at 65 ◦ C for 20 h. After codeset hybridization overnight, the samples were washed and immobilized to a cartridge using the Nanostring nCounter Prep Station (NanoString Technologies, Seattle, WA, USA ) for 4 h. Finally, the cartridges containing immobilized and aligned reporter complexes were scanned in the nCounter Digital Analyzer (NanoString Technologies), and image data were subsequently generated using the high-resolution setting. Quality control assessment of raw NanoString gene expression counts was performed with nSolver Analysis Software version 4.0 and the default settings (NanoString Technologies, Seattle, WA, USA). Quantile normalization and differential expression were performed within the NanoStringNorm package (v1.2.1.1) [ 26 ] in the R statistical environ- Cells 2022,11, 154 5 of 20 ment (v3.6.3). The normalized log2 mRNA expression values were used for subsequent data analysis. Genes with fold change (FC) ≥ ± 2 and p< 0.01 were considered significant. Heatmap with hierarchical clustering of differentially expressed genes was built in the ComplexHeatmap package (v2.0.0) [27]. 2.8. Expression Microarray The expression profile of the FaDu cells was analyzed by microarray slides Gene Expression Microarray, 4 × 44 K (Agilent Technologies, Santa Clara, CA, USA) in dual-color methodology (Cy3 and Cy5), following the manufacturer’s recommendations. Total RNA (500 ng) with the addition of control RNA (spike-in) were carried out to reverse transcription with the aid of the enzyme MMLV-RT (Maloney Murine Leukemia Virus—Reverse Transcriptase). Subsequently, nucleotides marked with the fluorochromes cyanine 5 (Cy5) were added to the T7 polymerase enzyme to the parental and resistant cells cDNA. The respective cDNAs were purified with commercial columns and then hybridized on the slides for 17 h at a constant temperature of 65 ◦ C in a hybridization oven (Agilent Technologies). Finally, according to the manufacturer’s recommendations, the hybridized slides were washed in Wash Buffer 1 and Wash Buffer 2. The slides were scanned at 550 nm (green spectrum—-Cy3) and 640 nm (red spectrum-Cy5) on the Agilent Scanner Surescan (Agilent Technologies). Data extraction and quality control were performed using the Feature Extraction software, version 12 (Agilent Technologies). Oligonucleotides were identified by the customized protocol GE2_107_Sep09. After quantification, the raw data means (gMeanSignal) were selected to subtract the background means (gBGMeanSignal) used for future analyses. The expression data were analyzed in an R environment, version 4 . The limma package was used to remove positive and negative controls, values that overlapped the background, and data conversion on a logarithmic scale for the inclusion of data, identification of flags, and generation of expression matrices. Then, the data were normalized by the quantile methodology, and the moderated t test was applied, followed by false-discovery rate (FDR) correction. The category that presented at least three genes and a classification p≤0.05 was considered significant after Benjamini–Hochberg correction. 2.9. Sanger Sequencing The analysis of ROS1 mutation (c.6341A>G) was performed by PCR followed by direct Sanger sequencing, as described previously [ 28 ]. Briefly, using a specific pair of primers (forward 5 0 -3 0 : AGCATTACTCTGTGTCCCGT; reverse 5 0 -3 0 : AGGGATCTGGCAGCTAGAAA), the target region was amplified by PCR using a Veriti PCR thermal cycler (Applied Biosystems, Foster City, CA). We used an initial denaturation at 95 ◦ C for 1 min followed by 35 cycles of 95 ◦ C denaturation for 30 s; specific annealing temperature was for 30 s and the 72 ◦ C elongation phase for 30 s, followed by a 72 ◦ C final elongation for 2 min. Amplification of PCR products was confirmed by gel electrophoresis. Sequencing PCR was performed using the BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, Waltham, MA, USA ) and a 3500 xL Genetic Analyzer (Applied Biosystems, Waltham, MA, USA). 2.10. Cell Viability Assay The cell viability was performed by MTS (Promega, Madison, WI, USA) as previously described [ 15 ]. To determine the IC 50 values, cells were seeded into 96-well plates at a density of 5 × 103 cells per well and allowed to adhere overnight in DMEM 10% FBS. Subsequently, the cells were treated with increasing concentration of cetuximab (0, 20, 30, 50, 100, 200 e 250 µ g/mL) diluted in DMEM-0.5% FBS for 72 h. The results were expressed as mean viable cells relative to PBS alone (considered 100% viability) ± SD. The IC 50 concentration was calculated by nonlinear regression analysis using GraphPad Prism software version 7. The assays were performed in triplicate at least three times. Cells 2022,11, 154 6 of 20 2.11. Morphological Data The images of the cell lines’ morphological changes after treatment with cetuximab were obtained in Olympus XT01 (Olympus, Shinjuku, Tokyo, Japan) microscope at 100×magnification. 2.12. Wound Healing Migration Assay The cells were seeded in six-well plates and cultured in DMEM-10%FBS to at least 95% of confluence. Monolayer cells were washed with PBS and scraped with a plastic 100 µ L pipette tip. The “wounded” areas were photographed by phase-contrast microscopy after 0, 24, 48, and 72 h. The following formula calculated the relative migration distance: percentage of wound closure (%) = 100(A − B)/A, where A is the width of cell wounds before incubation, and B is the width of cell wounds after incubation [29]. 2.13. Colony Formation Assay Anchorage-Dependent FaDu parental and FaDu resistant cells were seeded at a density of 5 × 10 3 /well in six-well plates and maintained in a culture medium for 8–10 days at 37 ◦ C. Finally, colonies were stained with 0.125% crystal violet solution. Colonies larger than 50 cells were photographed under the light microscope Eclipse 2200 (Nikon, Minato, Tokyo, Japan), and the number of colonies was analyzed by the open-source software CFU (Plos One— http://opencfu.sourceforge.net/, accessed on 20 October 2021) [ 30 ]. The results represent the mean of at least three independent experiments. 2.14. Adhesion Assay Adhesion of FaDu parental and FaDu resistant cell lines was evaluated as described previously [ 31 ]. Briefly, a 96-well plate was coated for 24 h with PBS, BSA (bovine serum albumin, 10 µ g/mL, Sigma-Aldrich), Matrigel ® . Matrigel ® was diluted at 1:10 in PBS1X. The next day the excess liquids were removed, and the plates were incubated with 100 µ L/well of 0.1% BSA for two h and washed with PBS. Then, 6 × 10 3 cells of FaDu parental and FaDu resistant cells were added to each well in a serum-free medium and incubated at 37 ◦ C in a 5% CO 2 humidified atmosphere for 2 h. The non-adherent cells were rinsed off, and the remaining cells were fixed with 10% trichloroacetic acid (TCA), stained with crystal violet and quantified using an ELISA reader at 540 nm. 2.15. Immunofluorescence Analysis Epidermal growth factor receptor (EGFR) was stained as described [ 32 ], 2.5 ×104cells were seeded in 12-well plate in DMEM 10%. The next day, cells were washed in PBS and permeabilized with 0.3% Triton X-100 for 10 min. Cells were incubated with primary antibodies, Goat anti-EGFR (1:1000, Dako, Santa Clara, CA, USA), and Rabbit anti-phosphomTOR (1:1000, cell signaling) for 24 h at 4 ◦ C. Cetuximab (CTX) was detected using antihuman IgG Fc antibody (1:1000; R&D systems) for 24 h at 4 ◦ C. After the wash step with PBS1X, cells were incubated for 1 h at room temperature with Alexa 560 labeled anti-goat secondary antibodies (1:400, Invitrogen). Sections were then stained with Hoechst (Thermo Scientific, Waltham, MA, USA) and washed with PBS three times. The cells were analyzed using fluorescence microscopy (Olympus, Fluoview FV10, Shinjuku, Tokyo, Japan ) at 600×magnification. 2.16. Statistical Analysis Single comparisons between the conditions studied were made using Student’s t test, and the differences between the groups were tested using variance analysis. The statistical analysis was performed using GraphPad Prism version 8.4.3. The level of significance in all statistical analyses was set as p< 0.05. Cells 2022,11, 154 7 of 20 3. Results 3.1. Cetuximab-Resistance Model Establishment and Characterization To establish an HNSCC cetuximab-resistant in vitro model, FaDu cells were treated with increasing cetuximab doses for eight months, leading to the establishment of seven resistant clones. All resistant clones decreased EGFR phosphorylation levels upon cetuximab treatment and demonstrated at least a two-fold higher IC 50 ranging from 400 µ g/mL to 5320 µ g/mL compared with parental cells (Figure 1A and Supplementary Table S1). Interestingly, clone C5 exhibits a profile of resistance to ERK and AKT inhibition despite demonstrating complete EGFR inhibition (Figure 1A). For this response profile, we chose this clone for further analysis. C5 clone demonstrated higher IC50 fold-change (17-fold, Supplementary Table S1) compared to FaDu parental, as we can see in the cell viability profile (Figure 1B). No other significant changes in others tyrosine kinases receptors were observed in the protein array (Supplementary Figure S1A). Besides, the C5 clone depicted a marked alteration of cellular morphology, exhibiting a spindle shape and scattering profile compared to the epithelial morphology of parental cells, suggesting loose cell–cell interaction (Figure 1C). Cells 2022, 11, x FOR PEER REVIEW 7 of 21 analyzed using fluorescence microscopy (Olympus, Fluoview FV10, Shinjuku, Tokyo, Japan,) at 600× magnification. 2.16. Statistical Analysis Single comparisons between the conditions studied were made using Student’s t test, and the differences between the groups were tested using variance analysis. The statistical analysis was performed using GraphPad Prism version 8.4.3. The level of significance in all statistical analyses was set as p < 0.05. 3. Results 3.1. Cetuximab-Resistance Model Establishment and Characterization To establish an HNSCC cetuximab-resistant in vitro model, FaDu cells were treated with increasing cetuximab doses for eight months, leading to the establishment of seven resistant clones. All resistant clones decreased EGFR phosphorylation levels upon cetuximab treatment and demonstrated at least a two-fold higher IC50 ranging from 400 µg/mL to 5320 µg/mL compared with parental cells (Figure 1A and Supplementary Table S1). Interestingly, clone C5 exhibits a profile of resistance to ERK and AKT inhibition despite demonstrating complete EGFR inhibition (Figure 1A). For this response profile, we chose this clone for further analysis. C5 clone demonstrated higher IC50 fold-change (17-fold, Supplementary Table S1) compared to FaDu parental, as we can see in the cell viability profile (Figure 1B). No other significant changes in others tyrosine kinases receptors were observed in the protein array (Supplementary Figure 1A). Besides, the C5 clone depicted a marked alteration of cellular morphology, exhibiting a spindle shape and scattering profile compared to the epithelial morphology of parental cells, suggesting loose cell–cell interaction (Figure 1C). Figure 1. Cetuximab resistant model establishment and characterization. (A) EGFR signaling of parental and cetuximab-resistant clones after cetuximab resistant model establishment. (B) Cell viability assay of parental and resistant clone upon cetuximab exposition in 72 h. (C) Cell morphology of parental and resistant cells P: FaDu parental; R: FaDu resistant; C: Clone. The images were acquired in 10× magnification. 3.2. Cetuximab Resistance Is Associated with Chromosomal Abnormalities To evaluate cetuximab resistance’s molecular impact, we further performed a detailed genomic and transcriptomic profile comparison between parental and FaDu C5 resistant cells. FaDu parental and resistant cell lines’ karyotyping analysis revealed severe aneuploidy, with 51–57 chromosomes, with 11 numerical alterations and several chromosomal structural changes (Figure 2A). The parental cells presented hyperdiploid and composite karyotype with 51 to 53 chromosome figures, with several aberrations such as trisomy of chromosomes 1, 2, 3, 6, 7, 8, 9, 10,11, 12, 16, and 17, monosomy of chromosomes 5, 13, 19, 20, 21 and 22, and tetrasomy of chromosome 18. The resistant cell line had a hyperdiploid and composite karyotype with many chromosomes, ranging from 52 to 56, Figure 1. Cetuximab resistant model establishment and characterization. ( A ) EGFR signaling of parental and cetuximab-resistant clones after cetuximab resistant model establishment. ( B ) Cell viability assay of parental and resistant clone upon cetuximab exposition in 72 h. ( C ) Cell morphology of parental and resistant cells P: FaDu parental; R: FaDu resistant; C: Clone. The images were acquired in 10×magnification. 3.2. Cetuximab Resistance Is Associated with Chromosomal Abnormalities To evaluate cetuximab resistance’s molecular impact, we further performed a detailed genomic and transcriptomic profile comparison between parental and FaDu C5 resistant cells. FaDu parental and resistant cell lines’ karyotyping analysis revealed severe aneuploidy, with 51–57 chromosomes, with 11 numerical alterations and several chromosomal structural changes (Figure 2A). The parental cells presented hyperdiploid and composite karyotype with 51 to 53 chromosome figures, with several aberrations such as trisomy of chromosomes 1, 2, 3, 6, 7, 8, 9, 10,11, 12, 16, and 17, monosomy of chromosomes 5, 13, 19, 20, 21 and 22, and tetrasomy of chromosome 18. The resistant cell line had a hyperdiploid and composite karyotype with many chromosomes, ranging from 52 to 56, showing several alterations such as trisomy of X, 1, 2, 3, 6, 8, 11, 16, 17, and 18 chromosomes, monosomy of chromosomes 4, 5, 13, 14, 19, 20, 21 and 22, and tetrasomy of chromosomes 7, 9, 10 and 12 (Supplementary Table S2). Cells 2022,11, 154 8 of 20 Cells 2022, 11, x FOR PEER REVIEW 8 of 21 showing several alterations such as trisomy of X, 1, 2, 3, 6, 8, 11, 16, 17, and 18 chromosomes, monosomy of chromosomes 4, 5, 13, 14, 19, 20, 21 and 22, and tetrasomy of chromosomes 7, 9, 10 and 12 (Supplementary Table S2). Figure 2. Karyotypes and Copy number alterations (CNA) overview of FaDu parental and FaDu resistant cells. (A) Representative metaphase of FaDu parental and FaDu resistant cells. (B) Overview of the CNAs found in FaDu resistant cells in comparison with FaDu parental cells. In red gain and in blue deletions. M: marker chromosome. The chromosomal or copy number aberrations (CNA) were also evaluated by wholeexome sequencing (WES) data and CNA Nanostring panel of 87 genes. The WES showed 31 chromosomal regions with CNA associated with cancer by Cancer Genome Interpreter (CGI) and Nexus (Figure 2B). There were 15 amplified regions, with one presenting high amplification, harboring genes such as RHOA, KRAS, MYB, MAP3K5, BCL2L2, and YAP1 (Table 1). Deletions were found in 15 regions, harboring genes such as TP53, PTEN, WT1, BRCA1, MAP2K4, and NF1. These data are in accordance with karyotyping analysis, where we also found amplification of chromosomes 7 and 12, containing the same amplified genes found in CNA analysis such as KRAS, MDM2, HMGA2, SHH, CCDND2, and FRS2. Many of the altered loci identified are related to MTOR-PI3K-AKT and MAPK proliferation signaling pathways. Other altered regions harbored genes mainly related to the Figure 2. Karyotypes and Copy number alterations (CNA) overview of FaDu parental and FaDu resistant cells. ( A ) Representative metaphase of FaDu parental and FaDu resistant cells. ( B ) Overview of the CNAs found in FaDu resistant cells in comparison with FaDu parental cells. In red gain and in blue deletions. M: marker chromosome. The chromosomal or copy number aberrations (CNA) were also evaluated by wholeexome sequencing (WES) data and CNA Nanostring panel of 87 genes. The WES showed 31 chromosomal regions with CNA associated with cancer by Cancer Genome Interpreter (CGI) and Nexus (Figure 2B). There were 15 amplified regions, with one presenting high amplification, harboring genes such as RHOA, KRAS, MYB, MAP3K5, BCL2L2, and YAP1 (Table 1). Deletions were found in 15 regions, harboring genes such as TP53, PTEN, WT1, BRCA1, MAP2K4, and NF1. These data are in accordance with karyotyping analysis, where we also found amplification of chromosomes 7 and 12, containing the same amplified genes found in CNA analysis such as KRAS, MDM2, HMGA2, SHH, CCDND2, and FRS2. Many of the altered loci identified are related to MTOR-PI3K-AKT and MAPK proliferation signaling pathways. Other altered regions harbored genes mainly related to the DNA repair process, apoptosis, and transcriptional factors. All genes reported as tumor drivers by Cancer Genome Interpreter (CGI) [33] are shown in Table 1. Cells 2022,11, 154 9 of 20 Table 1. Copy number alterations differentially found in FaDu resistant compared with FaDu parental cell line by whole exome sequencing and Nanostring platform. Chromosome Event Cytoband Cancer Gene Driver Statement by CGI chr 17 Deletion p13.3–p11.2 MAP2K4 known in: PA; BRCA; COREAD chr 13 Deletion q31.1–q32.2 GPC5 predicted passenger chr 20 Deletion q11.22–q13.33 EEF1A2 predicted passenger chr 17 Deletion p13.3–p11.2 MAPK7 predicted passenger chr 17 Deletion p13.3–p11.2 TP53 known in: BCL; THYM chr 11 Deletion p15.5–p12 WT1 known in: WT; DSRCT chr 10 Deletion q22.3–q26.3 PTEN known in: G; PRAD; ED; CM; TH; BRCA; L; OV; PA chr 7 Deletion p14.3–p12.1 IKZF1 known in: ALL; DLBCL chr 10 Deletion q22.3–q26.3 SUFU known in: MB chr 16 Deletion q24.3 FANCA known in: AML; LK; PRAD chr 17 Deletion p13.3–p11.2 FLCN known in: TH chr 17 Deletion q11.1–q23.1 NF1 known in: NF; G; MPN; CM; PLEN; HNC; SG; LK chr 17 Deletion q11.1–q23.1 SUZ12 known in: CANCER chr 17 Deletion q11.1–q23.1 BRCA1 known in: OV; BRCA chr 12 High Amplification p12.1–q11 KRAS predicted driver chr 14 Amplification q12–q32.33 NKX2-1 known in: NSCLC chr 14 High Amplification q11.2–q12 BCL2L2 predicted passenger chr 5 High Amplification p13.3–q11.2 SKP2 predicted passenger chr 22 Amplification q11.1–q12.1 CRKL predicted passenger chr 11 High Amplification q22.1–q22.3 YAP1, BIRC2 predicted passenger chr 7 High Amplification q36.1–q36.3 SHH predicted passenger chr 6 Amplification q16.2–q27 MYB predicted driver chr 6 Amplification q16.2–q27 MAP3K5 predicted passenger chr 1 Amplification q32.1–q32.2 MDM4 known in: GBM; BLCA; RB; S chr 12 Amplification q14.3–q24.33 MDM2, HMGA2 known in: S; G; COREAD; LIP chr 9 Amplification p24.2–p22.1 JAK2 known in: BRCA chr 9 Amplification p24.2–p22.1 CD274 known in: BCC chr 8 Amplification q12.1–q24.3 MYC known in: BLY; CLL; NB; COREAD; MYMA; PRAD chr 5 High Amplification p13.3–q11.2 RICTOR known in: L chr 6 Amplification q16.2–q27 ESR1 known in: UCEC; BRCA; OV chr 12 Amplification p13.33–p12.1 CCND2 known in: L chr 12 Amplification q14.3–q24.33 FRS2 known in: LIP chr 14 Amplification q12–q32.33 FOXA1 Known in: COREAD chr 14 Amplification q12–q32.33 PAX9 Known in: NSCLC chr 14 Amplification q12–q32.33 NKX2-8 predicted passenger CGI: Cancer Genome interpreter; PA: Pancreas; BRCA: Breast adenocarcinoma; COREAD: Colorectal adenocarcinoma; BCL: B cell lymphoma; THYM: Thymic; WT: Wilms Tumor; G: Glioma; TH: Thyroid; DSRCT: Desmoplastic small round cell Tumor; PRAD: Prostate Adenocarcinoma; ED: Endometrium; CM: Cutaneous melanoma; L: Lung; OV: Ovary; ALL: Acute Lymphoblastic leukemia; DLBCL: Diffuse Large B cell Lymphoma; MB: Medulloblastoma; AML: Acute Myeloid Leukemia; LK: Leukemia; NF: Neurofibroma; MPN: Malignant Peripheral nerve sheath Tumor; PLEN: Plexiform Neurofibroma; HNC: Head and Neck; SG: Salivary Glands; NSCLC: Non-small lung cancer; BLCA: Bladder; GBM: Glioblastoma multiforme; RB: Retinoblastoma; S: Sarcoma; LIP: Liposarcoma; BCC: Basal cell carcinoma; BLY: Burkitt Lymphoma; CLL: Chronic Lymphocytic Leukemia; NB: Neuroblastoma; MYMA: Myeloma; UCEC: Uterine Corpus Endometroid Carcinoma. 3.3. Differential Gene Expression and Mutation Profile The differential transcriptomic profile of FaDu parental and resistant cells was evaluated using the NanoString PanCancer Pathways Panel. Of the 730 genes evaluated, 36 were differentially expressed, with 18 genes upregulated (RHOA, COL5A1, PLCG2, LIFR, PDGFD, RASGRF1, SETBP1, HDAC2, PPP3CB, SKP2, PIK3R3, GTF2H3, PBRM1, MCM4, PRKDC, FGF1, ALKBH3, PTPN11) and 18 downregulated (MAP3K12, FZD10, CCND2, PPP2R2C, BMP7, CD40, TNF, CACNG6, STAT3, AKT3, AKT2, BMP2, FAZ, FLNC, FGF11, DLL3, RASGRP2, PRKAA2) (Figure 3A). Next, we performed an analysis of the functional connections among the proteins encoded by the 36 genes differentially expressed Cells 2022,11, 154 16 of 20 constitutive activation of the mTOR/PI3K/AKT signaling axis in cetuximab resistant lung cell lines [ 62 ]. The upregulation of the mTOR/PI3K/AKT pathway was also reported using UM-SCC-6R cetuximab-resistant cells that demonstrated EGF-independent signaling [43]. Conversely, it was previously reported that the mTOR/PI3K/AKT pathway’s constitutive activation leads to EGFR trafficking [ 63 ]. Nuclear EGFR translocation is reported to be related to anti-EGFR therapy resistance [64]; thus, our results corroborate this hypothesis. As mentioned, the mTOR pathway seems to play a significant role in cetuximab resistance in HNSCC. A recent study associated MTOR overexpression in the TKI inhibitors resistance process, demonstrating that stress-induced mutagenesis contributes to adaptive evolution in cancer for drug resistance [ 65 ]. Our study found an increase in mTOR levels in whole cellular compartments, including in the membrane, cytoplasm, and mainly in the nucleus of cetuximab-resistant cells. Besides, we also identified an upregulation of genes involved in mTOR signaling, namely RHOA, PIK3R3, SKP2, and a frameshift mutation in IRS2 that was not present in the parental cell line. IRS2 acts as a protein scaffold that activates the phosphoinositide 3-kinase (PI3K)/AKT/mTOR pathway, leading to proliferation and migration [ 66 ]. Thus, the inability of IRS2 to respond to negative feedback signals could contribute to higher PI3K/mTOR activity associated with cetuximab resistance in HNSCC. Of note, IRS2 mutations were recently associated with invasion in pleomorphic invasive lobular carcinoma [ 67 ]. Overall, mTOR-PIK3-AKT family members’ overexpression could be involved with cetuximab resistance, and combination regimens with drugs that block mTOR may overcome cetuximab resistance in HNSCC. We also found a ROS1 variant (c.6341A>G) associated with resistant cells. ROS1 was previously described as regulated and associated with metastasis to lung and lymph nodes in oral squamous cell carcinoma [ 68 ]. Of note, ROS1 mutations were associated with response to anti-ROS1 inhibitors, such as Lorlatinib in pancreatic cancer [ 69 ]. Recently, Davies and coworkers demonstrated a compensatory mechanism of growth control involving ROS and EGFR, where cells resistant to ROS1 inhibition have been resensitized by inhibiting EGFR by a switch between these pathways [ 70 ]. Thus, co-targeting of ROS1 and EGFR could potentially offer an effective option to overcome cetuximab resistance. Further validation in other cell line models and in head and neck patients submitted to cetuximab are warranted to consolidate these findings. 5. Conclusions In summary, this is the first report to describe the molecular basis of cetuximab resistance in HNSCC. Our study suggests that the development of cetuximab resistance in HNSCC is a complex mechanism that involves an increased number of genetic aberrations and protein dysregulation. The cetuximab acquired–resistant model was successfully established and demonstrated that the overexpression of the RhoA-mTOR-PIK3-AKT pathway and stem/mesenchymal phenotype are potentially novel cetuximab-resistance alterations. Combining regimens between cetuximab and RhoA-mTOR-PIK3-AKT inhibitors appear to be an excellent strategy to overcome cetuximab resistance. The clinical benefit from these molecules’ inhibitors should be evaluated in clinical trials, especially in a salvage setting with patients who have acquired resistance to cetuximab. Supplementary Materials: The following supporting information can be downloaded at: https: //www.mdpi.com/article/10.3390/cells11010154/s1, Table S1. IC 50 values for each cetuximab resistant clone established; Table S2. Main changes found in karyotype analysis between Fadu Parental and Fadu Resistant; Table S3. Antibody conditions utilized in Western blot analysis; Supplementary Figure S1 . Cetuximab resistant model RTK’S phosphoarray and ROS1 c.6341A>G validation. (A) RTK’s phosphoarray of FaDu parental and FaDu resistant. (B) Integrated Genomics Viewer (IGV) frequency of ROS 1 C.6341A>G mutation in FaDu parental (top) and FaDu resistant (bottom) cells. (C) Sanger sequencing of ROS 1 C.6341A>G mutation in parental and resistant cells. The electropherogram depicts a ROS1 mutation C.6341A>G in the resistant cell line. FaDu Parental; R: FaDu Resistant. Cells 2022,11, 154 17 of 20 Author Contributions: Conception and design of the work: R.M.R., I.N.F.G. and R.J.d.S.-O.; methodology, I.N.F.G., R.J.d.S.-O., L.F.L., L.S.d.S., O.M., A.v.H.L., V.A.O.S., S.P.d.S. and F.C.N.; analysis and interpretation of the data, I.N.F.G., R.J.d.S.-O., A.F.E., L.S.d.S., V.A.O.S., A.v.H.L. and F.C.N.; drafting the manuscript, I.N.F.G. and R.J.d.S.-O.; critical revision of the manuscript, R.M.R., V.A.O.S., O.M., L.F.L., A.L.C., I.N.F.G., R.J.d.S.-O. and A.v.H.L. All authors have read and agreed to the published version of the manuscript. Funding: This work was supported by Barretos Cancer Hospital and the Public Ministry of Labor Campinas (Research, Prevention, and Education of Occupational Cancer) in Campinas, Brazil, CAPESDFATD (88887.137283/2017-00). INFG is the recipient of a FAPESP Ph.D. fellowship (2017/22305-9). Institutional Review Board Statement: Not applicable. Informed Consent Statement: Not applicable. Data Availability Statement: The data presented in this study are available upon request from the corresponding author. Acknowledgments: The authors would like to acknowledge the technical support of Adriana Cruvinel Carloni and Flavia Calmom in the Lyoplate analysis, Ana Carolina Laus in Nanostring analysis, and Mariana Tomazini Pinto in EMT results analysis. Conflicts of Interest: The authors declare no conflict of interest. References 1. Sung, H.; Ferlay, J.; Siegel, R.L.; Laversanne, M.; Soerjomataram, I.; Jemal, A.; Bray, F. Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries. CA Cancer J. Clin. 2021 ,71, 209–249. [CrossRef] [PubMed] 2. Cramer, J.D.; Burtness, B.; Le, Q.T.; Ferris, R.L. The changing therapeutic landscape of head and neck cancer. Nat. Rev. Clin. Oncol. 2019,16, 669–683. [CrossRef] [PubMed] 3. Alsahafi, E.; Begg, K.; Amelio, I.; Raulf, N.; Lucarelli, P.; Sauter, T.; Tavassoli, M. Clinical update on head and neck cancer: Molecular biology and ongoing challenges. Cell Death Dis. 2019,10, 1–17. [CrossRef] 4. Leemans, C.R.; Snijders, P.J.F.; Brakenhoff, R.H. The molecular landscape of head and neck cancer. Nat. Rev. Cancer 2018 ,18, 269–282. [CrossRef] [PubMed] 5. de Carvalho, A.C.; Perdomo, S.; dos Santos, W.; Fernandes, G.C.; de Jesus, L.M.; Carvalho, R.S.; Scapulatempo-Neto, C.; de Almeida, G.C. ; Sorroche, B.P.; Arantes, L.M.R.B.; et al. Impact of genetic variants in clinical outcome of a cohort of patients with oropharyngeal squamous cell carcinoma. Sci. Rep. 2020,10, 1–12. [CrossRef] 6. Oliveira-Silva, R.J.; De Carvalho, A.C.; Viana, L.D.S.; Carvalho, A.L.; Reis, R. Anti-EGFR Therapy: Strategies in Head and Neck Squamous Cell Carcinoma. Recent Patents Anti-Cancer Drug Discov. 2016,11, 170–183. [CrossRef] 7. Brand, T.M.; Iida, M.; Luthar, N.; Starr, M.M.; Huppert, E.J.; Wheeler, D.L. Corrigendum to: “Nuclear EGFR as a molecular target in cancer” [Radiother Oncol 108 (2013) 370–77]. Radiother. Oncol. 2019,130, 195. [CrossRef] 8. Moreira, J.; Tobias, A.; O’Brien, M.P.; Agulnik, M. Targeted Therapy in Head and Neck Cancer: An Update on Current Clinical Developments in Epidermal Growth Factor Receptor-Targeted Therapy and Immunotherapies. Drugs 2017 ,77, 843–857. [CrossRef] 9. Azoury, S.C.; Gilmore, R.C.; Shukla, V. Molecularly targeted agents and immunotherapy for the treatment of head and neck squamous cell cancer (HNSCC). Discov. Med. 2016,21, 507–515. 10. Vermorken, J.B.; Trigo, J.; Hitt, R.; Koralewski, P.; Diaz-Rubio, E.; Rolland, F.; Knecht, R.; Amellal, N.; Schueler, A.; Baselga, J. Open-Label, Uncontrolled, Multicenter Phase II Study to Evaluate the Efficacy and Toxicity of Cetuximab As a Single Agent in Patients with Recurrent and/or Metastatic Squamous Cell Carcinoma of the Head and Neck Who Failed to Respond to Platinum-Based Therapy. J. Clin. Oncol. 2007,25, 2171–2177. [CrossRef] 11. Vermorken, J.B.; Mesia, R.; Rivera, F.; Remenar, E.; Kawecki, A.; Rottey, S.; Erfan, J.; Zabolotnyy, D.; Kienzer, H.-R.; Cupissol, D.; et al. Platinum-Based Chemotherapy plus Cetuximab in Head and Neck Cancer. N. Engl. J. Med. 2008 ,359, 1116–1127. [CrossRef] 12. Bonner, J.A.; Harari, P.M.; Giralt, J.; Azarnia, N.; Shin, D.M.; Cohen, R.B.; Jones, C.U.; Sur, R.; Raben, D.; Jassem, J.; et al. Radiotherapy plus Cetuximab for Squamous-Cell Carcinoma of the Head and Neck. N. Engl. J. Med. 2006 ,354, 567–578. [CrossRef] [PubMed] 13. Leblanc, O.; Vacher, S.; Lecerf, C.; Jeannot, E.; Klijanienko, J.; Berger, F.; Hoffmann, C.; Calugaru, V.; Badois, N.; Chilles, A.; et al. Biomarkers of cetuximab resistance in patients with head and neck squamous cell carcinoma. Cancer Biol. Med. 2020 ,17, 208–217. [CrossRef] [PubMed] 14. Mehra, R.; Cohen, R.B.; Burtness, B.A. The role of cetuximab for the treatment of squamous cell carcinoma of the head and neck. Clin. Adv. Hematol. Oncol. H&O 2008,6, 742–750. Cells 2022,11, 154 18 of 20 15. Silva-Oliveira, R.J.; Melendez, M.; Martinho, O.; Zanon, M.F.; Viana, L.D.S.; Carvalho, A.L.; Reis, A.R.M. AKT can modulate the in vitro response of HNSCC cells to irreversible EGFR inhibitors. Oncotarget 2017,8, 53288–53301. [CrossRef] [PubMed] 16. Singchat, W.; Hitakomate, E.; Rerkarmnuaychoke, B.; Suntronpong, A.; Fu, B.; Bodhisuwan, W.; Peyachoknagul, S.; Yang, F.; Koontongkaew, S.; Srikulnath, K. Genomic Alteration in Head and Neck Squamous Cell Carcinoma (HNSCC) Cell Lines Inferred from Karyotyping, Molecular Cytogenetics, and Array Comparative Genomic Hybridization. PLoS ONE 2016 ,11, e0160901. [CrossRef] [PubMed] 17. Li, H.; Durbin, R. Fast and accurate long-read alignment with Burrows–Wheeler transform. Bioinformatics 2010 ,26, 589–595. [CrossRef] [PubMed] 18. Koboldt, D.C.; Larson, D.E.; Wilson, R.K. Using VarScan 2 for Germline Variant Calling and Somatic Mutation Detection. Curr. Protoc. Bioinform. 2013,44, 15.4.1–15.4.17. [CrossRef] [PubMed] 19. Forbes, S.A.; Beare, D.; Boutselakis, H.; Bamford, S.; Bindal, N.; Tate, J.; Cole, C.G.; Ward, S.; Dawson, E.; Ponting, L.; et al. COSMIC: Somatic cancer genetics at high-resolution. Nucleic Acids Res. 2017,45, D777–D783. [CrossRef] [PubMed] 20. Benjamin, D.; Sato, T.; Cibulskis, K.; Getz, G.; Stewart, C.; Lichtenstein, L. Calling Somatic SNVs and Indels with Mutect. BioRxiv 2019, 861054. [CrossRef] 21. McLaren, W.; Gil, L.; Hunt, S.E.; Riat, H.S.; Ritchie, G.R.S.; Thormann, A.; Flicek, P.; Cunningham, F. The Ensembl Variant Effect Predictor. Genome Biol. 2016,17, 1–14. [CrossRef] 22. 1000 Genomes Project Consortium; Auton, A.; Brooks, L.D.; Durbin, R.M.; Garrison, E.P.; Kang, H.M.; Korbel, J.O.; Marchini, J.L.; McCarthy, S.; McVean, G.A.; et al. A global reference for human genetic variation. Nature 2015,526, 68–74. 23. Lek, M.; Karczewski, K.J.; Minikel, E.V.; Samocha, K.E.; Banks, E.; Fennell, T.; O’Donnell-Luria, A.H.; Ware, J.S.; Hill, A.J.; Cummings, B.B.; et al. Analysis of protein-coding genetic variation in 60,706 humans. Nature 2016,536, 285–291. [CrossRef] 24. Robinson, J.T.; Thorvaldsdóttir, H.; Winckler, W.; Guttman, M.; Lander, E.S.; Getz, G.; Mesirov, J.P. Integrative genomics viewer. Nat. Biotechnol. 2011,29, 24–26. [CrossRef] [PubMed] 25. Rosa, M.N.; Evangelista, A.F.; Leal, L.F.; De Oliveira, C.M.; Silva, V.A.O.; Munari, C.C.; Munari, F.F.; Matsushita, G.D.M.; Dos Reis, R .; Andrade, C.E.; et al. Establishment, molecular and biological characterization of HCB-514: A novel human cervical cancer cell line. Sci. Rep. 2019,9, 1–13. [CrossRef] [PubMed] 26. Waggott, D.; Chu, K.; Yin, S.; Wouters, B.G.; Liu, F.-F.; Boutros, P.C. NanoStringNorm: An extensible R package for the pre-processing of NanoString mRNA and miRNA data. Bioinformatics 2012,28, 1546–1548. [CrossRef] 27. Gu, Z.; Eils, R.; Schlesner, M. Complex heatmaps reveal patterns and correlations in multidimensional genomic data. Bioinformatics 2016,32, 2847–2849. [CrossRef] [PubMed] 28. Vicente, A.L.S.; Crovador, C.S.; Macedo, G.; Scapulatempo-Neto, C.; Reis, R.M.; Vazquez, V.L. Mutational Profile of Driver Genes in Brazilian Melanomas. J. Glob. Oncol. 2019,5, 1–14. [CrossRef] 29. Martinho, O.; Silva-Oliveira, R.; Miranda-Gonçalves, V.; Clara, C.; Almeida, J.R.; Carvalho, A.L.; Barata, J.T.; Reis, R.M. In Vitro and In Vivo Analysis of RTK Inhibitor Efficacy and Identification of Its Novel Targets in Glioblastomas. Transl. Oncol. 2013 ,6, 187–196, IN17–IN20. [CrossRef] 30. Geissmann, Q. OpenCFU, a New Free and Open-Source Software to Count Cell Colonies and Other Circular Objects. PLoS ONE 2013,8, e54072. [CrossRef] 31. Salo, T.; Sutinen, M.; Apu, E.H.; Sundquist, E.; Cervigne, N.K.; De Oliveira, C.E.; Akram, S.U.; Ohlmeier, S.; Suomi, F.; Eklund, L.; et al. A novel human leiomyoma tissue derived matrix for cell culture studies. BMC Cancer 2015,15, 981. [CrossRef] [PubMed] 32. Suomela, S.; Elomaa, O.; Skoog, T.; Ala-Aho, R.; Jeskanen, L.; Pärssinen, J.; Latonen, L.; Grénman, R.; Kere, J.; Kähäri, V.-M.; et al. CCHCR1 Is Up-Regulated in Skin Cancer and Associated with EGFR Expression. PLoS ONE 2009 ,4, e6030. [CrossRef] [PubMed] 33. Tamborero, D.; Rubio-Perez, C.; Deu-Pons, J.; Schroeder, M.P.; Vivancos, A.; Rovira, A.; Tusquets, I.; Albanell, J.; Rodon, J.; Tabernero, J.; et al. Cancer Genome Interpreter annotates the biological and clinical relevance of tumor alterations. Genome Med. 2018,10, 1–8. [CrossRef] [PubMed] 34. Szklarczyk, D.; Gable, A.L.; Lyon, D.; Junge, A.; Wyder, S.; Huerta-Cepas, J.; Simonovic, M.; Doncheva, N.T.; Morris, J.H.; Bork, P.; et al. STRING v11: Protein–protein association networks with increased coverage, supporting functional discovery in genome-wide experimental datasets. Nucleic Acids Res. 2019,47, D607–D613. [CrossRef] [PubMed] 35. D’Amato, V.; Rosa, R.; D’Amato, C.; Formisano, L.; Marciano, R.; Nappi, L.; Raimondo, L.; Di Mauro, C.; Servetto, A.; Fusciello, C.; et al. The dual PI3K/mTOR inhibitor PKI-587 enhances sensitivity to cetuximab in EGFR-resistant human head and neck cancer models. Br. J. Cancer 2014,110, 2887–2895. [CrossRef] [PubMed] 36. Liu, X. The Epithelial-Mesenchymal Transition and Cancer Stem Cells: Functional and Mechanistic Links. Curr. Pharm. Des. 2015 , 21, 1279–1291. [CrossRef] 37. Byeon, H.K.; Ku, M.; Yang, J. Beyond EGFR inhibition: Multilateral combat strategies to stop the progression of head and neck cancer. Exp. Mol. Med. 2019,51, 1–14. [CrossRef] [PubMed] 38. Cheng, K.-Y.; Hao, M. Mammalian Target of Rapamycin (mTOR) Regulates Transforming Growth Factorβ 1 (TGFβ 1)-Induced Epithelial-Mesenchymal Transition via Decreased Pyruvate Kinase M2 (PKM2) Expression in Cervical Cancer Cells. Med. Sci. Monit. 2017,23, 2017–2028. [CrossRef] 39. Krzyszczyk, P.; Acevedo, A.; Davidoff, E.J.; Timmins, L.M.; Marrero-Berrios, I.; Patel, M.; White, C.; Lowe, C.; Sherba, J.J.; Hartmanshenn, C.; et al. The growing role of precision and personalized medicine for cancer treatment. Technology 2018 ,6, 79–100. [CrossRef] [PubMed] Cells 2022,11, 154 19 of 20 40. Benavente, S.; Huang, S.; Armstrong, E.A.; Chi, A.; Hsu, K.-T.; Wheeler, D.L.; Harari, P.M. Establishment and Characterization of a Model of Acquired Resistance to Epidermal Growth Factor Receptor Targeting Agents in Human Cancer Cells. Clin. Cancer Res. Off. J. Am. Assoc. Cancer Res. 2009,15, 1585–1592. [CrossRef] [PubMed] 41. Boeckx, C.; Blockx, L.; de Beeck, K.O.; Limame, R.; Van Camp, G.; Peeters, M.; Vermorken, J.B.; Specenier, P.; Wouters, A.; Baay, M.; et al. Establishment and characterization of cetuximab resistant head and neck squamous cell carcinoma cell lines: Focus on the contribution of the AP-1 transcription factor. Am. J. Cancer Res. 2015,5, 1921–1938. 42. De Pauw, I.; Lardon, F.; Bossche, J.V.D.; Baysal, H.; Pauwels, P.; Peeters, M.; Vermorken, J.B.; Wouters, A. Overcoming Intrinsic and Acquired Cetuximab Resistance in RAS Wild-Type Colorectal Cancer: An In Vitro Study on the Expression of HER Receptors and the Potential of Afatinib. Cancers 2019,11, 98. [CrossRef] [PubMed] 43. Willey, C.D.; Anderson, J.C.; Trummell, H.Q.; Naji, F.; de Wijn, R.; Yang, E.S.; Bredel, M.; Thudi, N.K.; Bonner, J.A. Differential escape mechanisms in cetuximab-resistant head and neck cancer cells. Biochem. Biophys. Res. Commun. 2019 ,517, 36–42. [CrossRef] 44. Morgillo, F.; Della Corte, C.M.; Fasano, M.; Ciardiello, F. Mechanisms of resistance to EGFR-targeted drugs: Lung cancer. ESMO Open 2016,1, e000060. [CrossRef] 45. Lièvre, A.; Bachet, J.-B.; Le Corre, D.; Boige, V.; Landi, B.; Emile, J.-F.; Côté, J.-F.; Tomasic, G.; Penna, C.; Ducreux, M.; et al. KRAS Mutation Status Is Predictive of Response to Cetuximab Therapy in Colorectal Cancer. Cancer Res. 2006 ,66, 3992–3995. [CrossRef] [PubMed] 46. Li, H.; Peyrollier, K.; Kilic, G.; Brakebusch, C. Rho GTPases and cancer. BioFactors 2014,40, 226–235. [CrossRef] 47. Pan, Q.; Bao, L.W.; Teknos, T.N.; Merajver, S.D. Targeted Disruption of Protein Kinase C ε Reduces Cell Invasion and Motility through Inactivation of RhoA and RhoC GTPases in Head and Neck Squamous Cell Carcinoma. Cancer Res. 2006 ,66, 9379–9384. [CrossRef] [PubMed] 48. Ruihua, H.; Mengyi, Z.; Chong, Z.; Meng, Q.; Xin, M.; Qiulin, T.; Feng, B.; Ming, L. RhoA regulates resistance to irinotecan by regulating membrane transporter and apoptosis signaling in colorectal cancer. Oncotarget 2016,7, 87136–87146. [CrossRef] 49. Doublier, S.; Riganti, C.; Voena, C.; Costamagna, C.; Aldieri, E.; Pescarmona, G.P.; Ghigo, D.; Bosia, A. RhoA Silencing Reverts the Resistance to Doxorubicin in Human Colon Cancer Cells. Mol. Cancer Res. MCR 2008,6, 1607–1620. [CrossRef] [PubMed] 50. Gulhati, P.; Bowen, K.A.; Liu, J.; Stevens, P.D.; Rychahou, P.; Chen, M.; Lee, E.Y.; Weiss, H.L.; O’Connor, K.; Gao, T.; et al. mTORC1 and mTORC2 Regulate EMT, Motility, and Metastasis of Colorectal Cancer via RhoA and Rac1 Signaling Pathways. Cancer Res. 2011,71, 3246–3256. [CrossRef] 51. Bhowmick, N.A.; Ghiassi, M.; Bakin, A.; Aakre, M.; Lundquist, C.A.; Engel, M.E.; Arteaga, C.L.; Moses, H.L. Transforming Growth Factorβ 1 Mediates Epithelial to Mesenchymal Transdifferentiation through a RhoA-dependent Mechanism. Mol. Biol. Cell 2001,12, 27–36. [CrossRef] 52. Kalluri, R.; Weinberg, R.A. The basics of epithelial-mesenchymal transition. J. Clin. Investig. 2009 ,119, 1420–1428. [CrossRef] [PubMed] 53. Lamouille, S.; Connolly, E.; Smyth, J.; Akhurst, R.; Derynck, R. TGFβ -induced activation of mTOR complex 2 drives epithelial– mesenchymal transition and cell invasion. J. Cell Sci. 2012,125, 1259–1273. [CrossRef] [PubMed] 54. Prieto-Vila, M.; Takahashi, R.-U.; Usuba, W.; Kohama, I.; Ochiya, T. Drug Resistance Driven by Cancer Stem Cells and Their Niche. Int. J. Mol. Sci. 2017,18, 2574. [CrossRef] 55. Thapa, R.; Wilson, G. The Importance of CD44 as a Stem Cell Biomarker and Therapeutic Target in Cancer. Stem Cells Int. 2016 , 2016, 2087204. [CrossRef] [PubMed] 56. Suda, K.; Murakami, I.; Yu, H.; Kim, J.; Tan, A.-C.; Mizuuchi, H.; Rozeboom, L.M.; Ellison, K.; Rivard, C.J.; Mitsudomi, T.; et al. CD44 Facilitates Epithelial-to-Mesenchymal Transition Phenotypic Change at Acquisition of Resistance to EGFR Kinase Inhibitors in Lung Cancer. Mol. Cancer Ther. 2018,17, 2257–2265. [CrossRef] 57. Allegra, E.; Trapasso, S. Role of CD44 as a marker of cancer stem cells in head and neck cancer. Biol. Targets Ther. 2012 ,6, 379–383. [CrossRef] [PubMed] 58. Wu, K.; Xu, H.; Tian, Y.; Yuan, X.; Wu, H.; Liu, Q.; Pestell, R. The role of CD44 in epithelial–mesenchymal transition and cancer development. OncoTargets Ther. 2015,8, 3783–3792. [CrossRef] [PubMed] 59. Straub, M.; Drecoll, E.; Pfarr, N.; Weichert, W.; Langer, R.; Hapfelmeier, A.; Götz, C.; Wolff, K.-D.; Kolk, A.; Specht, K. CD274/PDL1 gene amplification and PD-L1 protein expression are common events in squamous cell carcinoma of the oral cavity. Oncotarget 2016,7, 12024–12034. [CrossRef] 60. Jiang, L.; Guo, F.; Liu, X.; Li, X.; Qin, Q.; Shu, P.; Li, Y.; Wang, Y. Continuous targeted kinase inhibitors treatment induces upregulation of PD-L1 in resistant NSCLC. Sci. Rep. 2019,9, 1–9. [CrossRef] [PubMed] 61. Yonesaka, K.; Zejnullahu, K.; Okamoto, I.; Satoh, T.; Cappuzzo, F.; Souglakos, J.; Ercan, D.; Rogers, A.; Roncalli, M.; Takeda, M.; et al. Activation of ERBB2 Signaling Causes Resistance to the EGFR-Directed Therapeutic Antibody Cetuximab. Sci. Transl. Med. 2011,3, 99ra86. [CrossRef] [PubMed] 62. Iida, M.; Brand, T.M.; Starr, M.M.; Huppert, E.J.; Luthar, N.; Bahrar, H.; Coan, J.P.; Pearson, H.E.; Salgia, R.; Wheeler, D.L. Overcoming acquired resistance to cetuximab by dual targeting HER family receptors with antibody-based therapy. Mol. Cancer 2014,13, 242. [CrossRef] [PubMed] 63. Er, E.E.; Mendoza, M.C.; Mackey, A.M.; Rameh, L.E.; Blenis, J. AKT Facilitates EGFR Trafficking and Degradation by Phosphorylating and Activating PIKfyve. Sci. Signal. 2013,6, ra45. [CrossRef] [PubMed] Cells 2022,11, 154 20 of 20 64. Li, C.; Iida, M.; Dunn, E.F.; Ghia, A.J.; Wheeler, D.L. Nuclear EGFR contributes to acquired resistance to cetuximab. Oncogene 2009,28, 3801–3813. [CrossRef] [PubMed] 65. Cipponi, A.; Goode, D.L.; Bedo, J.; McCabe, M.J.; Pajic, M.; Croucher, D.R.; Rajal, A.G.; Junankar, S.R.; Saunders, D.N.; Lobachevsky, P.; et al. MTOR signaling orchestrates stress-induced mutagenesis, facilitating adaptive evolution in cancer. Science 2020,368, 1127–1131. [CrossRef] [PubMed] 66. Bray, S.M.; Lee, J.; Kim, S.T.; Hur, J.Y.; Ebert, P.J.; Calley, J.N.; Wulur, I.H.; Gopalappa, T.; Wong, S.S.; Qian, H.-R.; et al. Genomic characterization of intrinsic and acquired resistance to cetuximab in colorectal cancer patients. Sci. Rep. 2019 ,9, 1–13. [CrossRef] 67. Zhu, S.; Ward, B.M.; Yu, J.; Matthew-Onabanjo, A.N.; Janusis, J.; Hsieh, C.-C.; Tomaszewicz, K.; Hutchinson, L.; Zhu, L.J.; Kandil, D.; et al. IRS2 mutations linked to invasion in pleomorphic invasive lobular carcinoma. JCI Insight 2018,3. [CrossRef] 68. Shih, C.-H.; Chang, Y.-J.; Huang, W.-C.; Jang, T.-H.; Kung, H.-J.; Wang, W.-C.; Yang, M.-H.; Lin, M.-C.; Huang, S.-F.; Chou, S.-W.; et al. EZH2-mediated upregulation of ROS1 oncogene promotes oral cancer metastasis. Oncogene 2017 ,36, 6542–6554. [CrossRef] 69. Velthaus, J.-L.; Iglauer, P.; Simon, R.; Bokemeyer, C.; Bannas, P.; Beumer, N.; Imbusch, C.D.; Goekkurt, E.; Loges, S. Lorlatinib Induces Durable Disease Stabilization in a Pancreatic Cancer Patient with a ROS1 p.L1950F Mutation: Case Report. Oncol. Res. Treat. 2021,44, 495–502. [CrossRef] 70. Davies, K.D.; Mahale, S.; Astling, D.P.; Aisner, D.L.; Le, A.T.; Hinz, T.K.; Vaishnavi, A.; Bunn, P.A.; Heasley, L.E.; Tan, A.C.; et al. Resistance to ROS1 Inhibition Mediated by EGFR Pathway Activation in Non-Small Cell Lung Cancer. PLoS ONE 2013 ,8, e82236. [CrossRef]