Caracterización de genes de Rhizobium tropici CIAT 899 implicados en la biosíntesis de los factores de nodulación independiente de la activación por flavonoides e inducidos por estrés osmótico

Departamento de Microbiología Facultad de Biología Caracterización de genes de Rhizobium tropici CIAT 899 implicados en la biosíntesis de los factores de nodulación independiente de la activación por flavonoides e inducidos por estrés osmótico Memoria presentada por Pablo del Cerro Sánchez para optar al título de Doctor Sevilla, 2019 Departamento de Microbiología Facultad de Biología LOS DIRECTORES DE LA TESIS Fdo. Francisco Javier Ollero Márquez. Catedrático. Departamento de Microbiología. Universidad de Sevilla. Fdo. Francisco Pérez Montaño. Profesor Contratado Doctor. Departamento de Microbiología. Universidad de Sevilla. Departamento de Microbiología Facultad de Biología Mi agradecimiento al Ministerio de Educación, Cultura y Deporte (ayuda FPU14-00160) por haber hecho posible la realización de este trabajo - No estás escribiendo... - Estoy con mi tren, ¿te gusta? Lo acabo de comprar. - ¿Y desde cuando no escribís nada? - Estuve de viaje... - Quizás ya no tengas nada que decir. Mira aquí te marqué varios trabajos posibles. - No necesito que me busques trabajo, estoy bien así, soy poeta. - ¿Qué oficio es ser poeta? Donde dice aquí: "Se busca poeta, buena remuneración". El lado oscuro del corazón AGRADECIMIENTOS Resumen Resumen en español .................................................................................................. 3 English abstract .......................................................................................................... 5 Introducción La simbiosis rizobio-leguminosa ................................................................................. 9 Antecedentes ..................................................................................................................... 9 El establecimiento de la simbiosis rizobio-leguminosa ..................................................... 10 Los genes de nodulación ................................................................................................. 14 El regulador transcripcional NodD .................................................................................... 16 Otros reguladores transcripcionales de interés ................................................................ 17 Reguladores de la familia ArsR: NolR ...................................................................................... 17 Reguladores de la familia AraC ................................................................................................ 18 Los factores de nodulación (FN) ...................................................................................... 19 Filogenia .......................................................................................................................... 20 Otros factores relevantes en la simbiosis rizobio-leguminosa .......................................... 21 Polisacáridos de superficie ....................................................................................................... 21 Formación de biopelículas ....................................................................................................... 23 Percepción de quórum o quorum sensing (QS) ....................................................................... 24 Movilidad bacteriana................................................................................................................. 25 Producción de ácido indolacético (AIA) ................................................................................... 26 Sistemas de secreción bacterianos .......................................................................................... 27 El macrosimbionte: las leguminosas ......................................................................... 29 Phaseolus vulgaris ................................................................................................................... 29 Leucaena leucocephala ........................................................................................................... 29 Lotus japonicus y Lotus burttii .................................................................................................. 29 El microsimbionte: Rhizobium tropici CIAT 899 ........................................................ 31 Antecedentes ................................................................................................................... 31 Filogenia de R. tropici CIAT 899 ...................................................................................... 31 El genoma de R. tropici CIAT 899 .................................................................................... 32 Producción de FN en presencia de flavonoides y estrés salino ........................................ 35 Objetivos Objetivos ................................................................................................................... 39 Material y Métodos Estirpes y plásmidos utilizados.................................................................................. 43 Estirpes bacterianas ......................................................................................................... 43 Estirpes de Escherichia coli ...................................................................................................... 43 Rhizobium tropici CIAT 899 y sus derivados ............................................................................ 43 Otras estirpes ........................................................................................................................... 45 Plásmidos ......................................................................................................................... 45 Medios y agentes selectivos ..................................................................................... 49 Medios de cultivo .............................................................................................................. 49 Medios para Rhizobium ............................................................................................................ 49 Medios para E. coli ................................................................................................................... 50 Medios para Azospirillum ......................................................................................................... 51 Medio de conservación de bacterias ........................................................................................ 52 Medidas de pH y espectrofotometría ................................................................................ 52 Agentes selectivos ............................................................................................................ 52 Flavonoides ...................................................................................................................... 53 Técnicas de biología molecular ................................................................................. 55 Conjugación bacteriana triparental ................................................................................... 55 Transformación en E. coli ................................................................................................. 55 Extracción del ADN total ................................................................................................... 56 Extracción del ADN plasmídico (minipreps) ...................................................................... 57 Restricción del ADN .......................................................................................................... 57 Electroforesis del ADN ...................................................................................................... 57 Aislamiento del ADN de geles de agarosa ........................................................................ 58 Desfosforilación del ADN .................................................................................................. 58 Ligación del ADN .............................................................................................................. 59 Amplificación del ADN por PCR ........................................................................................ 59 Hibridación ADN:ADN ....................................................................................................... 60 Secuenciación del ADN y búsqueda de promotores ......................................................... 62 Mutagénesis ..................................................................................................................... 63 Mutagénesis dirigida mediante inserción del interposón Ω ...................................................... 63 Mutagénesis dirigida por deleción no polar utilizando el método de PCR solapante .............. 66 Estudios de polisacáridos ................................................................................................. 68 Estimación de la cantidad de EPS: El método de la antrona-H2SO4 ....................................... 68 Estudio de los EPS de R. tropici CIAT 899 por Resonancia Magnética Nuclear (RMN) ......... 69 Estudio de los LPS ................................................................................................................... 69 Ensayos de formación de biopelículas .............................................................................. 72 Ensayos de detección de AHL .......................................................................................... 73 Extracción, separación y detección de AHL mediante cromatografía en capa fina (TLC) . 73 Ensayos de movilidad en superficie y movilidad tipo swimming ....................................... 74 Cuantificación de la producción de ácido indolacético (AIA)............................................. 74 Cuantificación de la expresión de genes bacterianos por PCR cuantitativa ..................... 75 Medida de la actividad β-galactosidasa ............................................................................ 78 Estudios de ARNseq ........................................................................................................ 79 Mapeo de los datos de las transcriptómicas ..................................................................... 79 Estimación de los genes diferencialmente expresados .................................................... 80 Purificación y análisis por cromatografía líquida asociada a espectrometría de masas de los FN .............................................................................................................................. 80 Purificación y análisis por cromatografía en capa fina (TLC) de los FN ............................ 82 Material y métodos para los estudios con plantas .................................................... 83 Plantas utilizadas en esta Tesis ....................................................................................... 83 Soluciones nutritivas para las plantas .............................................................................. 83 Desinfección y germinación de semillas ........................................................................... 84 Inoculación y cultivo de plantas: Jarro de Leonard (Vincent, 1970) .................................. 84 Sistema de hidroponía en tubo: ensayos de actividad biológica de los FN ....................... 85 Ensayos de nodulación .................................................................................................... 85 Aislamientos de las bacterias de los nódulos ................................................................... 86 Estimación de la actividad nitrogenasa ............................................................................ 86 Resultados Análisis transcriptómico de R. tropici CIAT 899 en presencia de flavonoides y estrés osmótico ................................................................................................................... 91 Antecedentes ................................................................................................................... 91 Expresión de los genes de nod en presencia de diferentes estreses osmóticos .............. 92 Estudios transcriptómicos globales mediante ARNseq ..................................................... 94 Validación de datos de transcriptómica por qRT-PCR. ............................................................ 95 Transcriptómica de R. tropici CIAT 899 en presencia del flavonoide apigenina. ............... 96 Transcriptómica de R. tropici CIAT 899 en presencia de estrés osmótico iónico (NaCl). .. 98 Transcriptómica de R. tropici CIAT 899 en presencia de estrés osmótico no-iónico (manitol). ........................................................................................................................ 100 La producción de ácido indolacético (AIA) se induce en R. tropici CIAT 899 en presencia de apigenina y estrés salino. .......................................................................................... 102 Otros genes implicados en procesos bacterianos relevantes son también diferencialmente expresados en presencia de estrés osmótico ................................................................ 103 Procesos regulados en presencia de estrés osmótico iónico (NaCl) ..................................... 103 Procesos regulados en presencia de estrés osmótico no-iónico (manitol) ............................ 104 Estudio del papel simbiótico de los cinco reguladores NodD de R. tropici CIAT 899. ................................................................................................................................ 107 Antecedentes.................................................................................................................. 107 Obtención de mutantes ................................................................................................... 107 NodD1 y NodD2 activan el promotor del gen nodA de R. leguminosarum bv. viciae en presencia de apigenina y estrés osmótico, respectivamente .......................................... 108 Estudio transcriptómico de los mutantes RSP82 y nodD2::Ω en presencia de apigenina y estrés osmótico .............................................................................................................. 110 Validación de datos de transcriptómica por qRT-PCR. ................................................... 114 Determinación por espectrometría de masas de los FN producidos en apigenina y estrés salino en CIAT 899 y mutantes nodD ............................................................................. 116 La síntesis de FN en presencia de apigenina y estrés osmótico está regulada por NodD1 y NodD2, respectivamente ................................................................................................ 117 Ensayos de nodulación de los mutantes nodD de R. tropici CIAT 899 con diferentes leguminosas ................................................................................................................... 118 La producción de AIA en R. tropici CIAT 899 está regulada por NodD1 y NodD2 ........... 120 Obtención de un doble mutante ΔnodD1/ΔnodD2 y caracterización fenotípica ............... 121 Los FN producidos por R. tropici CIAT 899 en presencia de apigenina y estrés salino tienen actividad biológica en P. vulgaris. ........................................................................ 123 Estudio del papel simbiótico de las tres proteínas NodA de R. tropici CIAT 899 .... 125 Antecedentes.................................................................................................................. 125 Producción de FN en presencia de apigenina y estrés salino en los mutantes de los genes nodA ............................................................................................................................... 125 Caracterización fenotípica de los mutantes en los genes nodA en la simbiosis con diferentes leguminosas ................................................................................................... 129 Actividad biológica de los FN producidos por R. tropici CIAT 899 y los mutantes ∆nodA1A3 y ∆nodA1A2A3 en P. vulgaris ......................................................................................... 130 Caracterización de otros genes implicados en la síntesis de FN bajo estrés osmótico ................................................................................................................................ 133 NrcR, regulador transcripcional de la familia ArsR. ......................................................... 133 Antecedentes .......................................................................................................................... 133 Ensayos de qRT-PCR en R. tropici CIAT 899 y en el mutante nrcR::Ω en presencia de apigenina y estrés osmótico .................................................................................................................... 133 Análisis de los FN producidos en R. tropici CIAT 899 y en el mutante nrcR::Ω en presencia de apigenina y estrés salino ........................................................................................................ 134 Ensayos de nodulación de R. tropici CIAT 899 y nrcR::Ω en P. vulgaris y L. leucocephala. 136 Ensayos de competitividad en P. vulgaris muestran que el mutante nrcR::Ω es menos competitivo que la estirpe silvestre ........................................................................................ 137 NrcR regula otros fenotipos bacterianos que son relevantes en la simbiosis rizobio-leguminosa ................................................................................................................................................ 138 AraC, un regulador transcripcional de la familia AraC próximo a nodD2 en el genoma de R. tropici CIAT 899 ......................................................................................................... 140 Antecedentes .......................................................................................................................... 140 Los estudios de ARNseq muestran que AraC es esencial para la activación de los genes nod en presencia de estrés salino. ................................................................................................ 141 La síntesis de FN en presencia de estrés salino está regulada por AraC ............................. 144 Ensayos de nodulación de R. tropici CIAT 899 y ∆araC en P. vulgaris y L. leucocephala .... 146 Discusión Discusión general ................................................................................................... 151 Interpretación de los datos transcriptómicos .................................................................. 151 En la activación de la síntesis de los FN en R. tropici CIAT 899 intervienen diferentes reguladores transcripcionales ........................................................................................ 157 Hasta tres genes nodA garantizan la síntesis de FN en R. tropici CIAT 899 .................. 162 Las dos vías de síntesis de FN en R. tropici CIAT 899 son relevantes para el establecimiento de la simbiosis con leguminosas .......................................................... 164 Perspectivas de futuro ............................................................................................ 169 Conclusión Conclusiones .......................................................................................................... 173 Conclusions ............................................................................................................ 175 Bibliografía Bibliografía .............................................................................................................. 179 Anexos Anexos .................................................................................................................... 199 ÍNDICE DE FIGURAS Figura 1 – Esquema de la regulación de la síntesis de los FN en los rizobios. Las flechas negras representan activación descrita. ....................................................... 11 Figura 2 – Esquema de la cascada regulatoria activada por la recepción del FN en el pelo radical. La flecha discontinua indica que la activación podría ser directa o indirecta. ................................................................................................................... 12 Figura 3 – Esquema de la colonización de la raíz de la leguminosa por parte de los rizobios. .................................................................................................................... 13 Figura 4 – Modelo estructural del dímero de NodD1 de S. meliloti (Peck et al., 2013). Esta imagen ha sido cedida por Roger Castells (John Innes Centre, Norwich, Reino Unido). ...................................................................................................................... 17 Figura 5 – Estructura de los FN y sus decoraciones descritas. También se muestran las proteínas que llevan a cabo la síntesis y las decoraciones del FN. Figura adaptada de Perret et al., 2000. ............................................................................................... 20 Figura 6 – Árbol filogenético a partir de las secuencias del ARNr 16S. Los géneros en negrita contienen especies de rizobios. Los paréntesis y corchetes indican que el genoma ha sido secuenciado. Figura tomada de Masson-Boivin et al. (2009). ........ 21 Figura 7 - Esquema de la superficie rizobiana en la que se muestra la disposición de los polisacáridos superficiales. ME: Membrana externa; EP: Espacio periplásmico; MC: Membrana citoplasmática; EPS: Exopolisacáridos; GC: Glucanos cíclicos; LPS: Lipopolisacáridos; KPS: Polisacárido capsular de tipo antígeno-K; FL: Fosfolípidos; PM: Proteínas de membrana. Figura tomada de Vinardell et al., 2005. .................... 23 Figura 8 – Algunos de los tipos de movilidad bacteriana más estudiados. Figura adaptada de Kearns, 2010. ....................................................................................... 26 Figura 9 - Relaciones genómicas entre R. tropici CIAT 899 y otros rizobios o relacionados basado en el índice de las distancias de genomas MUMi. Esta figura ha sido tomada de Ormeño-Orrillo et al., 2012. ............................................................. 32 Figura 10 – Genes nod descritos hasta la fecha y presentes en el plásmido simbiótico de R. tropici CIAT 899. .............................................................................................. 34 Tabla 1 – Funciones de algunos genes nod presentes en los rizobios. ................... 15 Tabla 2 – Información relevante obtenida en la secuenciación del genoma de R. tropici CIAT 899. .................................................................................................................. 33 Tabla 3 – Genes nod de R. tropici CIAT 899 cuya función ha sido descrita. ............ 34 Tabla 4 – Estirpes de E. coli utilizadas en la presente Tesis Doctoral. ..................... 43 Tabla 5 – Estirpes de R. tropici CIAT 899 utilizadas en la presente Tesis Doctoral. 43 Tabla 6 – Otras estirpes utilizadas en la presente Tesis Doctoral. ........................... 45 Tabla 7 – Plásmidos utilizados en la presente Tesis Doctoral. ................................. 45 Tabla 8 – Componentes del medio TY. .................................................................... 49 Tabla 9 – Componentes del medio YM. ................................................................... 49 Tabla 10 – Componentes del medio B-. .................................................................... 50 Tabla 11 – Solución de oligoelementos del medio B-. .............................................. 50 Tabla 12 – Componentes del medio LB. .................................................................. 50 Tabla 13 – Componentes del medio NFb. ................................................................ 51 Tabla 14 – Solución de vitaminas del medio NFb..................................................... 51 Tabla 15 – Agentes selectivos. ................................................................................. 52 Tabla 16 – Soluciones empleadas en las transformaciones bacterianas. ................ 56 Tabla 17 – Soluciones empleadas en la electroforesis del ADN. ............................. 58 Tabla 18 – Soluciones empleadas en la hibridación ADN:ADN (I). .......................... 61 Tabla 19 – Soluciones empleadas en la hibridación ADN:ADN (II)........................... 61 Tabla 20 – Soluciones empleadas en la hibridación ADN:ADN (III).......................... 62 Tabla 21 - Cebadores utilizados en esta Tesis para mutagenizar genes por inserción del interposón Ω. ....................................................................................................... 65 Tabla 22 - Cebadores utilizados para mutagenizar genes por deleción mediante PCR solapante. .................................................................................................................. 67 Tabla 23 – Soluciones empleadas en el estudio de LPS (I). ..................................... 70 Tabla 24 – Soluciones empleadas en el estudio de LPS (II). .................................... 71 Tabla 25 – Soluciones empleadas en el estudio de LPS (III). ................................... 72 Tabla 26 – Soluciones empleadas en el estudio de AIA. .......................................... 75 Tabla 27 - Cebadores utilizados en los experimentos de qRT-PCR. ........................ 76 Tabla 28 – Soluciones empleadas en la medida de actividad β-galactosidasa. ....... 78 Tabla 29 – Solución de Fåhraeus. ............................................................................ 83 Tabla 30 – Solución de Gibson. ................................................................................ 83 Tabla 31 – Condiciones utilizadas en los ensayos de β-galactosidasa utilizando la estirpe R. tropici CIAT 899 (pMP240). ....................................................................... 92 Tabla 32 – Genes nod o regulados por una NB de R. tropici CIAT 899 diferencialmente expresados (± 4) en 3,7 µM de apigenina con respecto al control. ........................... 97 Tabla 33 – Genes nod, de fijación de nitrógeno o regulados por una NB de R. tropici CIAT 899 diferencialmente activados (± 4) en presencia de NaCl 300 mM. ............. 99 Tabla 34 – Genes nod, de fijación de nitrógeno o regulados por una NB de R. tropici CIAT 899 diferencialmente activados (± 2,5) en presencia de 400 mM de manitol. 101 Tabla 35 – Expresión diferencial de todos los genes nod o regulados por NB y diferencialmente expresados en R. tropici CIAT 899 y sus derivados RSP82 y nodD2::Ω en presencia de 3,7 µM de apigenina. .................................................... 111 Tabla 36 – Expresión diferencial de todos los genes nod o regulados por NB y diferencialmente expresados en R. tropici CIAT 899 y los mutantes RSP82 y nodD2::Ω en presencia de 300 mM de NaCl con respecto a la estirpe parental en condiciones control. .................................................................................................................... 112 Tabla 37 - Expresión diferencial de todos los genes nod o regulados por NB y diferencialmente expresados en R. tropici CIAT 899 y el mutante nodD2::Ω en presencia de 400 mM de manitol con respecto a la estirpe parental en condiciones control. .................................................................................................................... 113 Tabla 38 – Número total de FN producidos por la estirpe parental R. tropici CIAT 899 y los mutantes en los genes nodD en condiciones control, NaCl 300 mM y apigenina 3,7 µM. .................................................................................................................... 116 Tabla 39 – Fenotipo simbiótico de R. tropici CIAT 899 y sus derivados afectados en los genes nodD en P. vulgaris, L. leucocephala, L. japonicus y L. burttii. ............... 119 Tabla 40 – Fenotipo simbiótico de R. tropici CIAT 899 y el mutante ΔnodD1/ΔnodD2 en P. vulgaris y L. burttii. ......................................................................................... 123 Tabla 41 – Ensayos de actividad biológica de los FN en P. vulgaris. ..................... 124 Tabla 42 – FN producidos por los mutantes ∆nodA1A3 y ∆nodA1A2A3 en presencia de apigenina 3,7 µM. .............................................................................................. 128 Tabla 43 – FN producidos por los mutantes ∆nodA1A3 y ∆nodA1A2A3 en presencia de NaCl 300 mM. .................................................................................................... 128 Tabla 44 – Fenotipo simbiótico de R. tropici CIAT 899 y sus derivados afectados en los genes nodA en P. vulgaris, L. leucocephala, L. japonicus y L. burttii. ............... 130 Tabla 45 – Ensayos de actividad biológica de los FN aplicados en raíces de P. vulgaris. ................................................................................................................... 131 Tabla 46 – Número total de FN producidos por la estirpe parental R. tropici CIAT 899 y el mutante nrcR::Ω en condiciones control (B-), NaCl 300 mM y apigenina 3,7 µM. ................................................................................................................................ 135 Tabla 47 – Fenotipo simbiótico de R. tropici CIAT 899, el mutante nrcR::Ω, nrcR::Ω (pMUS1333) y nrcR::Ω::pMUS1353 en P. vulgaris y L. leucocephala. .................... 136 Tabla 48 – Expresión diferencial de todos los genes nod o de los genes regulados por NB y diferencialmente expresados en R. tropici CIAT 899 y el mutante ∆araC en presencia de 300 mM de NaCl con respecto al control de la estirpe parental. ........ 142 Tabla 49 – Expresión diferencial de todos los genes nod o de los genes regulados por NB y diferencialmente expresados en R. tropici CIAT 899 y el mutante ∆araC en presencia de 3,7 µM de apigenina con respecto al control. .................................... 144 Tabla 50 – FN producidos por la estirpe parental R. tropici CIAT 899 y el mutante ∆araC en condiciones control (B-), NaCl 300 mM y apigenina 3,7 µM. ................... 146 Tabla 51 – Fenotipo simbiótico de R. tropici CIAT 899 y el mutante ∆araC en P. vulgaris y L. leucocephala. ...................................................................................... 146 Tabla 52 – Expresión diferencial de todos los genes nod descritos en R. tropici CIAT 899 en presencia de 300 mM de NaCl, 400 mM de manitol y 3.7 µM de apigenina. ................................................................................................................................ 153 Tabla 53 – Inducción de la formación de nódulos fijadores de nitrógeno en diferentes leguminosas por R. tropici CIAT 899 y algunos de sus mutantes. .......................... 168 ABREVIATURAS ▪ AHL: N-acil-homoserina lactonas. ▪ AIA: Ácido Indolacético. ▪ EPS: Exopolisacáridos. ▪ FBN: Fijación biológica del nitrógeno. ▪ FN: Factor de nodulación. ▪ GC: Glucanos cíclicos. ▪ HTH: Helix-Turn-Helix. ▪ KPS: Polisacáridos capsulares. ▪ LCO: Lipoquitooligosácarido. ▪ LPS: Lipopolisacáridos. ▪ NAcGlu: N-acetilglucosamina. ▪ NB: Caja de nodulación. Del inglés nod-box. ▪ NN: Número de nódulos. ▪ nod: nodulación. ▪ pA: pRtrCIAT899a. ▪ pB: pRtrCIAT899b. ▪ pC: pRtrCIAT899c. ▪ PSPA: Peso seco parte aérea. ▪ QS: Quorum sensing. ▪ RMN: Resonancia magnética nuclear. ▪ SST3: Sistema de secreción tipo III. ▪ SST4: Sistema de secreción tipo IV. ▪ SST5: Sistema de secreción tipo V. ▪ SST6: Sistema de secreción tipo VI. ▪ TLC: Cromatografía en capa fina. 1 RESUMEN 8 Introducción 9 Introducción La simbiosis rizobio-leguminosa Antecedentes En la actualidad, nuestra sociedad se enfrenta al reto de satisfacer la demanda alimentaria de una población mundial en continuo aumento. Hoy día esta población es de 7600 millones de habitantes, y se estima que en 2030 habrá 8600 millones, que pasarán a ser 9800 millones en 2050. Por esto, la disponibilidad de nitrógeno es fundamental para la alimentación mundial y la aplicación de fertilizantes nitrogenados, que requiere un elevado consumo energético, contribuye a la amenaza creciente del efecto invernadero y del cambio climático. En este contexto, la fijación biológica del nitrógeno (FBN) es una de las claves para romper la dependencia del uso de fertilizantes nitrogenados. La FBN la realizan microorganismos procariotas en vida libre o mediante el establecimiento de relaciones simbióticas con algunas plantas de la familia Fabaceae (leguminosas). Las leguminosas representan una de las fuentes más importantes de proteína vegetal para los seres humanos y la alimentación animal en todo el mundo. Por lo tanto, entender cómo las leguminosas establecen interacciones simbióticas que les permitan crecer sin añadir abonos nitrogenados a los cultivos es una cuestión esencial para mantener un alto rendimiento de los cultivos y una buena seguridad alimentaria de manera sostenible. Cada vez está más claro que para mejorar el rendimiento de los cultivos se debe tener en cuenta la interacción de todos sus componentes, es decir, las interacciones entre las plantas, el suelo, los microbios, los insectos y el clima, conocidas colectivamente como fitobioma (Müller et al., 2016). Las plantas pueden reconocer moléculas sintetizadas por los distintos organismos presentes en su entorno, que pueden desembocar en relaciones mutualistas (simbióticas) o en una respuesta inmune por parte de la planta (patógenas) (Cook et al., 2015). El establecimiento de asociaciones simbióticas está restringido a pocas especies de bacterias y hongos. La más extendida (presente en la mayoría de las plantas terrestres) y evolutivamente más antigua es la simbiosis entre los hongos micorrícicos, pertenecientes al Filo Glomeromycota, y las plantas. Gracias a esta relación simbiótica, el hongo suministra o facilita a la planta 10 Introducción ciertos nutrientes, entre los que destaca el fósforo (Oldroyd, 2013). Además, como se ha mencionado anteriormente, algunas plantas de la familia de las leguminosas han desarrollado una simbiosis, generalmente radicular y a nivel intracelular, con bacterias fijadoras de nitrógeno denominadas colectivamente rizobios. Por otra parte, el actinomiceto Frankia induce la formación de unas estructuras nodulares fijadoras de nitrógeno en plantas actinorrícicas como son los miembros de los géneros de árboles Alnus o Causarina (Oldroyd, 2013). También existen otras asociaciones simbióticas en las plantas, pero en la mayoría de los casos los mecanismos de señalización para llevarlas a cabo son desconocidos. El establecimiento de la simbiosis rizobio-leguminosa Las leguminosas establecen simbiosis con un grupo de bacterias del suelo conocidas como rizobios. Este proceso simbiótico es muy específico y comienza con la secreción por la raíz de las leguminosas de unos metabolitos secundarios conocidos como flavonoides que actúan como atrayentes químicos de los rizobios. La presencia de estos flavonoides activa a un regulador transcripcional constitutivo codificado por el gen nodD, que por medio de la unión a un promotor conservado denominado caja nod o nod-box (NB), induce la expresión de un grupo de genes conocido como genes de nodulación o genes nod (Mulligan y Long, 1985) (Figura 1). Los genes nod codifican para unas proteínas encargadas de sintetizar y secretar unos compuestos conocidos como factores de nodulación o factores Nod (FN) (Dénarié et al., 1996). Estas moléculas de naturaleza lipoquitooligosacarídica son reconocidas por unos receptores específicos en la raíz, iniciando una cascada regulatoria en la célula vegetal. Los componentes que regulan esta ruta de señalización se han descrito principalmente en las leguminosas modelo de estudio Medicago truncatula y Lotus japonicus. 11 Introducción Figura 1 – Esquema de la regulación de la síntesis de los FN en los rizobios. Las flechas negras representan activación descrita. En L. japonicus, la percepción de los FN se lleva a cabo por la unión a dos receptores LysM (NFR1 y NFR5) junto a un receptor con dominio LRR-quinasa (SYMRK), que inician una cascada regulatoria, hasta la fecha desconocida, que transmite la señal al núcleo de la planta (Figura 2) (Madsen et al., 2003; Radutoiu et al., 2003; Madsen et al., 2010; Broghammer et al., 2012). En el núcleo, esta señalización genera unas oscilaciones de Ca2+ gracias a la acción conjunta del complejo de canales POLLUX (DMI1 en M. truncatula), CNGC15 y CASTOR (MCA8 en M. truncatula) (Charpentier et al., 2008; Charpentier et al., 2016). Estas señales son decodificadas directamente por el complejo proteico CCAMK y CYCLOPS, que transfieren la señal a través de diferentes factores de transcripción (NSP1, NSP2 y DELLAs), iniciándose la transcripción de los genes de la planta responsables de la formación de los nódulos (genes NIN y ENOD, entre otros) (Kaló et al., 2005; Smit et al., 2005; Oldroyd y Downie, 2008; Yano et al., 2008; Singh y Parniske, 2012; Miller et al., 2013). Los nódulos pueden presentar diferentes morfologías según la planta hospedadora. Por un lado, los que tienen morfología esférica se denominan nódulos determinados, como son los de L. japonicus, Phaseolus vulgaris (judía) o Glycine max (soja). Mientras, los que tienen morfología cilíndrica se denominan indeterminados y son 12 Introducción típicos en M. truncatula o Leucaena leucocephala (Leucena). En los nódulos indeterminados, el primordio se origina en el córtex interno de la raíz y da lugar a un meristemo apical persistente, de modo que continuamente se generan nuevas células que van siendo infectadas, por lo que el nódulo adopta la forma cilíndrica (Ferguson et al., 2010). El primordio de los nódulos determinados se origina en el córtex externo y da lugar a un meristemo cuya actividad es transitoria, de modo que genera una masa esférica de células que se diferenciarán a la vez (Ferguson et al., 2010). Algunos autores han sugerido la existencia de otros tres tipos de nódulos: nódulos de tipo dalbergoide, nódulos indeterminados con gradiente de edad y un meristemo, y nódulos indeterminados con gradiente de edad y dos meristemos (Sprent, 2007). Figura 2 – Esquema de la cascada regulatoria activada por la recepción del FN en el pelo radical. La flecha discontinua indica que la activación podría ser directa o indirecta. Recientemente, se ha observado que las fitohormonas también desempeñan un papel importante durante la infección del rizobio y la formación de los nódulos. 13 Introducción Concretamente, se ha comprobado que las citoquininas en L. japonicus y M. truncatula son importantes para el inicio de la formación de los nódulos, la regulación de la infección del rizobio y la determinación del número de nódulos (Gamas et al., 2017). Esta regulación ocurre por cambios en los niveles de las hormonas vegetales, que pueden ser provocados por la planta en respuesta a la señalización del FN o bien por la síntesis directa de estas fitohormonas por parte de los rizobios (Ferguson y Mathesius, 2014). Por lo tanto, la simbiosis rizobio-leguminosa se inicia por un complejo intercambio de señales. A continuación, los rizobios se adhieren a los pelos radicales, que se deforman y curvan en respuesta a los FN permitiendo la formación de un canal o tubo de infección en el interior del pelo radical por donde los rizobios entran hasta el córtex radicular (Oldroyd et al., 2011) (Figura 3). Figura 3 – Esquema de la colonización de la raíz de la leguminosa por parte de los rizobios. 14 Introducción Una vez en el interior de la célula vegetal, el rizobio se endocita rodeándose por una membrana de origen vegetal (la membrana peribacteroidea) dando lugar a una estructura, que se asemeja a un orgánulo, al que se le denomina simbiosoma (Udvardi y Poole, 2013). Dentro de este simbiosoma, las bacterias se diferencian en bacteroides. Estos bacteroides son reducen el nitrógeno atmosférico a amonio por la acción del complejo enzimático denominado nitrogenasa. No obstante, en algunas leguminosas que pertenecen al clado IRLC (del inglés Inverted Repeat Lacking Clade) se han identificado unos genes que codifican para una familia de péptidos ricos en cisteínas denominados NCR (del inglés Nodule specific Cysteine-Rich) que regulan la diferenciación del bacteroide controlando que solo ciertos rizobios puedan hacerlo y, por tanto, actúan como un punto de control adicional en la especificidad de la simbiosis (Kereszt et al., 2018). Este tipo de péptidos solo se han identificado en las leguminosas del clado IRLC como Medicago, Pisum o Trifolium. No obstante, se piensa que en el resto de las leguminosas también podría haber algún tipo de selección, pudiendo ser incluso las propias condiciones abióticas presentes en el nódulo (estrés osmótico, pH, entre otros) (Green et al., 2019). Los genes de nodulación En los rizobios, los genes esenciales para la nodulación, infección y fijación de nitrógeno están normalmente agrupados en operones. Los genes de nodulación o genes nod están implicados en la síntesis, procesamiento y transporte de los FN, siendo los genes más conservados en los rizobios los denominados genes nod comunes que incluyen a los genes nodABCDIJ (Remigi et al., 2015). Inicialmente, se denominaron genes nod, pero la continua descripción de nuevos genes de nodulación hizo necesaria la utilización de las designaciones de genes nol y genes noe. En la mayoría de los rizobios se localizan en un plásmido de tamaño variable llamado plásmido simbiótico o pSym. Pero en algunas especies, como Bradyrhizobium japonicum o Mesorhizobium loti, los genes de nodulación se agrupan en islas simbióticas en el cromosoma de la bacteria (Downie, 1998). 15 Introducción De todos los genes nod, los genes nodABC están presente en casi todas las especies de rizobios ya que son los encargados de sintetizar la estructura básica o núcleo del FN (Spaink et al., 1991). En el proceso de síntesis, la proteína NodC (N- acetilglucosamina transferasa) se encarga de sintetizar el esqueleto del FN, que está formado por moléculas de N-acetilglucosamina (NAcGlu), y también determina su longitud (Geremia et al., 1994). El siguiente paso en la síntesis es llevado a cabo por NodB que codifica una quitina desacetilasa, que desacetila uno de los residuos de NAcGlu extremo no reductor de la cadena, que posteriormente es acilado por la proteína NodA (John et al., 1993; Atkinson et al., 1994). En la siguiente Tabla 1 se muestran las funciones de los genes de nodulación más comunes, entre las que destacan la decoración de los FN, tales como la adición de grupos de azufre o de grupos metilo, y el transporte de estos factores al exterior (Downie, 1998). Tabla 1 – Funciones de algunos genes nod presentes en los rizobios. Gen Función de la proteína a la que codifica nodA Aciltransferasa nodB Quitina desacetilasa nodC NAcGlu transferasa nodD Regulador transcripcional de genes nod nodEF Síntesis de ácidos grasos poliinsaturados nodH Sulfotransferasa nodIJ, nodT Exportación del FN nodL, nodX, nolL O-acetiltransferasa nodM Glucosamina sintasa nodPQ Síntesis de sulfato en forma activa nodS N-metiltransferasa nodU, nolO O-carbamoil transferasa nodZ Fucosil transferasa nolK Epimerasa implicada en la síntesis de fucosa nolR Represor de genes nod Información obtenida de Perret et al., 2000; Vance, 2002. 16 Introducción El regulador transcripcional NodD El gen nodD es uno de los genes de nodulación más importantes ya que codifica para el regulador transcripcional que activa (a veces reprime) a los genes nod en presencia del flavonoide apropiado. Este regulador, perteneciente a la familia proteica LysR, se transcribe de forma constitutiva y en presencia del flavonoide adecuado, cambia su conformación a activa para unirse a las NB activando o reprimiendo la expresión de los operones de los genes nod o de genes relacionados con la simbiosis que se encuentren aguas abajo (Fellay et al., 1998; Peck et al., 2006; Long, 2016). Los rizobios suelen poseer una o dos copias del gen nodD, aunque algunos rizobios portan hasta cinco copias del gen nodD en su genoma, lo que podría estar relacionado con un mayor rango de nodulación (Ormeño-Orrillo et al., 2012). En cuanto a su estructura, la proteína NodD no ha conseguido ser cristalografiada de momento. No obstante, estudios de mutagénesis puntuales y aproximaciones bioinformáticas a partir de la cristalografía de otras proteínas similares indican que NodD podría formar homodímeros o heterodímeros, donde existe una región de unión al inductor (en este caso el flavonoide) y otra región de unión al ADN (HTH, del inglés Helix-Turn-Helix) y a la ARN polimerasa (Figura 4) (Peck et al., 2013). Además, hay otros puntos importantes que hay que tener en cuenta en la activación y función de NodD. Por un lado, este regulador transcripcional no siempre tiene un papel activador de la expresión de los genes nod, ya que en Sinorhizobium (=Ensifer) fredii NGR234, NodD2 actúa como represor de los genes nod (Fellay et al., 1998; Kobayashi et al., 2004). En S. fredii USDA257 y USDA191, la sobreexpresión de nodD2 reduce la transcripción de nodD1 (Machado et al., 1998). Además, en S. fredii HH103, la mutación de nodD2 provoca que la bacteria sintetice FN con un mayor número de decoraciones lo que permite a este rizobio establecer simbiosis efectiva en L. japonicus, algo que no ocurre en la estirpe silvestre que tan solo forma primordios nodulares (Acosta-Jurado et al., 2019). Por otro lado, no existen evidencias bioquímicas que determinen la interacción del flavonoide con la proteína NodD, lo que podría abrir la puerta a que otros componentes pudieran intervenir en la activación de 17 Introducción NodD, y, por tanto, en la regulación de los genes nod. De hecho, no se ha descrito aún un flavonoide activador de NodD en M. loti, simbionte modelo en L. japonicus (Kelly et al., 2018a), lo que sugiere que la activación de NodD podría ser más compleja de lo que se conoce hasta la fecha. Figura 4 – Modelo estructural del dímero de NodD1 de S. meliloti (Peck et al., 2013). Esta imagen ha sido cedida por Roger Castells (John Innes Centre, Norwich, Reino Unido). Otros reguladores transcripcionales de interés Reguladores de la familia ArsR: NolR Otro grupo importante de reguladores transcripcionales que están implicados en mayor o menor medida en la efectividad de la simbiosis entre rizobios y leguminosas son las proteínas de unión a metales. En estos reguladores, la unión de iones metálicos altera la conformación alostérica de la proteína y, por tanto, permite modular la expresión de aquellos genes diana. La familia de reguladores ArsR es una de las más importantes en bacterias por el número de reguladores transcripcionales que 24 Introducción Normalmente, las biopelículas están compuestas por agua, iones, células y una matriz de EPS (Sutherland, 2001), lo que proporciona una barrera contra la difusión de compuestos como antibióticos y sustancias de defensa producidos por los hospedadores, y contra el estrés ante factores ambientales como radiación, cambios de pH, estrés osmótico y desecación (Gilbert et al., 1997; Janczarek, 2011). Otros componentes bacterianos, tales como los flagelos y los LPS, juegan también un papel esencial en la formación de estas biopelículas (Rinaudi y Giordano, 2010). En la rizosfera, muchos de los rizobios forman biopelículas cuando colonizan la raíz. Hasta la fecha, no se conoce con exactitud los mecanismos por los que se forma una biopelícula en los rizobios, aunque se van descubriendo factores que son necesarios para la formación de ésta. De hecho, se ha observado en S. meliloti que los propios FN pueden formar parte de la matriz de la biopelícula, siendo esenciales para la formación de la estructura tridimensional de la misma, necesaria para el establecimiento de la interacción simbiótica (Fujishige et al., 2006). Otro estudio reciente en S. fredii SMH12 muestra que la formación de biopelículas es crucial para una óptima colonización de raíz, y por tanto, para el establecimiento de la simbiosis en G. max (Pérez-Montaño et al., 2014). En ambos estudios, la formación de estas biopelículas está regulada por flavonoides inductores de los genes nod. Percepción de quórum o quorum sensing (QS) El proceso por el que las bacterias cambian su expresión génica de manera coordinada en respuesta a cambios en la densidad de población se conoce como quorum sensing (QS). En este proceso intervienen unas moléculas señal que difunden fácilmente por la membrana llamadas autoinductores (Fuqua et al., 1994; Miller y Bassler, 2001). En bacterias Gramnegativas, los principales autoinductores se han identificado como N-acil-homoserina lactonas (AHL) y su producción se ha detectado también en bacterias asociadas a plantas, incluidos los rizobios (Cha et al., 1998). Los genes regulados por QS están implicados en cambios adaptativos en la fisiología de las poblaciones bacterianas, adaptando y modificando su comportamiento cuando se alcanza una cierta densidad celular (Calatrava-Morales et al., 2018). Así, los genes 25 Introducción controlados por QS modulan una amplia variedad de fenotipos: virulencia, transferencia de plásmidos, producción de toxinas, inhibición del crecimiento, formación de biopelículas, producción de EPS, movilidad, eficiencia en la nodulación, desarrollo del simbiosoma y fijación de nitrógeno, que son relevantes para el establecimiento de la simbiosis o para la relación patogénica con hospedadores eucariotas (Fuqua et al., 1994; Pérez-Montaño et al., 2011 y 2013). Curiosamente, los procesos de QS son relevantes tanto en comunicación intraespecífica como en interespecífica, como el que ocurre entre B. japonicum y A. brasilense donde la co-inoculación de estas dos estirpes en G. max incrementa la biomasa de esta leguminosa, y todo ello por los procesos de QS que se dan entre ambas estirpes, ya que la ausencia de las AHL no produce este incremento afectando además al crecimiento bacteriano y la formación de biopelículas (Fagotti et al., 2019) Movilidad bacteriana Otro proceso conservado y extendido en las bacterias es la movilidad que les permite mayor eficacia en la obtención de nutrientes, acceder a mejores nichos, evitar el efecto de toxinas o de condiciones desfavorables y una mejor dispersión bacteriana. En la simbiosis rizobio-leguminosa, la movilidad tiene una gran relevancia tanto en la quimiotaxis que es responsable de la atracción de los rizobios a la rizosfera, como durante la colonización de la raíz. De hecho, los rizobios que forman biopelículas sobre la raíz en la rizosfera pueden volverse altamente móviles y desplazarse sobre el sustrato en un proceso conocido como movilidad de tipo swarming que es dependiente de flagelo (Verstraeten et al., 2008; Amaya-Gómez et al., 2015). No obstante, se han descrito otros tipos de movilidad de superficie donde intervienen otros componentes independientes del flagelo: twitching, que es el movimiento superficial de bacterias en las que intervienen los pili bacterianos de tipo IV, gliding que se da por la formación de complejos de adhesión focal a la superficie, y sliding que es un movimiento de superficie por translocación pasiva que es dependiente del crecimiento bacteriano y 26 Introducción la producción de surfactante, entre otros (Figura 8) (Kearns, 2010). Por otra parte, la movilidad de tipo swimming es un tipo de movilidad bacteriana que también es dependiente de flagelo, pero, a diferencia de la de tipo swarming, se lleva a cabo en ambientes líquidos. Figura 8 – Algunos de los tipos de movilidad bacteriana más estudiados. Figura adaptada de Kearns, 2010. Producción de ácido indolacético (AIA) Algunas bacterias, incluyendo los rizobios, tienen la capacidad de producir la fitohormona ácido indolacético (AIA) que promueve en la planta el desarrollo de raíces laterales y adventicias, entre otras funciones. Aunque originalmente la producción de fitohormonas se relacionaba con eventos de patogenicidad (Jameson, 2000), ciertos rizobios pueden producir AIA como por ejemplo en S. meliloti y R. leguminosarum, donde la producción de esta fitohormona se incrementa en presencia de determinados flavonoides (Prinsen et al. 1991). En S. fredii NGR234 se ha identificado un operón relacionado con la síntesis de AIA (genes y4wEFG) que está bajo regulación de una NB (NB15). Además, estos genes son transcripcionalmente activados por NodD1 y NodD2 en presencia del flavonoide inductor daidzeína, lo que indica que la producción AIA está vinculada a la síntesis de FN en el contexto del establecimiento de la simbiosis con leguminosas (Theunis et al., 2004). 27 Introducción Sistemas de secreción bacterianos Las bacterias utilizan unas estructuras macromoleculares conocidas como sistemas de secreción para exportar proteínas y ADN a través de la membrana plasmática y la pared celular. Estos complejos permiten a las bacterias interaccionar con el entorno, lo que es relevante en la supervivencia bacteriana. Existen diferentes tipos de sistemas de secreción, pero hasta la fecha, solo los primeros siete se han investigado en profundidad (Tseng et al., 2009; Deakin y Broughton, 2009). En los rizobios, la secuenciación de diversas estirpes ha demostrado que estas bacterias frecuentemente contienen múltiples sistemas de secreción. Sin embargo, la presencia de estos sistemas en el genoma no significa que tengan un papel en la simbiosis. En general, los rizobios contienen los sistemas de secreción de tipo 3 (SST3), SST4, SST5 y SST6, que presentan una alta homología con los que presentan los patógenos bacterianos (Nelson y Sadowski, 2015; Ormeño-Orrillo et al., 2016). Se ha demostrado que los SST3, SST4 y SST6 están involucrados en la simbiosis con leguminosas, ya que éstos translocan unas proteínas conocidas como efectores que suprimen y/o subvierten la respuesta defensiva de la planta, promoviendo en algunos casos la formación de los nódulos (Jiménez-Guerrero et al., 2015). 28 Introducción 29 Introducción El macrosimbionte: las leguminosas En la presente Tesis Doctoral se ha trabajado con las leguminosas P. vulgaris, L. leucocephala, L. japonicus y L. burttii. Phaseolus vulgaris De entre todas las leguminosas, la judía (P. vulgaris) es una de las más extensamente cultivadas a lo largo del planeta, participando en la nutrición de cerca de 500 millones de personas. Esta planta desarrolla nódulos de tipo determinado y es considerada una planta promiscua por su capacidad de establecer simbiosis efectiva con un grupo genéticamente heterogéneo de rizobios originarios de diferentes partes del mundo (Laeremans y Vanderleyden, 1998; Martínez-Romero, 2003). Leucaena leucocephala La leucena (L. leucocephala) es una leguminosa de crecimiento rápido y muy utilizada como fuente de proteínas para el ganado, tanto en verde como en seco. Es un árbol que puede alcanzar hasta 18 m de altura, aunque a veces adquiere porte arbustivo, y del que existen más de 100 cultivares en el mundo. Es nativa de las tierras semiáridas de América Central y México. Desarrolla nódulos de tipo indeterminado y sus simbiontes más habituales pertenecen a los géneros Rhizobium y/o Bradyrhizobium (Wang et al., 1999). Lotus japonicus y Lotus burttii Lotus japonicus no es una planta utilizada en agricultura. No obstante, es una de las leguminosas modelo debido a sus características: su ciclo de vida es corto (2-3 meses), puede autofertilizarse y posee una gran simplicidad en la arquitectura de su genoma diploide (n=6), que ha sido secuenciado y es de relativamente pequeño tamaño (472 Mb) en comparación con otras leguminosas (Sato et al., 2008). En cuanto 30 Introducción a L. burttii, se trata de una planta muy similar a L. japonicus. Se ha comenzado a trabajar en investigación con esta planta en los últimos años ya que, debido a su cercanía filogenética, se puede cruzar con L. japonicus. Además, esta planta florece y produce semillas en menos tiempo que L. japonicus, lo que la ha colocado en otra planta relevante en investigación a pesar de que su genoma no ha sido secuenciado (Kawaguchi et al., 2005). 31 Introducción El microsimbionte: Rhizobium tropici CIAT 899 Antecedentes En la presente Tesis Doctoral se ha trabajado con la estirpe bacteriana CIAT 899 de R. tropici. Esta estirpe se aisló por primera vez en Colombia de nódulos de P. vulgaris (Martínez-Romero et al., 1991). Se trata de un rizobio promiscuo por su capacidad de establecer simbiosis con un amplio rango de leguminosas (Hungria et al., 2000). Este rizobio se utiliza a menudo como inoculante ya que es uno de los simbiontes más eficientes en judía. Además, CIAT 899 es capaz de tolerar diferentes tipos de estreses abióticos, entre los que se destacan altas temperaturas, suelos ácidos y salinos, y presencia de metales pesados (Martínez-Romero et al., 1991: Hungria et al., 1993; Graham et al., 1994). De hecho, ensayos de campo han determinado que esta estirpe es un buen inoculante bacteriano para el cultivo de leguminosas, especialmente en aquellos suelos sometidos a algún tipo de estrés abiótico (Hungria et al., 2003). Recientemente se ha secuenciado su genoma por lo que esto, sumado a todas estas características mencionadas anteriormente, lo han convertido en un organismo modelo de estudio (Ormeño-Orrillo et al., 2012). Filogenia de R. tropici CIAT 899 En la última década, los árboles filogenéticos construidos a partir del ARNr 16S junto a otros genes conservados, sitúan a la especie R. tropici en el mismo clado que otras especies como R. leucaenae, R. multihospitium, R. lusitanum, R. miluonense y R. rhizogenes (Ribeiro et al., 2012). De manera general, en la siguiente Figura 9 se muestran las relaciones filogenéticas entre los rizobios cuyos genomas se habían secuenciado hasta el 2012, donde CIAT 899 se sitúa próximo a Rhizobium sp. PRF81 (actualmente R. freirei PRF81) y sorprendentemente más alejada de otras estirpes que nodulan judía como R. etli CFN42 o R. phaseoli CIAT652 (Ormeño-Orrillo et al., 2012). 32 Introducción Figura 9 - Relaciones genómicas entre R. tropici CIAT 899 y otros rizobios o relacionados basado en el índice de las distancias de genomas MUMi. Esta figura ha sido tomada de Ormeño-Orrillo et al., 2012. No obstante, el aislamiento y secuenciación de nuevos rizobios en los últimos años han incluido nuevas especies en el grupo formado por CIAT 899 y PRF81. Un claro ejemplo es la secuenciación de las estirpes CFN 299 y CPAO 29.8 de R. leucaenae, cuyos plásmidos simbióticos presentan una identidad mayor del 99% con el que porta CIAT 899 (Ormeño-Orrillo et al., 2016). Este hecho sugiere que este plásmido simbiótico podría estar conservado entre diferentes estirpes de rizobios, lo que ha generado la aparición del “simbiovar” tropici (grupo de rizobios que portan el mismo plásmido simbiótico). Este simbiovar está en continuo crecimiento en los últimos años debido al aislamiento y secuenciación de nuevas estirpes. El genoma de R. tropici CIAT 899 Como se ha indicado anteriormente, el genoma de CIAT 899 se secuenció en 2012 (Ormeño-Orrillo et al., 2012). Este genoma está compuesto de 6.686.337 pb repartidas en un cromosoma (3.837.060 pb) y tres plásmidos: pRtrCIAT899a (216.610 pb), pRtrCIAT899b o plásmido simbiótico (549.467 pb) y un megaplásmido pRtrCIAT899c 33 Introducción (2.083.197 pb). En la siguiente Tabla 2 se recoge información detallada sobre algunas características de los diferentes replicones de CIAT 899. Tabla 2 – Información relevante obtenida en la secuenciación del genoma de R. tropici CIAT 899. Genoma de R. tropici CIAT 899 Cromosoma pRtrCIAT899a pRtrCIAT899b pRtrCIAT899c Total Tamaño (Mb) 3,8 0,22 0,55 2,08 6,69 G + C (%) 59,9 58,6 57,6 59,4 59,5 Numero Genes 3734 212 500 1905 Secuencias codificantes 3672 212 500 1905 6289 ARNt 53 - - - - ARNr 9 - - - - La secuenciación del genoma ha permitido identificar la presencia de hasta cinco genes nodD en el plásmido simbiótico, característica atípica en el resto de los rizobios y hecho que también ocurre en algunas de las estirpes pertenecientes al simbiovar tropici. La presencia de estos cinco genes nodD sugiere la existencia de una vía compleja de regulación de los genes relacionados con la nodulación. Otro aspecto para resaltar es la presencia de hasta tres genes nodA, característica de nuevo única entre los rizobios descritos. De estos tres genes, los genes nodA1 y nodA2 se encuentran en dos operones donde se localizan la mayoría de los genes nod de CIAT 899: nodA1BCSUIJHPQ y nodA2hsnTnodFE (Figura 10, Tabla 3). Estos dos operones están precedidos por dos NB. También se han identificado otros genes nod repartidos por el plásmido simbiótico: nodA3, carente de NB y aguas arriba de nodD3; nodM, precedido por una NB; nodD4, que se encuentra próximo a un operón de dos genes cuya función es desconocida pero que son precedidos por otra NB; y nodD5, muy próximo al operón y4wEF implicado en la síntesis de la fitohormona ácido indolacético (AIA), y que está precedido por una NB. En cuanto a los genes relacionados con la fijación de nitrógeno, se encuentran agrupados en los siguientes cuatro operones en el plásmido simbiótico de CIAT 899: nifHDKENX, nifTZfdxNfixNnifBAfixXCBAnifWSUQ, nifEN, fixLJK y fixNOPQ. 40 Objetivos 41 Material y Métodos MATERIAL Y MÉTODOS 42 Material y Métodos 43 Material y Métodos Estirpes y plásmidos utilizados Estirpes bacterianas Las estirpes bacterianas y los plásmidos utilizados en la presente Tesis Doctoral se recogen en las Tablas 4-7. Estirpes de Escherichia coli Tabla 4 – Estirpes de E. coli utilizadas en la presente Tesis Doctoral. Nombre Características relevantes Referencia DH5α SupE44, lacU169, 5hsdR17, recA1, endA1, gyrA96, thi-1, relA1, (NalR) Sambrook et al., (1989) Rhizobium tropici CIAT 899 y sus derivados Tabla 5 – Estirpes de R. tropici CIAT 899 utilizadas en la presente Tesis Doctoral. Nombre Características relevantes Referencia R. tropici CIAT 899 Estirpe silvestre (RifR) Martínez-Romero et al., (1991) RSP82 Estirpe CIAT 899 que porta un casete Km insertado en el gen nodD1 (KmR) Guasch-Vidal et al., (2013) nodD2::Ω Estirpe CIAT 899 que porta el interposón Ω insertado en el gen nodD2 (SpcR) Esta Tesis nodD3::Ω Estirpe CIAT 899 que porta el interposón Ω insertado en el gen nodD3 (SpcR) Esta Tesis nodD4::Ω Estirpe CIAT 899 que porta el interposón Ω insertado en el gen nodD4 (SpcR) Esta Tesis nodD5::Ω Estirpe CIAT 899 que porta el interposón Ω insertado en el gen nodD5 (SpcR) Esta Tesis ΔnodD1 Estirpe CIAT 899 con el gen nodD1 delecionado Esta Tesis ΔnodD1/ΔnodD2 Estirpe CIAT 899 con los genes nodD1/nodD2 delecionados Esta Tesis 44 Material y Métodos Nombre Características relevantes Referencia nrcR::Ω Estirpe CIAT 899 que porta el interposón Ω insertado en el gen nrcR (SpcR) Esta Tesis nrcR::Ω (pMUS1333) Estirpe nrcR::Ω complementada en trans: plásmido de expresión portador del gen nrcR silvestre (RifR SpcR GmR) Esta Tesis nrcR::Ω::pMUS1353 Estirpe nrcR::Ω complementada en cis: integración genómica del gen nrcR silvestre (RifR SpcR KmR) Esta Tesis ΔnodA1 Estirpe CIAT 899 con el gen nodA1 delecionado Esta tesis ΔnodA2 Estirpe CIAT 899 con el gen nodA2 delecionado Esta tesis ΔnodA3 Estirpe CIAT 899 con el gen nodA3 delecionado Esta tesis ΔnodA1A2 Estirpe CIAT 899 con los genes nodA1/nodA2 delecionados Esta tesis ΔnodA1A3 Estirpe CIAT 899 con los genes nodA1/nodA3 delecionados Esta tesis ΔnodA2A3 Estirpe CIAT 899 con los genes nodA2/nodA3 delecionados Esta tesis ΔnodA1A2A3 Estirpe CIAT 899 con los genes nodA1/nodA2/nodA3 delecionados Esta tesis ΔaraC Estirpe CIAT 899 con el gen araC delecionado Esta tesis R. tropici CIAT 899 (pMP240) Estirpe CIAT 899 con el plásmido pMP240, portador de la fusión pnodA::lacZ (TcR) Dardanelli et al., (2008) RSP82 (pMP240) Mutante RSP82 con el plásmido pMP240 (KmR TcR) Esta Tesis nodD2::Ω (pMP240) Mutante nodD2::Ω con el plásmido pMP240 (SpcR TcR) Esta Tesis nodD3::Ω (pMP240) Mutante nodD3::Ω con el plásmido pMP240 (SpcR TcR) Esta Tesis nodD4::Ω (pMP240) Mutante nodD4::Ω con el plásmido pMP240 (SpcR TcR) Esta Tesis nodD5::Ω (pMP240) Mutante nodD5::Ω con el plásmido pMP240 (SpcR TcR) Esta Tesis ΔnodD1/ΔnodD2 (pMP240) Mutante ΔnodD1/ΔnodD2 con el plásmido pMP240 (TcR) Esta Tesis ΔaraC (pMP240) Mutante ΔaraC (RTCIAT899_PB01075) con el plásmido pMP240 (TcR) Esta Tesis 45 Material y Métodos Otras estirpes Tabla 6 – Otras estirpes utilizadas en la presente Tesis Doctoral. Nombre Características relevantes Referencia Agrobacterium tumefaciens NT1 (pZRL4) A. tumefaciens curada del plásmido pTiC58; con el plásmido pZRL4, portador de la fusión traG::lacZ y del gen traR, (GmR) Cha et al., (1998) Azospirillum brasilense Ab-V6 Estirpe silvestre que fija nitrógeno en vida libre Hungria et al., (2010) Plásmidos Tabla 7 – Plásmidos utilizados en la presente Tesis Doctoral. Nombre Características relevantes Referencia pRK2013 Plásmido coadyuvante, (KmR) Figurski y Helinski, (1979) pBBR1-MCS-5 Vector de clonación de amplio rango de hospedador, (GmR) Kovach et al., (1995) pMP240 Plásmido que porta la fusión transcripcional entre el promotor del gen nodA de R. leguminosarum bv. viciae con el gen lacZ, (TcR) De Maagd et al., (1988) pGEM-T Easy Vector de clonación de productos de PCR, (ApR) Promega (EEUU) pGEM-T Easy::nodD2 Plásmido pGEM-T Easy que porta el gen nodD2 silvestre de CIAT 899 (ApR) Esta Tesis pGEM-T Easy::nodD3 Plásmido pGEM-T Easy que porta el gen nodD3 silvestre de CIAT 899 (ApR) Esta Tesis pGEM-T Easy::nodD4 Plásmido pGEM-T Easy que porta el gen nodD4 silvestre de CIAT 899 (ApR) Esta Tesis pGEM-T Easy::nodD5 Plásmido pGEM-T Easy que porta el gen nodD5 silvestre de CIAT 899 (ApR) Esta Tesis pGEM-T Easy::nrcR Plásmido pGEM-T Easy que porta el gen nrcR silvestre de CIAT 899, (ApR) Esta Tesis pGEM-T Easy::nodD3::Ω Plásmido pGEM-T Easy::nodD3 interrumpido con el interposón Ω en el punto SmaI del gen nodD3, (SpcR ApR) Esta Tesis 46 Material y Métodos Nombre Características relevantes Referencia pGEM-T Easy::nrcR::Ω Plásmido pGEM-T Easy::nrcR interrumpido con el interposón Ω en el punto HindIII del gen nrcR, (SpcR ApR) Esta Tesis pHP45Ω Plásmido que contiene el interposón Ω, (SpcR/StrR, ApR) Prentki y Krisch, (1984) pK18mob Vector de clonación suicida en los rizobios, (KmR) Schäfer et al,. (1994) pK18mob::nodD2 Plásmido pK18mob que porta el gen nodD2 silvestre que proviene del plásmido pGEM-T Easy::nodD2, (KmR) Esta Tesis pK18mob::nodD4 Plásmido pK18mob que porta el gen nodD4 silvestre que proviene del plásmido pGEM-T Easy::nodD4, (KmR) Esta Tesis pK18mob::nodD5 Plásmido pK18mob que porta el gen nodD5 silvestre que proviene del plásmido pGEM-T Easy::nodD5, (KmR) Esta Tesis pK18mob::nodD2::Ω Plásmido pK18mob::nodD2 interrumpido con el interposón Ω en el punto PstI del gen nodD2, (SpcR KmR) Esta Tesis pK18mob::nodD3::Ω Plásmido pK18mob que porta el gen nodD3::Ω que proviene del plásmido pGEM-T Easy::nodD3::Ω, (SpcR KmR) Esta Tesis pK18mob::nodD4::Ω Plásmido pK18mob::nodD4 interrumpido con el interposón Ω en el punto SalI del gen nodD4, (SpcR KmR) Esta Tesis pK18mob::nodD5::Ω Plásmido pK18mob::nodD5 interrumpido con el interposón Ω en el punto XhoI del gen nodD5, (SpcR KmR) Esta Tesis pK18mob::nrcR::Ω Plásmido pK18mob que porta el gen nrcR::Ω que proviene del plásmido -pGEM-T Easy::nrcR::Ω, (SpcR KmR) Esta Tesis pK18mobsacB Vector de clonación suicida en los rizobios, (KmR SacS) Schäfer et al., (1994) pK18mobsacB::ΔnodD1 Plásmido pK18mobsacB que porta el gen nodD1 delecionado, (KmR SacS) Esta Tesis pK18mobsacB::ΔnodD2 Plásmido pK18mobsacB que porta el gen nodD2 delecionado, (KmR SacS) Esta Tesis pK18mobsacB::ΔaraC Plásmido pK18mobsacB que porta el gen araC delecionado, (KmR SacS) Esta Tesis 47 Material y Métodos Nombre Características relevantes Referencia pK18mobsacB::ΔnodA1 Plásmido pK18mobsacB que porta el gen nodA1 delecionado, (KmR SacS) Esta Tesis pK18mobsacB::ΔnodA2 Plásmido pK18mobsacB que porta el gen nodA2 delecionado, (KmR SacS) Esta Tesis pK18mobsacB::ΔnodA3 Plásmido pK18mobsacB que porta el gen nodA3 delecionado, (KmR SacS) Esta Tesis pMUS1333 pBBR1-MCS-5 que porta el gen nrcR silvestre, (GmR) Esta Tesis pMUS1353 pK18mob que porta el gen nrcR silvestre, (GmR) Esta Tesis 48 Material y Métodos 49 Material y Métodos Medios y agentes selectivos Medios de cultivo La composición de los medios de cultivo utilizados en esta Tesis Doctoral se describe en las Tablas 8-14. Medios para Rhizobium Tabla 8 – Componentes del medio TY. Medio TY (Behringer, 1974) Extracto de levadura 3 g Triptona 5 g CaCl2 2 H2O 0,65 g H2O destilada Completar hasta 1 L El pH se ajustó a 6,8-7,0 y el medio se esterilizó en la autoclave durante 20 minutos a una atmósfera de sobrepresión (121 °C). Tabla 9 – Componentes del medio YM. Medio YM (Vincent, 1970) K2HPO4 500 mg MgSO4 7 H2O 200 mg NaCl 100 mg Extracto de levadura 400 mg Manitol 10 g H2O destilada Completar hasta 1 L El pH se ajustó a 6,8-7,0 y el medio se esterilizó en la autoclave durante 20 minutos a una atmósfera de sobrepresión (121 °C). En los ensayos de actividad β-galactosidasa se utilizó el medio YM3, que es igual que el medio YM, pero que contiene 3 g de manitol por L de medio en lugar de 10 g L-1. 56 Material y Métodos se centrifugó a 3500 g durante 10 minutos a 4 °C. El sobrenadante se descartó y el sedimento celular obtenido se resuspendió en 30 mL de solución TBF-I a 4 °C (Tabla 16). La mezcla se incubó en hielo durante 10 minutos y se centrifugó a 3500 g durante 10 minutos a 4 °C. El sobrenadante se descartó y el sedimento se resuspendió en 4 mL de solución TBF-II a 4 °C (Tabla 16). Se repartieron alícuotas de 50 μL en eppendorfs que se congelaron en nitrógeno líquido y se almacenaron a -80 °C hasta su uso. Tabla 16 – Soluciones empleadas en las transformaciones bacterianas. Soluciones empleadas Composición soluciones TFB-I AcK 3 M pH 5,8, MnCl2 1 M, CaCl2 1 M, RbCl 1 M, Glicerol 15% TFB-II MOPS 1 M pH 7, CaCl2 1 M, RbCl 1 M, Glicerol 15% Las células de E. coli competentes se descongelaron en hielo durante 5 minutos. Se añadió el ADN plasmídico o la mezcla de ligación, se mezcló suavemente con la pipeta y se incubó en hielo durante, al menos, 20 minutos. Posteriormente, la mezcla se incubó durante 90 segundos en un baño a 42 °C y, una vez transcurrido ese tiempo, se incubó rápidamente en hielo durante 5 minutos. Pasado este tiempo, se añadió 1 mL de medio LB y se incubó a 37 °C en agitación durante una hora. Tras la incubación, se centrifugó durante 3 minutos a 5000 g y se descartó el sobrenadante, dejando alrededor de 100 μL, que se usaron para resuspender el sedimento celular. La mezcla se sembró en placas de medio LB, con los antibióticos adecuados, y se incubó a 37 °C durante 24 horas. Extracción del ADN total Para la extracción del ADN total de R. tropici CIAT 899 y sus mutantes se utilizó el kit G-spinTM Total DNA Extraction Kit (iNtRON Biotechnology, Corea del Sur). La extracción se realizó siguiendo el protocolo del fabricante a partir de cultivos de 1,5 mL de cultivos bacterianos que se crecieron en TY en un agitador orbital (180 rpm) durante 48 horas a una temperatura de 28 °C. 57 Material y Métodos Extracción del ADN plasmídico (minipreps) La extracción de plásmidos de cultivos de E. coli se realizó utilizando el kit Wizard® Plus SV Minipreps DNA Purification System (Promega, EEUU). La extracción se realizó siguiendo el protocolo del fabricante a partir de cultivos de 1,5 mL de cultivos bacterianos que se crecieron en LB en un agitador orbital (180 rpm) durante 24 horas a una temperatura de 37 °C. Restricción del ADN Se utilizaron las enzimas de restricción suministradas por New England Biolabs (EEUU). Si la endonucleasa originó extremos 5’ monocatenarios, éstos se pueden convertir en bicatenarios mediante la actividad polimerasa del fragmento Klenow de la ADN polimerasa I de E. coli en presencia de desoxinucleótidos trifosfatos (dNTPs). Cuando fue necesario, con el fragmento Klenow (Roche, Suiza), se pudieron convertir los extremos cohesivos en extremos romos. Electroforesis del ADN Se llevó a cabo en geles de agarosa, preteñidos con bromuro de etidio (5 µl de bromuro de etidio a una concentración de 0,325 mg mL-1 por cada 50 mL de agarosa), a una concentración variable desde el 0,8% (m/v) hasta el 2% en tampón TAE 0,5X, dependiendo del peso molecular de los fragmentos que se quisieron separar. Las muestras de ADN mezcladas con el tampón de carga se añadieron a los pocillos del gel (Tabla 17). Como patrones de referencia se usaron diferentes marcadores de peso molecular, como el ADN del fago λ digerido con la enzima de restricción HindIII o marcadores tipo escalera de 100 pb o de 1 kb (Bioline, Reino Unido). La electroforesis se realizó en cubetas Mupid-One (Advance, Japón) a 100 V utilizando tampón TAE (Tabla 17). Las bandas se visualizaron en un transiluminador de luz UV. Las imágenes se capturaron mediante el aparato de captación de imágenes Gel DocTM XR+ (Bio- 58 Material y Métodos Rad, EEUU) y se analizaron con el programa informático Image LabTM (Bio-Rad, EEUU). Tabla 17 – Soluciones empleadas en la electroforesis del ADN. Soluciones empleadas Composición soluciones Tampón TAE Tris-HCl 30 mM, 0,002% (v/v) EDTA 0,5 M pH 8, ácido acético glacial 0,00114% (v/v). Ajustar el pH a 8 Tampón de carga Azul de bromofenol 0,25% (m/v), xileno cianol FF 0,25% (m/v), glicerol 30% (v/v) Aislamiento del ADN de geles de agarosa Para purificar fragmentos de ADN de un gel de agarosa se cortó la porción de gel que contenía la banda de interés y se purificó mediante el kit Wizard® SV Gel and PCR Clean-Up System (Promega, EEUU) siguiendo las instrucciones del fabricante. Desfosforilación del ADN La desfosforilación del ADN se realiza para reducir la autoligación de vectores linealizados tras la restricción con una enzima. Tras la digestión enzimática, se añadió a la mezcla de reacción la enzima fosfatasa alcalina (Roche, Suiza) y se incubó la reacción durante 30 minutos a 37 °C. A continuación, se inactivó la enzima añadiendo ácido etilén-glicol tetraacético (EGTA) 0,2 M pH 9,0 a la mezcla de reacción en una proporción 1:10 (v/v). También se puede inactivar la enzima incubando la mezcla durante 15 minutos a 65 °C. Por último, el ADN se purificó mediante el kit Wizard® SV Gel and PCR Clean-Up System (Promega, EEUU) siguiendo las instrucciones del fabricante. 59 Material y Métodos Ligación del ADN Para clonar un fragmento de ADN en un vector, las moléculas de ADN ya digeridas con la(s) enzima(s) de restricción adecuada(s) se purificaron mediante el kit Wizard® SV Gel and PCR Clean-Up System (Promega, EEUU). Para ello, se mezclaron en las proporciones adecuadas (habitualmente en proporción 1:3 vector:inserto), se les añadió 1/10 del volumen final del tampón de ligación y 1 μL (1 U μl-1) de la ligasa del fago T4 (New England Biolabs, EEUU). La mezcla se incubó durante un mínimo de 4 horas a temperatura ambiente. Los productos de la reacción se utilizaron para transformar células competentes de E. coli mediante el método descrito anteriormente. Amplificación del ADN por PCR Según la fidelidad requerida de la secuencia a amplificar por PCR, se utilizaron las Taq polimerasas Q5 (alta fidelidad, New England Biolabs, EEUU) o GoTaq® Green Master Mix (PCR convencional, Promega, EEUU). En ambos casos, la reacción de PCR se realizó siguiendo el protocolo establecido por los fabricantes. Cuando se utilizó la enzima Q5, que no incluye los dNTPs en el vial, se añadieron éstos a partir de un stock de 10 mM de dNTPs mix de Bioline (Reino Unido). Para las reacciones de PCR se siguió el protocolo descrito por Saiki (1990). Los programas usados en cada caso siguen el siguiente esquema común: ▪ 1 - Desnaturalización del ADN a 95 °C durante 5 minutos. ▪ 2 - Desnaturalización del ADN a 95 °C durante 30 segundos. ▪ 3 - Unión de los cebadores al ADN de cadena simple a la temperatura recomendada por el fabricante (Tib Molbiol, Alemania) durante 30 segundos. ▪ 4 - Polimerización del ADN a 72 °C variando el tiempo de polimerización en función del tamaño del ADN a amplificar (1 minuto por kb). ▪ 5 - Repetición del ciclo de polimerización (desde el paso 2), 34 veces más. ▪ 6 - Polimerización del ADN a 72 °C durante 5 minutos. 60 Material y Métodos El volumen de la mezcla de reacción varió dependiendo del experimento. Como norma general, 20 μL de mezcla reacción contenían los cebadores usados a una concentración de 0,2 μM, dNTPs a 0,2 mM, tampón de PCR 1X y 0,1 U de Taq polimerasa. Para diseñar los cebadores se tuvo en cuenta que: ▪ La longitud fuera de alrededor de 20 nucleótidos. ▪ El porcentaje de G + C estuviera comprendido entre 55-65%. ▪ La temperatura de fusión (Tm) estuviera comprendida entre 55-65 °C. ▪ Los cebadores no aparearan entre sí. Hibridación ADN:ADN Se empleó un sistema no radiactivo que se basa en el marcaje de ADN con digoxigenina-UTP y la detección de los híbridos ADN:ADN-digoxigenina mediante enzimoinmunoensayo. Para esta detección se utilizó un anticuerpo conjugado (antidigoxigenina conjugado con la enzima fosfatasa alcalina). Las bandas de hibridación se visualizaron mediante una reacción colorimétrica en el mismo filtro de hibridación. En primer lugar, tras extraer el ADN total y tras la digestión con la(s) enzima(s) de restricción adecuada(s) se realizó la electroforesis en gel de agarosa donde se incluyó el marcador de peso molecular λ HindIII marcado con digoxigenina (Roche, Suiza). A continuación, el ADN del gel de agarosa se transfirió a filtros de nylon Hybond-N (Amersham Biosciences, Reino Unido). Para ello, el gel, inmediatamente después de la electroforesis, se sumergió en HCl 0,25 M durante 20 minutos con agitación suave. Posteriormente, se lavó con agua destilada y se mantuvo en una solución de desnaturalización durante 30 minutos en agitación. La transferencia del ADN a los filtros se realizó por presión durante aproximadamente 15 horas en presencia del tampón de transferencia alcalino. Transcurrido ese tiempo, los filtros se lavaron en SSC 2X durante 5 minutos. Finalmente, el ADN se fijó al filtro por exposición a la luz 61 Material y Métodos ultravioleta durante 2 minutos. La composición de la soluciones utilizadas se muestran en la Tabla 18. Tabla 18 – Soluciones empleadas en la hibridación ADN:ADN (I). Soluciones empleadas Composición soluciones SSC 20X NaCl 2,1 M, citrato de sodio 0,3 M. Ajustar el pH a 7 Solución de desnaturalización NaCl 1,5 M, NaOH 0,5 M Tampón de transferencia alcalino NaCl 1,5 M, NaOH 0,25 M El marcaje de la sonda se realizó mediante una PCR en la que se añadió a la mezcla normal de PCR 1 μL de dNTPs 10X que contenía UTP marcado con digoxigenina. A continuación, se procedió a la hibridación. Para ello, al filtro de nylon se le añadió la solución de pre-hibridación que contiene esperma de salmón (100 μg mL-1) previamente desnaturalizado por calor (95 °C durante 10 minutos y 5 minutos en hielo) (Tabla 19). El filtro se pre-hibridó con esta solución incubándolo de 2 a 6 horas a 42 °C. Transcurrido este tiempo, se retiró la solución de pre-hibridación y se añadió la sonda, previamente desnaturalizada por calor (95 °C durante 10 minutos y 5 minutos en hielo) y diluida en 2,5 mL de solución de pre-hibridación. El filtro se incubó con esta nueva solución durante toda la noche a 42 °C. Transcurrido este tiempo se lavó el filtro dos veces con una solución de SSC 2X, SDS 0,1% durante 5 minutos a temperatura ambiente. A continuación, se lavó otras dos veces con SSC 1X, SDS 0,1% durante 5 minutos a temperatura ambiente y, por último, se realizaron dos lavados más con SSC 0,1X, SDS 0,1% durante 15 minutos a 68 °C. Tabla 19 – Soluciones empleadas en la hibridación ADN:ADN (II). Soluciones empleadas Composición soluciones SSC 20X NaCl 2,1 M, citrato de sodio 0,3 M. Ajustar el pH a 7 SDS 20% SDS 200 g L-1 Solución de prehibridación 100 mL SSC 20X (v/v), 0,4 mL SDS 20% (m/v), 100 mL H2O destilada, 20 g de reactivo de bloqueo (Roche), 0,4 g N- laurilsarcosina 62 Material y Métodos Finalmente, se llevó a cabo la detección inmunológica. Después de realizar los lavados, el filtro se incubó durante 5 minutos en 100 mL de tampón 1 a temperatura ambiente y en agitación, para eliminar los restos de SDS. Posteriormente, los filtros se introdujeron en bolsas de hibridación junto con 10 mL de tampón 2 y se incubaron durante 90 minutos a temperatura ambiente con agitación suave. A continuación, se retiró el tampón 2 y se cambió por una nueva solución de tampón 2 que contenía el anticuerpo anti-digoxigenina en una proporción de 1:5000 (v/v). El filtro se incubó en esta solución durante 45 minutos a temperatura ambiente con agitación suave. Para eliminar el anticuerpo no fijado, el filtro se extrajo de las bolsas y se lavó dos veces durante 15 minutos en 100 mL de tampón 1 a temperatura ambiente con agitación. Finalmente, el filtro se equilibró en 50 mL de tampón 3 durante 5 minutos. Para visualizar el resultado se usó un método colorimétrico que consiste en introducir los filtros en bolsas de hibridación herméticamente selladas junto con una solución de revelado. Las bolsas se incubaron a temperatura ambiente y en oscuridad hasta que el resultado de la hibridación fuera claramente visible. Posteriormente, los filtros se lavaron con agua destilada y se secaron al aire. Las soluciones utilizadas se muestran en la Tabla 20. Tabla 20 – Soluciones empleadas en la hibridación ADN:ADN (III). Soluciones empleadas Composición soluciones Tampón 1 Tris-HCl 100 mM pH 8 y NaCl 150 mM Tampón 2 Reactivo de bloqueo al 2% (m/v) disuelto en tampón 1 Tampón 3 Tris-HCl 80 mM pH 9,5, NaCl 100 mM y MgCl2 50 mM Solución de revelado 66 μL de solución NBT (75 mg mL-1 de nitroazul tetrazolio en dimetilformamida al 70%), 66 μL de solución BCIP (50 mg mL-1 de 5-bromo-4-cloro-3-indolil fosfato en dimetilformamida al 100%) en 10 mL de tampón 3 Secuenciación del ADN y búsqueda de promotores La secuenciación del ADN se llevó a cabo en los servicios de secuenciación de la empresa STAB VIDA (Portugal). Para el análisis informático básico de las secuencias de ADN se empleó el programa de comparación de secuencias BLASTn disponible en la página web del NCBI. 63 Material y Métodos Para la búsqueda de secuencias consenso de las cajas de nodulación (NB) de los genes que pudieran estar regulados por NodD, se usó la aplicación fuzznuc del paquete de bioinformática EMBOSS. El patrón de búsqueda utilizado fue: AT[CT][CG][AG]N5[TC][GA][GA]ATN7AT[CT]CAAACAATC[GA]ATTTTNCN2AT. Las secuencias de ADN se alinearon usando el programa ClustalW y se modificaron con Boxshade en EMBnet. Mutagénesis Mutagénesis dirigida mediante inserción del interposón Ω En general, para mutar el gen diana con el interposón Ω (SpcR/StrR), se amplificó el gen de interés mediante PCR y se clonó en el plásmido pGEM-T Easy. A continuación, este plásmido se digirió con una o dos enzimas de restricción de interés, cuya diana/s se encuentra/n situada/s en el interior de la secuencia del gen a mutagenizar. El plásmido linealizado se ligó con un fragmento de 2 kb que contiene el interposón Ω digerido previamente con la/s mismas enzimas de restricción o con enzimas que generan extremos romos. Este interposón Ω fue obtenido a partir del plásmido pHP45Ω. Una vez interrumpido el gen diana, el fragmento que lo contiene se escindió de plásmido pGEM-T Easy usando las enzimas adecuadas y se clonó en el plásmido suicida en los rizobios pK18mob (KmR). Cuando fue de interés, antes de interrumpir el gen por medio del interposón Ω, este fragmento se clonó en pK18mob y ahí se interrumpió el gen con el interposón. Finalmente, el plásmido pK18mob con el gen mutado por inserción del interposón, se transfirió a la estirpe parental CIAT 899 mediante conjugación triparental. Posteriormente, se seleccionaron colonias SpcR/StrR y KmS que hubiesen integrado en la copia silvestre la copia mutante por doble recombinación homóloga. Los mutantes obtenidos se comprobaron por PCR y/o hibridación ADN-ADN. Los genes nodD2, nodD3, nodD4, nodD5 y nrcR, se mutaron siguiendo esta estrategia. Los cebadores utilizados para clonar y posteriormente mutar estos genes se muestran en la Tabla 21. 64 Material y Métodos A continuación se detalla la obtención de cada uno de los mutantes mediante inserción del interposón Ω: Para construir el mutante en el gen nodD2, se clonó un fragmento de 1450 pb en el plásmido pGEM-T Easy. Posteriormente, se cortó un fragmento EcoRI que contenía el gen nodD2 y se clonó en el plásmido pK18mob (KmR). El nuevo plásmido obtenido se cortó con la enzima PstI, que presenta un único punto de corte en la fase abierta de lectura del gen nodD2. Este corte se hizo romo utilizando el fragmento Klenow de la ADN polimerasa I, y en el mismo punto, se clonó un fragmento SmaI que contenía el interposón Ω (SpcR) procedente el plásmido pHP45Ω. El plásmido obtenido se transfirió por conjugación a R. tropici CIAT 899 y la homogenotización del gen se seleccionó buscando colonias resistentes a espectinomicina y sensibles a kanamicina. Para obtener el mutante en el gen nodD3, se clonó un fragmento de 1500 pb en el plásmido pGEM-T Easy. Este plásmido se cortó con SmaI, que presenta un único punto de corte en la fase abierta de lectura del gen nodD3. En este punto se insertó el interposón Ω (SpcR) procedente el plásmido pHP45Ω. Posteriormente, este plásmido se cortó con EcoRI, se seleccionó un fragmento de 3,5 kb que portaba el gen nodD3::Ω y se clonó en el plásmido pK18mob, que se cortó también con EcoRI. El plásmido obtenido se transfirió por conjugación a R. tropici CIAT 899 y la homogenotización del gen se seleccionó buscando colonias resistentes a espectinomicina y sensibles a kanamicina. En el caso del mutante en el gen nodD4, se clonó un fragmento de 1497 pb en el plásmido pGEM-T Easy. Posteriormente, se cortó un fragmento EcoRI que contenía el gen nodD4 y se clonó en el plásmido pK18mob (KmR). El nuevo plásmido obtenido se cortó con la enzima SalI, que presenta un único punto de corte en la fase abierta de lectura del gen nodD4. Este corte se hizo romo utilizando el fragmento Klenow de la ADN polimerasa I, y en el mismo punto se clonó un fragmento SmaI que contenía el interposón Ω (SpcR) procedente el plásmido pHP45Ω. El plásmido obtenido se 65 Material y Métodos transfirió por conjugación a R. tropici CIAT 899 y la homogenotización del gen se seleccionó buscando colonias resistentes a espectinomicina y sensibles a kanamicina. Para obtener el mutante en el gen nodD5, se clonó un fragmento de 1478 pb en el plásmido pGEM-T Easy. Posteriormente, se cortó un fragmento EcoRI que contenía el gen nodD5 y se clonó en el plásmido pK18mob (KmR). El nuevo plásmido obtenido se cortó con la enzima XhoI, que presenta un único punto de corte en la fase abierta de lectura del gen nodD5. Este corte se hizo romo utilizando el fragmento Klenow de la ADN polimerasa I, y en el mismo punto se clonó un fragmento SmaI que contenía el interposón Ω (SpcR) procedente el plásmido pHP45Ω. El plásmido obtenido se transfirió por conjugación a R. tropici CIAT 899 y la homogenotización del gen se seleccionó buscando colonias resistentes a espectinomicina y sensibles a kanamicina. Finalmente, para obtener el mutante en el gen nrcR, se clonó un fragmento de 962 pb en el plásmido pGEM-T Easy. Posteriormente, el plásmido se cortó con HindIII que presenta un único punto de corte en la fase abierta de lectura del gen nrcR, y en este punto se clonó el interposón Ω (SpcR) cortado con HindIII. A continuación, este plásmido se cortó con EcoRI, se seleccionó un fragmento de 2,9 kb que portaba el gen nrcR::Ω y se clonó en el plásmido pK18mob que se cortó también con EcoRI. El plásmido obtenido se transfirió por conjugación a R. tropici CIAT 899 y la homogenotización del gen se seleccionó buscando colonias resistentes a espectinomicina y sensibles a kanamicina. En todos los casos la homogenotización de la mutación en CIAT 899 se comprobó por PCR y/o hibridación. Tabla 21 - Cebadores utilizados en esta Tesis para mutagenizar genes por inserción del interposón Ω. Gen Primer Secuencia (5’-3’) Tm (° C) nodD2 nodD2 F GAATTGTGGAAAGTCCAATA 47,8 nodD2 nodD2 R CGCCTCCTGCAGAATTATCT 54,6 72 Material y Métodos Tabla 25 – Soluciones empleadas en el estudio de LPS (III). Soluciones empleadas Composición soluciones Solución de fijación Etanol 30%(v/v), ácido acético 10% (v/v) en agua destilada Solución de oxidación La misma composición que la solución de fijación, añadiendo además 0,7% (m/v) de peryodato sódico (NaIO4) Solución de tinción Nitrato de plata 0,1% (AgNO3) (m/v) en agua destilada Solución de revelado Carbonato sódico 3% (Na2CO3) (m/v), 0,035% de formaldehído al 37% (v/v) en agua destilada Ensayos de formación de biopelículas La medida de la capacidad de formación de biopelículas sobre superficies plásticas por parte de R. tropici CIAT 899 y sus mutantes se realizó por el método descrito por Margaret et al. (2013). Para ello, se crecieron los cultivos en los medios TY o B-, para comprobar si el tipo de medio podía también influenciar en la formación de la biopelícula. Cuando fue necesario, se añadió 300 mM NaCl o apigenina 3,7 µM. Una vez crecidas las bacterias, los cultivos se diluyeron hasta una D.O.600nm de 0,2 y se inocularon 100 μL de este cultivo en placas de 96 pocillos de poliestireno. Las placas se cerraron con una tapa estéril para prevenir la evaporación y se incubaron boca abajo a 28 °C durante 48 horas y sin agitación. El crecimiento bacteriano se cuantificó a través de la medida de la D.O.600nm al final del experimento. El contenido de los pocillos se retiró y se secó a temperatura ambiente para luego lavarlos 3 veces con solución salina estéril (NaCl 0,9%). Posteriormente, los pocillos se secaron a temperatura ambiente. Una vez secos, los pocillos se tiñeron con 100 μL de cristal violeta 0,1% durante 20 minutos a temperatura ambiente, se lavaron 3 veces con agua destilada y se secaron a temperatura ambiente. Por último, la cuantificación de la biopelícula formada se llevó a cabo por la adición de 100 μL de etanol al 96% en cada pocillo para solubilizar el cristal violeta y se calculó de la cantidad de colorante que se había unido mediante un lector de placas multipocillos a una D.O.570nm (Synergy HT; BioTek; EEUU). Cada experimento se llevó a cabo por triplicado y se analizaron 12 pocillos por tratamiento. 73 Material y Métodos Ensayos de detección de AHL Para la detección de las AHL producidas por las tres estirpes bacterianas, se llevaron a cabo ensayos de difusión en placa de Petri usando al biosensor A. tumefaciens NT1 (pZRL4) tal y como se describe en Cha et al. 1998. El método consistió en colocar cilindros metálicos de 0,8 cm de diámetro por 1 cm de altura previamente esterilizados en placas de Petri sobre las que se dejó solidificar medio YM con agar. Posteriormente, se añadió a cada placa 4 mL de agar de cobertera con 400 μL de cultivo crecido hasta fase estacionaria del biosensor A. tumefaciens NT1 (pZRL4) y 40 μL de X-Gal (20 mg mL-1). Después de solidificarse, se retiraron los cilindros metálicos y en cada pocillo se añadieron 200 μL de los sobrenadantes bacterianos obtenidos a partir de cultivos crecidos hasta la fase estacionaria durante al menos 6 días. Cuando fue necesario, se añadió 300 mM NaCl y/o apigenina 3,7 µM a los medios de cultivos. Las placas se incubaron 48 horas a 28 °C. Extracción, separación y detección de AHL mediante cromatografía en capa fina (TLC) La TLC (del inglés, Thin Layer Chromatography, TLC) se empleó para separar las diferentes AHL sintetizadas por las baterías. Para ello, se obtuvieron sobrenadantes de las bacterias crecidas durante 6 días en 15 mL de medio YM3 y se extrajeron con un volumen de diclorometano. Cuando fue necesario, se añadió 300 mM NaCl o apigenina 3,7 µM. Tras esto, se evaporó el diclorometano hasta sequedad a temperatura ambiente y el sedimento resultante se resuspendió en 150 μL de acetato de etilo acidificado (0,1% de ácido acético glacial). Para cada bacteria, se cargó un volumen adecuado que osciló entre 10 y 30 μL de muestra del concentrado en la TLC (HPTLC plates RP-18 F254S, Merck, Alemania) y se usó metanol:agua (60:40 v/v) como fase móvil. Por último, se dejó secar la cromatoplaca para evaporar todo el solvente. Tras la separación de las AHL mediante TLC, su detección se llevó a cabo siguiendo la metodología descrita por Cha et al. (1998). Se usaron, según el número de muestras 74 Material y Métodos cargadas, placas TLC de 10x10 cm o de 20x20 cm. Como biosensor para revelar las placas se utilizó A. tumefaciens NT1 (pZRL4). Según el tamaño de la plaza, se mezclaron 20 u 80 mL de YM3 1,2% de agar, 10 o 40 mL de cultivo del biosensor crecido hasta fase estacionaria y 40 o 160 μL de X-gal (40 mg mL-1). Finalmente, se vertió la mezcla sobre la placa TLC, que previamente fue colocada en placas de Petri cuadradas del tamaño adecuado. Se incubó durante 48 horas a 28 °C hasta la aparición de bandas azules correspondientes a las AHL. Como controles se utilizaron las AHL comerciales C6 y C8 (Sigma-Aldrich S.A, EEUU). Estas AHL se prepararon a una concentración de 50 µg mL-1 en acetato de etilo acidificado. De esta suspensión, se tomaron 5 µL y se resuspendieron en 200 µL de agua, que fue lo que se cargó en la TLC. Ensayos de movilidad en superficie y movilidad tipo swimming Los ensayos de movilidad en superficie y tipo swimming se llevaron a cabo en los medios TY y B- (complementado cuando es necesario con NaCl 300 mM o apigenina 3,7 μM) conteniendo 0,4% o 0,28% de agar (Bacto, Francia), respectivamente. Las estirpes para ensayar se cultivaron en 5 mL de medio TY en un agitador orbital (180 rpm) durante 96 horas a una temperatura de 28 °C. Cuando fue necesario, se añadió 300 mM NaCl y/o apigenina 3,7 µM. De estos cultivos, se inocularon 2 μL sobre el agar (movilidad de superficie) o dentro del agar (movilidad swimming). Las placas inoculadas se envolvieron con parafilm y se incubaron hasta 96 horas a 28 °C en posición vertical. Se midió el halo de movimiento cada 24 horas. Cada experimento se realizó tres veces con tres repeticiones cada vez. Cuantificación de la producción de ácido indolacético (AIA) Para cuantificar la cantidad de AIA de un cultivo, se cuantificó la producción de grupos indol según el método descrito por Patten y Glick (2002). Para ello, se crecieron las bacterias en medio TY suplementado con triptófano (1 g L-1) en un agitador orbital (180 rpm) durante 96 horas a una temperatura de 28 °C. Cuando fue necesario, se añadió 300 mM NaCl o apigenina 3,7 µM. El ensayo se realizó en placas de 96 pocillos 75 Material y Métodos utilizando el reactivo de Salkowski (Tabla 26) (Bric et al., 1991). En cada pocillo se pusieron 100 μL de reactivo de Salkowski y 100 μL del sobrenadante del cultivo en fase estacionaria de cada uno de los aislamientos. La reacción se mantuvo hasta la aparición del color rojizo (unos 30 minutos aproximadamente). Posteriormente, se midió la D.O.535nm. En paralelo se realizó una recta de calibrado con concentraciones conocidas de AIA, lo que permitió cuantificar el AIA producido por estas bacterias. Tabla 26 – Soluciones empleadas en el estudio de AIA. Soluciones empleadas Composición soluciones Reactivo Salkowski H2SO4 al 98% 150 mL, H2O destilada 250 mL y FeCl3 0,5 M 7,5 mL Cuantificación de la expresión de genes bacterianos por PCR cuantitativa Una de las estrategias seguidas para cuantificar la expresión de genes bacterianos fue realizar experimentos de PCR cuantitativa o qRT-PCR a partir de los ADNc previamente retrotranscritos a partir de ARNm de dichos genes. Para la extracción del ARN total, los cultivos de las estirpes de R. tropici CIAT 899 se sembraron en medio TY (suplementado con NaCl 300 mM o apigenina 3,7 μM cuando fue necesario), se incubaron a 28 °C y en agitación (180 rpm) durante 48 horas. La extracción del ARN bacteriano se realizó utilizando los kits High Pure RNA isolation kit (Roche, Suiza), siguiendo las instrucciones del fabricante. El ARN obtenido se cuantificó en un Nanodrop de Thermo Scientific NanoDrop (Thermo Fisher Scientific, EEUU). A continuación, se llevó a cabo la retrotranscripción utilizando el kit PrimeScript RT reagent (Takara, Japón) siguiendo las instrucciones del fabricante. El ADNc obtenido se utilizó como molde para llevar a cabo reacciones de qRT-PCR. Los cebadores utilizados se diseñaron teniendo en cuenta que la longitud del amplicón estuviera comprendida entre 140 y 180 pb (Tabla 27). Asimismo, para asegurar una 76 Material y Métodos eficiencia adecuada se eligieron amplicones que no mostrasen estructuras secundarias a la temperatura de apareamiento de los cebadores. Para realizar los ensayos de qRT-PCR se utilizó el kit FastStart SYBR Green Master (Roche, Suiza) a partir del ADNc obtenido y siguiendo las indicaciones del fabricante. La reacción se llevó a cabo en un termociclador LightCycler 480 II (Roche, Suiza). El volumen de la mezcla de reacción fue de 20 μL, que contenía los cebadores usados a una concentración de 0,3 μM y 5 μL de SYBR. Las condiciones programadas para llevar a cabo la reacción de PCR cuantitativa fueron las siguientes: ▪ Desnaturalización del ADN a 95 ºC durante 5 minutos. ▪ Desnaturalización del ADN a 95 ºC durante 5 minutos (40 ciclos). ▪ Unión de los cebadores al ADN de cadena simple a la temperatura recomendada por el fabricante durante 30 segundos (40 ciclos). ▪ Polimerización del ADN a 72 ºC durante 15 segundos (40 ciclos). ▪ Repetición a 72 ºC durante 5 minutos para que todas las hebras terminen de polimerizar. ▪ Melting Curve desde 60 ºC a 90 ºC para ver la afinidad de los cebadores al ADN diana. Para la obtención del valor expresión diferencial o Fold Change se usaron al menos tres muestras biológicas con tres réplicas cada una en cada condición. Con todo ello, se calculó el valor de expresión diferencial usando el método ΔΔCt (Pfaffl et al., 2002). Tabla 27 - Cebadores utilizados en los experimentos de qRT-PCR. Gen Primer Secuencia (5’-3’) Tm (° C) nodA1 qpcrnodA1-F TGATGCTAATGGTGTCGCGGC 60,4 nodA1 qpcrnodA1-R ATGCCCGATCCCCAATCCCT 61,3 nodB nodBqPCR-F ACAAGGTCGCCAATCACA 54,5 nodB nodBqPCR-R GCGCATATATTGCACCGA 53,1 nodC qpcrnodc_F ATCGCGGCAACTGTTGTTCCA 60,1 nodC qpcrnodc_R GCGGTCCGAGGTTCTGACCA 61,9 nodS nodSqPCR-F GTGCCAGAAGCGATTGAT 53,0 77 Material y Métodos Gen Primer Secuencia (5’-3’) Tm (° C) nodS nodSqPCR-R CTGCAACCACGATCAGAT 52,3 nodU nodUqPCR-F TTCGAAGAGCTCTACGAG 50,7 nodU nodUqPCR-R CTTATCCTCCAATCGGAC 49,3 nodI nodIqPCR-F AGCTGCTTGTCATGGATG 52,7 nodI nodIqPCR-R GAAGTGGGTGGTCAAGAT 51,7 nodJ nodJqPCR-F GCTGGGAAGCAATCCTAT 51,9 nodJ nodJqPCR-R CATAGTGGCGACGATCAA 52,0 nodH nodHqPCR-F GGGTCAGTGGCTGAAATT 52,6 nodH nodHqPCR-R TGCTCGGATCAAACGCAT 54,9 nodA2 qpcrnodA2-F GGGATTGTACGGGATACGCACCG 61,7 nodA2 qpcrnodA2-R CGTGCGGAAAAACCGTCACAGG 61,2 hsnT qPCRhsnT-F GGCCCGTGCTTGTCTATATG 55,7 hsnT qPCRhsnT-R CGGAGACGAGACATGACGTA 56,0 nodF qPCRnodF-F GACGAAATAACGACTGAG 47,5 nodF qPCRnodF-R TAAACTCGATGCCGATGT 52,1 nodE qPCRnodE-F GGCGGTGGATCAGATTAGAC 55,1 nodE qPCRnodE-R GCTTCCCAAGACTTCAGCAC 56,3 nodM nodM-F TTGCAATAGCGTAGGCAAGC 56,1 nodM nodM-R TGATGTCGCCTCCGAATTTC 55,3 y4wE rty4we-F TAGTGTTGGATGAGGCGT 52,9 y4wE rty4we-R CCTTCCGATAAGTTCAGGA 51,1 y4wF rt-y4wf-F CACCAGGCTGCTATGCGGAA 60,3 y4wF rt-y4wf-R GGGTCTACCTGTGGCAATCCA 59,2 RTCIAT899_PB01545 HP(NB5)-F TGAAACTTGAAGGAAGCGCG 56,1 RTCIAT899_PB01545 HP(NB5)-R TCGACGTGGCAAGGCATTAT 57,1 RTCIAT899_PC04980 Trans pC - F TGAAGAGAAGTTCGCCATGG 55,0 RTCIAT899_PC04980 Trans pC - R CGACATCGAGAACTGCTACA 54,3 RTCIAT899_CH06050 Trans Chr2 F GGCGATCTCTATCTGGTCAA 53,8 RTCIAT899_CH06050 Trans Chr2 R TTTGCCCGTAACGTCTTCCA 56,9 rpsL Trans Chr3 F GCAGGTAAAGCGTAACAAGG 54,0 rpsL Trans Chr3 R CGGGGATGTAACCAATGACT 54,6 RTCIAT899_CH14150 Trans Chr4 F AATCTTCAGCTGTTTCAGGT 53,5 RTCIAT899_CH14150 Trans Chr4 R ATGCGACCGTCTATGTCGAA 56,1 nodD2 nodD2qPCRF AAAGCGTCTGGCAAGGGAAG 58,1 nodD2 nodD2qPCRR TTTTCGTCGAACAGCTTCGC 56,2 fixC qPCR-FixC-F TCTCTCTTGGCATCGGTT 53,4 fixC qPCR-FixC-R CACCTTCGGGAATGAGAT 51,5 mtlD qPCR-MtlD-F CATGGTCGATCGTATCAC 49,9 78 Material y Métodos Gen Primer Secuencia (5’-3’) Tm (° C) mtlD qPCR-MtlD-R ACACCGACCTTTTCAAGC 53,1 nodA3 qPCRnodA3F CACATTGCAGAAGTTTCAA 48,7 nodA3 qPCRnodA3R GTGGCAGCGTAGATCGTACGCT 61,3 nifH qPCR-nifH-F CGTCATCACCTCCATCAACT 51,4 nifH qPCR-nifH-R TTCCTGGGCCTTGTTCTC 51,1 mtlE qPCR-MtlE-F ATCTGGAGCAAGCTCGGC 57,9 mtlE qPCR-MtlE-R ACATCACCATCGAGCTTTCG 55,2 16S 16S-F GGGCTGGTAAGGTTCTGCGC 61,3 16S 16S-R GGTGGCGCAGCTAACGCAT 61,4 Medida de la actividad β-galactosidasa La determinación de la actividad β-galactosidasa se emplea para cuantificar la expresión de un gen cuando el promotor dicho gen se fusiona con el gen lacZ o cuando se ha insertado un casete con una copia de lacZ carente de promotor dentro del gen en cuestión. Para medir esta actividad se siguió el método descrito por Miller (1972). Así, se inocularon tubos con 5 mL de YM3 líquido a partir de cultivos bacterianos en fase exponencial y se incubaron hasta alcanzar una D.O.660nm entre 0,15 y 0,3. Posteriormente, se mezclaron en un tubo 200 µL de cultivo, 800 µL de tampón Z, 20 µL de cloroformo y 10 µL de SDS 0,1% (m/v) en H2O destilada (Tabla 28). La mezcla se agitó en vórtex durante 15 segundos y se añadió 200 µL de ONPG (orto-nitrofenil- β-d-galactopiranósido) preparado a una concentración de 4 mg mL-1 en tampón Z. La mezcla se incubó durante 5 minutos a temperatura ambiente. La reacción se detuvo añadiendo 500 µL de Na2CO3 1 M a la reacción. Por último, se cuantificó la D.O.420nm de cada tubo. Los experimentos se realizaron por triplicado incluyendo al menos tres réplicas en cada ensayo. Las unidades de actividad β-galactosidasa se calcularon siguiendo la fórmula descrita en Miller (1972). Tabla 28 – Soluciones empleadas en la medida de actividad β-galactosidasa. Soluciones empleadas Composición soluciones Tampón Z Na2HPO4 7 H2O 104 mM, NaH2PO4 H2O 45 mM, KCl 10 mM, MgSO4 7 H2O 1 mM Completar hasta 1 L y ajustar el pH a 7,0. 79 Material y Métodos Estudios de ARNseq En primer lugar, se llevó a cabo la extracción de ARN total siguiendo la misma metodología empleada anteriormente. Se extrajeron hasta dos muestras independientes por cada condición. Para ello, los cultivos se crecieron en 7 mL de medio TY durante 48 horas a 28 °C en agitación orbital a 180 rpm. Cuando fue necesario, se añadieron los diferentes inductores de los genes nod (NaCl 300 mM, apigenina 3,7 µM o manitol 400 mM). A continuación, el ARN ribosómico (ARNr) se eliminó usando el kit MICROB Express Bacterial mRNA Purification (Ambion, EEUU) siguiendo las instrucciones del fabricante. La secuenciación del ADNc se llevó a cabo por la empresa Sistemas Genómicos (España), mediante el uso de la tecnología Next Generation Sequencing (NGS) platform Illumina (EEUU) y el secuenciador Illumina HiSeq 2000 (Illumina, EEUU). Las muestras de ARNm se usaron para generar librerías de ADNc completas a partir de los transcriptomas siguiendo las instrucciones del fabricante para la secuenciación mediante la plataforma NGS. La calidad del ADNc se analizó mediante el kit Bioanalyzer 2100 DNA 1000 (Agilent Technologies, EEUU) y se cuantificó usando un fluorómetro Qubit 2.0 (Invitrogen, EEUU). Mapeo de los datos de las transcriptómicas Las lecturas obtenidas por la secuenciación del transcriptoma completo se mapearon frente al genoma de R. tropici CIAT 899 (ID del Genoma en NCIB: 11072) usando el algoritmo Life Technologies mapping versión 1.3 (EEUU). Las lecturas de baja calidad se eliminaron usando el software Picard Tools version 1.83. 80 Material y Métodos Estimación de los genes diferencialmente expresados La predicción génica se estimó usando el método cufflinks (Trapnell et al., 2010) y los niveles de expresión se calcularon usando el software htseq versión 0.5.4p3 (Anders y Huber, 2010). Este método elimina las lecturas multi-mapeadas considerando para la expresión génica solamente las lecturas únicas. El método edge versión 3.2.4 se aplicó para el análisis de la expresión diferencial entre las condiciones (Robinson et al., 2010). Este método usa un modelo de Poisson para estimar la varianza de los datos de la transcriptómica para la expresión diferencial y depende de diferentes procesos de normalización basados en la rigidez de las muestras, la composición en G+C,y la longitud de los genes. La expresión diferencial de los genes se obtuvo comparando los valores obtenidos en las diferentes estirpes y condiciones respecto a aquellos datos obtenidos para las estirpes CIAT 899 en condiciones control (TY). Los genes diferencialmente expresados para la estirpe CIAT 899, RSP82, nodD2::Ω y ∆araC en presencia de 300 mM de NaCl o 3,7 µM de apigenina se definieron como aquellos genes que presentaron una expresión de cuatro veces más (expresados) o cuatro veces menos (reprimidos) que la expresión detectada en la condición control (Fold change de ± 4), y con un valor de p adjust inferior a 0,7. En cuanto a los estudios transcriptómicos llevados a cabo en presencia de 400 mM de manitol (estirpes CIAT 899 y nodD2::Ω), los genes diferencialmente expresados se definieron como aquellos genes con un Fold change de ± 2,5 y con un valor de p adjust inferior a 0,05. Los diferentes niveles de Fold change seleccionados en los diferentes estudios de ARNseq, se establecieron en base a los valores de expresión diferencial esperados en ciertos genes determinados en estudios previos y en base a las variaciones de expresión de genes entre muestras biológicas. Purificación y análisis por cromatografía líquida asociada a espectrometría de masas de los FN Los estudios de cromatografía líquida asociada a espectrometría de masas (del inglés, Liquid Chromatography–Mass Spectrometry, LC-MS/MS) se llevaron a cabo con la ayuda del grupo del Profesor Antonio Gil Serrano del Departamento de Química 81 Material y Métodos Orgánica de la Universidad de Sevilla. Para el aislamiento y purificación de los FN de las estirpes de interés, se siguió el método descrito en Guasch-Vidal et al. (2013): ▪ Se inocularon tubos con 5 mL de cultivo en medio TY de la bacteria a estudiar. Se dejan creciendo 48 horas en agitación (180 rpm) a 28 °C. ▪ De los cultivos anteriores, se inocularon 2,5 mL en 100 mL de medio mínimo (B-) en las condiciones adecuadas. Estos cultivos se dejaron creciendo durante 72 horas en agitación (180 rpm) a 28 °C. A continuación, los 100 mL de los cultivos crecidos se usaron para inocular matraces que contenían 900 mL del mismo medio, que se dejaron creciendo hasta alcanzar la fase exponencial tardía (4 días) en agitación (180 rpm) a 28 °C. ▪ Las células se retiraron por centrifugación a 10.000 g durante 10 minutos, y al sobrenadante se le añadieron 300 mL de n-butanol. ▪ La mezcla se mantuvo en agitación durante 12 horas y posteriormente, se dejó en reposo, al menos, 24 horas más hasta observar una buena separación de las fases acuosa y butanólica. ▪ Finalmente, se recogió la fase butanólica (superior), que contiene los FN, que se llevó a sequedad en un rotavapor a 45 °C. La purificación de los FN para su posterior análisis mediante cromatografía líquida de alta presión asociada a espectrometría de masas (del inglés, High-Performance Liquid Chromatography Mass Spectrometry, HPLC MS/MS) se realizó utilizando un cartucho de extracción en fase sólida (SPE C18 Resprep, Teknokroma, España). El cartucho se acondicionó con 2 mL de metanol y 2 mL de una disolución de acetonitrilo al 20% en H2O (v/v). Seguidamente, la muestra se pasó a través del relleno por aspiración a un flujo aproximado de 5 mL min-1. Las sales y otras moléculas muy polares se eliminaron por elución con una disolución acuosa de acetonitrilo al 20% (v/v). Finalmente, se utilizaron 5 mL de metanol para eluir selectivamente los FN de la columna. La fracción metanólica obtenida se concentró, se liofilizó y se resuspendió en 1 mL de acetonitrilo al 20% en H2O (v/v). 88 Resultados 89 Resultados RESULTADOS 90 Resultados 91 Resultados Análisis transcriptómico de R. tropici CIAT 899 en presencia de flavonoides y estrés osmótico Antecedentes R. tropici CIAT 899 es una estirpe de rizobio que se caracteriza por su capacidad para producir FN en presencia de estrés osmótico (NaCl) (Estévez et al., 2009; Guasch- Vidal et al., 2013). No obstante, se desconoce por qué una alta concentración de NaCl (300 mM NaCl) induce la síntesis de FN en esta bacteria. En la presente Tesis Doctoral, se quiso comprobar en primer lugar, si otro estrés osmótico diferente al estrés salino induce también la síntesis de FN en este rizobio. Teniendo en cuenta que se conoce el genoma de CIAT 899 desde el año 2012 (Ormeño-Orillo et al., 2012) parecía interesante, también de cara a los estudios transcriptómicos que se pretendían abordar, identificar las NB presentes en el genoma de la bacteria. Así, con las herramientas que se describen en Material y Métodos, se detectaron hasta 10 NB diferentes, todas ellas localizadas en el plásmido simbiótico (Figura 12). Estas NB mostraron este patrón consenso: ATN11ATN7ATN2AN4ATN2ATTNTN7. Los genes localizados aguas debajo de estas NB fueron: ▪ NB1: nodA1BCSUIJHPQ. ▪ NB2: nodA2hsnTnodFE. ▪ NB3: nodM. ▪ NB4: y4wEF. ▪ NB5: RTCIAT899_PB01550 y RTCIAT899_PB01545. ▪ NB6: RTCIAT899_PB00370 y RTCIAT899_PB00375. ▪ NB7: RTCIAT899_PB01055. ▪ NB8: RTCIAT899_PB00495. ▪ NB9: nodD2. ▪ NB10: RTCIAT899_PB00540. 92 Resultados Figura 12 – Alineación de las secuencias correspondientes a las NB de R. tropici CIAT 899. Los residuos marcados con negro y gris indican nucleótidos idénticos y similares. respectivamente. En el consensus se marcan los nucleótidos altamente conservados en las diez NB. Expresión de los genes de nod en presencia de diferentes estreses osmóticos Una forma sencilla y rápida de comprobar la expresión de los genes nod es midiendo la actividad β-galactosidasa de CIAT 899 portando el plásmido pMP240 en las diferentes condiciones que se quieran estudiar. Este plásmido porta el promotor conservado del gen nodA de R. leguminosarum bv. viciae clonado aguas arriba del gen lacZ carente de su propio promotor de forma que, la expresión de la enzima βgalactosidasa codificada por el gen lacZ, depende de la actividad del promotor del gen nodA. Una vez transferido por conjugación este plásmido a CIAT 899, se realizaron ensayos de actividad β-galactosidasa en presencia de diferentes condiciones, entre las que se incluyeron tres condiciones de estrés osmótico (una condición de estrés iónico: NaCl, y dos de estrés no iónico: manitol y sacarosa) y otra condición control, en presencia de apigenina, el flavonoide inductor de los genes nod de CIAT 899. Las concentraciones de las distintas sustancias se muestran en la siguiente Tabla 31. Tabla 31 – Condiciones utilizadas en los ensayos de β-galactosidasa utilizando la estirpe R. tropici CIAT 899 (pMP240). Medio utilizado Condición Observaciones YM3 NaCl 300 mM Estrés osmótico iónico YM3 Manitol 400 mM Estrés osmótico no iónico NB1 1 CATTCAAGATGTGGATGGTTGCCATCCAAACAATCAATTTTACCGATTC-- NB2 1 CATTCATCGCATGGATGCGCCACATCCAAATAATCGATTTTACGAATTA-- NB3 1 AATCCATGACGTAAATGGGTGCGATCCAAAGAATCGATTTTTCCAATAA-- NB4 1 CATCCGACATTTGGATGAGTCCTATTAAATCAATCGATTATCCCGATGG-- NB5 1 TATCCATATCGTAAATAAGCGTTATCTAAACAATAAATT-TGCAAACGAA- NB6 1 CATCCATTGCTTAGATCATTGCGATCCAACCAATCAATTTTACCGATCT-- NB7 1 AATTGATGCCGTGGATGTGTGCTATTCAAACAATCGATTTTGCGAATTG-- NB8 1 CATGCCGGCCGCGAATTGTATTCATTCAAACAATCAATTTTACGCAGCG-- NB9 1 AATCGATTGTTTGAATAGCACACATCCACGGCATCAATT-TACACGCTAA- NB10 1 CATTTGCGAAACGAATTGGTCTTATCCAAACAATCGATTTT--CAATCGCC consensus 1 .**...........**...... **..*....**..***.*...... . 93 Resultados Medio utilizado Condición Observaciones YM3 Sacarosa 400 mM Estrés osmótico no iónico YM3 Apigenina 3.7 μM Flavonoide inductor de los genes nod Los resultados obtenidos en estos ensayos de β-galactosidasa mostraron que, además de la ya conocida activación de los genes nod que se produce en presencia de apigenina y estrés salino, en presencia de manitol y sacarosa (estreses osmóticos no iónicos) los niveles de activación de los genes nod son significativamente superiores a las condiciones control sin inducir (Figura 13). De hecho, los niveles de actividad β-galactosidasa son similares en las condiciones de estrés por manitol, estrés salino y apigenina, mientras que, en presencia de sacarosa, aunque los niveles son superiores a los observados en condiciones control, no alcanzaron los niveles de inducción observados en el resto de los tratamientos. Figura 13 – Ensayos de actividad β-galactosidasa en la estirpe R. tropici CIAT 899 (pMP240) en condiciones control (YM3), apigenina (3,7 µM), NaCl (300 mM), manitol (400 mM) y sacarosa (400 mM). Todos los tratamientos se compararon con los datos obtenidos en el tratamiento control mediante el test no paramétrico de Mann-Whitney. Los valores marcados con * son significativamente diferentes al nivel α = 5%. 94 Resultados Estos resultados de actividad β-galactosidasa indicaron que, además del flavonoide apigenina y del estrés salino, otros estreses osmóticos incluidos los no-iónicos (manitol y sacarosa), podrían estar activando la expresión de los genes nod y por tanto la producción de FN en R. tropici CIAT 899. Estudios transcriptómicos globales mediante ARNseq Con el objetivo de profundizar en el estudio de la expresión diferencial de los genes simbióticos en aquellas condiciones donde se observaron niveles altos de actividad βgalactosidasa en R. tropici CIAT 899, se realizaron estudios transcriptómicos globales mediante ARNseq. Las condiciones para llevar a cabo estos estudios se eligieron en base a los resultados obtenidos en los ensayos de actividad β-galactosidasa del apartado anterior (Figura 13): ▪ Control (TY). ▪ Apigenina (TY + 3,7 µM apigenina). ▪ Estrés osmótico iónico (TY + 300 mM NaCl) ▪ Estrés osmótico no iónico (TY + 400 mM manitol) Tal y como se describe en el apartado de Material y Métodos, se realizaron dos extracciones de ARN independientes por cada condición. Así, se extrajo el ARN total de las diferentes muestras y a continuación se purificó el ARNm. Las muestras se enviaron a la empresa Sistemas Genómicos SL (España) la cual llevó a cabo la secuenciación y los análisis bioinformáticos. Todos los resultados en número de transcritos se compararon uno a uno con las condiciones control sin inducir (medio TY). Los resultados obtenidos en este estudio transcriptómico mostraron que, de los 6289 genes presentes en el genoma de CIAT 899, solo 19 genes se expresaron diferencialmente en presencia de flavonoide apigenina (0,3% del total). Sin embargo, 790 genes se expresaron diferencialmente bajo 300 mM de NaCl (12,5% del total). Para considerar que un gen se expresó diferencialmente se eligió un umbral de ± 4 95 Resultados veces de expresión (o Fold change) con respecto al control sin inducir. Por otra parte, en el caso de los estudios de ARNseq en presencia de manitol, el umbral elegido para considerar a un gen diferencialmente diferenciado fue de ± 2.5 veces de expresión. En este contexto, en presencia de 400 mM de manitol se expresaron diferencialmente 743 genes, lo que supone un 11,8% de los genes totales de la bacteria. No es de extrañar el elevado número de genes diferencialmente expresados en condiciones de estrés osmótico, ya que la expresión diferencial de la mayoría de estos genes estuvo relacionada con la adaptación del rizobio tolerar el estrés osmótico en cuestión. No obstante, el número de genes diferencialmente expresados en presencia de flavonoide apigenina fue menor al observado en otros rizobios, como por ejemplo en la estirpe S. fredii HH103 (Pérez-Montaño et al., 2016b), indicando que, en un principio, la maquinaria simbiótica de CIAT 899 en respuesta a flavonoide podría estar controlada bajo un número limitado de genes. Validación de datos de transcriptómica por qRT-PCR. Para validar los datos de expresión diferencial obtenidos mediante ARNseq, se realizaron ensayos de qRT-PCR de determinados genes en las diferentes condiciones de estudio, y se compararon con los valores obtenidos en los ARNseq (Figura 14). Así, se seleccionaron en condiciones de presencia de apigenina y estrés salino hasta 19 genes (araC1, rpsL, araC2, y4wE, y4wF, nodA2, hsnT, nodF, nodE, nodA1, nodB, nodC, nodS, nodU, nodI, nodJ, nodH, RTCIAT899_PB01545, nodM, RTCIAT899_PC04980) para cada una las condiciones, mientras que bajo estrés osmótico por manitol se seleccionaron siete genes (fixC, mtlD, nodA3, nodF, nifH, nodA2, mtlE). En las tres condiciones, los valores obtenidos por ARNseq presentaron correlación positiva con los valores obtenidos en los ensayos de qRT-PCR, dando validez a los estudios transcriptómicos realizados. 96 Resultados Figura 14 – Niveles de correlación entre los experimentos de ARNseq y qRT-PCR en las condiciones de apigenina (A), NaCl (B) y manitol (C). Se validaron para cada condición los genes indicados en la figura. Transcriptómica de R. tropici CIAT 899 en presencia del flavonoide apigenina. Tras la secuenciación del ADNc, los resultados mostraron que un total de 19 genes se expresaron diferencialmente (0,3% del genoma total) en presencia de apigenina. De estos 19 genes, 15 de ellos estaban localizados en el plásmido simbiótico (pRtrCIAT899b). Los otros cuatro genes, que se reprimieron, dos se localizan en el 97 Resultados cromosoma de la bacteria, uno en el plásmido pRtrCIAT899a y otro en el plásmido pRtrCIAT899c (Tabla 32). De los 19 genes expresados diferencialmente, diez eran genes nod que se activaron diferencialmente en presencia de apigenina. En cambio, la expresión de los otros diez genes de nodulación (nodD1-nodD5, nodH, nodP, nodQ, nodA3 y nodM) no alcanzó el umbral de expresión significativa determinado para este estudio (± 4). Por otro lado, el gen y4wE, relacionado con la síntesis de la fitohormona ácido indolacético y que está precedido por la NB4, se indujo significativamente. Además, también se observó que otros dos genes que codifican para proteínas hipotéticas (RTCIAT899_PB01550 y RTCIAT899_PB01545) y que están precedidos por la NB5 se indujeron diferencialmente. Por lo tanto, de las diez NB identificadas en CIAT 899, las NB1, NB2, NB4 y NB5 (cuatro de un total de diez) se activaron en presencia de flavonoide apigenina. Tabla 32 – Genes nod o regulados por una NB de R. tropici CIAT 899 diferencialmente expresados (± 4) en 3,7 µM de apigenina con respecto al control. Número de acceso NCBI Gen NB Inducción apigenina Función Replicón RTCIAT899_PB01300 nodA1 NB1 8,73 Síntesis FN pB RTCIAT899_PB01305 nodB NB1 11,4 Síntesis FN pB RTCIAT899_PB01310 nodC NB1 6,69 Síntesis FN pB RTCIAT899_PB01315 nodS NB1 7,53 Síntesis FN pB RTCIAT899_PB01320 nodU NB1 5,39 Síntesis FN pB RTCIAT899_PB01325 nodI NB1 6,59 Síntesis FN pB RTCIAT899_PB01330 nodJ NB1 4,98 Síntesis FN pB RTCIAT899_PB01095 nodA2 NB2 10,3 Síntesis FN pB RTCIAT899_PB01110 hsnT NB2 7,27 Desconocida pB RTCIAT899_PB01115 nodF NB2 13,39 Síntesis FN pB RTCIAT899_PB01120 nodE NB2 10,37 Síntesis FN pB RTCIAT899_PB00575 y4wE NB4 8,58 Síntesis AIA pB RTCIAT899_PB01550 NB5 6,75 Desconocida pB RTCIAT899_PB01545 NB5 4,26 Desconocida pB RTCIAT899_PB00585 7,18 Desconocida pB RTCIAT899_CH01400 -5,41 Desconocida Cromosoma RTCIAT899_CH01520 -7,75 Desconocida Cromosoma 104 Resultados número de genes que codifican para componentes de transportadores del tipo ABC (del inglés Atp Binding Cassette), como por ejemplo la familia de genes phN. Esto indica que CIAT 899 podría acumular osmolitos compatibles para tolerar el estrés salino. Sin embargo, también se observó que se activaron los genes thuAB implicados en el catabolismo de la trehalosa, un osmolito compatible en CIAT 899 (Fernández- Aunión et al., 2010). Figura 16 – Principales procesos regulados diferencialmente en R. tropici CIAT 899 según los datos transcriptómicos llevados a cabo en condiciones de 300 mM de NaCl. En rojo se muestran los procesos reprimidos y en negro los activados. Procesos regulados en presencia de estrés osmótico no-iónico (manitol) Tal y como se comentó anteriormente, y a diferencia de lo que ocurre en presencia de estrés salino, en presencia de estrés osmótico no-iónico por manitol se observó que muchos genes relacionados con la fijación de nitrógeno (18 genes que codifican para componentes de la nitrogenasa, ferredoxinas y flavoproteínas) se activaron diferencialmente (Tabla 34). No obstante, en cuanto a los genes nod, solo cinco se expresaron diferencialmente con respecto a las condiciones control. 105 Resultados Además, otros procesos bacterianos se activaron o se reprimieron en presencia de este estrés osmótico. Por un lado, los genes relacionados con la movilidad, tanto de la síntesis de flagelo (genes flg y fli), movilidad del flagelo (genes mot), formación de los pili de tipo IV (cpaEF y pilZ) y quimiotaxis (cheA) también se inhibieron bajo estrés osmótico por manitol (Figura 17). Por otra parte, se reprimieron los genes relacionados con la exportación de los KPS (kpsCE) y la síntesis de EPS (exoZ), mientras que el gen que codifica para el inhibidor de la síntesis de polisacáridos (psiB) se activó. De manera específica, en estas condiciones de estrés osmótico no iónico, el gen ndvA, que está relacionado con la síntesis y transporte de los glucanos cíclicos (β-1,2), se activó. Por otro lado, tal y como ocurría bajo estrés salino, se activaron genes que codifican para las subunidades de los ribosomas (familia de genes rpl y rps) y para las subunidades de las ATP sintasas (familia de genes atp), indicando que CIAT 899 también induce su metabolismo para sintetizar nuevas proteínas y poder obtener energía en forma de ATP, lo que ayudaría a tolerar el estrés. De nuevo, se inhibieron un gran número de genes que codifican para componentes de transportadores del tipo ABC, lo que parece indicar que CIAT 899 también podría acumular osmolitos compatibles para tolerar el estrés osmótico no iónico. Figura 17 – Principales procesos regulados diferencialmente en R. tropici CIAT 899 según los datos transcriptómicos llevados a cabo en condiciones de 400 mM de manitol. En rojo se muestran los procesos reprimidos y en negro los activados. 106 Resultados De igual manera que con el estrés salino, se activaron los genes que codifican para las proteínas que catabolizan la trehalosa (thuAB). Sin embargo, para tolerar el estrés osmótico CIAT 899 podría estar también acumulando glicerol, ya que se reprimió el gen glpD responsable del catabolismo de este compuesto. Además, tal y como se esperaba, en estas condiciones de estrés osmótico por altas concentraciones de manitol, se activaron genes relacionados con la importación y catabolismo del manitol, como los genes mtlD y mtlE. Por último, también llama la atención que, a diferencia del estrés salino, los genes que codifican para distintas chaperonas (groEL, groES, dnaJ, grpE y htpG) se activaron diferencialmente en este tipo de estrés, lo que indicaría que bajo estrés las chaperonas estarían manteniendo el plegamiento adecuado de las proteínas de esta bacteria. 107 Resultados Estudio del papel simbiótico de los cinco reguladores NodD de R. tropici CIAT 899. Antecedentes La secuenciación del genoma de R. tropici CIAT 899 mostró la presencia de hasta cinco reguladores transcripcionales NodD, característica atípica en el resto de los rizobios (Ormeño-Orrillo et al., 2012). Por esto, se decidió estudiar el papel de las cinco copias del gen nodD y comprobar si alguna de ellas es responsable de la activación de los genes nod en presencia de estrés osmótico. Para ello, se decidió obtener, mediante mutagénesis dirigida utilizando el interposón Ω, mutantes en cada una de las copias del gen nodD presentes en el plásmido simbiótico de CIAT 899. En estudios previos realizados por nuestro grupo de investigación se había obtenido un mutante por inserción del gen nodD1 (estirpe RSP82), que era incapaz de producir FN en presencia de apigenina, y sí lo hacía en presencia de estrés salino (Guasch-Vidal et al., 2013), lo que indicaba que NodD1 es responsable de la activación de los genes nod en presencia de flavonoides exclusivamente. Por tanto, se abordó la obtención de los mutantes en los genes nodD2, nodD3, nodD4 y nodD5. Obtención de mutantes Brevemente, para la obtención de estos mutantes se amplificaron por PCR las correspondientes secuencias génicas utilizando para ello dos cebadores externos a cada gen (ver Material y Métodos). A continuación, las secuencias amplificadas se clonaron en el vector pGEM-T Easy y, posteriormente, se clonó el interposón Ω en puntos de corte únicos de cada gen nodD, para de esta forma interrumpir la fase de lectura abierta de cada gen nodD. Una vez obtenidas estas construcciones, se clonaron las mismas en el plásmido pK18mob, un plásmido no replicable en CIAT 899, por lo que podemos seleccionar procesos de doble recombinación homóloga en los que se sustituye la copia silvestre del gen de CIAT 899 por la copia interrumpida por el interposón Ω. Esta copia es seleccionable porque el interposón porta un gen de resistencia a espectinomicina. Como se ha descrito en Material y Métodos, para 108 Resultados seleccionar copias con el interposón integrado en el gen y que no contenga el plásmido también integrado, se seleccionan colonias resistentes a espectinomicina y sensibles a kanamacina, gen de resistencia presente en el plásmido. Finalmente, la integración del interposón en cada una de las estirpes mutantes se confirmaron tanto por PCR como por experimentos de hibridación ADN-ADN. En la Figura 18 se muestra la comprobación por PCR e hibridación del mutante nodD3::Ω. Figura 18 – Ejemplo de comprobación por PCR e hibridación del mutante nodD3::Ω en R. tropici CIAT 899. En la hibridación, el ADN extraído del mutante nodD3::Ω fue digerido con la enzima de restricción EcoRI. NodD1 y NodD2 activan el promotor del gen nodA de R. leguminosarum bv. viciae en presencia de apigenina y estrés osmótico, respectivamente Ya que el regulador transcripcional NodD regula la transcripción de los genes nod, el objetivo de este apartado fue estudiar la activación de los genes nod en el fondo mutante de los distintos genes nodD de CIAT 899, todo ello en presencia de apigenina, estrés salino (estrés osmótico iónico) y estrés por manitol (no iónico). 109 Resultados Por consiguiente, se quiso estudiar si el promotor de los genes de nodulación (pnodA) se activa o no en estos mutantes en estas condiciones. Para ello, se utilizó la estirpe CIAT 899 (pMP240) y las estirpes mutantes en los genes nodD que portaban, por conjugación triparental, el plásmido pMP240. A continuación, se realizaron ensayos de β-galactosidasa de CIAT 899 (pMP240) y sus derivados en las siguientes condiciones: control, apigenina, estrés salino (estrés osmótico iónico) y estrés por manitol (estrés osmótico no-iónico) (Figura 19). Figura 19 – Ensayos de actividad β-galactosidasa en la estirpe R. tropici CIAT 899 (pMP240) y los diferentes mutantes en los genes nodD (pMP240) en condiciones control (YM3, barras azules), apigenina 3,7 µM (barras rojas), NaCl 300 mM (barras grises) y manitol 400 mM (barras amarillas). Todos los tratamientos se compararon con los datos obtenidos en el tratamiento de CIAT 899 (pMP240) control mediante el test no paramétrico de Mann-Whitney. Los valores con * son significativamente diferentes a nivel α = 5%. En el apartado anterior, se observó en la Figura 13 que los niveles de actividad βgalactosidasa en la estirpe silvestre son significativamente superiores en presencia de apigenina, estrés salino y estrés por manitol, en comparación con las condiciones control. En el presente ensayo, los resultados mostraron que los niveles de actividad de la estirpe RSP82 (mutante en nodD1) en presencia de apigenina son similares a los obtenidos en las condiciones control sin inducir, mientras que, en presencia de estrés osmótico, la actividad no varió con respecto a la estirpe parental (Figura 19). 110 Resultados Por otra parte, la estirpe nodD2::Ω (pMP240) presentó niveles de actividad similares a las condiciones control sin inducir en presencia de estrés osmótico, mientras que la actividad β-galactosidasa en presencia de apigenina fue similar a la de la estirpe silvestre. Estos resultados mostraron que la proteína NodD1 es la responsable de la activación de los genes nod en presencia de flavonoide apigenina, y la proteína NodD2 la responsable de la activación de los genes nod en presencia de estrés osmótico iónico o no iónico. Finalmente, las estirpes nodD3::Ω, nodD4::Ω y nodD5::Ω no produjeron cambios significativos en los niveles de actividad β-galactosidasa con respecto a la estirpe silvestre en todas las condiciones ensayadas, por lo que podría ser que ninguno de estos genes esté implicado en la activación transcripcional de los genes nod en presencia de apigenina o estrés osmótico. Estudio transcriptómico de los mutantes RSP82 y nodD2::Ω en presencia de apigenina y estrés osmótico A raíz de los resultados de actividad β-galactosidasa del apartado anterior, y ya que se disponía de los datos de ARNseq de la estirpe silvestre en presencia de flavonoide y estrés osmótico, se realizó un nuevo estudio transcriptómico de la estirpe RSP82 en presencia de apigenina y estrés salino; y de la estirpe nodD2::Ω en presencia de apigenina, estrés salino y estrés por manitol (Figura 19). La metodología y condiciones empleadas para este estudio fueron, en general, idénticas a las utilizadas anteriormente con la estirpe silvestre, donde se ha considerado a un gen diferencialmente diferenciado cuando la expresión es ± 4 veces en condiciones de apigenina y estrés salino, y ± 2.5 veces en presencia de estrés por manitol. Los datos obtenidos en estos nuevos estudios transcriptómicos mostraron que, en presencia de apigenina, ninguno de los diez genes nod diferencialmente activados en la estirpe silvestre se activó en la estirpe RSP82, confirmando el papel de NodD1 en la activación de estos genes en presencia de apigenina (Tabla 35). Tampoco se 111 Resultados activaron los genes y4wE (NB4), RTCIAT899_PB01550 y RTCIAT899_PB01545 (NB5). En estas mismas condiciones, la expresión diferencial de los genes simbióticos del mutante nodD2::Ω no se vio afectada en presencia de apigenina, con la única excepción del gen RTCIAT899_PB01545, que codifica para una proteína hipotética, y que se expresó menos que en la estirpe silvestre (4,26 vs 2,36). Tabla 35 – Expresión diferencial de todos los genes nod o regulados por NB y diferencialmente expresados en R. tropici CIAT 899 y sus derivados RSP82 y nodD2::Ω en presencia de 3,7 µM de apigenina. Número de acceso NCBI Gen NB Inducción CIAT 899 Inducción RSP82 Inducción nodD2::Ω RTCIAT899_PB01295 nodD1 1,23 -1,29 -1,53 RTCIAT899_PB01070 nodD2 NB9 −1,25 -1,52 -7,93 RTCIAT899_PB00640 nodD3 −1,21 -1,39 1,32 RTCIAT899_PB01560 nodD4 1,09 -1,04 -1,16 RTCIAT899_PB00560 nodD5 −1,12 -1,24 -2,16 RTCIAT899_PB01300 nodA1 NB1 8,73 -2,08 10,85 RTCIAT899_PB01305 nodB NB1 11,4 -1,12 12,33 RTCIAT899_PB01310 nodC NB1 6,69 -1,72 5,96 RTCIAT899_PB01315 nodS NB1 7,53 -2,27 5,59 RTCIAT899_PB01320 nodU NB1 5,39 -1,37 6,48 RTCIAT899_PB01325 nodI NB1 6,59 -2,47 5,2 RTCIAT899_PB01330 nodJ NB1 4,98 -2,46 3,42 RTCIAT899_PB01340 nodH NB1 3,09 -1,95 1,73 RTCIAT899_PB01345 nodP NB1 2,78 -3,08 1,32 RTCIAT899_PB01350 nodQ NB1 3,25 -2,31 1,79 RTCIAT899_PB01095 nodA2 NB2 10,3 1,41 8,29 RTCIAT899_PB01115 nodF NB2 13,39 1,21 5,17 RTCIAT899_PB01120 nodE NB2 10,37 -1,51 6,35 RTCIAT899_PB00645 nodA3 1,15 2,03 2,77 RTCIAT899_PB02710 nodM NB3 2,43 -1,52 2,8 RTCIAT899_PB00575 y4wE NB4 8,58 -2,94 4,25 RTCIAT899_PB01550 NB5 6,75 1,36 4,11 RTCIAT899_PB01545 NB5 4,26 1,43 2,36 En rojo se muestran los genes reprimidos y en negro los genes activados. En negrita se muestran los genes diferencialmente expresados (± 4). En cada caso se expresa las veces de inducción o de represión de cada gen con respecto al gen de la estirpe R. tropici CIAT 899 en condiciones control. 112 Resultados En cuanto a los datos obtenidos en condiciones de estrés salino, de los 14 genes nod diferencialmente expresados en la estirpe silvestre, ninguno se indujo en el fondo mutante del gen nodD2, indicando que este regulador es el responsable de la activación transcripcional de los genes nod en presencia de estrés salino en CIAT 899 (Tabla 36). Tampoco se indujeron los genes y4wEF, RTCIAT899_PB01550 y RTCIAT899_PB01545 en el mutante nodD2::Ω bajo estrés salino. En cuanto al mutante RSP82 (mutante en nodD1), se observó que los genes regulados bajo las NB1, NB3 y NB4 no se activaban en condiciones de estrés salino. Sin embargo, sí se observó cierta activación transcripcional en el operón controlado por la NB2 (genes nodA2FE) y la NB5 (RTCIAT899_PB01550 y RTCIAT899_PB01545). Este resultado podría indicar que NodD1 podría estar también implicado en la activación de ciertos genes nod en presencia de estrés salino, o bien que podría estar promoviendo la transcripción de nodD2 en estas condiciones. Esta última hipótesis se apoya en el hecho de que, en presencia de 300 mM de NaCl, el gen nodD2 controlado por la NB9 se activa 3,01 veces en la estirpe silvestre, mientras que en el mutante RSP82 presenta unos valores de inducción de 1,02 (Tabla 36). Tabla 36 – Expresión diferencial de todos los genes nod o regulados por NB y diferencialmente expresados en R. tropici CIAT 899 y los mutantes RSP82 y nodD2::Ω en presencia de 300 mM de NaCl con respecto a la estirpe parental en condiciones control. Número de acceso NCBI Gen NB Inducción CIAT 899 Inducción RSP82 Inducción nodD2::Ω RTCIAT899_PB01295 nodD1 1,04 -1,24 1,06 RTCIAT899_PB01070 nodD2 NB9 3,01 1,02 -3,29 RTCIAT899_PB00640 nodD3 2,1 1,4 1,53 RTCIAT899_PB01560 nodD4 1,16 1,29 1,56 RTCIAT899_PB00560 nodD5 −1,09 1,11 -1,04 RTCIAT899_PB01300 nodA1 NB1 13,66 2,63 -1,13 RTCIAT899_PB01305 nodB NB1 19,01 3,46 1,29 RTCIAT899_PB01310 nodC NB1 12 2,43 1,19 RTCIAT899_PB01315 nodS NB1 12,89 2,16 1,03 RTCIAT899_PB01320 nodU NB1 10,18 2,91 1,56 RTCIAT899_PB01325 nodI NB1 12,48 1,94 1,36 113 Resultados Número de acceso NCBI Gen NB Inducción CIAT 899 Inducción RSP82 Inducción nodD2::Ω RTCIAT899_PB01330 nodJ NB1 10,15 1,71 -1,06 RTCIAT899_PB01340 nodH NB1 7,6 1,96 1,08 RTCIAT899_PB01345 nodP NB1 6,08 -1,31 -1,75 RTCIAT899_PB01350 nodQ NB1 6,39 -1,01 -1,33 RTCIAT899_PB01095 nodA2 NB2 9,81 4,14 1,08 RTCIAT899_PB01115 nodF NB2 13,43 4,16 1,612 RTCIAT899_PB01120 nodE NB2 11,94 4,11 1,47 RTCIAT899_PB00645 nodA3 3,36 1,91 2,82 RTCIAT899_PB02710 nodM NB3 5,85 1,68 1,32 RTCIAT899_PB00575 y4wE NB4 12,17 1,88 -1,13 RTCIAT899_PB00570 y4wF NB4 7,11 1,04 -1,3 RTCIAT899_PB01550 NB5 28,65 7,72 1,97 RTCIAT899_PB01545 NB5 14,37 4,73 1,43 En rojo se muestran los genes reprimidos y en negro los genes activados. En negrita se muestran los genes diferencialmente expresados (± 4). En cada caso se expresa las veces de inducción o de represión de cada gen con respecto al gen de la estirpe R. tropici CIAT 899 en condiciones control. Finalmente, con respecto a los resultados de ARNseq en presencia de estrés osmótico no iónico (manitol), de los genes nod o regulados por NB, diferencialmente expresados en la estirpe silvestre (nodD1, nodA2, nodF, nodE, nodA3, RTCIAT899_PB01550 y RTCIAT899_PB01545), solo los genes nodF y RTCIAT899_PB01550 se indujeron diferencialmente en el fondo mutante del gen nodD2, sugiriendo que el regulador NodD2 sería el responsable de la activación transcripcional de estos genes en presencia de altas concentraciones de manitol (Tabla 37). Tabla 37 - Expresión diferencial de todos los genes nod o regulados por NB y diferencialmente expresados en R. tropici CIAT 899 y el mutante nodD2::Ω en presencia de 400 mM de manitol con respecto a la estirpe parental en condiciones control. Número de acceso NCBI Gen NB Inducción CIAT 899 Inducción nodD2::Ω RTCIAT899_PB01295 nodD1 4,63 1,88 RTCIAT899_PB01070 nodD2 NB9 2,28 -1,91 RTCIAT899_PB00640 nodD3 1,6 1,38 RTCIAT899_PB01560 nodD4 1,48 1,5 Model Plant-Associated Bacteria. Dordrecht: Kluwer Academic Publishers; 1998. p. 361–86. 6. Geurts R, Bisseling T. Rhizobium Nod factor perception and signalling. Plant Cell. 2002;14:S239–49. 7. Brencic A, Winans SC. Detection of and response to signals involved in host-microbe interactions by plant-associated bacteria. Microbiol Mol Biol Rev. 2005;69:155–94. 8. Oldroyd GE. Speak, friend, and enter: signaling systems that promote beneficial symbiotic associations in plants. Nat Rev Microbiol. 2013;11:252–63. 9. Khan W, Prithiviraj B, Smith DL. Nod factor [Nod Bj V (C18:1, MeFuc)] and lumichrome enhance photosynthesis and growth of corn and soybean. J Plant Physiol. 2008;163:1342–51. 10. Liang Y, Cao Y, Tanaka K, Thibivilliers S, Wan J, Choi J, et al. Nonlegumes respond to rhizobial Nod factors by suppressing the innate immune response. Science. 2013;341:1384–7. 11. Marks BB, Nogueira MA, Hungria M, Megías M. Biotechnological potential of rhizobial metabolites to enhance the performance of Bradyrhizobium spp and Azospirillum brasilense inoculants with soybean and maize. AMB Express. 2013;3:21. 12. Smith S, Habib A, Kang Y, Leggett M, Diaz-Zorita M. LCO applications provide improved responses with legumes and non-legumes. In: De Bruijn F, editor. Biological Nitrogen Fixation. New Jersey: John Wiley & Sons, Inc; 2015. p. 1073–81. 13. Kondorosi E, Gyuris J, Schmidt J, John M, Duda E, Hoffmann B, et al. Positive and negative control of nod gene expression in Rhizobium meliloti is required for optimal nodulation. Embo J. 1989;8:1331–40. 14. Spaink HP. Root nodulation and infection factors produced by rhizobial bacteria. Annu Rev Microbiol. 2000;54:257–88. 15. Krause A, Doerfel A, Gottfert M. Mutational and transcriptional analysis of the type III secretion system of Bradyrhizobium japonicum. Mol Plant Microbe Interact. 2002;15:1228–35. 16. Theunis M, Kobayashi H, Broughton WJ, Prinsen E. Flavonoids, NodD1, NodD2, and Nod-Box NB15 modulate expression of the y4wEFG locus that is required for indole-3-acetic acid synthesis in Rhizobium sp. strain NGR234. Mol Plant Microbe Interac. 2004;17:1153–61. 17. Vinardell JM, Lopez-Baena FJ, Hidalgo A, Ollero FJ, Bellogin R, Espuny MR, et al. The effect of FITA mutations on the symbiotic properties of Sinorhizobium fredii varies in a chromosomal-background-dependent manner. Arch Microbiol. 2004;181:144–54. 18. López-Baena FJ, Vinardell JM, Pérez-Montaño F, Crespo-Rivas JC, Bellogín RA, Espuny Mdel R, et al. Regulation and symbiotic significance of nodulation outer proteins secretion in Sinorhizobium fredii HH103. Microbiology. 2008;154:1825–36. 19. Pérez-Montaño F, Guasch-Vidal B, González-Barroso S, López-Baena FJ, Cubo T, Ollero FJ, et al. Nodulation-gene-inducing flavonoids increase overall production of autoinducers and expression of N-acyl homoserine lactone synthesis genes in rhizobia. Res Microbiol. 2011;162:715–23. 20. Pérez-Montaño F, Jiménez-Guerrero I, Del Cerro P, Baena-Ropero I, López- Baena FJ, Ollero FJ, et al. The symbiotic biofilm of Sinorhizobium fredii SMH12, necessary for successful colonization and symbiosis of Glycine max cv Osumi, is regulated by quorum sensing systems and inducing flavonoids via NodD1. PLoS One. 2014;9:e105901. 21. Hungria M, Johnston AWB, Phillips DA. Effects of flavonoids released naturally from bean (Phaseolus vulgaris)onnodD-regulated gene transcription in Rhizobium leguminosarum bv. phaseoli. Mol Plant Microbe Interac. 1992;5:199–203. 22. Broughton WJ, Jabbouri S, Perret X. Keys to symbiotic harmony. J Bacteriol. 2000;182:5641–52. 23. Garcia MLJ, Dunlap J, Loh J, Stacey G. Phenotypic characterization and regulation of the nolA gene of Bradyrhizobium japonicum. Mol Plant Microbe Interact. 1996;9:625–35. 24. Martínez-Romero E, Segovia L, Mercante FM, Franco AA, Graham P, Pardo MA. Rhizobium tropici, a novel species nodulating Phaseolus vulgaris L. beans and Leucaena sp. trees. Int J Syst Bacteriol. 1991;41:417–26. 25. Hernández-Lucas I, Segovia L, Martínez-Romero E, Pueppke SG. Phylogenetic relationships and host range of Rhizobium spp. that nodulates Phaseolus vulgaris L. Appl Environ Microbiol. 1995;61:2775–9. 26. Hungria M, Andrade DS, Chueire LMO, Probanza A, Guitierrez-Manero FJ, Megías M. Isolation and characterization of new efficient and competitive bean (Phaseolus vulgaris L.) rhizobia from Brazil. Soil Biol Biochem. 2000;21:1515–28. 27. Poupot R, Martínez-Romero E, Promé JC. Nodulation factors from Rhizobium tropici are sulfated or nonsulfated chitopentasaccharides containing an N-methyl-N-acylglucosaminyl terminus. Biochemistry. 1993;32:10430–5. 28. Morón B, Soria-Díaz ME, Ault J, Verroios G, Noreen S, Rodríguez-Navarro DN, et al. Low pH changes the profile of nodulation factors produced by Rhizobium tropici CIAT899. Chem Biol. 2005;12:1029–40. 29. Estevez J, Soria-Diaz ME, De Cordoba FF, Moron B, Manyani H, Gil A, et al. Different and new Nod factors produced by Rhizobium tropici CIAT899 following Na + stress. FEMS Microbiol Lett. 2009;293:220–31. 30. Guasch-Vidal B, Estévez J, Dardanelli MS, Soria-Díaz ME, De Córdoba FF, Balog CI, et al. High NaCl concentrations induce the nod genes of Rhizobium tropici CIAT899 in the absence of flavonoid inducers. Mol Plant Microbe Interact. 2013;26:451–60. 31. van Rhijn PJS, Feys B, Verreth C, Vanderleyden J. Multiple copies of nodD in Rhizobium tropici CIAT899 and BR816. J Bacteriol. 1993;175:438–47. 32. Ormeño-Orrillo E, Menna P, Gonzaga LA, Ollero FJ, Nicolas MF, Rodrigues EP, et al. Genomic basis of broad host range and environmental adaptability of Rhizobium tropici CIAT 899 and Rhizobium sp PRF 81 which are used in inoculants for common bean (Phaseolus vulgaris L). BMC Genomics. 2012;13:735. 33. Fellay R, Hanin M, Montorzi G, Frey J, Freiberg C, Golinowski W, et al. nodD2 of Rhizobium sp. NGR234 is involved in the repression of the nodABC operon. Mol Microbiol. 1998;27:1039–50. 34. Gillette WK, Elkan GH. Bradyrhizobium (Arachis) sp. strain NC92 contains two nodD genes involved in the repression of nodA and a nolA gene required for the efficient nodulation of host plants. J Bacteriol. 1996;178:2757–66. 35. Berg HC. The rotary motor of bacterial flagella. Annu Rev Biochem. 2003;72:19–54. 36. Tambalo DD, Vanderlinde EM, Robinson S, Halmillawewa A, Hynes MF, Yost CK. Legume seed exudates and Physcomitrella patens extracts influence swarming behavior in Rhizobium leguminosarum. Can J Microbiol. 2014;60:15–24. 37. Honma MA, Ausubel FM. Rhizobium meliloti has three functional copies of the nodD symbiotic regulatory gene. Proc Natl Acad Sci U S A. 1987;84:8558–62. 38. Appelbaum ER, Thompson DV, Idler K, Chartrain N. Rhizobium japonicum USDA 191 has two nodD genes that differ in primary structure and function. J Bacteriol. 1998;170:12–20. 39. Loh J, Stacey G. Nodulation gene regulation in Bradyrhizobium japonicum:a unique integration of global regulatory circuit. Appl Environ Microbiol. 2003;69:10–7. 40. Honma MA, Asomaning M, Ausubel FM. Rhizobium meliloti nodD genes mediate host-specific activation of nodABC. J Bacteriol. 1990;172:901–11. 41. RelićB, Fellay R, Lewin A, Perret K, Price NPJ, Rochepeau P, et al. nod genes and Nod Factors of Rhizobium species NGR 234. In: Palacios R, Mora J, Newton WE, editors. New Horizons in Nitrogen Fixation. Dordrecht: Kluwer Academic Publishers; 1993. p. 183–9. 42. Göttfert M, Groß P, Hennecke H. Proposed regulatory pathway encoded by the nodV and nodW genes, determinants of host specificity in Bradyrhizobium japonicum. Proc Natl Acad Sci. 1990;87:2680–4. 43. Spaink HP. Rhizobial lipo-oligosaccharides: answers and questions. Plant Mol Biol. 1992;20:977–86. 44. Muñoz N, Soria-Díaz ME, Manyani H, Sánchez-Matamoros RC, Serrano AG, Megías M, et al. Structure and biological activities of lipochitooligosaccharide nodulation signals produced by Bradyrhizobium japonicum USDA 138 under saline and osmotic stress. Biol Fertil Soils. 2014;50:207–15. 45. Jabbouri S, RelićB, Hanin M, Kamalaprija P, Burger U, Promé D, et al. nolO and noeI (HsnIII) of Rhizobium sp. NGR234 are involved in 3-O-carbamoylation and 2-O-methylation of Nod factors. J Bio Chem. 1998;273:12047–55. 46. Folch-Mallol JL, Marroqui S, Sousa C, Manyani H, Lopez-Lara IM, van der Drift KM, et al. Characterization of Rhizobium tropici CIAT899 nodulation factors: the role of nodH and nodPQ genes in their sulfation. Mol Plant Microbe Interact. 1996;9(3):151–63. 47. Vargas C, Martínez LJ, Megías M, Quinto C. Identification and cloning of nodulation genes and host specificity determinants of the broad host-range Rhizobium leguminosarum biovar phaseoli strain CIAT899. Mol Microbiol. 1990;4:1899–910. 48. Machado D. Krishnan HB: nodD alleles of Sinorhizobium fredii USDA 191 differentially influence soybean nodulation, nodC expression, and production of exopolysaccharides. Curr Microbiol. 2003;47:134–7. 49. Machado D, Pueppke SG, Vinardel JM, Ruiz-Sainz JE, Krishnan HB. Expression of nodD1 and nodD2 in Sinorhizobium fredii, a nitrogen-fixing symbiont of soybean and other legumes. Mol Plant Microbe Interac. 1998;11:375–82. del Cerro et al. BMC Genomics (2015) 16:251 Page 12 of 13 50. Gomes DF, Ormeno-Orrillo E, Hungria M. Biodiversity, symbiotic efficiency and genomics of Rhizobium tropici and related species. In: De Bruijn F, editor. Biological Nitrogen Fixation. New Jersey, Hoboken: Wiley-Blackwell; 2015. p. 747–56. 51. Grange L, Hungria M, Graham PH, Martínez-Romero E. New insights into the origins and evolution of rhizobia that nodulate common bean (Phaseolus vulgaris) in Brazil. Soil Biol Biochem. 2007;39(4):867–76. 52. Pinto FGS, Hungria M, Mercante FM. Polyphasic characterization of Brazilian Rhizobium tropici strains effective in fixing N 2 with common bean (Phaseolus vulgaris L.). Soil Biol Biochem. 2007;39(8):1851–64. 53. Acosta-Durán C, Martínez-Romero E. Diversity of rhizobia from nodules of the leguminous tree Gliricidia sepium, a natural host of Rhizobium tropici. Arch Microbiol. 2002;178:161–4. 54. Menna P, Hungria M, Barcellos FG, Bangel EV, Hess PN, Martínez-Romero E. Molecular phylogeny based on the 16S rRNA gene of elite rhizobial strains used in Brazilian commercial inoculants. Syst Appl Microbiol. 2006;29:315–32. 55. Rincón-Rosales R, Lloret L, Ponce E, Martínez-Romero E. Rhizobia with different symbiotic efficiencies nodulate Acaciella angustissima in Mexico, including Sinorhizobium chiapanecum sp. nov. which has common symbiotic genes with Sinorhizobium mexicanum. FEMS Microbiol Ecol. 2009;67:103–17. 56. Capela D, Carrere S, Batut J. Transcriptome-based identification of the Sinorhizobium meliloti NodD1 regulon. Appl Environ Microbiol. 2005;71:4910–3. 57. Beringer JE. R factor transfer in Rhizobium leguminosarum. J Gen Microbiol. 1974;84:188–98. 58. Vincent JM. The modified Fahraeus slide technique. In: Vincent JM, editor. A manual for the practical study of root nodule bacteria. Oxford, UK: Blackwell Scientific Publications; 1970. 59. Sambrook J, Fritsch EF, Maniatis T. Molecular Cloning: A Laboratory Manual. 2nd ed.ColdSpringHarbor,NY,USA:ColdSpringHarborLaboratoryPress;1989. 60. Lamrabet Y, Bellogín RA, Cubo T, Espuny MR, Gil-Serrano A, Krishnan HB, et al. Mutation in GDP-fucose synthesis genes of Sinorhizobium fredii alters Nod factors and significantly decreases competitiveness to nodulate soybeans. Mol Plant-Microbe Interact. 1999;12:207–17. 61. Schäfer A, Tauch A, Jäger W, Kalinowski J, Thierbach G, Pühler A. Small mobilizable multi-purpose cloning vectors derived from the Escherichia coli plasmids pK18 and pK19: selection of defined deletions in the chromosome of Corynebacterium glutamicum. Gene. 1994;145:69–73.62. 62. Prentki P, Krisch HM. In vitro insertional mutagenesis with a selectable DNA fragment. Gene. 1984;29:303–13. 63. Simon R. High frequency mobilization of gram-negative bacterial replicons by the in vivo constructed Tn5-Mob transposon. Mol Gen Genet. 1984;196:413–20. 64. Figurski DH, Helinski DR. Replication of an origin-containing derivative of plasmid RK2 dependent on a plasmid function provided in trans. Proc Natl Acad Sci U S A. 1979;76:1648–52. 65. López-Baena FJ, Monreal JA, Pérez-Montaño F, Guasch-Vidal B, Bellogín RA, Vinardell JM, et al. The absence of Nops secretion in Sinorhizobium fredii HH103 increases GmPR1 expression in Williams soybean. Mol Plant Microbe Interac. 2009;22:1445–54. 66. Gomes DF, Batista JSS, Rolla AAP, Silva LPS, Bloch C, Galli-Terasawa LV, et al. Proteomic analysis of free-living Bradyrhizobium diazoefficiens: highlighting potential determinants of a successful symbiosis. BMC Genomics. 2014;15:643. doi: 10.1186/1471-2164-15-643. 67. Pfaffl MW, Horgan GW, Dempfle L. Relative expression software tool (REST) for group-wise comparison and statistical analysis of relative expression results in real-time PCR. Nucleic Acids Res. 2002;30:e36. 68. Tomlinson AD, Ramey-Hartung B, Day TV, Merrit PM, Fuqua C. Agrobacterium tumefaciens ExoR represses succinoglycan biosynthesis and is required for biofilm formation and motility. Microbiology. 2010;156:2670–81. 69. O’Toole GA, Kolter R. Initiation of biofilm formation in Pseudomonas fluorescens WCS365 proceeds via multiple, convergent signalling pathways: a genetic analysis. Mol Microbiol. 1998;28:449–61. 70. Glickmann E, Dessaux Y. A critical examination of the specificity of the Salkowski reagent for indolic compounds produced by phytopathogenic bacteria. Appl Environ Microbiol. 1995;61:793–6. 71. Fierro-Coronado RA, Quiroz-Figueroa FR, García-Pérez LM, Ramírez-Chávez E, Molina-Torres J, Maldonado-Mendoza IE. IAA-producing rhizobacteria from chickpea (Cicer arietinum L.) induce changes in root architecture and increase root biomass. Can J Microbiol. 2014;60:639–48. Submit your next manuscript to BioMed Central and take full advantage of: • Convenient online submission • Thorough peer review • No space constraints or color figure charges • Immediate publication on acceptance • Inclusion in PubMed, CAS, Scopus and Google Scholar • Research which is freely available for redistribution Submit your manuscript at www.biomedcentral.com/submit del Cerro et al. BMC Genomics (2015) 16:251 Page 13 of 13 RESEARCH ARTICLE Open Access Opening the “black box”of nodD3,nodD4 and nodD5 genes of Rhizobium tropici strain CIAT 899 Pablo del Cerro 1 , Amanda Alves Paiva Rolla-Santos 2 , Douglas Fabiano Gomes 2 , Bettina Berquó Marks 2 , María del Rosario Espuny 1 , Miguel Ángel Rodríguez-Carvajal 3 , María Eugenia Soria-Díaz 4 , André Shigueyoshi Nakatani 2 , Mariangela Hungria 2* , Francisco Javier Ollero 1 and Manuel Megías 1 Abstract Background: Transcription of nodulation genes in rhizobial species is orchestrated by the regulatory nodD gene. Rhizobium tropici strain CIAT 899 is an intriguing species in possessing features such as broad host range, high tolerance of abiotic stresses and, especially, by carrying the highest known number of nodD genes—five—and the greatest diversity of Nod factors (lipochitooligosaccharides, LCOs). Here we shed light on the roles of the multiple nodD genes of CIAT 899 by reporting, for the first time, results obtained with nodD3,nodD4 and nodD5 mutants. Methods: The three nodD mutants were built by insertion of Ωinterposon. Nod factors were purified and identified by LC-MS/MS analyses. In addition, nodD1 and nodC relative gene expressions were measured by quantitative RT-PCR in the wt and derivative mutant strains. Phenotypic traits such as exopolysaccharide (EPS), lipopolysaccharide (LPS), swimming and swarming motilities, biofilm formation and indole acetid acid (IAA) production were also perfomed. All these experiments were carried out in presence of both inducers of CIAT 899, apigenin and salt. Finally, nodulation assays were evaluated in up to six different legumes, including common bean (Phaseolus vulgaris L.). Results: Phenotypic and symbiotic properties, Nod factors and gene expression of nodD3, nodD4 and nodD5 mutants were compared with those of the wild-type (WT) CIAT 899, both in the presence and in the absence of the nod-gene- inducing molecule apigenin and of saline stress. No differences between the mutants and the WT were observed in exopolysaccharide (EPS) and lipopolysaccharide (LPS) profiles, motility, indole acetic acid (IAA) synthesis or biofilm production, either in the presence, or in the absence of inducers. Nodulation studies demonstrated the most complex regulatory system described so far, requiring from one (Leucaena leucocephala, Lotus burtii)tofour(Lotus japonicus) nodD genes. Up to 38 different structures of Nod factors were detected, being higher under salt stress, except for the nodD5 mutant; in addition, a high number of structures was synthesized by the nodD4 mutant in the absence of any inducer. Probable activator (nodD3 and nodD5)orrepressorroles(nodD4), possibly via nodD1 and/or nodD2,were attributed to the three nodD genes. Expression of nodC,nodD1 and each nodD studied by RT-qPCR confirmed that nodD3 is an activator of nodD1, both in the presence of apigenin and salt stress. In contrast, nodD4 might be an inducer with apigenin and a repressor under saline stress, whereas nodD5 was an inducer under both conditions. (Continued on next page) * Correspondence: [email protected] 2 Embrapa Soja, C.P. 231, 86001-970 Londrina, Paraná, Brazil Full list of author information is available at the end of the article © 2015 del Cerro et al. Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated. del Cerro et al. BMC Genomics (2015) 16:864 DOI 10.1186/s12864-015-2033-z (Continued from previous page) Conclusions: We report for R. tropici CIAT 899 the most complex model of regulation of nodulation genes described so far. Five nodD genes performed different roles depending on the host plant and the inducing environment. Nodulation required from one to four nodD genes, depending on the host legume. nodD3 and nodD5 were identified as activators of the nodD1 gene, whereas, for the first time, it was shown that a regulatory nodD gene—nodD4—might act as repressor or inducer, depending on the inducing environment, giving support to the hypothesis that nodD roles go beyond nodulation, in terms of responses to abiotic stresses. Keywords: Biological nitrogen fixation, LCO, nodD gene, Nod factors, Symbiosis Background The association of rhizobial strains and legumes represents one of the most perfect symbiotic interactions, in which a sophisticated machinery has been developed in both partners for millions of years, now contributing the highest inputs of nitrogen on Earth [1–4]. A fascinating step in the symbiosis is represented by the molecular signal dialogue established between the compatible partners, starting with the message sent with the exudation of molecules—mainly flavonoids—from the host legume, and replied with the synthesis of lipochitooligosaccharides (LCOs)—also known as Nod factors—by the rhizobium [5–10]. The “maestro”that orchestrates this symphony in the bacterium is the regulatory nodD gene, constitutively expressed and responsible for initiating the transcriptions of the remaining nodulation genes [9–12]. Rhizobium tropici is abundantly found in tropical acid soils of South America; its main characteristics are high tolerance of environmental stresses and ability to nodulate a broad range of legumes, the most economically important being common bean (Phaseolus vulgaris L.) [13–16]. Probably the most intriguing feature of the common bean-R. tropici symbiosis is the abundance of flavonoid nod-gene inducers released by the host legume [17, 18], and the synthesis of the largest known variety of Nod factors by R. tropici CIAT 899 [19–23]. Also unique are the observations that R. tropici CIAT 899 is capable of producing LCOs under abiotic stresses—such as acidic and saline conditions—in the absence of plant-molecular signals [20–23], and interestingly, some LCOs are produced even in the absence of saline stress and flavonoids [23]. Rhizobial species described so far have one to five regulatory nodD genes. R. tropici CIAT 899 and closely related species carrying the symbiovar tropici (R. leucaenae CFN 299, R. freirei PRF 81) possess the highest numbers, with five copies of nodD genes [24, 25]. Elucidating the roles of the five nodD genes of CIAT 899 may help to understand their protagonism in host-range characteristics and in the strategies that the strain uses to circumvent abiotic stresses. It may also contribute to gaining a better understanding of the evolution of symbiotic interactions, since R. tropici has a strong resemblance to the pathogen Agrobacterium in terms of genes and proteins [25, 26]. As a first study, we shed light on the roles of nodD1 and nodD2 of R. tropici CIAT 899, with data related to the activation/repression of nodulation genes, their role Fig. 1 Gene neighborhood of nodD3,nodD4 and nodD5 genes and representation of the mutations. aGene localizationin the symbiotic plasmid (pRtCIAT899b) of R. tropici strain CIAT 899 and location of primers used to perform RTqPCR experiments (dark arrows); bSchematic representation of the nodD3,nodD4 and nodD5 mutation del Cerro et al. BMC Genomics (2015) 16:864 Page 2 of 10 in host range and showing that these two genes have functions beyond nodulation [23]. Here we achieve improved understanding of the mechanisms controlling regulation of the nodD genes of CIAT 899, with studies of nodD3,nodD4 and nodD5 mutants. Results and discussion Gene localization and phenotypes in vitro of the wild type and mutant strains nodD gene nomenclature was used as defined for the genome of R. tropici strain CIAT 899 [25]. nodA3 precedes nodD3 and is close to an aquaporin; nodD4 precedes the operon nifHDK and nodD5 is downstream of an operon of hypothetical proteins (Fig. 1). nodD3,nodD4 and nodD5 genes correspond to the CD5, CD21 and CD29 nodD-hy- bridizing regions of CIAT 899 described by van Rhijn et al. [24], respectively. Mutations in the nodD3, nodD4 and nodD5 genes were achieved as described in the Methods section. In general, evaluations were performed in the absence of any inducer (B − medium) [20], in the presence of the nod-gene-inducing molecule apigenin (3.7 μM), or undersalinitystress(NaCl300mM)thatalsoinduce the synthesis of Nod factors. The same treatments were used in our previous study with nodD1 and nodD2 mutants [23]. Some bacterial properties may be regulated via NodD proteins, and in our previous study we showed that both nodD1 and nodD2 have a constitutive suppression role on swarming motility and an activation effect on indole acetic acid (IAA) synthesis [23]. Here, we found no differences between the three mutants and the WT strain in exopolysaccharide (EPS) and lipopolysaccharide (LPS) profiles, swimming and swarming motilities, biofilm formation, or IAA synthesis (data not shown). Symbiotic phenotypes Symbiotic phenotypes of the WT CIAT 899 and the mutant strains were verified in pots containing sterile substrate (Leonard jars). Previously, we reported that common bean requires both nodD1 and nodD2, whereas nodD1 was the main nodulation regulator of both leucaena [Leucanea leucocephala (Lam.) de Wit] and siratro [Macroptilium atropurpureum (DC.) Urb.] [23]. For comparison, these results are shown again in Table 1, together with the results obtained with nodD3,nodD4 and nodD5 mutants; in addition, the symbiotic properties of all five nodD mutants were assayed in two other host legumes, Lotus burtii Borsos and Lotus japonicus (Regel) K. Larsen. For the common bean, there were no statistical differences between the WT and the three mutants in terms of the nodulation or shoot dry weight (SDW) parameters, but we should mention that there was a decrease in nodulation, which might indicate effects of minor magnitude due to the mutations, with an emphasis on nodD5,whereit also affected SDW. Leucaena and siratro also did not show differences in nodulation between the WT and the three mutants, but SDW of leucaena inoculated with nodD4 and nodD5 mutants was slightly, but significantly, lower (Table 1). In relation to the nodulation of Lotus species, nodD1 was the main regulator in L. japonicus and very important Table 1 Plant responses (nodule number, n°/plant) and shoot dry weight (g/pl) to inoculation of common bean, leucaena, siratro, Lotus japonicus and L. burtii with R. tropici strain CIAT 899 and derivatives. Plants evaluated after 25 (common bean.), 42 days (leucaena and siratro), or 50 days (Lotus spp.) of growth under controlled conditions Strains P. vulgaris L. leucocephala M. atropurpureum L. japonicus L. burtii Nodule number Shoot dry weight Nodule number Shoot dry weight Nodule number Shoot dry weight Nodule number Shoot dry weight Nodule number Shoot dry weight R. tropici CIAT 899 213 ± 52 a 1.82 ± 0.64 a 13 ± 4 a 0.41 ± 0.03 a 34 ± 8 a 0.05 ± 0.01 a 22 ± 9 0.064 ± 0.03 11 ± 5 0.04 ± 0.02 nodD1 mutant 38 ± 11 *,a 1.42 ± 0.35 a 0±0 *,a 0.09 ± 0.01 *,a 0±0 *,a 0.05 ± 0 a 0±0 * 0.007 ± 0.004 * 5±2 * 0.04 ± 0.02 nodD2 mutant 95 ± 38 *,a 1.03 ± 0.27 a 10 ± 3 a 0.36 ± 0.04 **,a 24 ± 8 a 0.05 ± 0 a 30 ± 10 0.039 ± 0.013 * 12 ± 5 0.03 ± 0.01 nodD3 mutant 182 ± 25 1.80 ± 0.34 13 ± 3 0.39 ± 0.09 38 ± 12 0.05 ± 0 12 ± 4 * 0.025 ± 0.014 * 9 ± 4 0.04 ± 0.01 nodD4 mutant 190 ± 24 1.84 ± 0.5 14 ± 3 0.37 ± 0.01 * 29 ± 8 0.05 ± 0 17 ± 6 0.058 ± 0.052 12 ± 5 0.03 ± 0.02 nodD5 mutant 179 ± 16 1.45 ± 0.68 12 ± 4 0.37 ± 0.01 * 33 ± 7 0.05 ± 0.01 6 ± 2 * 0.021 ± 0.011 * 12 ± 2 0.05 ± 0.01 None 0 ± 0 * 0.80 ± 0.25 * 0±0 * 0.09 ± 0.01 * 0±0 * 0.05 ± 0 0 ± 0 * 0.008 ± 0.004 * 0±0 * 0.01 ± 0 * a After [23] * Data represent means ± SD (standard deviation) of 6 jars, each with two plants. nodD3, nodD4 and nodD5 mutant parameters were individually compared with the parental strain CIAT 899 parameters by using the Mann-Whitney non-parametric test. Values tagged by * and ** are significantly different at the level α=10 and 5 %, respectively del Cerro et al. BMC Genomics (2015) 16:864 Page 3 of 10 for L. burtii,whereasnodD2 did not affect nodulation but resulted in a significative reduction in SDW of L. japonicus, indicating that it interferes with the efficiency of nitrogen fixation. In addition, for L. japonicus,amutationinnodD3 and nodD5 also affected nodulation and SDW, whereas no effects were observed for L. burtii (Table 1). From these data, we may conclude that full nodulation of common bean requires both nodD1 and nodD2 genes, but it is possible that nodD3 and nodD5 could make minor contributions that were not statistically detected in our experiments. Therefore, as in several other rhizobial species [27, 28] including the broadly nodulating S. fredii NGR 234 [29], nodD1 is the main gene regulating nodulation of leucaena, siratro, L. burtii and L. japonicus.Siratrodoes not require any other nodD gene for nodulation, but a non-statistically significant decrease observed with the nodD2 mutant should be more fully investigated. Lotus burtii does not require any of the nodD genes except for nodD1. In contrast, L. japonicus receives contributions from all the nod genes except for nodD4 for nodulation, because with the other nodD mutants a reduced SDW was observed (Table 1). The most intricate pattern of responses in nodulation described so far is that for Sinorhizobium meliloti, which utilizes the three copies of nodD to optimize nodulation of each of its legume hosts [27]. However, now we present a regulatory pattern that involves from one nodD gene (leucaena, L. burtii)tofour(L. japonicus).Therewerealso indications that nodD genes influence nodule effectiveness, as shown for nodD2,nodD4 and nodD5 for leucaena, and nodD2 for L. japonicus. Another particularity for R. tropici CIAT 899 was that, in general, nodD2 was not a repressor of any of the legumes evaluated, contrary to what happens with the broadly nodulating strain NGR 234 [30]. Nod-factor patterns The interesting roles of Nod factors—which apparently can go further than nodulation—have been broadly investigated over a long period of time [5, 8, 10, 12, 31]. R. tropici CIAT 899 synthesises a large variety of Nod factors when induced by flavonoids [19–23], or under abiotic stress conditions in the absence of flavonoids [2023]; surprisingly, Nod factors are also synthesized in the absence of any known inducer [23]. A variety of Nod-factor structures was synthesized by the nodD3,nodD4 and nodD5 mutants (Additional file 1: Table S1, Additional file 2: Table S2 and Additional file 3: Table S3). nodD3 mutant reduced the number of Nod factors under all three conditions, control, when induced with apigenin and uneder saline conditions, while nodD5 mutant had a decrease in the number of Nod factors under control and saline conditions (Table 2). It is noteworthy that nodD4 increased the number of Nod factors in under salinity, without the induction of apigenin. The larger number of Nod factors was observed under saline conditions for the WT and nodD4 mutants, whereas similar numbers were observed with apigenin (Table 2). These results add more evidence to the hypothesis that the large production of Nod factors is related to the well known properties of broad host infectivity and the high tolerance of abiotic stresses of R. tropici,being able to establish symbioses even under harsh environmental conditions [13–16]. In relation to the Nod-factor structures, the mutations in nodD3 ingeneraldidnotresultinchangesinthe molecules produced both in the presence of apigenin and salt. However, in the negative control B − , the number of molecules was drastically reduced, which indicates that nodD3 might be an activator of other regulatory genes such as nodD1 (Additional file 1: Table S1, Additional file 2: Table S2 and Additional file 3: Table S3). Moreover, CIAT 899 produced only two Nod factors deacetyled in the presence of apigenin [V (C 18:1 )dNAcandV(C 18:1 ,NMe) dNAc]. However, the nodD3 mutant produced five deacetyled Nod factors that were not detected in the LCOs biosynthesized by the nodD4 and nodD5 mutants. These results suggest that the nodD3 gene is important for the deacetylation of Nod factors produced by CIAT 899 in the presence of apigenin. Non-deacetylated Nod factors were detected in control and saline conditions (Additional file 1: Table S1, Additional file 2: Table S2 and Additional file 3: Table S3). Interestingly, it has been suggested that hsnT (=noeT) has a role in Nod-factor decoration in Neorhizobium galegae [32]. Under saline stress, in addition to an increase in the LCOs synthesized by the nodD4 mutant, fatty acids of C 14:1 were not found, nor were sulphated molecules of four units of N-acetyl-glucosamine. Not least important, the strong increase in the number of molecules in the nodD4 mutant might indicate that the gene is a repressor of other regulatory genes, such as nodD1 (Additional file 1: Table S1, Additional file 2: Table S2 and Additional file 3: Table S3). For the nodD5 mutant, no quantitative or qualitative differences in LCOs were observed, whereas important Table 2 Number of Nod factors produced by the wild type R. tropici strain CIAT 899 and the nodD3,nodD4 and nodD5 mutants when grown in control B − medium [20], with 3.4 μMof apigenin or salt (NaCl 300 mM). The structures of Nod factors under each condition are shown in Additional file 1: Table S1, Additional file 2: Table S2 and Additional file 3: Table S3 B − medium Apigenin Salt CIAT 899 - WT 11 29 36 nodD3 22125 nodD4 15 22 38 nodD5 83026 del Cerro et al. BMC Genomics (2015) 16:864 Page 4 of 10 differences were detected under saline stress. The mutation not only resulted in a decrease in the number of LCOs, but also the molecules included neither fatty acids C 14:0 ,nor sulphated molecules of 4 units of N-acetylglucosamine. In addition, we did not detect the fatty acids C 20:0 or C 20:1 -V(C 20:0 ,NMe,S);V(C 20:1 ,NMe)andV(C 20:1 , NMe,S), found in the WT, nodD3 and nodD4 strains in the presence of salt. It is worth mentioning that nodD1 and nodD2 mutants also do not produce these factors in the presence of salt [23]. Fatty acids C 20:0 or C 20:1 under salt stress and/or C 14:0 oC 14:1 with apigenin might have the participation of genes detected in the genome of CIAT 899 [25], such as nodE and nodF genes [33]. Consequently, the absence of these fatty acids in nodD5 mutants under saline stress indicates that other regulatory nodD genes were not activated under salt, and nodD1 and nodD2 are strong candidates, as their mutants inhibited the synthesis of these fatty acids. We suggest that nodD5 could be an activator of nodD1 or nodD2 in the presence of salt to allow the expression of genes nodE-nodF. This intricate regulatory mechanism for the production of LCOs involving five nodD genes—demonstrated in our study—seems to have no parallel in other rhizobia, especially under saline stress. As the tropical conditions where R. tropici is abundantly found are often extreme [34], this might indicate a high degree of evolution to allow the symbioses to form and function under harmful conditions. It is also worth mentioning that several other roles have been attributed to LCOs besides being involved in early steps of nodulation. For example, there are reports that LCO effects resemble those of cytokinins [29], that they have a role in mechanisms related to defense against Fig. 2 RT-qPCR analysis of the expression of nodD genes from R. tropici CIAT 899 and derivatives grown under control (B- medium), in the absence and in the presence of apigenin (3.7 μM) or NaCl (300 mM). Expression data shown are the mean (± standard deviation of the mean) of three biological replicates. Data were normalized in relation to the endogenous control (16S rRNA). The asterisks indicate a statistically significant expression at the level α= 5 %, determined by REST2009 software. Light gray bars: wild type strain, black bars: mutant. a,bexpression induced in the nodD3 mutant; c,dexpression induced in the nodD4 mutant; e,fexpression induced in the nodD5 mutant del Cerro et al. BMC Genomics (2015) 16:864 Page 5 of 10 disease [35, 36] and seed germination [37]; therefore, the role of LCO structure in phenotype determination deserves further investigation. Gene expression We performed gene-expression studies with the wild type and nodD3,nodD4 and nodD5 mutants. In these studies we evaluated the expression of nodC—which controls the elongation of the oligosaccharide chain of Nod factors and is transcribed with the activation of nod genes [8]—of the nodD1 gene and of each of the three nodD genes, to improve our understanding of the roles of these three genes. As expected, endogenous expression of all nodD genes was consistently low, as these genes are constitutively expressed. In addition, the expression of each nodD gene corresponding to each nodD mutation was confirmed as null (Fig. 2). Significant expression of nodC for both the WT and the nodD3 mutant was verified, of 42- and 58-fold, respectively, when induced by apigenin, and, although at basal low levels, nodD1 expression was significantly increased in the WT strain (Fig. 2a). Under saline stress, amutationinnodD3 decreased both nodC and nodD1 expression, confirming the results obtained with Nod factors, that nodD3 is an activator of nodD1, especially under saline conditions (Fig. 2b). The picture obtained with nodD4 was somewhat different. A mutation in nodD4 resulted in a 3-fold decrease, but not in total inhibition of expression of nodC with apigenin; therefore, the results indicate an activation role in the presence of apigenin (Fig. 2c). However, in saline conditions, nodD4 expression in the WT strain was down-regulated, indicating a repressor role, that was confirmed by an increase of 3.35-fold on nodC expression when the gene was mutated Fig. 2d. Therefore, under apigenin nodD4 acted as an activator and under salt stress as a repressor of other nod genes (Fig. 2c, d). In relation to nodD5, the gene proved to be an inducer, increasing the expression of both nodC and nodD1 in the presence of both the inducer molecule apigenin (Fig. 2e) and salt stress (Fig. 2f). These results are consistent with the results based on the synthesis of Nod factors. Phylogeny of nodD genes A phylogenetic tree was built to verify the similarities between the five copies of nodD genes of CIAT 899, helping to add information about these genes. Figure 3 shows that nodD2 gene of CIAT 899 is positioned in a different cluster from the other nodD genes, showing full similarity with the nodD2 of R. freirei PRF 81, that belongs to the “R. tropici group”[38]. Within the same great cluster of the phylogenetic tree, but positioned in another subgroup was the nodD3 genes of R. etli sv phaseoli. The other four copies of nodD genes of CIAT 899 were positioned in another great cluster, each one showing full identity with the correspondent nodD gene of R. freirei. Fig. 3 Phylogenetic tree of representatives nodD genes of some relevant rizobia. The branchs length represents the evolutionary lineages changing over time. The length of the brach represents the amount of changes and it is proportional to the number of nucleotide substitutions per site. The bar at the bottom of the figure provides a scale for the evolution. The numbers next to each node represent a measure of support for the node (between 0 and 1). A high value means that there is strong evidence that the sequences to the right of the node cluster together to the exclusion of any other. Phylogenetic tree was built as described in the Methods section. In this phylogenetic tree, nodD1 to nodD5 CIAT 899 correspond to Rhizobium tropici CIAT 899 nodD genes; nodD1 to nodD5 PRF 81 correspond to Rhizobium freirei PRF 81 nodD genes; nodD1 to nodD3 IE 4803 correspond to Rhizobium etli sv. phaseoli IE 4803 nodD genes; nodD1 to nodD3 1021 correspond to Sinorhizobium meliloti 1021 nodD genes; and nodD1 and nodD2 USDA 76 correspond to Bradyrhizobium elkanii USDA 76 nodD genes. del Cerro et al. BMC Genomics (2015) 16:864 Page 6 of 10 Therefore, apparently nodD2 had a different evolutionary history from the other nodD genes, and as we pointed out before, one important host legume, leucaena does not need nodD2 for full nodulation, while common bean does. One hypothesis is that nodD2 could have been acquired in the evolutionary process of getting the ability to nodulate common bean. Why five nodD genes? In contrast to what we have previously reported for nodD1 and nodD2 [23], nodD3,nodD4 and nodD5 of R. tropici CIAT 899 did not affect phenotypic traits such as motility or of IAA synthesis. However, they contributed to the intricate regulatory mechanism of nodulation of different host plants that, overall, may require from one to four genes. It remains to be determined if all five genes contribute to the nodulation of common bean, since minor, but not statistically significant, decreases in nodulation were observed with nodD3,nodD4 and nodD5 mutants. Apparently the increased number of Nod factors and the activation of nodD1 and nodC genes under abiotic stress may be critical for nodulation under abiotic stresses or for enlargement of host range, guaranteeing the survival of both symbiotic partners under harsh environmental conditions. It is surprising that one major host, common bean, releases so many nod-gene-inducing molecules [17, 18, 39] and that a main rhizobial symbiont synthesizes so many Nod factors by the action of five nodD genes. The results previously obtained with hosts such as leucaena and siratro—and now confirmed with Lotus spp.—where nodD1 played the major role adds weight to the hypothesis that common bean is not the main host for R. tropici [23]. One important observation was that the phylogenetic comparisons of nodD genes positioned nodD2 in a different cluster from the other nodD genes, what might indicate an evolution in the process of getting the ability to nodulate common bean, the requires both nodD1 and nodD2 genes, contrary to hosts as leucaena. Sharing the nodulation responsibility with more than one nodD gene,as is the case with common bean, suggests the ultimate evolution of the symbiosis, guaranteeing that nodulation occurs under abiotic stresses. Conclusions R. tropici CIAT 899 is an intriguing rhizobia with high tolerance of environmental stresses, the ability to nodulate a broad range of legume hosts and carrying five copies of the regulatory nodD gene [34]. The role of three nodD genes of CIAT 899 was investigated for the first time in this study. nodD3 and nodD5 were identified as activators of the nodD1 gene, whereas nodD4 might act as repressor or inducer, depending on the inducing environment. A large variety of Nod factors was produced by the three mutants when induced by apigenin or salt stress, and also in the absence of any inducer. We may hypothesize that the high number of nodD copies and the synthesis of many Nod factors might help R. tropici both in enhancing the host range and in the ability to nodulate the hosts under harsh environmental conditions. Methods Bacterial strains, plasmids, media, and growth conditions Rhizobium tropici CIAT 899 and derivative strains (nodD3, nodD4 and nodD5 mutants) were grown at 28 °C on tryptone yeast (TY) medium [40], B − minimal medium [20] or yeast-extract mannitol (YM) medium [41], supplemented when necessary with apigenin to a final concentration of 3.7 μM or with NaCl at 300 mM. Escherichia coli strains were cultured on Luria-Bertani (LB) medium [42] at 37 °C. When required, the media were supplemented withtheappropriateantibioticsasdescribedbyLamrabet et al. [43]. The same strategy described before for obtaining nodD2 mutants of R. tropici CIAT 899 [23] was now used to obtain nodD3,nodD4 and nodD5 mutants by the insertion in the ORF of these genes of the Ωinterposon (carrying the spectinomycin resistance gene (spc R 100 μgmL −1 ). Briefly, pair primers nodD3-F (5′–GAG CTA CCT CGA CTG CTA) and nodD3-R (5′–CTA CCG CCA TGA TCA CCA) were used for amplifying nodD3 gene. The 1500-bp PCR product was cloned in pGEM ® -T Easy (PROMEGA) (Amp R 100 μgmL −1 ). The PCR-amplified nodD3 fragment was cutted with the endonuclease SmaI, which cut the nodD3 gene in one site, disrupting it. The obtained DNA was ligated with Ω,whichwaspreviouslydigested with the SmaI enzyme. The ligation mixture was transformed into E. coli strain DH5α.ThenodD3::Ωfragment (3,5 Kb) was excised from pGEM ® -T Easy with the endonuclease EcoRI and cloned in the vector pK18mob [44], that confers resistance to kanamycin (km R 30 μgmL −1 ), equally restricted with EcoRI. Pair primers nodD4-F (5′–CTG TCG CTC TGA TAT TCG A) and nodD4-R (5′–ATA GGA CAG CCT TGG CAA) were used for amplifying nodD4 gene. The 1497-bp PCR product was cloned in pGEM ® -T Easy. The PCR- amplified nodD4 fragment was excised from pGEM ® -T Easy with the endonuclease EcoRI and cloned in the vector pK18mob equally restricted with EcoRI. In order to eliminate a SalI site in the polylinker of pK18mob, the plasmid was cut with SmaIandHindIII and religated. The plasmid containing the PCR-amplified nodD4 fragment was cut with the endonuclease SalI, which disrupt the nodD4 gene in one site and then was treated with the Klenow enzyme. The obtained DNA was ligated with the Ωinterposon, which was previously digested with the SmaI enzyme. The ligation mixture was transformed into E. coli strain DH5α. Pair primers nodD5-F (5′–GCT CTT TCT TTC CCA CCA A) and nodD5-R (5′–GAT CTG CCG ATG GCT CA) were used for amplifying nodD5 gene. The 1478-bp del Cerro et al. BMC Genomics (2015) 16:864 Page 7 of 10 PCR product was cloned in pGEM ® -T Easy. The PCR- amplified nodD5 fragment was excised from pGEM ® -T Easy with the endonuclease EcoRI and cloned in the vector pK18mob equally restricted with EcoRI. This plasmid was digested with the enzyme XhoI, which cut the nodD5 gene in two sites, releasing a fragment of approximately 18 pb. Rest of the plasmid was treated with Klenow enzyme to convert the cohesive end generated by the enzyme to a blunt end. The obtained DNA was ligated with the Ω interposon, which was previously digested with the SmaI enzyme (blunt end). The ligation mixture was transformed into E. coli strain DH5α. In all cases, plasmids harbouring mutation in the nodD3, nodD4 and nodD5 genes, were transferred from E. coli to Rhizobium strains by conjugation as described by Simon [45] using plasmid pRK2013 [46] as helper. The plasmid generated was used for the homogenotization of the mutated version of the nodDs gene in R. tropici CIAT 899 by using the methodology previously described [47]. The homogenotization was confirmed by DNA-DNA hybridization. For this purpose, DNA was blotted to Hybond-N nylon membranes (Amersham, UK), and the DigDNA method of Roche (Switzerland) was employed according to the manufacturer’s instructions. A scheme of the mutation generated in the nodD3,nodD4 and nodD5 genes are shown in Fig. 1. It is worth mentioning that growth rate was not affected by mutation in nodD3, nodD4, or nodD5 genes; in addition, for the target mutagenesis of nod genes external primers were chosen that would allow to specifically amplify both genes, what was possible because the intergenic regions flanking both genes have different sequences. Therefore, the different phenotypes observed in both mutants are caused by loss of function of these genes. The parental and mutant strains are deposited in the culture collection of the Department of Biology of the Universidad de Sevilla and at the Diazotrophic and Plant Growth Promoting Bacteria Culture Collection of Embrapa Soja (WFCC Collection # 1213, WDCM Collection # 1054). Identification of nod factors Purification and LC-MS/MS analyses of Nod factors produced by R. tropici CIAT 899 and derivative strains growninB − minimal medium (supplemented when required with NaCl 300 mM or apigenin 3.7 μM) were performed as described previously [22]. RNA isolation, cDNA synthesis and quantitative RT-PCR Wild-type CIAT 899 and mutants strains were precultured in 10-mL aliquots of TY medium at 100 rpm and 28 °C in the dark. After 48 h, the three strains preinoculated were transferred to new media and subjected to the following conditions: control (without induction), 300 mM NaCl and apigenin 3.7 μM. These new cultures were performed in triplicate under the same conditions as for the pre-cultures, 100 rpm and 28 °C in the dark, except that were grown into the exponential phase (O.D. at 600 nm of 0.5 to 0.6). Total RNA was extraction, verification of concentration and integrity and synthesis of cDNA were performed as described before Primers for the RT-qPCR targets, genes nodD1,nodD3, nodD4, nodD5 and nodC,weredesigned using Primer3Plus (http://www.bioinformatics.nl/cgi-bin/ primer3plus/primer3plus.cgi/), to obtain amplicons of 50– 150 bp. With the same software, a primer to 16S rRNA was obtained and applied to normalize the relative expression of the targets. To avoid unspecific alignments, the primer sequences were searched against the R. tropici CIAT 899 genome (http://www.ncbi.nlm.nih.gov/nuccore/ 440224888?report=genbank). The primer sequences and sizes of the amplified fragments are available in Additional file 4: Table S4. RT-qPCR reactions were performed as described before [23]. Rest2009 software package [48] was used to evaluate the data by providing a robust statistical analysis (p< 0.05). The normalization of cycle threshold (Ct) of RT-qPCR amplifications was performed based on the selected endogenous gene (16S rRNA). Phenotypic traits Analysis of exopolysaccharide (EPS), lipopolysaccharide (LPS), swimming and swarming phenotypes, biofilm formation and quantification of indole acetic acid (IAA) production were perfomed as described before [23]. Nodulation assays For the evaluation of the symbiotic phenotypes, wild-type R. tropici strain CIAT 899 and nodD1, nodD2, nodD3, nodD4 and nodD5 mutants were grown in YM medium until a concentration of 10 9 cells mL −1 was achieved, to be used as inoculum. Surface-sterilized seeds [41] were used for the assays with common bean (Phaseolus vulgaris L.), leucaena [Leucaena leucocephala (Lam.) de Wit] and siratro [Macroptilium atropurpureum (DC) Urb.], Lotus burtii Borsos, and Lotus japonicus (Regel) K.Larsen. Pregerminated seeds (about 2 days after germination) were placed in sterilized pouches or Leonard jars containing N- free nutrient solution [41], with 1 mL of inoculum of each strain added and verified for nodulation capacity after 25 (common bean), 42 days (leucaena and siratro) and 50 days (Lotus japonicus and Lotus burtii) with a 16-h 25 °C/18 °C photoperiod and about 70 % relative humidity. Shoots were dried at 65 °C until constant weight was achieved, and then weighed. Experiments were performed three times. Phylogenetic tree construction Phylogenetic tree was obtained by using online plataform (http://phylogeny.lirmm.fr/phylo_cgi/) [49]. Nucleotide del Cerro et al. BMC Genomics (2015) 16:864 Page 8 of 10 last set of genes coded for proteins with unknown functions (Fig. 4, Additional file 4). Therefore, at least two main biological processes were activated in CIAT 899 when induced with apigenin: the synthesis of NF (nodA1BCSUIJHPQ1Q2 and nodA2hsnTnodFE genes) and the production of IAA (y4wEF genes). Of special interest is the elucidation of the symbiotic role of the set of genes with unknown function activated with apigenin (RTCIAT899_PB01550 and RTCIAT899_ PB01545). In summary, these results indicate that when induced with apigenin, CIAT 899 is able to synthesize NF that will induce root nodule primordia formation, as well as phytohormones that will favor root development. This is consistent with a recent study in which an increase in the production of IAA is reported when CIAT 899 is grown in cultures supplemented with both apigenin and salt [20]. A similar regulation cascade involving NodD1 and flavonoids has been reported in Sinorhizobium fredii NGR234 for the synthesis of IAA [25]. Common responses: synthesis of nodulation molecules and identification of nod boxes As previously mentioned in the introduction, the capacity to nodulate under salt stress conditions has been described for many rhizobial strains [15]. However, the salt-regulated production of NF has been only reported for R. tropici CIAT 899. Are the CIAT 899 genetic pathways to synthesize NF under salt stress similar to those described for apigenin? The RNA-seq analysis shown in this work indicated that although the pattern of symbiotic gene activation in the presence of salt was similar to that obtained with apigenin (Fig. 4, Additional files 4 and 5), slightly higher expressions of nod genes, with an emphasis on the nodA1 operon, was observed when the bacterium was induced with salt (Table 2). Moreover, under salt stress nodM and a gene that codes for a flavine mononucleotide reductase (RTCIAT899_PB02705) were significantly up-regulated. Although the upregulation of nodM was not detected in the RNA-seq of CIAT 899 grown in the presence of apigenin, it was detected in the qRT-PCR analysis (5.69 fold-change) (Table 1). All these results indicate that the transcription of the CIAT 899 nod genes seems to respond similarly to the presence of either apigenin or salt (Table 2). The question that remains unclear is whether the responses observed follow the common NodD activation pathway. To answer this question, an in silico analysis to detect promoter motifs was conducted using consensus sequences Fig. 2 R. tropici CIAT 899 responses to apigenin and salt stress. Venn diagram showing the overlapping of differentially expressed genes in the presence of inducer molecules. The arrows indicate the number of up-regulated and down-regulated genes in each treatment, being the number of overlapping intersections indicative of genes expressed in both conditions Fig. 3 Number of regulated genes from each over-represented biological process (Gene Onthology, GO). Biological processes and number of genes affected in bacterial cultures supplemented with apigenin (yellow) aor salt (blue) (b). Over-represented functional categories were those with a pvalue in hypergeometrical test inferior to 0.15 Pérez-Montaño et al. BMC Genomics (2016) 17:198 Page 5 of 11 of nod boxes (NB) present in other related rhizobial strains. Thus, ten potential NB were identified, all sharing the AT-N 11 -AT-N 7 -AT-N 2 -A-N 4 -AT-N 2 -ATT-N-T sequence consensus (Fig. 5). Four of these NB were situated upstream of the four different sets of genes upregulated under both inducing conditions, namely, the operons nodA1BCSUIJHPQ1Q2 (NB1), nodA2hsnT- nodFE (NB2), y4wEF operon (NB4) and the nodM gene (NB3) (Table 3, Additional files 4 and 5). Interestingly, two of the genes previously identified as up-regulated with apigenin (RTCIAT899_PB01550 and RTCIAT899_ PB01545) were also induced with salt. The expression of one of these genes (RTCIAT899_PB01545) was validated by qRT-PCR in the presence of both apigenin (8.88-fold) and salt (18.11-fold) (Table 1). This gene expression, combined with the fact that both genes were located downstream NB5, indicate that these hypothetical proteins could be playing a role in the symbiotic process (Table 3, Additional files 4 and 5). Finally, NB7 was located upstream a gene (RTCIAT899_PB01055) upregulated with salt, but not with apigenin (Table 3, Additional file 5). Altogether, these results suggest that when CIAT 899 was induced either by apigenin or salt, genes related to Fig. 4 Circular representation of the complete RNA-seq-based transcriptomic data set of apigenin and salt cultures versus standard cultures for all replicons of R. tropici CIAT 899. Fold-change values of consecutive genes are represented by linked peaks. Each peak corresponds to one gene, being ordered according to their relative position in the replicon. Yellow peaks: differentially expressed genes in the presence of apigenin. Blue peaks: differentially expressed genes under salt stress. The arrows indicate names and related biological processes of some differentially expressed genes. NB: nod box. aChromosome (3.8 Mb), bpRtrCIAT899a (0.22 Mb), cpRtrCIAT899b (0.55 Mb), dpRtrCIAT899c (2.08 Mb) Pérez-Montaño et al. BMC Genomics (2016) 17:198 Page 6 of 11 the synthesis of NF and IAA were activated through the recognition of specific nod boxes (Table 2). In S. fredii NGR234, nineteen nod boxes have been identified and eighteen of them were inducible with flavonoids via NodD1. In addition, S. fredii NGR234 carries two copies of the nodD gene and four of these nod boxes are controlled by NodD2 [26]. Salt stress response: a pathway towards symbiosis? Chromosomal RNA-seq analysis showed, under salt stress, an up-regulation of genes whose products are implied in the formation of ribosomes (both 30 and 50S ribosomal proteins coded by the rpl and rps genes, respectively) and in the utilization of the disaccharide trehalose (thuAB genes), an osmotic stabilizer [27, 28]. Instead, down-regulation was detected in genes that encode proteins involved in chemotaxis (cheXYAWRBYD genes) [29], formation of Flp-type pili (type IVb protein secretion system; tadBCD and cpaABCDEF genes) [30], or ABC-type transport (several genes: e.g. phn genes). In addition, a set of genes located in pRtrCIAT899c and involved in the export of capsular polysaccharide across the inner membrane (genes of the family bexC/ ctrB/kpsE) was also down-regulated (Fig. 4, Additional file 5) [31]. Therefore, the global response of CIAT 899 to salt stress indicates that the strain drastically reduces the uptake of molecules and the energy consumption, reducing the ATP-dependent transport of the ABC-type permeases. However, under saline shock conditions R. etli CE3 over-expresses genes that code for many ABC transporters and increases the transcription levels of genes related to the biosynthesis of trehalose [16]. Nevertheless, in CIAT 899 an up-regulation of genes involved in the degradation of trehalose was detected. The explanation could be that this osmolyte tends to accumulate during symbiosis, but it is toxic to plants. To solve this problem, bacteria would produce trehalose-degrading enzymes [32]. These observations in CIAT 899, combined with the production of NF and IAA under salt stress, make us formulate the next question: could the promotion of the symbiosis represent a strategy of CIAT 899 to ensure nodulation under this abiotic stress condition? To shed light on this question we have analyzed the changes in biological processes under saline conditions. First, we observed an enhancement in ribosomal synthesis, which could be related to a translation increase due Table 2 Fold-change expression values of the R. tropici CIAT 899 nod genes on the RNA-seq analysis. Fold-change values followed by an asterisk (*) are significantly over-expressed Gene name/Locus tag Apigenin Salt nodD1/RTCIAT899_PB01295 1.23 1.04 nodD2/RTCIAT899_PB01070 −1.25 3.01 nodD3/RTCIAT899_PB00640 −1.21 2.1 nodD4/RTCIAT899_PB01560 1.09 1.16 nodD5/RTCIAT899_PB00560 −1.12 −1.09 nodA1/RTCIAT899_PB01300 8.73* 13.66* nodB/RTCIAT899_PB01305 11.4* 19.01* nodC/RTCIAT899_PB01310 6.69* 12* nodS/RTCIAT899_PB01315 7.53* 12.89* nodU/RTCIAT899_PB01320 5.39* 10.18* nodI/RTCIAT899_PB01325 6.59* 12.48* nodJ/RTCIAT899_PB01330 4.98* 10.15* nodH/RTCIAT899_PB01340 3.09 7.6* nodP/RTCIAT899_PB01345 2.78 6.08* nodQ1/RTCIAT899_PB01350 3.25 6.39* nodQ2/RTCIAT899_PB01355 1.28 2.54 nodA2/RTCIAT899_PB01095 10.3* 9.81* hsnT/RTCIAT899_PB01100 7.27* 5.94* nodF/RTCIAT899_PB01105 13.39* 13.43* nodE/RTCIAT899_PB01110 10.37* 11.94* nodA3/RTCIAT899_PB00645 1.15 3.36 nodM/RTCIAT899_PB02710 2.43 5.85* Fig. 5 Alignment of NB sequences from R. tropici CIAT 899. Software fuzznuc of the EMBOSS package was used to identify nod box-like sequences. Hits were selected based on their conservation to previously identified NB sequences. Searching of these consensus sequences was carried out on the whole genome of R. tropici CIAT 899. DNA sequences were aligned using the ClustalW program and manipulated with Boxshade at EMBnet. Dark and gray boxes indicate identical and similar nucleotides, respectively. Promoter consensus motifs are marked with an asterisk on the consensus line Pérez-Montaño et al. BMC Genomics (2016) 17:198 Page 7 of 11 to an increase in the transcription of nodulation genes (a stronger nod gene up-regulation was detected in salt stress conditions). Second, general protein secretion systems and surface polysaccharides seem to play an important role in bacterial fitness under stressing environmental conditions, such as high salinity or temperature [16, 23, 24]. However, in CIAT 899 we observed inhibition under salt stress. Remarkably, both cellular components can also be considered microbeassociated molecular patterns (MAMP), which trigger the plant immune system [33]. Other rhizobial strains in the presence of inducer flavonoids modify their surface molecules to avoid plant immune responses, thereby promoting nodulation [34]. Finally, when colonizing legume roots many rhizobia form micro-colonies or biofilms. In some of these rhizobia common nod genes are required for the development of these structures, since the biofilm matrix is composed in part by NF [35, 36]. Thus, in CIAT 899, the synthesis of NF and the downregulation of chemotaxis genes detected under saline conditions could be related to the formation of a symbiotic biofilm. In summary (Fig. 6), these results suggest that in the presence of salt CIAT 899 could strategically increase the transcription of nodulation genes and the synthesis of NF to increase the chances to establish symbiosis even under abiotic stressing conditions. Conclusions Our work shows that in the presence of the nodulation inducing molecules apigenin (3.7 μM) and salt (300 mM), R. tropici CIAT 899 increases the transcription of the same set of genes (slightly higher expression upon salt treatment), whose encoded proteins are involved in the synthesis of symbiotic molecules. Besides, the saltdependent production of these symbiotic molecules could be a CIAT 899 strategy to ensure nodulation under salt stress. Methods Culture conditions and RNA extraction R. tropici CIAT 899 was grown for 72 h at 28 °C on tryptone yeast (TY) medium [37], supplemented with apigenin 3.7 μM or NaCl 300 mM when necessary (induction of the synthesis of NF) [14, 20]. Total RNA was isolated using a High Pure RNA Isolation Kit (Roche), according to the manufacturer’s instructions. Verification of the amount and quality of total RNA samples was carried out using a Nanodrop 1000 spectrophotometer (Thermo Scientific) and a Qubit 2.0 Fluorometer (Invitrogen). Two independent total RNA extractions were obtained for each condition. Quantitative reverse transcription PCR Result obtained in the RNA-seq analysis were validated by quantitative reverse transcription PCR (qRT-PCR) of 20 selected genes, which represented differentially and non-differentially expressed genes in the presence of apigenin and salt. Total RNA was isolated using a High Pure RNA Isolation Kit (Roche) and RNAase Free DNA Set (Qiagen), according to the manufacturer’s instructions. This (DNA-free) RNA was reverse transcribed into cDNA using a QuantiTec Reverse Transcription Kit (Qiagen). Quantitative PCR was performed using a LightCycler 480 (Roche) with the following conditions: Table 3 Up-regulation of the R. tropici CIAT 899 pRtCIAT899b genes located downstream nod boxes. Transcriptional activation (4-fold induction with respect to control cultures) of several nod box controlled operons was demonstrated by RNA-seq data in the presence of both inducer molecules. HP: gene that codes for a hypothetical protein NB (Distance) Cds number/Locus tag/Gene name Putative function Fold changeapigenin Fold changesalt 1 (270 pb) cds216 to 227/RTCIAT899_ PB01300 to RTCIAT899_ PB01345/nodABCSUIJHPQ1Q2 NF production 8.73 to 1.28 13.66 to 2.54 2 (250 pb) cds177 to 180/RTCIAT899_ PB01095 to RTCIAT899_ PB01110/nodA2hsnTnodFE NF production 10.3 to 10.37 9.81 to 11.94 3 (180 pb) cds450 to 449/RTCIAT899_ PB02710 to RTCIAT899_ PB02705/nodM NF production 2.43 to 3.18 5.85 to 8.49 4 (680 pb) cds95 to 93/RTCIAT899_PB00575 to RTCIAT899_ PB00565/y4wEF Synthesis of IAA 8.57 to 1.63 12.17 to 3.27 5 (38 pb) cds263 to 262/RTCIAT899_PB01550 to RTCIAT899_ PB01545/HP Unknown 6.75 to 4.26 28.65 to 14.37 6 (70 pb) cds61 to 62/RTCIAT899_PB00370 to RTCIAT899_ PB00375/HP Unknown 1.80 to 2.11 2.17 to 1.64 7 (191 pb) cds170/RTCIAT899_PB01055/HP Unknown 1.18 5.68 8 (470 pb) cds81/RTCIAT899_PB00495/HP Unknown −1.05 2.58 9 (979 pb) cds173/RTCIAT899_PB01570/nodD2 Transcriptional regulation −1.25 3.01 10 (292 pb) cds89/RTCIAT899_PB00540/HP a Unknown 1.13 −1.44 a The transcriptional orientation of this gene is opposite to the NB10 sequence orientation Pérez-Montaño et al. BMC Genomics (2016) 17:198 Page 8 of 11 95 °C, 10 min; 95 °C, 30 s; 50 °C, 30 s; 72 °C, 20 s; forty cycles, followed by the melting curve profile from 60 to 95 °C to verify the specificity of the reaction. The R. tropici CIAT 899 16S rRNA gene was used as an internal control to normalize gene expression. The fold-changes of two biological samples with three technical replicates of each condition were obtained using the ΔΔC t method [38]. Selected genes and primers are listed in Additional file 2. RNA sequencing Ribosomal RNA was depleted using a MICROB Express Bacterial mRNA Purification kit (Ambion), following the manufacturer’s protocol. Integrity and quality of the ribosomal depleted RNA was checked with Agilent Bioanalyzer 2100 (Agilent Technologies). RNA sequencing was carried out by Sistemas Genómicos (https:// www.sistemasgenomicos.com/web_sg/) with the Next Generation Sequence (NGS) platform Illumina using the Illumina HiSeq 2000 sequencing instrument (Illumina). Ribosomal-depleted samples were used to generate whole transcriptome libraries following the manufacturer's recommendations for sequencing on this NGS platform. Amplified cDNA quality was analyzed by the Bioanalyzer 2100 DNA 1000 kit (Agilent Technologies) and quantified using the Qubit 2.0 Fluorometer (Invitrogen). Mapping of the RNA-seq data The initial whole transcriptome paired-end reads obtained from sequencing were mapped against the latest version of the R. tropici CIAT 899 genome (http:// www.ncbi.nlm.nih.gov/genome/?term=Rhizobium_tropi- ci_CIAT_899) using the the Life Technologies mapping algorithm version 1.3 (http://www.lifetechnologies.- com/). Low-quality reads were eliminated using Picard Tools software version 1.83, remaining only high quality reads. Assessment of differentially expressed genes Gene prediction was estimated using the cufflinks method [39] and the expression levels were calculated using the htseq software, version 0.5.4p3 [40]. This method eliminates multimapped reads, considering only unique reads for the gene expression estimation. The edge method version 3.2.4 was applied for differential expression analysis among conditions [41]. This method uses a Poisson model to estimate the variance of the RNA-seq data for differential expressions, and relies on different normalized processes based on depth global samples, CG composition and length of genes. Differentially expressed genes were established in those genes with a fold-change lower or higher than−4 or 4, respectively, with a pvalue adjust to 0.7. Fig. 6 Model of the Rhizobium tropici CIAT 899 transcriptomic response under salt stress. RNA-seq studies indicate that in the presence of high concentration of salt CIAT 899 increase the transcription of nodulation genes and the synthesis of NF. Transcriptional activation (+) or inhibition (−) of other biological processes associated with the presence of salt supports the hypothesis that salt-dependent production of NF could be a special R. tropici CIAT 899 strategy to ensure nodulation under salt stress conditions. HP: gene that codes for a hypothetical protein Pérez-Montaño et al. BMC Genomics (2016) 17:198 Page 9 of 11 Functional categorization of genes In order to assign the statistical over-represented functional categories in the presence of both nod geneinducing molecules, an enrichment functional study was performed. Thus, genes were annotated using Uniprot databases and a hypergeometrical test using all genes as background and differential gene expression as interesting group of genes was applied [42]. This statistical test calculates the statistical significance using pvalue [43], being in this case evaluated the significance of functional categories. Those functional categories (biological processes) with a pvalue inferior to 0.15 were considered over-represented. Consensus motifs The program fuzznuc of the EMBOSS package was used to identify nod box-like sequences. Hits were selected based on their conservation to known NB sequences [44, 45]. Thus, the search pattern used was at[ct][cg][ag]n(5)[tc][- ga][ga]atn(7)at[ct]caaacaatc[ga]attttncn(2)at, allowing a maximum of 3 mismatches. Searching of these consensus sequences was carried out on the whole genome of CIAT 899. Alignment of the NB sequences was performed using ClustalW at EMBnet. RNA-seq data accession number The RNA-seq data discussed in this publication have been deposited in the Sequence Read Archive of NCBI under the accession number SRP067561. Additional files Additional file 1: General features of the total sequenced and mapped reads. Reads were mapped using a Bayesian inference using Cufflinks v2.11 software. Worst quality reads were removed by means of Picard Tools (See the Material and Methods section) (PDF 185 kb) Additional file 2: Correlation degrees between RNA-Seq and qRT-PCR experiments. qRT-PCR and RNA-seq fold-change values of 20 selected genes were represented in a graphic to obtain the correlation degrees in both conditions. Genes and primer sequences are shown (XLS 38 kb) Additional file 3: Functions (Gene Onthology, GO) associated to R. tropici CIAT 899 responses to apigenin and salt.A hypergeometric test performed in the platform R (See the Material and Methods section) was carried out to assign the statistical over-represented functional categories in presence of both nod gene inducing molecules (XLSX 11 kb) Additional file 4: Whole genome differential expression in R. tropici CIAT 899 cultures supplemented with apigenin. Python and R were used to study differential expression among sample groups. Algorism proposed by DESeq2 was used for gene differential expression, taking as a dispersion model a negative binomial distribution. Differentially expressed genes were established in those genes with a fold change lower or higher than−4 or 4, respectively (See the Material and Methods section). Fold-change values are represented by bars. Each bar corresponds to one gene and they are ordered according to their relative position in each replicon. Blue bars: genes not differentially expressed. Yellow bars: differentially expressed genes. The arrows indicate names of some differentially expressed genes. Ch: chromosome, pC: pRtrCIAT899c, pB: pRtrCIAT899b, pA: pRtrCIAT899a (XLSX 750 kb) Additional file 5: Whole genome differential expression in R. tropici CIAT 899 cultures supplemented with salt. Python and R were used to study differential expression among sample groups. Algorism proposed by DESeq2 was used for gene differential expression, taking as a dispersion model a negative binomial distribution. Differentially expressed genes were established in those genes with a fold change lower or higher than−4or4, respectively (See the Material and Methods section). Fold change values are represented by bars. Each bar corresponds to one gene and they are ordered according to their relative position in each replicon. Blue bars: genes not differentially expressed. Yellow bars: differentially expressed genes. The arrows indicate names of some differentially expressed genes. Ch: chromosome, pC: pRtrCIAT899c, pB: pRtrCIAT899b, pA: pRtrCIAT899a (XLSX 654 kb) Competing interests The authors declare that they have no competing interests. Authors’contributions MH, MM and FJO conceived and designed the experiments. PDC, IJG and FPM performed the experiments. PDC, IJG and FPM analyzed the data. FJLB, MM and FJO contributed with reagents/materials/analysis tools. FJLB, TC, FJO and FPM wrote the paper. All authors have read and approved the final manuscript. Acknowledgements We would like to thank the Ministerio de Economía y Competitividad of the Spanish government (project AGL2012-), the Junta de Andalucía (project P11-CVI-7050) and the University of Seville (VPPI) for funding this work. Mr. Del Cerro is recipient of an FPU fellowship of the Ministerio de Economía y Competitividad. Dr. Pérez-Montaño is recipient of a post-doctoral contract of the VPPI of the University of Seville. Dr. Hungria is a research fellow of CNPq- Brazil. We also would like to acknowledge Dr. Juan Carlos Treviño (Sistemas Genómicos S.L.) for his help during all the bioinformatic analysis and Dr. Jonathan Trow (Sequence Read Archive from NCBI) for his technical assistance during the RNA-seq data submission. We thank the Servicio General de Biología of the CITIUS from the University of Seville for allowing us to use their laboratory equipment. Author details 1 Departamento de Microbiología, Facultad de Biología, Universidad de Sevilla, Avenida Reina Mercedes n° 6, 41012 Sevilla, Spain. 2 Embrapa Soja, Londrina, Paraná, Brazil. Received: 15 October 2015 Accepted: 25 February 2016 References 1. Broughton WJ, Jabbouri S, Perret X. Keys to symbiotic harmony. J Bacteriol. 2000;182:5641–52. 2. Oldroyd GE. Speak, friend, and enter: signaling systems that promote beneficial symbiotic associations in plants. Nat Rev Microbiol. 2013;11:252–63. 3. Black M, Moolhuijzen P, Chapman B, Barrero R, Howieson J, Hungria M, et al. The genetics of symbiotic nitrogen fixation: comparative genomics of 14 rhizobia strains by resolution of protein clusters. Genes. 2012;3:138–66. 4. van Hameren B, Hayashi S, Gresshoff PM, Ferguson BJ. Advances in the identification of novel factors required in soybean nodulation, a process critical to sustainable agriculture and food security. J Plant Biol Soil Health. 2013;1:6. 5. Hungria M, Phillips DA. Effects of a seed color mutation on rhizobial nodgene-inducing flavonoids and nodulation in common bean. Mol Plant- Microbe Interact. 1993;6:418–22. 6. Phillips DA, Joseph CM, Maxwell CA. Trigonelline and stachydrine released from alfalfa seeds activate NodD2 protein in Rhizobium meliloti. Plant Physiol. 1992;99:1526–31. 7. Cooper JE. Early interactions between legumes and rhizobia: disclosing complexity in a molecular dialogue. J Appl Microbiol. 2007;103:1355–65. 8. Martínez-Romero E, Segovia L, Mercante FM, Franco AA, Graham P, Pardo MA. Rhizobium tropici, a novel species nodulating Phaseolus vulgaris L. Beans and leucaena sp. Trees. Int J Syst Bacteriol. 1991;41:417–26. Pérez-Montaño et al. BMC Genomics (2016) 17:198 Page 10 of 11 9. Gomes DF, Ormeño-Orrillo E, Hungria M. Biodiversity, symbiotic efficiency and genomics of Rhizobium tropici and related species. In: De Bruijn F, editor. Biological nitrogen fixation. vol.2. Chapter 74. New Jersey: Wiley; 2015. p. 747–56. 10. Poupot R, Martínez-Romero E, Promé JC. Nodulation factors from Rhizobium tropici are sulfated or nonsulfated chitopentasaccharides containing an N- methyl-N-acylglucosaminyl terminus. Biochemistry. 1993;32:10430–5. 11. Garcia MLJ, Dunlap J, Loh J, Stacey G. Phenotypic characterization and regulation of the nolA gene of Bradyrhizobium japonicum. Mol Plant Microbe Interact. 1996;9:625–35. 12. Estévez J, Soria-Díaz ME, de Córdoba FF, Morón B, Manyani H, Gil A, et al. Different and new Nod factors produced by Rhizobium tropici CIAT899 following Na + stress. FEMS Microbiol Lett. 2009;293:220–31. 13. Morón B, Soria-Díaz ME, Ault J, Verroios G, Noreen S, Rodríguez-Navarro DN, et al. Low pH changes the profile of nodulation factors produced by Rhizobium tropici CIAT899. Chem Biol. 2005;12:1029–40. 14. Guasch-Vidal B, Estévez J, Dardanelli MS, Soria-Díaz ME, de Córdoba FF, Balog CI, et al. High NaCl concentrations induce the nod genes of rhizobium tropici CIAT899 in the absence of flavonoid inducers. Mol Plant Microbe Interact. 2013;26:451–60. 15. Zahran HH. Rhizobium-legume symbiosis and nitrogen fixation under severe conditions and in an arid climate. Microbiol Mol Biol Rev. 1999;63:968–89. 16. López-Leal G, Tabche ML, Castillo-Ramírez S, Mendoza-Vargas A, Ramírez- Romero MA, Dávila G. RNA-Seq analysis of the multipartite genome of Rhizobium etli CE3 shows different replicon contributions under heat and saline shock. BMC Genomics. 2014;15:770. 17. Ormeño-Orrillo E, Menna P, Gonzaga LA, Ollero FJ, Nicolas MF, Rodrigues EP, et al. Genomic basis of broad host range and environmental adaptability of rhizobium tropici CIAT 899 and rhizobium sp. PRF 81 which are used in inoculants for common bean (Phaseolus vulgaris L.). BMC Genomics. 2012; 13:735. 18. John M, Röhring H, Schmidt J, Wienecke U, Schell J. Rhizobium NodB protein involved in nodulation signal synthesis is a chitooligossacharide deacetylase. Proc Natl Acad Sci U S A. 1993;90:625–9. 19. van Rhijn PJ, Feys B, Verreth C, Vanderleyden J. Multiple copies of nodD in Rhizobium tropici CIAT899 and BR816. J Bacteriol. 1993;175:438–47. 20. del Cerro P, Rolla-Santos AAP, Gomes DF, Marks BB, Pérez-Montaño F, Rodríguez-Carvajal MA, et al. Regulatory nodD1 and nodD2 genes of Rhizobium tropici strain CIAT 899 and their roles in the early stages of molecular signaling and host-legume nodulation. BMC Genomics. 2015;16:251. 21. del Cerro P, Rolla-Santos AAP, Gomes DF, Marks BB, Espuny MR, P Rodríguez-Carvajal MA, et al. Opening the "black box" of nodD3,nodD4 and nodD5 genes of Rhizobium tropici strain CIAT 899. BMC Genomics. 2015;16:864. 22. Hansen KD, Irizarry RA, Wu Z. Removing technical variability in RNA-seq data using conditional quantile normalization. Biostatistics. 2012;3:204–16. 23. Alexandre A, Laranjo M, Oliveira S. Global transcriptional response to heat shock of the legume symbiont mesorhizobium loti MAFF303099 comprises extensive gene downregulation. DNA Res. 2014;21:195–206. 24. Gomes DF, Batista JSS, Schiavon AL, Andrade DS, Hungria M. Proteomic profiling of Rhizobium tropici PRF 81: identification of conserved and specific responses to heat stress. BMC Microbiol. 2012;12:84. 25. Theunis M, Kobayashi H, Broughton WJ, Prinsen E. Flavonoids, NodD1, NodD2, and nod-box NB15 modulate expression of the y4wEFG locus that is required for indole-3-acetic acid synthesis in Rhizobium sp. Strain NGR234. Mol Plant Microbe Interact. 2004;17:1153–61. 26. Kobayashi H, Naciri-Graven Y, Broughton WJ, Perret X. Flavonoids induce temporal shifts in gene-expression of nod-box controlled loci in Rhizobium sp. NGR234. Mol Microbiol. 2004;51:335–47. 27. Ampomah OY, Avetisyan A, Hansen E, Svenson J, Huser T, Jensen JB, et al. The thuEFGKAB operon of rhizobia and Agrobacterium tumefaciens codes for transport of trehalose, maltitol, and isomers of sucrose and their assimilation through the formation of their 3-keto derivatives. J Bacteriol. 2013;195:3797–807. 28. Strøm AR, Kaasen I. Trehalose metabolism in escherichia coli: stress protection and stress regulation of gene expression. Mol Microbiol. 1993;8: 205–10. 29. Park SY, Chao X, Gonzalez-Bonet G, Beel BD, Bilwes AM, Crane BR. Structure and function of an unusual family of protein phosphatases: the bacterial chemotaxis proteins CheC and CheX. Mol Cell. 2004;16:563–74. 30. Zatakia HM, Nelson CE, Syed UJ, Scharf BE. ExpR coordinates the expression of symbiotically important, bundle-forming Flp pili with quorum sensing in Sinorhizobium meliloti. Appl Environ Microbiol. 2014;80:2429–39. 31. Kroll JS, Loynds B, Brophy LN, Moxon ER. The bex locus in encapsulated Haemophilus influenzae: a chromosomal region involved in capsule polysaccharide export. Mol Microbiol. 1990;4:1853–62. 32. Boboye B. Degradation of trehalose by rhizobia and characteristics of a trehalose-degrading enzyme isolated from Rhizobium species NGR234. J Appl Microbiol. 2004;97:256–61. 33. Jones JD, Dangl JL. The plant immune system. Nature. 2006;444:323–9. 34. Vinardell JM, Ollero FJ, Hidalgo A, López-Baena FJ, Medina C, Ivanov- Vangelov K, et al. NolR regulates diverse symbiotic signals of Sinorhizobium fredii HH103. Mol Plant Microbe-Interact. 2004;17:676–85. 35. Fujishige NA, Lum MR, De Hoff PL, Whitelegge JP, Faull KF, Hirsch AM. Rhizobium common nod genes are required for biofilm formation. Mol Microbiol. 2008;67:504–15. 36. Pérez-Montaño F, Jiménez-Guerrero I, Del Cerro P, Baena-Ropero I, López- Baena FJ, Ollero FJ, et al. The symbiotic biofilm of Sinorhizobium fredii SMH12, necessary for successful colonization and symbiosis of glycine max cv osumi, is regulated by quorum sensing systems and inducing flavonoids via NodD1. PLoS One. 2014;9, e105901. 37. Beringer JE. R factor transfer in Rhizobium leguminosarum. J Gen Microbiol. 1974;84:188–98. 38. Pfaffl MW. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 2001;29, e45. 39. Trapnell C, Williams BA, Pertea G, Mortazavi A, Kwan G, van Baren MJ, et al. Transcript assembly and quantification by RNA-Seq reveals unannotated transcripts and isoform switching during cell differentiation. Nat Biotechnol. 2010;28:511–5. 40. Anders S, Huber W. Differential expression analysis for sequence count data. Genome Biol. 2010;11:R106. 41. Robinson MD, McCarthy DJ, Smyth GK. EdgeR a bioconductor package for differential expression analysis of digital gene expression data. Bioinformatics. 2010;26:139–40. 42. Huang DW, Sherman BT. Lempicki. Bioinformatics enrichment tools: paths toward the comprehensive functional analysis of large gene lists. Nucleic Acids Res. 2009;37:1–13. 43. Rice JA. Mathematical Statistics and Data Analysis. 2007; (Third ed.). In: USA: Duxbury Press. p.42. 44. Sousa C, Folch JL, Boloix P, Megías M, Nava N, Quinto C. A Rhizobium tropici DNA region carrying the amino-terminal half of a nodD gene and a nodbox-like sequence confers host-range extension. Mol Microbiol. 1993;9: 1157–68. 45. Okker RJ, Spaink HP, Lugtenberg BJ, Schlaman HR. Mutants in the nodFEL promoter of Rhizobium leguminosarum bv. Viciae reveal a role of individual nucleotides in transcriptional activation and protein binding. Arch Microbiol. 2001;175:152–60. • We accept pre-submission inquiries • Our selector tool helps you to find the most relevant journal • We provide round the clock customer support • Convenient online submission • Thorough peer review • Inclusion in PubMed and all major indexing services • Maximum visibility for your research Submit your manuscript at www.biomedcentral.com/submit Submit your next manuscript to BioMed Central and we will help you at every step: Pérez-Montaño et al. BMC Genomics (2016) 17:198 Page 11 of 11 RESEARCH ARTICLE NrcR, a New Transcriptional Regulator of Rhizobium tropici CIAT 899 Involved in the Legume Root-Nodule Symbiosis Pablo del Cerro 1 , Amanda A. P. Rolla-Santos 2 , Rocío Valderrama-Fernández 3 , Antonio Gil- Serrano 3 , Ramón A. Bellogín 1 , Douglas Fabiano Gomes 2 , Francisco Pérez-Montaño 1 , Manuel Megías 1 , Mariangela Hungría 2 , Francisco Javier Ollero 1 * 1Departamento de Microbiología, Facultad de Biología, Universidad de Sevilla. Sevilla, Spain, 2Embrapa Soja, Cx. Postal 231, 86001–970, Londrina, Paraná, Brazil, 3Departamento de Química Orgánica, Facultad de Química, Universidad de Sevilla. Sevilla, Spain *[email protected] Abstract The establishment of nitrogen-fixing rhizobium-legume symbioses requires a highly complex cascade of events. In this molecular dialogue the bacterial NodD transcriptional regulators in conjunction with plant inducers, mostly flavonoids, are responsible for the biosynthesis and secretion of Nod factors which are key molecules for successful nodulation. Other transcriptional regulators related to the symbiotic process have been identified in rhizobial genomes, including negative regulators such as NolR. Rhizobium tropici CIAT 899 is an important symbiont of common bean (Phaseolus vulgaris L.), and its genome encompasses intriguing features such as five copies of nodD genes, as well as other possible transcriptional regulators including the NolR protein. Here we describe and characterize a new regulatory gene located in the non-symbiotic plasmid pRtrCIAT899c, that shows homology (46% identity) with the nolR gene located in the chromosome of CIAT 899. The mutation of this gene, named nrcR (nolR-like plasmid c Regulator), enhanced motility and exopolysaccharide production in comparison to the wild-type strain. Interestingly, the number and decoration of Nod Factors produced by this mutant were higher than those detected in the wildtype strain, especially under salinity stress. The nrcR mutant showed delayed nodulation and reduced competitiveness with P.vulgaris, and reduction in nodule number and shoot dry weight in both P.vulgaris and Leucaena leucocephala. Moreover, the mutant exhibited reduced capacity to induce the nodC gene in comparison to the wild-type CIAT 899. The finding of a new nod-gene regulator located in a non-symbiotic plasmid may reveal the existence of even more complex mechanisms of regulation of nodulation genes in R.tropici CIAT 899 that may be applicable to other rhizobial species. PLOS ONE | DOI:10.1371/journal.pone.0154029 April 20, 2016 1/19 a11111 OPEN ACCESS Citation: del Cerro P, Rolla-Santos AAP, Valderrama- Fernández R, Gil-Serrano A, Bellogín RA, Gomes DF, et al. (2016) NrcR, a New Transcriptional Regulator of Rhizobium tropici CIAT 899 Involved in the Legume Root-Nodule Symbiosis. PLoS ONE 11 (4): e0154029. doi:10.1371/journal.pone.0154029 Editor: Francisco Martinez-Abarca, Estacion Experimental del Zaidin—CSIC, SPAIN Received: February 23, 2016 Accepted: April 7, 2016 Published: April 20, 2016 Copyright: © 2016 del Cerro et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Data Availability Statement: All relevant data are in the body of the manuscript and in the supporting information. Funding: This work was supported by the Project AGL2012-38831 of the Ministerio de Economía y Competitividad (Spanish Government, www.mineco. gob.es), CNPq (National Council for Scientific and Technological Development, http://cnpq.br/, Science without Borders 400205/2012-5). AAPR-S acknowledges a postdoctoral fellowship from CNPq (National Council for Scientific and Technological Development, http://cnpq.br/, Science without Introduction The establishment of the symbiosis between rhizobia and their specific host legumes involves highly complex events that culminate in the formation of nodules and in the establishment of the nitrogen fixation process. Nodulation requires a molecular dialogue between the bacteria and the host plants. The dialogue begins with the exudation of molecules from the legume roots, mostly flavonoids, which are recognized by the specific rhizobium, inducing the transcription of a set of nodulation genes [1,2]. These genes are responsible for the biosynthesis and secretion of Nod factors (NFs), identified as lipochitooligosaccharides, required for launching the nodulation and the nitrogen-fixation process [3–7]. A large number of bacterial transcriptional regulators actuate nodulation, the most important of which are the NodD proteins, which belong to the LysR-type transcriptional-regulator family. The nodD genes are constitutively expressed and their cognate proteins are responsible for the recognition of suitable flavonoids, which start the transcription of the nodulation genes [8,9]. Another important group of transcriptional regulators is the family of metal-sensing regulatory proteins. In this case, a specific metal-ion union regulates the protein’s allosteric conformation and modulates the expression of several target genes. In bacteria, the arsenic repressor family (ArsR) represents one of the most important regulators of the family of metalsensing proteins. In this family, there are positive and negative transcriptional regulators, which have been described for many bacteria, including several rhizobial species [10–12]. A well-characterized member of this family is the NolR protein, originally described as a general repressor of the activator nodD1 and the common nodABC operon in Sinorhizobium meliloti [13–15]. Two models to explain the repression through the NolR protein have been proposed: i) in promoters with overlapping transcription initiation and operator sites, NolR binding prevents gene expression enabling RNA polymerase interaction; and ii) in promoter regions containing upstream nod box (NB) sequences for NodD proteins, NolR binds this promoter region and alters NodD association resulting in inactivation of the gene expression [16]. In S.fredii HH103, a nolR mutant provoked changes in NF decoration and exopolysaccharide production [17]. However, S.meliloti and S.medicae nolR mutants increased the nodC expression, and, in the case of S.medicae, improved the competitiveness and nodulation efficiency on Medicago truncatula and Medicago sativa [18]. Rhizobium tropici strain CIAT 899 (hereafter CIAT 899) is a successful microsymbiont of common bean (P.vulgaris L.) in tropical acid soils. The main features of this broad host-range strain include its high tolerance of environmental stresses such as high temperature, acidity and salinity [19–22]. An intriguing feature of CIAT 899 relies on its capacity of producing a large variety of NFs even in the absence of flavonoids when grown under abiotic stresses such as acid or saline conditions [23–30]. Genome sequencing of strain CIAT 899 displayed a large number of genes that code for transcriptional-regulator families, including five nodD genes (all of them located in the symbiotic plasmid; pRtrCIAT899b) and one nolR gene (located in the chromosome). Moreover, another gene located in the megaplasmid pRtrCIAT899c and encoding an undescribed protein which shares homology with the canonical NolR protein has also been identified [31]. In this study, we performed experiments to shed light on the role of this new, undescribed nolR-like transcriptional regulator gene—which we named nrcR—during the symbiotic process. Materials and Methods Bacteria growth conditions, plasmids, mutant obtention Strains and plasmids used in this study are listed in Table 1.R.tropici CIAT 899 strains were grown at 28°C on tryptone yeast (TY) medium [32], B - minimal medium [33] or yeast extract Characterization of R.tropici CIAT 899 nrcR Mutant PLOS ONE | DOI:10.1371/journal.pone.0154029 April 20, 2016 2/19 Borders 400205/2012-5). MH a research fellow from CNPq (NPq (National Council for Scientific and Technological Development, http://cnpq.br/). FPM a postdoctoral fellowship from VPP (University of Seville, https://investigacion.us.es/secretariadoinvestigacion/plan-propio). PdC a FPU fellowship from Ministerio de Economía y Competitividad (FPU14/00160, Spanish Government, www.mineco. gob.es). The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication. Competing Interests: The authors have declared that no competing interests exist. mannitol (YM) medium [34], supplemented when necessary with apigenin 3.7 μM or with NaCl 300 mM. Escherichia coli strains were cultured on LB medium [35] at 37°C. When required, the media were supplemented with the appropriate antibiotics as previously described [36]. A similar number of colony forming units (cfu/ml) was obtained for both strains by plating bacteria on addecuated solid medium (data not shown). Primers nolR-like-F (5’–TAG CAG AGC GAT GTC AGA) and nolR-like-R (5’–CGA TGC CAA TTT CCG GAA) were used for amplifying the nrcR gene. The 980-bp PCR product was cloned in pGEM1-T Easy (PROMEGA) (Amp R 100 μgmL -1 ) and the resulting plasmid was digested with the enzyme HindIII, which cuts the nrcR gene in one site, and ligated to a 2 kb fragment containg the Ointerposon (Spc R 100 μgmL -1 )(S1 Fig). Lastly, this plasmid was digested with EcoRI and the 2.98-kb fragment containing the nrcR::Owas cloned in the rhizobial suicide vector pK18mob [37], that confers resistance to kanamycin (km R 30 μgmL -1 ), equally restricted with EcoRI. The generated plasmid pK18mob containing the nrcR::Ofragment was transferred from E.coli strain DH5αto R.tropici CIAT 899 strain by conjugation as described by Simon [38], using plasmid pRK2013 as helper [39], and used for the homogenization of the mutated version of nrcR in CIAT 899 by using the methodology previously described [40]. The deletion event was confirmed by PCR and hybridization. To complement in trans the nrcR mutation, the pGEM1-T Easy plasmid harboring the 980-bp PCR product that contains the whole nrcR gene was digested by EcoRI and cloned into the expression vector pBBR1-MCS-5 (Gm R 10 μgmL -1 )[41], equally digested with the same restriction enzyme, to generate the plasmid pMUS1333. This plasmid was transferred to ncrR:: Ωmutant strain by conjugation, obtaining the ncrR::Ω(pMUS1333) strain. The in cis complementation of the nrcR mutant was carried out cloning the EcoRI fragment containing the entire nrcR gene into the vector pK18mob, generating plasmid pMUS1353. This plasmid was transferred by conjugation into the ncrR::Ωstrain and the kanamycin resistant transconjugant was selected. The ncrR::Ω(pMUS1353) strain harbors the plasmid inserted into the pRtrCIAT899c by simple recombination, thus containing both wild-type and mutated nrcR gene. The parental and derivative strains were deposited at the culture collection of the Department of Biology of the Universidad de Sevilla and at the Diazotrophic and Plant Growth Promoting Bacteria Culture Collection of Embrapa Soja (WFCC Collection # 1213, WDCM Collection # 1054). Bioinformatics The Phyre2 web portal (http://www.sbg.bio.ic.ac.uk/phyre2) was used to analyze and predict the function of the NrcR protein [42]. To confirm the prediction obtained, comparisons and similarity analysis among NrcR and the set of protein were carry out using the Basic Local Alignment Search tool (BLAST) suite of NCBI [43]. Specific protein alignments were performed using the ClustalW online platform, [44]. The multiple sequence alignments were edited by using Boxshade at EMBnet. Table 1. Bacterial strains and plasmids employed in this study. Strain or plasmid Derivation and relevant properties Source or reference R.tropici CIAT 899 Wild-type strain, Rif R [19] nrcR:: ΩR.tropici CIAT 899 nrcR::Ω, Rif R Spc R This work nrcR:: Ω(pMUS1333) nrcR mutant complemented in trans, Rif R Spc R Gm R This work nrcR:: Ω(pMUS1353) nrcR mutant complemented in cis, Rif R Spc R Km R This work pMUS1333 pBBR1-MCS-5 containing the entire nrcR gene, Gm R This work pMUS1353 pK18mob containing the entire nrcR gene, Km R This work doi:10.1371/journal.pone.0154029.t001 Characterization of R.tropici CIAT 899 nrcR Mutant PLOS ONE | DOI:10.1371/journal.pone.0154029 April 20, 2016 3/19 Table 3. Nod Factor structures biosynthesized in the presence of apigenin (3.7 μM) by the wild-type strain CIAT 899 and the nrcR:: Ωmutant. [M+H] + (m/z)B i ions Structure a CIAT 899 b nrcR:: Ω b 824 400, 603 III (C 16:0 )-+ 838 414, 617 III (C 16:0 , NMe) + + 850 426, 629 III (C 18:1 )++ 852 428, 631 III (C 18:0 )++ 864 440, 643 III (C 18:1 , NMe) + + 999 372, 575, 778 IV (C 14:0 )++ 1011 384, 597, 790 IV (C 14:1 , NMe) + - 1013 386, 589, 792 IV (C 14:0 , NMe) + + 1025 398, 601, 804 IV (C 16:1 )+- 1027 400, 603, 806 IV (C 16:0 )++ 1039 412, 615, 818 IV (C 16:1 , NMe) + + 1041 414, 617, 820 IV (C 16:0 , NMe) + + 1053 426, 629, 832 IV (C 18:1 )++ 1055 428, 631, 834 IV (C 18:0 )++ 1067 440, 643, 846 IV (C 18:1 , NMe) + + 1069 442, 645, 848 IV (C 18:0 , NMe) + + 1081 454, 657, 860 IV (C 20:1 )++ 1202 372, 575, 778, 981 V (C 14:0 )+- 1214 426, 629, 790, 832, 993 d V(C 18:1 , dNAc) + - 1216 386, 589, 792, 995 V (C 14:0 , NMe) + + 1228 440, 643, 846, 1007 e V(C 18:1 , NMe, dNAc) + - 1230 400, 603, 806, 1009 V (C 16:0 )++ 1242 412, 615, 818, 1021 V (C 16:1 , NMe) + + 1244 414, 617, 820, 1023 V (C 16:0 , NMe) + + 1256 426, 629, 832, 1035 V (C 18:1 )+- 1258 428, 631, 834, 1037 V (C 18:0 )-+ 1270 440, 643, 846, 1049 V (C 18:1 , NMe) + + 1272 442, 645, 848, 1051 V (C 18:0 , NMe) + + 1284 454, 657, 860, 1063 V (C 20:1 )-+ 1298 468, 671, 874, 1077 V (C 20:1 , NMe) - + 1324 414, 617, 820, 1023 V (C 16:0 , NMe, S) + + 1336 426, 629, 832, 1035 V (C 18:1 ,S) + + 1350 440, 643, 846, 1049, [M-80] +c = 1270 V (C 18:1 , NMe, S) + + 1352 442, 645, 848, 1051 V (C 18:0 , NMe, S) - + 1378 468, 671, 874, 1077 V (C 20:1 , NMe, S) - + a NF structures are represented following the convention [64] that indicates the number of GlcNAc residues in the backbone (Roman numeral), the length and degree of unsaturation of the fatty acyl chain, and the other substituents, which are listed in the order in which they appear, moving clockwise from the fatty acid. NMe, N-methyl group at glucosamine non reducing residue; S, sulfate group at reducing glucosamine residue. b Symbol: + = detected;—= non detected. c These ions arise by loss of a neutral with mass 80 Da, corresponding to the loss of SO 3 . d Mixture of two Nod Factors, deacetylated at glucosamine residues numbers 2 and 3, respectively. e Nod Factor deacetylated at glucosamine residue number 2. doi:10.1371/journal.pone.0154029.t003 Characterization of R.tropici CIAT 899 nrcR Mutant PLOS ONE | DOI:10.1371/journal.pone.0154029 April 20, 2016 10 / 19 Table 4. Nod Factor structures biosynthesized in the presence of NaCl 300 mM by the wild-type strain CIAT 899 and the nrcR:: Ωmutant. [M+H] + (m/z)B i ions Structure a CIAT 899 b nrcR:: Ω b 811 428, 631 II Hex (C 18:0 )-+ 824 400, 603 III (C 16:0 )++ 838 414, 617 III (C 16:0 , NMe) + + 850 426, 629 III (C 18:1 )++ 852 428, 631, 834 III (C 18:0 )-+ 864 440, 643 III (C 18:1 , NMe) + + 866 442, 645, 848 III (C 18:0 , NMe) - + 878 454, 657 III (C 20:1 )-+ 892 468, 671 III (C 20:1 , NMe) - + 999 372, 575, 778 IV (C 14:0 )++ 1013 386, 589, 792 IV (C 14:0 , NMe) + + 1025 398, 601, 804 IV (C 16:1 )+- 1026 440, 643, 846 III Hex (C 18:1 , NMe) - + 1027 400, 603, 806 IV (C 16:0 )++ 1028 442, 645, 848 III Hex (C 18:0 , NMe) - + 1039 412, 615, 818 IV (C 16:1 , NMe) - + 1041 414, 617, 820 IV (C 16:0 , NMe) + + 1053 426, 629, 832 IV (C 18:1 )++ 1055 428, 631, 834 IV (C 18:0 )++ 1067 440, 643, 846 IV (C 18:1 , NMe) + + 1069 442, 645, 848 IV (C 18:0 , NMe) + + 1083 456, 659, 862 IV (C 20:0 )-+ 1095 468, 671, 874 IV (C 20:1 , NMe) - + 1097 470, 673, 876 IV (C 20:0 , NMe) - + 1147 440, 643, 846 IV (C 18:1 , NMe, S) + + 1149 442, 645, 848 IV (C 18:0 ,NMe, S) + + 1177 470, 673, 876 IV (C 20:0 , NMe, S) - + 1203 414, 617, 820, 1023 IV Hex (C 16:0 , NMe) + + 1205 414, 617, 820, 1023 IV Hex-ol (C 16:0 , NMe) + - 1215 426, 629, 832, 1035 IV Hex (C 18:1 )+- 1216 386, 589, 792, 995 V (C 14:0 , NMe) + + 1229 440, 643, 846, 1049 IV Hex (C 18:1 , NMe) + + 1230 400, 603, 806, 1009 V (C 16:0 )+- 1231 440, 643, 846, 1049 IV Hex-ol (C 18:1 , NMe) + - 1231 442, 645, 848, 1051 IV Hex (C 18:0 , NMe) - + 1233 442, 645, 848, 1051 IV Hex-ol (C 18:0 , NMe) + - 1242 412, 615, 818, 1021 V (C 16:1 , NMe) + + 1244 414, 617, 820, 1023 V (C 16:0 , NMe) + + 1256 426, 629, 832, 1035 V (C 18:1 )++ 1257 468, 671, 874, 1077 IV Hex (C 20:1 , NMe) - + 1258 428, 631, 834, 1037 V (C 18:0 )++ 1259 470, 673, 876, 1079 IV Hex (C 20:0 , NMe) - + 1270 440, 643, 846, 1049 V (C 18:1 , NMe) + + 1272 442, 645, 848, 1051 V (C 18:0 , NMe) + + 1284 454, 657, 860, 1063 V (C 20:1 )-+ 1298 468, 671, 874, 1077 V (C 20:1 , NMe) + + (Continued) Characterization of R.tropici CIAT 899 nrcR Mutant PLOS ONE | DOI:10.1371/journal.pone.0154029 April 20, 2016 11 / 19 the decrease in nodulation was reflected in lower shoot dry weight (25% less) of plants inoculated with the mutant strain (Table 5). When leucaena was inoculated with the nrcR mutant, significant differences in nodulation were also observed at 50 days, i.e. decreases of 41% in nodule number and of 20% in shoot dry weight in comparison to the wild-type strain. The in trans complementation [nrcR::Ω (pMUS1333)] of the nrcR mutant did not restore the nodulation phenotypes (Table 5). In fact, the rhizobia isolated from nodules induced by this strain in bean and leucaena plants were Spc r Gm s , indicating loss of the pMUS1333 plasmid. For this reason, an in cis nrcR-complemented strain [nrcR::Ω(pMUS1353)] was constructed. In this case, the complementation restored symbiotic characteristics in both plants (Table 5). Moreover, the competitiveness assays showed that the mutant strain was less competitive for nodulation on common bean plants than the wild-type strain (Fig 5). Indeed, after 45 days of inoculation, the nrcR mutant occupied only 10% of the nodules. Discussion The participation of NodD transcriptional regulators in conjunction with plant inducers, mostly flavonoids, is required for nod-gene expression in rhizobia, which represents the beginning of the nodulation process. The absence of the transcriptional regulator repressor NolR provokes changes in NF decoration as well as decreases in nodulation efficiency in other rhizobial species and strains such as S.fredii and S.meliloti, indicating that a fine-tuning of nodgene expression is required for optimal nodulation of the plant host [13,17]. A structural and biochemical analysis of the NolR protein revealed that a DNA-protein interaction domain is essential to the full understanding of its transcriptional repression role in several target genes [18]. In this study, we investigated a new potential symbiotic regulator belonging to the ArsR family of proteins located in the non-symbiotic plasmid pRtrCIAT899c of R.tropici CIAT 899. Here, we report that this transcriptional regulator, named NrcR, shares homology in the sequence, especially in the DNA-binding domain, with NolR. We have demonstrated that the mutation of the nrcR gene affects several steps of the symbiosis of CIAT 899 with host legumes, revealing a novel level of regulation. Table 4. (Continued) [M+H] + (m/z)B i ions Structure a CIAT 899 b nrcR:: Ω b 1300 470, 673, 876, 1079 V (C 20:0 , NMe) - + 1324 414, 617, 820, 1023 V (C 16:0 , NMe, S) + + 1336 426, 629, 832, 1035 V (C 18:1 ,S) + - 1350 440, 643, 846, 1049, [M-80]+ c = 1270 V (C 18:1 , NMe, S) + + 1352 442, 645, 848, 1051 V (C 18:0 , NMe, S) + + 1366 456, 659, 862, 1065 V (C 20:0 ,S) - + 1378 468, 671, 874, 1077 V (C 20:1 , NMe, S) + + 1380 470, 673, 876, 1079 V (C 20:0 , NMe, S) + + a NF structures are represented following the convention [64] that indicates the number of GlcNAc residues in the backbone (Roman numeral), the length and degree of unsaturation of the fatty acyl chain, and the other substituents, which are listed in the order in which they appear, moving clockwise from the fatty acid. Hex, hexose; Hex-ol, hexytol (reduced terminal hexose); NMe, N-methyl group at glucosamine non reducing residue; S, sulfate group at reducing glucosamine residue. b Symbol: + = detected;—= non detected. c These ions arise by loss of a neutral with mass 80 Da, corresponding to the loss of SO 3 . doi:10.1371/journal.pone.0154029.t004 Characterization of R.tropici CIAT 899 nrcR Mutant PLOS ONE | DOI:10.1371/journal.pone.0154029 April 20, 2016 12 / 19 We found that the NrcR transcriptional regulator inhibits surface motility, as the mutant strain consistently showed higher mobility than the parental strain (Fig 1). Nowadays, five types of motility are ascribed to bacteria [48] and it remains to be discovered which one is altered by the absence of NrcR. For this reason, we have generically defined this phenotype as a surface motility type. Fig 3. qRT-PCR analysis of the expression of nodC gene from R.tropici CIAT 899 and the nrcR::Ω strain grown in the absence or presence of apigenin (3.7 μM) or NaCl (300 mM). Expression data were individually compared with the expression without inducing molecules of the wild-type strain by using the Mann-Whitney non-parametrical test. The asterisks (*) indicate a significant different at the level α= 5%. Black bars represent wild-type strain and dark gray bars represent the nrcR::Ωmutant strain. doi:10.1371/journal.pone.0154029.g003 Fig 4. Early nodulation phenotype in common bean inoculated with CIAT 899 and nrcR::Ωstrains assayed in pouch bags. 1 mL of a culture containg 10 9 cells mL -1 was used as inoculum. Experiment performed under controlled conditions of growth chamber and plants harvested at 15 days after inoculation. (A) wild-type strain. (B) Uninoculated control. (C) nrcR::Ωstrain. (D) Roots inoculated with the CIAT 899 strain. (E) Roots inoculated with the nrcR::Ωstrain. doi:10.1371/journal.pone.0154029.g004 Characterization of R.tropici CIAT 899 nrcR Mutant PLOS ONE | DOI:10.1371/journal.pone.0154029 April 20, 2016 13 / 19 The EPS produced by rhizobia has different structural functions, such as a protective barrier against environmental stresses [49,50]. In CIAT 899, the EPS is an octasaccharide formed by D-glucose, D-galactose, pyruvic and acetic acids, with a ratio of 3:1 between glucose and galactose [51]. Interestingly, the nrcR::Ωstrain produced a significantly higher amount of EPS than the parental CIAT 899 (Fig 2), but with no difference in the proportion of sugar detected in the NMR analysis. In addition to the protective role of the CIAT 899 EPS, it is worth mentioning that an increase in the EPS production by S.fredii HH103 promotes surface motility [52]. Thus, it is possible that the over-production of EPS by the nrcR mutant could contribute to its increased motility. Remarkably, nrcR gene is located in the CIAT 899 megaplasmid that also carries the exo genes, which are implied in the biosynthesis of EPS [53]. Thus, the relative position of all these genes is another clue that could be relating EPS production with the NrcR protein. However, the higher production of EPS by the nrcR mutant was not related to an increased expression of the exoA gene (involved in the biosynthesis of EPS), nor to a repression Table 5. Plant responses to inoculation of common bean and leucaena with R.tropici CIAT 899 and derivative strains. Strains P.vulgaris a L.leucocephala a Nodule number Shoot dry weight (g) Nodule number Shoot dry weight (g) R.tropici CIAT 899 251.3 ±30.25 1.58 ±0.21 17.5 ±3.1 0.49 ±0.05 nrcR:: Ω160.2 ±28.38*1.18 ±0.37 10.3 ±3.73*0.39 ±0.03* nrcR:: Ω(pMUS1333) 158.5 ±36.13*1.10 ±0.21*10.1 ±3.89*0.36 ±0.05* nrcR:: Ω(pMUS1353) 220.6 ±44.37 1.41 ±0.33 16.7 ±3.5 0.48 ±0.03 none 0 ±0*0.70 ±0.18*0±0*0.23 ±0.05* a Data represent means ±S.D. of six plant jars. Each jar contained two plants. Common bean plants were evaluated 30 days after inoculation. Leucaena plants were evaluated 50 days after inoculation. The nrcR::Ω,nrcR::Ω(pMUS1333) and nrcR::Ω(pMUS1353) parameters were individually compared with the parental strain CIAT 899 by using the Mann-Whitney non-parametric test. Values tagged by asterisk (*) are significantly different (α= 5%). doi:10.1371/journal.pone.0154029.t005 Fig 5. Competitiveness assay of CIAT 899 and nrcR::Ωstrains in common bean. 0,5 mL of each bacterial culture containing 10 9 cells mL -1 was used as inoculum. Percentages of nodule occupancy were evaluated for both strains in common bean plants after 45 days of inoculation. Values are the averages of three experiments. The nrcR::Ωstrain values were individually compared with their correspondent wild-type strain CIAT 899 by using the Mann-Whitney non-parametric test. Value tagged by asterisk (*) is significantly different at the level α= 5%. doi:10.1371/journal.pone.0154029.g005 Characterization of R.tropici CIAT 899 nrcR Mutant PLOS ONE | DOI:10.1371/journal.pone.0154029 April 20, 2016 14 / 19 of the exoX gene (a negative regulator of the EPS biosynthesis in rhizobia). Therefore, it is possible that the nrcR mutant shows higher capacity of exportation of EPS than the parental strain. Moreover, a mutation in the nrcR gene provoked a clear change in the number and decoration of the NFs synthesized, especially under saline conditions (Tables 2–4). It has been established that CIAT 899 is a host-promiscuous strain that shows high tolerance of environmental stresses [19–22]. Interestingly, the synthesis of a large variety of NFs from R.tropici CIAT 899 has been related to both features [23–30]. In contrast, qRT-PCR experiments showed decreases in the relative expression of the nodC gene in the nrcR mutant in comparison to that of the parental strain in the presence both of apigenin and of salt (Fig 3). Nevertheless, nodC expression in the mutant strain supplemented with apigenin or salt were 9.5-fold and 9-fold respectively higher than in the parental CIAT 899 strain grown without inducers, confirming that the nrcR mutant is able to synthesize NFs. Consequently, the nrcR::Ωstrain could decrease the quantity of NFs but increasing their diversity in comparison to those produced by the parental strain. The role of the NrcR transcriptional regulator in the symbiosis was also confirmed in nodulation tests with common bean and leucaena. The main effect was observed in the early steps of nodulation, with absence of nodules at 15 days of inoculation with the mutant strain (Fig 4). In addition, when co-inoculated with the wild-type strain, nodule occupancy by the mutant was far lower, possibly related to a lower root-colonization capacity (Fig 5). Competitiveness is critical under field conditions to the success or failure of introduced inoculant strains [54–59]. Furthermore, certain symbiosis-related phenotypes, such as motility or EPS production, can also affect bacterial competitiveness [60,61]. It has been described that the mutation on the exoA gene, decreasing EPS production, increases the competitiveness of S.fredii HH103 for soybean nodulation [52]. Therefore, we may suppose that decreased competitiveness of the nrcR mutant strain is related to the EPS over-production caused by the mutation. Lastly, the nrcR in trans complementation [nrcR::Ω(pMUS1333)] did not restore the capacity of nodulating bean and leucaena, because the strain lost the pMUS1333 plasmid, as demonstrated after the re-isolation of bacteria from nodules. However, the in cis complementation of the mutant strain [nrcR::Ω(pMUS1353)] restored the symbiotic phenotype (Table 5). In summary, NolR is a global regulatory protein that responds to environmental factors and regulates the expression of intracellular metabolic genes [62,63]. We hypothesize that the high tolerance of R.tropici CIAT 899 to environmental stresses is coordinated by a complex mechanism involving a broad range of transcriptional regulators. Evolution would have selected some of these regulators, such as the NrcR protein, to regulate nodulation and other features such as EPS production and motility even when nod-gene inducing molecules are limited. Therefore, the NrcR transcriptional regulator may represent an important strategy of CIAT 899 to succeed as a symbiont in stressing tropical conditions. In this context, the higher EPS production and motility detected in the nrcR mutant may represent an additional protective mechanism for tolerating abiotic stresses. Moreover, symbiotic behavior of the mutant could also represent an indirect effect of these protective mechanisms, affecting probably the early steps of nodulation. The activation of this transcriptional regulator seems to be dependent on flavonoids or salt. Therefore, our results suggest that NrcR is a significant component in the regulatory network present in R.tropici CIAT 899, which is necessary for orchestration of the symbiotic machinery and other important processes such as tolerance of abiotic stresses. Supporting Information S1 Fig. (A) Gene neighborhood of nrcR gene in the pRtrCIAT899c of R.tropici CIAT 899 genome. (B) HindIII endonuclease point and primers nolR-like-F and nolR-like-R location (C) Characterization of R.tropici CIAT 899 nrcR Mutant PLOS ONE | DOI:10.1371/journal.pone.0154029 April 20, 2016 15 / 19 Mutant interposon insertion. (TIF) S2 Fig. Alignment of NolR, ArsR and NrcR amino acid sequences using the ClustalW online platform and manipulated with Boxshade at EMBnet. Black and gray boxes indicate identical and similar amino acids, respectively. (A) Complete sequence alignment of NolR of S. fredii HH103, and NolR, ArsR and NrcR proteins of R.tropici CIAT 899. (B) Putative DNA- binding domain of NolR of S.fredii HH103, and NolR and NrcR of R.tropici CIAT 899. (TIF) S3 Fig. Mucous halo observed in surface motility of R.tropici CIAT 899 assays on TY supplemented with 0.4% agar. (A) CIAT 899. (B) nrcR::Ωmutant. (TIF) S1 Table. (PDF) Acknowledgments We thank the Servicio de Espectrometría de Masas, Servicio de Resonancia Magnética Nuclear and Servicio de Biología of the Centro de Investigación Tecnología e Innovacción (CITIUS) of the University of Seville for technical support. Author Contributions Conceived and designed the experiments: MM MH FJO. Performed the experiments: PdC AAPR-S RV-F DFG FPM RAB AG-S. Analyzed the data: PdC AAPR-S RV-F DFG FPM MM MH RAB AG-S FJO. Contributed reagents/materials/analysis tools: MM MH FJO. Wrote the paper: PdC FPM AG-S MM MH FJO. References 1. Hungria M, Johnston AWB, Phillips DA. Effects of flavonoids released naturally from bean (Phaseolus vulgaris)onnodD-regulated gene transcription in Rhizobium leguminosarum bv. phaseoli. Mol Plant- Microbe Interact. 1992; 5: 199–203. doi: 10.1094/MPMI-5-199 PMID: 1421508 2. Hungria M, Phillips DA. Effects of a seed color mutation on rhizobial nod-gene-inducing flavonoids and nodulation in common bean. Mol Plant Microbe Interact. 1993; 6: 418–422. doi: 10.1094/MPMI-6-418 3. Denarié J, Debellé F, Promé JC. Rhizobium lipo-chitinoligosaccharide nodulation factors: signaling molecules mediating recognition and morphogenesis. Ann Rev Biochem. 1996; 65: 503–535. doi: 10. 1146/annurev.bi.65.070196.002443 PMID: 8811188 4. Schlaman HRM, Phillips DA, Kondorosi E. Genetic organization and transcriptional regulation of rhizobial nodulation genes. In Spaink HP, Kondorosi A, Hooykaas PJJ, editors. The Rhizobiaceae. Kluwer Academic Publishers; 1998. pp. 361–386. 5. Geurts R, Bisseling T. Rhizobium Nod factor perception and signalling. Plant Cell. Supplement 2002; S239–S249. doi: 10.1105/tpc.002451 6. Brencic A, Winans SC. Detection of and response to signals involved in host-microbe interactions by plant-associated bacteria. Microbiol Mol Biol Rev. 2005; 69: 155–194. doi: 10.1128/MMBR.69.1.155– 194.2005 PMID: 15755957 7. Ormeño-Orrillo E, Hungria M, Martínez-Romero E. Dinitrogen-fixing prokaryotes. In Rosenberg E, DeLong EF, Stackebrandt E, Lory S, Thompson F, editors. The Prokaryotes: prokaryotic physiology and biochemistry. Berlin Heidelberg: Springer-Verlag; 2013. pp. 427–451. 8. Spaink HP. Root nodulation and infection factors produced by rhizobial bacteria. Annu Rev Microbiol. 2000; 54: 257–288. doi: 10.1146/annurev.micro.54.1.257 PMID: 11018130 9. Oldroyd GE. Speak, friend, and enter: signaling systems that promote beneficial symbiotic associations in plants. Nat Rev Microbiol. 2013; 11: 252–263. doi: 10.1038/nrmicro2990 PMID: 23493145 Characterization of R.tropici CIAT 899 nrcR Mutant PLOS ONE | DOI:10.1371/journal.pone.0154029 April 20, 2016 16 / 19 10. Shi W, Wu J, Rosen BP. Identification of a putative metal binding site in a new family of metalloregulatory proteins. J Biol Chem. 1994; 269: 19826–19829. PMID: 8051064 11. Kiss E, Mergaert P, Olàh B, Kereszt A, Staehelin C, Davies AE, et al. Conservation of nolR in the Sinorhizobium and Rhizobium genera of the Rhizobiaceae family. Mol Plant Microbe Interact. 1998; 11: 1186–1195. doi: 10.1094/MPMI.1998.11.12.1186 12. Osman D, Cavet JS. Bacterial metal-sensing proteins exemplified by ArsR-SmtB family repressors. Nat Prod Rep. 2010; 27: 668–680. doi: 10.1039/b906682a PMID: 20442958 13. Kondorosi E, Gyuris J, Schmidt J, John M, Duda E, Hoffmann B, et al. Positive and negative control of nod gene expression in Rhizobium meliloti is required for optimal nodulation. EMBO J. 1989; 8: 1331– 1340. PMID: 16453883 14. Kondorosi E, Pierre M, Cren M, Haumann U, Buire M, Hoffmann B, et al. Identification of NolR, a negative transacting factor controlling the nod regulon in Rhizobium meliloti. J Mol Biol. 1991; 222: 885–896. doi: 10.1016/0022-2836(91)90583-R PMID: 1840615 15. Cren M, Kondorosi A, Kondorosi E. NolR controls expression of the Rhizobium meliloti nodulation genes involved in the core Nod factor synthesis. Mol Microbiol. 1995; 15: 733–747. doi: 10.1111/j.1365- 2958.1995tb02381.x PMID: 7783644 16. Lee SG, Krishnan HB, Jez JM. Structural basis for regulation of rhizobial nodulation and symbiosis gene expression by the regulatory protein NolR. Proc Natl Acad Sci USA. 2014; 111: 6509–6514. doi: 10.1073/pnas.1402243111 PMID: 24733893 17. Vinardell JM, Ollero FJ, Hidalgo A, López-Baena FJ, Medina C, Ivanov-Vangelov K, et al. NolR regulates diverse symbiotic signals of Sinorhizobium fredii HH103. Mol Plant Microbe Interact. 2004; 17: 676–685. http://dx.doi.org/10.1094/MPMI.2004.17.6.676. PMID: 15195950 18. Sugawara M, Sadowsky MJ. Enhanced nodulation and nodule development by nolR mutants of Sinorhizobium medicae on specific Medicago host genotypes. Mol Plant Microbe Interact. 2014; 27: 328– 335. doi: 10.1094/MPMI-10-13-0312-R PMID: 24283939 19. Martínez-Romero E, Segovia L, Mercante FM, Franco AA, Graham P, Pardo MA. Rhizobium tropici,a novel species nodulating Phaseolus vulgaris L. beans and Leucaena sp. trees. Int J Syst Bacteriol. 1991; 41: 417–426. doi: 10.1099/00207713-41-3-417 PMID: 1715738 20. Hernández-Lucas I, Segovia L, Martínez-Romero E, Pueppke SG. Phylogenetic relationships and host range of Rhizobium spp. that nodulate Phaseolus vulgaris L. Appl Environ Microbiol. 1995; 61: 2775– 2779. PMID: 7618891 21. Pinto FGS, Hungria M, Mercante FM. Polyphasic characterization of Brazilian Rhizobium tropici strains effective in fixing N 2 with common bean (Phaseolus vulgaris L.). Soil Biol Biochem. 2007; 39: 1851– 1864. doi: 10.1016/j.soilbio.2007.01.001 22. Hungria M, Andrade DS, Chueire LMO, Probanza A, Gutiérrez-Mañero FJ, Megías M. Isolation and characterization of new efficient and competitive bean (Phaseolus vulgaris L.) rhizobia from Brazil. Soil Biol Biochem. 2000; 21:1515–1528. doi: 10.1016/S0038-0717(00)00063-8 23. Poupot R, Martínez-Romero E, Promé JC. Nodulation factors from Rhizobium tropici are sulfated or nonsulfated chitopentasaccharides containing an N-methyl-N-acylglucosaminyl terminus. Biochemistry. 1993; 32: 10430–10435. doi: 10.1021/bi00090a019 PMID: 8399187 24. Marks BB, Megías M, Ollero FJ, Nogueira MA, Araujo RS, Hungria M. Maize growth promotion by inoculation with Azospirillum brasilense and metabolites of Rhizobium tropici enriched on lipo-chitooligo- saccharides (LCOs). AMB Express. 2015; 5: 71. doi: 10.1186/s13568-015-0154-z PMID: 26567001 25. Morón B, Soria-Díaz ME, Ault J, Verroios G, Noreen S, Rodríguez-Navarro DN, et al. Low pH changes the profile of nodulation factors produced by Rhizobium tropici CIAT 899. Chem Biol. 2005; 12: 1029– 1040. doi: 10.1016/j.chembiol.2005.06.014 PMID: 16183027 26. Estévez J, Soria-Díaz ME, de Córdoba FF, Morón B, Manyani H, Gil A, et al. Different and new Nod factors produced by Rhizobium tropici CIAT 899 following Na + stress. FEMS Microbiol Lett. 2009; 293: 220–231. http://dx.doi.org/10.1111/j.1574-6968.2009.01540.x. doi: 10.1111/j.1574-6968.2009.01540.x PMID: 19260963 27. Guasch-Vidal B, Estévez J, Dardanelli MS, Soria-Díaz ME, de Córdoba FF, Balog CIA, et al. High NaCl concentrations induce the nod genes of Rhizobium tropici CIAT899 in the absence of flavonoid inducers. Mol Plant Microbe Interact. 2013; 26: 451–460. doi: 10.1094/MPMI-09-12-0213-R PMID: 23216086 28. van Hameren B, Hayashi S, Gresshoff PM, Ferguson BJ. Advances in the identification of novel factors required in soybean nodulation, a process critical to sustainable agriculture and food security. J Plant Biol Soil Health. 2013; 1: 6. 29. del Cerro P, Rolla-Santos AAP, Gomes DF, Marks B, Pérez-Montaño F, Rodríguez-Carvajal MA, et al. Regulatory nodD1 and nodD2 genes of Rhizobium tropici strain CIAT 899 and their roles in the early Characterization of R.tropici CIAT 899 nrcR Mutant PLOS ONE | DOI:10.1371/journal.pone.0154029 April 20, 2016 17 / 19 stages of molecular signaling and host-legume nodulation. BMC Genomics. 2015; 16: 251. doi: 10. 1186/s12864-015-1458-8 PMID: 25880529 30. del Cerro P, Rolla-Santos AAP, Gomes DF, Marks B, Espuny MR, Rodríguez-Carvajal MA, et al. Opening the “black box”of nodD3,nodD4 and nodD5 genes of Rhizobium tropici strain CIAT 899. BMC Genomics. 2015; 16: 864. doi: 10.1186/s12864-015-2033-z PMID: 26502986 31. Ormeño-Orrillo E, Menna P, Gonzaga LA, Ollero FJ, Nicolas MF, Rodrigues EP, et al. Genomic basis of broad host range and environmental adaptability of Rhizobium tropici CIAT 899 and Rhizobium sp. PRF 81 which are used in inoculants for common bean (Phaseolus vulgaris L.). BMC Genomics. 2012; 13: 735. doi: 10.1186/1471-2164-13-735 PMID: 23270491 32. Beringer J E. R factor transfer in Rhizobium leguminosarum. J Gen Microbiol. 1974; 84: 188–198. doi: 10.1099/00221287-84-1-188 PMID: 4612098 33. Spaink HP, Aarts A, Stacey G, Bloemberg GV, Lugtenberg BJJ, Kennedy EP. Detection and separation of Rhizobium and Bradyrhizobium Nod metabolites using thin-layer chromatography. Mol Plant Microbe Interact. 1992; 5: 72–80. doi: 10.1094/MPMI-5-072 PMID: 1600238 34. Vincent JM. The modified Fåhraeus slide technique. In Vincent JM, editor. A manual for the practical study of root nodule bacteria. Oxford, UK. Blackwell Scientific Publications; 1970. pp. 144–145. 35. Sambrook J, Fritsch EF, Maniatis T. Molecular Cloning. A Laboratory Manual, 2nd ed. Cold Spring Harbor Laboratory Press. Cold Spring Harbor NY USA. 1989. 36. Lamrabet Y, Bellogín RA, Cubo T, Espuny MR, Gil-Serrano A, Krishnan HB, et al. Mutation in GDP- fucose synthesis genes of Sinorhizobium fredii alters Nod factors and significantly decreases competitiveness to nodulate soybeans. Mol Plant Microbe Interact. 1999; 12: 207–217. doi: 10.1094/MPMI. 1999.12.3.207 PMID: 10065558 37. Schäfer A, Tauch A, Jäger W, Kalinowski J, Thierbach G, Pühler A. Small mobilizable multi-purpose cloning vectors derived from the Escherichia coli plasmids pK18 and pK19: selection of defined deletions in the chromosome of Corynebacterium glutamicum. Gene. 1994; 145: 69–73. doi: 10.1016/ 0378-1119(94)90324-7 PMID: 8045426 38. Simon R. High frequency mobilization of gram-negative bacterial replicons by the in vivo constructed Tn5-Mob transposon. Mol Gen Genet. 1984; 196: 413–420. PMID: 6094969 39. Figurski DH, Helinski DR. Replication of an origin-containing derivative of plasmid RK2 dependent on a plasmid function provided in trans. Proc Natl Acad Sci USA. 1979; 76: 1648–1652. doi: 10.1073/pnas. 76.4.1648 PMID: 377280 40. López-Baena FJ, Vinardell JM, Pérez-Montaño F, Crespo-Rivas JC, Bellogín RA, Espuny MR, et al. Regulation and symbiotic significance of nodulation outer proteins secretion in Sinorhizobium fredii HH103. Microbiology-SGM. 2008; 154: 1825–1836. doi: 10.1099/mic.0.2007/016337-0 41. Kovach ME, Elzer PH, Hill DS, Robertson GT, Farris MA, Roop RM, et al. Four new derivatives of the broad-host-range cloning vector pBBR1MCS, carrying different antibiotic-resistance cassettes. Gene. 1995; 166: 175–176. doi: 10.1016/0378-1119(95)00584-1 PMID: 8529885 42. Kelley LA, Mezulis S, Yates CM, Wass MN, Sternberg MJ. The Phyre2 web portal for protein modeling, prediction and analysis. Nat. protocols. 2015; 10: 845–858. doi: 10.1038/nprot.2015.053 PMID: 25950237 43. Johnson M, Zaretskaya I, Raytselis Y, Merezhuk Y, McGinnis S, Madden TL. NCBI BLAST: A better web interface. Nucleic Acids Res. 2008; 36: W5–9. doi: 10.1093/nar/gkn201 PMID: 18440982 44. Larkin MA, Blackshields G, Brown NP, Chenna R, McGettigan PA, McWilliam H, et al. ClustalW and ClustalX version 2. Bioinformatics. 2007; 23: 2947–2948. doi: 10.1093/bioinformatics/btm404 PMID: 17846036 45. Pérez-Montaño F, Jiménez-Guerrero I, Del Cerro P, Baena-Ropero I, López-Baena FJ, Ollero FJ, et al. The symbiotic biofilm of Sinorhizobium fredii SMH12, necessary for successful colonization and symbiosis of Glycine max cv Osumi, is regulated by Quorum Sensing systems and inducing flavonoids via NodD1. PLoS One. 2014; 9: e105901. doi: 10.1371/journal.pone.0105901 PMID: 25166872 46. Tomlinson AD, Ramey-Hartung B, Day TV, Merrit PM, Fuqua C. Agrobacterium tumefaciens ExoR represses succinoglycan biosynthesis and is required for biofilm formation and motility. Microbiology- SGM. 2010; 156: 2670–2681. doi: 10.1099/mic.0.039032–0 47. Gomes DF, Batista JSS, Rolla AAP, Silva LPS, Bloch C, Galli-Terasawa LV, et al. Proteomic analysis of free-living Bradyrhizobium diazoefficiens: highlighting potential determinants of a successful symbiosis. BMC Genomics. 2014; 15: 643. doi: 10.1186/1471-2164-15-643 PMID: 25086822 48. Kearns DB. A field guide to bacterial swarming motility. Nat Rev Microbiol. 2010; 8: 634–644. doi: 10. 1038/nrmicro2405 PMID: 20694026 Characterization of R.tropici CIAT 899 nrcR Mutant PLOS ONE | DOI:10.1371/journal.pone.0154029 April 20, 2016 18 / 19 49. Downie JA. The roles of extracellular proteins, polysaccharides and signals in the interactions of rhizobia with legume roots. FEMS Microbiol Rev. 2010; 34: 150–170. doi: 10.1111/j.1574-6976.2009.00205. xPMID: 20070373 50. Janczarek M. Environmental signals and regulatory pathways that influence exopolysaccharide production in rhizobia. Int J Mol Sci. 2011; 12: 7898–7933. doi: 10.3390/ijms12117898 PMID: 22174640 51. Gil-Serrano A, Sánchez del Junco A, Tejero-Mateo P, Megías M, Caviedes MA. Structure of the extracellular polysaccharide secreted by Rhizobium leguminosarum var. phaseoli CIAT 899. Carbohydr Res. 1990; 204: 103–107. doi: 10.1016/0008-6215(90)84025-P PMID: 2279241 52. Rodríguez-Navarro DN, Rodríguez-Carvajal MA, Acosta-Jurado S, Soto MJ, Margaret I, Crespo-Rivas JC, et al. Structure and Biological Roles of Sinorhizobium fredii HH103 Exopolysaccharide. PLoS One. 2014; 9: e115391. doi: 10.1371/journal.pone.0115391 PMID: 25521500 53. Geniaux E, Flores M, Palacios R, Martinez E. Presence of Megaplasmids in Rhizobium tropici and Further Evidence of Differences between the Two R.tropici Subtypes. Int J Syst Bacteriol. 1995; 45: 392– 394. doi: 10.1099/00207713-45-2-392 54. Streeter JG. Failure of inoculant rhizobia to overcome the dominance of indigenous strains for nodule formation. Can J Microbiol. 1994; 40: 513–522. doi: 10.1139/m94-084 55. Toro N. Nodulation competitiveness in the Rhizobium legume symbiosis. World J Microbiol Biotechnol. 1996; 12: 157–162. doi: 10.1007/BF00364680 PMID: 24415163 56. Triplett EW, Sadowsky MJ. Genetics of competition for nodulation of legumes. Annu Rev. Microbiol. 1992; 46: 399–428. doi: 10.1146/annurev.mi.46.100192.002151 PMID: 1444262 57. Vargas MAT, Mendes IC, Hungria M. The response of field grown Phaseolus vulgaris to Rhizobium inoculation and nitrogen fertilization in two Cerrado soils. Biol Fertil Soils. 2000; 32: 228–233. doi: 10. 1007/BF02197490 58. Hungria M, Campo RJ, Chueire LMO, Grange L, Megías M. Symbiotic effectiveness of fast-growing rhizobial strains isolated from soybean nodules in Brazil. Biol Fertil Soils. 2001; 33: 387–394. doi: 10. 1007/s003740100338 59. Mendes IC, Vargas MAT, Hungria M. Establishment of Bradyrhizobium japonicum and B.elkanii in a Brazilian Cerrados oxisol. Biol Fertil Soils. 2004; 40: 28–35. doi: 10.1007/s00374-004-0739-1 60. Liu R, Tran VM, Schmidt EL. Nodulating competitiveness of a nonmotile Tn7mutant of Bradyrhizobium japonicum in nonsterile soil. Appl Environ Microbiol. 1989; 55: 1895–1900. PMID: 16347986 61. McDermoti TR, Graham PH. Competitive ability and efficiency in nodule formation of strains of Bradyrhizobium japonicum. Appl Environ Microbiol. 1990; 56: 3035–3039. PMID: 16348311 62. Chen H, Higgins J, Kondorosi E, Kondorosi A, Djordjevic MA, Weinman JJ, et al. Identification of nolR- regulated proteins in Sinorhizobium meliloti using proteome analysis. Electrophoresis 2000; 21: 3823– 3832. doi: 10.1002/1522-2683(200011)21:17 PMID: 11271500 63. Chen H, Gao K, Kondorosi E, Kondorosi A, Rolfe BG. Functional genomic analysis of global regulator NolR in Sinorhizobium meliloti. Mol Plant Microbe Interact. 2005; 18: 1340–1352. doi: 10.1094/MPMI- 18-1340 PMID: 16478054 64. Spaink HP. Rhizobial lipo-oligosaccharides: Answers and questions. Plant Mol Biol. 1992; 20: 977– 986. doi: 10.1007/BF00027167 PMID: 1463833 Characterization of R.tropici CIAT 899 nrcR Mutant PLOS ONE | DOI:10.1371/journal.pone.0154029 April 20, 2016 19 / 19 www.nature.com/scientificreports/ 7 Scientific RepoRts | 7:46712 | DOI: 10.1038/srep46712 In conclusion, this is the first time in which it is demonstrated that a NodD protein is directly implied in the transcriptional activation of all symbiotic genes and in the synthesis of NF under an abiotic stress condition. Absence of NodD2 but not of NodD1 results in an absence of NF under saline conditions. However, we have observed in the RNAseq analyses that the nodulation genes induced in saline conditions in the wild-type strain CIAT 899 were induced to a higher rate than the corresponding genes induced in the nodD1 mutant. These results could indicate that NodD1 could somehow be involved in the activation of the NF synthesis under saline conditions. In these conditions, NodD2 activates the transcription of the nod genes, and we cannot discard that NodD2 also activate the nodD1 gene, and NodD1 in turn, activate the expression of the nod genes. Thus, the mechanism by which salt is directly or indirectly promoting the activation of NodD2 remains unclear. Future efforts should be focused in the molecular understanding of this special response of CIAT 899 under salt stress conditions. Material and methods Bacteria growth conditions, plasmids, mutant obtaining. All strains and plasmids used in this work are listed in TableS1. R. tropici CIAT 899 strains were grown at 28 °C on tryptone yeast (TY) medium30, B- min- imal medium31 or yeast extract mannitol (YM) medium32, supplemented when necessary with apigenin 3.7 μ M or with NaCl 300 mM. Escherichia coli strains were cultured on LB medium33 at 37 °C. When required, the media were supplemented with the appropriate antibiotics as previously described34. The ∆ nodD2 and the double ∆ nodD1/∆ nodD2 deletion mutants were made by overlapping PCR extension as previously described35, where 819 pb and 885 pb length were deleted from nodD1 and nodD2, respectively. The deleted DNA fragments were firstly cloned in the pK18mobsacB vector obtaining plasmids pMUS1397 and pMUS1395, respectively. Then, plasmids were transferred by conjugation and integrated in the genome of CIAT 899 by single recombination. Finally, a homologue recombination event in which the wild-type copy of the gene together with plasmid pK18mobsacB were lost, was selected. Mutated strains were confirmed by PCR and DNA-DNA hybridization. Moreover, both nodD2 mutant strains were complemented: plasmid pBBR1-MCS-5 containing the wild-type nodD2 gene (pMUS1396) was transferred to the nodD2::Ω mutant strain generating the in trans complemented strain nod- D2::Ω (pMUS1396). The ∆ nodD2 mutant was complemented in cis by integration of plasmid pK18mobsacB containing the nodD2 wild-type copy (pMUS1395) in the genome, obtaining the ∆ nodD2 (pMUS1395) strain. Besides, the nodD1 mutant (RSP82 strain) was also complemented in trans with plasmid pBBR1-MCS-5 containing the wild-type nodD1 gene (pMUS1398). Finally, the double ∆ nodD1/∆ nodD2 deletion mutant was also complemented separately with a copy of the nodD1 and nodD2 wild-type gene. For that, plasmid pMUS1395 and the nodD1 gene cloned into plasmid pK18mobsacB (pMUS1397) were integrated in the genome of the double mutant strain by conjugation and simple recombination, respectively, obtaining the ∆ nodD1/∆ nodD2 (pMUS1397) and the ∆ nodD1/∆ nodD2 (pMUS1395) strains. Primers employed in this study are listed in TableS7. The parental and derivative strains were deposited at the culture collection of the Department of Biology of the Universidad de Sevilla and at the Diazotrophic and Plant Growth Promoting Bacteria Culture Collection of Embrapa Soja (WFCC Collection #1213, WDCM Collection #1054). Determination of β-galactosidase activity. To determinate the β -galactosidase activity, wild-type, mutant and complemented strains were conjugated with the plasmid pMP240 which contains the transcriptional fusion between the R. leguminosarum bv. viciae nodA promoter and the lacZ gene (TableS1)36. Assays of β -galactosidase Figure 3. Proposed model to explain the regulation of the expression of the nod genes under apigenin (A) and salt stress (B) conditions in Rhizobium tropici CIAT 899. In the presence of high concentration of salt, NodD1 binds to NB9 increasing the expression of nodD2. (+ ) Indicates confirmed up-regulation, (+ a) indicates that flavonoids or salt activate NodD1 and NodD2, respectively, whereas other factors may also be involved in the activation, (+ b) indicates up-regulation confirmed in Rhizobium leguminosarum bv. viciae, (+ c) indicates putative up-regulation according to our transcriptomic CIAT 899 data, where in the presence of high concentration of salt, NodD1 binds to NB9 increasing the expression of nodD2 expression. Finally, (?) indicates hypothetic up-regulation. www.nature.com/scientificreports/ 8 Scientific RepoRts | 7:46712 | DOI: 10.1038/srep46712 activity from CIAT 899 and derivative strains were carried out as described by Zaat et al.37. Units of β -galac tosidase activity were calculated according to Miller38. The experiments were repeated three times, with six replicates each time. RP-TLC analysis of NF. Reversed-phase thin layer chromatography analyses were performed according to Spaink et al.31. Briefly, R. tropici CIAT 899 was grown on B- minimal medium, supplemented when necessary with inducing molecules. For the radiolabeling of Nod factors, 0.2 μ Ci of N-acetil-D-[1-14C]-glucosamine (specific activity 0.05 mCi) (PerkinElmer) was used. Cultures of 1 mL were grown to the end of the exponential growth phase and the supernatant was extracted with water-saturated butanol. The butanol fraction was evaporated to dryness and the resulting powder dissolved in 40 μ l of water-saturated butanol. This solution (10 μ L) was applied to the TLC plate (RP-18F254S) (Merck), where the Nod factors were separated with 50% acetonitrile/H2O (vol/ vol) as the mobile phase. TLC plates were exposed to a Fuji BAS-IIIs film for 10 days and the image was digitalized using the Phosphor-image system (Fuji). Identification of NF and biological activity assays. NF purification and LC-MS/MS analyses were performed as previously described21,22 by growing the wild-type and the derivative mutant strains in B− minimal medium, supplemented when required with NaCl 300 mM or apigenin 3.7 μ M. The purified NF were used for biological activity assays. Thus, common bean seeds were surface-sterilized and mounted in test tubes on a curled wire with the roots in 25 mL of Farhaeus medium39. Roots were shielded from light, and plants were grown for 10 days. Chamber conditions were 16 h at 26 °C in the light and 8 h and 18 °C in the dark, with 70% of humidity. To determine the presence of pseudonodules, roots were cleared with sodium hypochlorite and stained with methylene blue using the method of Truchet et al.40. Each experiment was repeated three times with six plants for each treatment. Nodulation assays. For the evaluation of the symbiotic phenotypes, the wild-type, the mutants and the complemented strains were grown in YM medium until the concentration of 109 cells mL−1. Surface-sterilized seeds of P. vulgaris and L. burtii were pre-germinated and placed on sterilized Leonard jars and test tubes respectively, containing Farhaeus N-free solution39. Germinated seeds were then inoculated with 1 mL of bacterial culture. Growth conditions were 16 h at 26 °C in the light and 8 h and 18 °C in the dark, with 70% of humidity. Nodulation parameters were evaluated after 30 days for P. vulgaris or 45 days for L. burtii. Shoots were dried at 70 °C for 48 h and weighed. Nodulation experiments were performed three times. RNA extraction. Total RNA was isolated using a High Pure RNA Isolation Kit (Roche), according to the manufacturer’s instructions. Verification of the amount and quality of total RNA samples was carried out using a Nanodrop 1000 spectrophotometer (Thermo Scientific) and a Qubit 2.0 Fluorometer (Invitrogen). Two independent total RNA extractions were obtained for each condition. Quantitative reverse transcription PCR. Results obtained in the RNA-seq analysis were validated by quantitative reverse transcription PCR (qRT-PCR) of 13 selected nodulation genes which represented differentially and non-differentially expressed genes in the presence of apigenin and salt. Total RNA was isolated using a High Pure RNA Isolation Kit (Roche) and RNAase Free DNA Set (Qiagen), according to the manufacturer’s instructions. This (DNA-free) RNA was reverse transcribed into cDNA using a QuantiTec Reverse Transcription Kit (Qiagen). Quantitative PCR was performed using a LightCycler 480 (Roche) with the following conditions: 95 °C, 10 min; 95 °C, 30 s; 50 °C, 30 s; 72 °C, 20 s; forty cycles, followed by the melting curve profile from 60 to 95 °C to verify the specificity of the reaction. The R. tropici CIAT 899 16S rRNA gene was used as an internal control to normalize gene expression. The fold-changes of two biological samples with three technical replicates of each condition were obtained using the Δ Δ Ct method41. Selected genes and primers are listed in S5. RNA sequencing. Ribosomal RNA was depleted using a MICROB Express Bacterial mRNA Purification kit (Ambion), following the manufacturer’s protocol. Integrity and quality of the ribosomal depleted RNA was checked with Agilent Bioanalyzer 2100 (Agilent Technologies). RNA sequencing was carried out by Sistemas Genómicos (https://www.sistemasgenomicos.com/web_sg/) with the Next Generation Sequence (NGS) platform Illumina using the Illumina HiSeq 2000 sequencing instrument (Illumina). Ribosomal-depleted samples were used to generate whole transcriptome libraries following the manufacturer’s recommendations for sequencing on this NGS platform. Amplified cDNA quality was analyzed by the Bioanalyzer 2100 DNA 1000 kit (Agilent Technologies) and quantified using the Qubit 2.0 Fluorometer (Invitrogen). The RNA-seq data discussed in this work have been deposited in the Sequence Read Archive of NCBI under the accession number PRJNA326592. Mapping of the RNA-seq data. The initial whole transcriptome paired-end reads obtained from sequencing were mapped against the latest version of the R. tropici CIAT 899 genome (http://www.ncbi.nlm.nih.gov/ genome/?term= Rhizobium_tropici_CIAT_899) using the Life Technologies mapping algorithm version 1.3 (http://www.lifetechnologies.com/). Low-quality reads were eliminated using Picard Tools software version 1.83, remaining only high quality reads. Assessment of differentially expressed genes. Gene prediction was estimated using the cufflinks method42 and the expression levels were calculated using the htseq software, version 0.5.4p343. This method eliminates multimapped reads, considering only unique reads for the gene expression estimation. The edge method version 3.2.4 was applied for differential expression analysis among conditions44. This method uses a Poisson model to estimate the variance of the RNA-seq data for differential expressions, and relies on different normalized processes based on depth global samples, CG composition and length of genes. Differentially expressed genes were established in those genes with a fold-change lower or higher than − 3 or 3, respectively, with a p value adjust to 0.1545,46. www.nature.com/scientificreports/ 9 Scientific RepoRts | 7:46712 | DOI: 10.1038/srep46712 References 1. Hassan, S. & Mathesius, U. The role of flavonoids in root-rhizosphere signalling: opportunities and challenges for improving plantmicrobe interactions. J Exp Bot. 63, 3429–3444 (2012). 2. Makoi, J. H. J. R. & Ndakidemi, P. A. Biological, ecological and agronomic significance of plant phenolic compounds in rhizosphere of the symbiotic legumes. African Journal of Biotechnology. 6, 1358–1368 (2007). 3. Cooper, J. E. Early interactions between legumes and rhizobia: disclosing complexity in a molecular dialogue. J Appl Microbiol. 103, 1355–1365 (2007). 4. Oldroyd, G. E. Speak, friend, and enter: signaling systems that promote beneficial symbiotic associations in plants. Nat Rev Microbiol. 11, 252–263 (2013). 5. Hungria, M., Johnston, A. W. B. & Phillips, D. A. Effects of flavonoids released naturally from bean (Phaseolus vulgaris) on nodD- regulated gene transcription in Rhizobium leguminosarum bv. phaseoli. Mol Plant Microbe Interact. 5, 199–203 (1992). 6. Hungria, M. & Phillips, D. A. Effects of a seed color mutation on rhizobial nod-gene-inducing flavonoids and nodulation in common bean. Mol Plant Microbe Interact. 6, 418–422 (1993). 7. Schlaman, H. R. M., Phillips, D. A. & Kondorosi, E. Genetic organization and transcriptional regulation of rhizobial nodulation genes. In Spaink, H. P., Kondorosi, A., Hooykaas, P. J. J. editors. The Rhizobiaceae. Kluwer Academic Publishers. pp. 361–386 (1998). 8. Long, S. R. SnapShot: Signaling in Symbiosis. Cell. 167, 582–582 (2016). 9. Peck, M. C., Fisher, R. F. & Long, S. R. Diverse flavonoids stimulate NodD1 binding to nod gene promoters in Sinorhizobium meliloti. J Bacteriol. 188, 5417–5427 (2006). 10. Peck, M. C., Fisher, R. F., Bliss, R. & Long, S. R. Isolation and characterization of mutant Sinorhizobium meliloti NodD1 proteins with altered responses to luteolin. J Bacteriol. 195, 3714–3723 (2013). 11. Dénarié, J., Debelle, F. & Prome, J. C. Rhizobium lipo-chitooligosaccharide nodulation factors: signaling molecules mediating recognition and morphogenesis. Annu Rev Biochem. 65, 503–535 (1996). 12. del Cerro, P. et al. NrcR, a New Transcriptional Regulator of Rhizobium tropici CIAT 899 Involved in the Legume Root-Nodule Symbiosis. PloS one. 11, e0154029; doi: 10.1371/journal.pone.0154029 (2016). 13. Barnett, M. J. & Long, S. R. The Sinorhizobium meliloti SyrM regulon: effects on global gene expression are mediated by syrA and nodD3. J bacteriol. 197(10), 1792–1806 (2015). 14. Cren, M., Kondorosi, A. & Kondorosi, E. NolR controls expression of the Rhizobium meliloti nodulation genes involved in the core Nod factor synthesis. Mol Microbiol. 15, 733–747 (1995). 15. Vinardell, J. M. et al. NolR regulates diverse symbiotic signals of Sinorhizobium fredii HH103. Mol Plant Microbe Interact. 17, 676–685 (2004). 16. Moscatiello, R., Squartini, A., Mariani, P. & Navazio, L. Flavonoid-induced calcium signalling in Rhizobium leguminosarum bv. viciae. New Phytol. 188(3), 814–823 (2010). 17. Leganes, F., Forchhammer, K. & Fernandez-Pinas, F. Role of calcium in acclima-tion of the cyanobacterium Synechococcus elongatus PCC 7942 to nitrogenstarvation. Microbiology. 155, 25–34 (2009). 18. Hungria, M. et al. Isolation and characterization of new efficient and competitive bean (Phaseolus vulgaris L.) rhizobia from Brazil. Soil Biol Biochem. 21, 1515–1528 (2000). 19. Martínez-Romero, E. et al. Rhizobium tropici, a novel species nodulating Phaseolus vulgaris L. beans and Leucaena sp. trees. Int J Syst Bacteriol. 41, 417–426 (1991). 20. Ormeño-Orrillo, E. et al. Genomic basis of broad host range and environmental adaptability of Rhizobium tropici CIAT 899 and Rhizobium sp. PRF 81 which are used in inoculants for common bean (Phaseolus vulgaris L.). BMC Genomics 13, 735; doi: 10.1186/1471-2164-13-735 (2012). 21. del Cerro, P. et al. Regulatory nodD1 and nodD2 genes of Rhizobium tropici strain CIAT 899 and their roles in the early stages of molecular signaling and host-legume nodulation. BMC Genomics. 16, 251; doi: 10.1186/s12864-015-1458-8 (2015). 22. del Cerro, P. et al. Opening the “black box” of nodD3, nodD4 and nodD5 genes of Rhizobium tropici strain CIAT 899. BMC Genomics. 16, 864; doi: 10.1186/s12864-015-2033-z (2015). 23. Nogales, J. et al. Rhizobium tropici genes involved in free-living salt tolerance are required for the establishment of efficient nitrogenfixing symbiosis with Phaseolus vulgaris. Mol plant microbe interact. 15, 225–232 (2002). 24. Poupot, R., Martínez-Romero, E. & Promé, J. C. Nodulation factors from Rhizobium tropici are sulfated or nonsulfated chitopentasaccharides containing an N-methyl-N-acylglucosaminyl terminus. Biochemistry. 32, 10430–10435 (1993). 25. Morón, B. et al. Low pH changes the profile of nodulation factors produced by Rhizobium tropici CIAT899. Chem Biol. 12, 1029–1040 (2005). 26. Estévez, J. et al. Different and new Nod factors produced by Rhizobium tropici CIAT899 following Na+ stress. FEMS Microbiol Lett. 293, 220–231 (2009). 27. Guasch-Vidal, B. et al. High NaCl concentrations induce the nod genes of Rhizobium tropici CIAT899 in the absence of flavonoid inducers. Mol Plant Microbe Interact. 26, 451–460 (2013). 28. Pérez-Montaño, F. et al. RNA-seq analysis of the Rhizobium tropici CIAT 899 transcriptome shows similarities in the activation patterns of symbiotic genes in the presence of apigenin and salt. BMC Genomics 17, 198; doi: 10.1186/s12864-016-2543-3 (2016). 29. Phillips, D. A., Joseph, C. M. & Maxwell, C. A. Trigonelline and stachydrine released from alfalfa seeds activate NodD2 protein in Rhizobium meliloti. Plant Physiol. 99, 1526–1531 (1992). 30. Beringer, J. E. R factor transfer in Rhizobium leguminosarum. J Gen Microbiol. 84, 188–198 (1974). 31. Spaink, H. P. Rhizobial lipo-oligosaccharides: answers and questions. Plant Mol Biol. 20, 977–986 (1992). 32. Vincent, J. M. The modified Fåhraeus slide technique. A manual for the practical study of root nodule bacteria, eds Vincent, J. M. 144–145 (Oxford, UK. Blackwell Scientific Publications, 1970). 33. Sambrook, J., Fritsch, E. F. & Maniatis, T. Molecular Cloning. A Laboratory Manual, (Cold Spring Harbor NY USA, 1989). 34. Lamrabet, Y. et al. Mutation in GDPfucose synthesis genes of Sinorhizobium fredii alters Nod factors and significantly decreases competitiveness to nodulate soybeans. Mol Plant Microbe Interact. 12, 207–217 (1999). 35. Griffitts, J. S. & Long, S. R. A symbiotic mutant of Sinorhizobium meliloti reveals a novel genetic pathway involving succinoglycan biosynthetic functions. Mol Microbiol. 67, 1292–1306 (2008). 36. de Maagd, R. A., Wijffelman, C. A., Pees, E. & Lugtenberg, B. J. J. Detection and subcellular localization of two Sym plasmiddependent proteins of Rhizobium leguminosarum biovar viciae. J Bacteriol. 170, 4424–4427 (1988). 37. Zaat, S. A. et al. Induction of the nodA promoter of Rhizobium leguminosarum Sym plasmid pRL1JI by plant flavanones and flavones. J Bacteriol. 169, 198–204 (1987). 38. Miller, J. H. Experiment in Molecular Genetics. (Cold Spring Harbor NY USA, 1972). 39. Farhaeus, G. The infection of clover root hairs by nodule bacteria studied by a simple glass slide technique. J Gen Microbiol. 16, 374–381 (1957). 40. Truchet, G., Camut, S., de Billy, F., Odorico, R. & Vasse, J. The Rhizobium-legume symbiosis. Two methods to discriminate between nodules and other root derived structures. Protoplasma. 149, 82–89 (1989). 41. Pfaffl, M. W. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res 29, e45; doi: 10.1093/ nar/29.9.e45 (2001). 42. Trapnell, C. et al. Transcript assembly and quantification by RNA-Seq reveals unannotated transcripts and isoform switching during cell differentiation. Nat Biotechnol. 28, 511–515 (2010). www.nature.com/scientificreports/ 10 Scientific RepoRts | 7:46712 | DOI: 10.1038/srep46712 43. Anders, S. & Huber, W. Differential expression analysis for sequence count data. Genome Biol. 11, R106 (2010). 44. Robinson, M. D., McCarthy, D. J. & Smyth, G. K. edgeR a Bioconductor package for differential expression analysis of digital gene expression data. Bioinformatics. 26, 139–140 (2010). 45. Kovach, M. E. et al. Four new derivatives of the broad-host-range cloning vector pBBR1MCS, carrying different antibiotic-resistance cassettes. Gene. 166, 175–176 (1995). 46. Schafer, A. et al. Small mobilizable multi-purpose cloning vectors derived from the Escherichia coli plasmids pK18 and pK19: selection of defined deletions in the chromosome of Corynebacterium glutamicum. Gene. 145, 69–73 (1994). Acknowledgements We would like to thank the Ministerio de Economía y Competitividad of the Spanish government (project AGL2016-77163-R), the Junta de Andalucía (project P11-CVI-7050) and the University of Seville (VPPI) for funding this work. Mr. Del Cerro is recipient of an FPU fellowship (FPU14/00160) of the Ministerio de Economía y Competitividad. Dr. Pérez-Montaño is recipient of a post-doctoral contract of the VPPI of the University of Seville. Dr. Hungria is a research fellow of CNPq-Brazil. We also would like to acknowledge Dr. Juan Carlos Treviño (Sistemas Genómicos S.L.) for his help during all the bioinformatic analysis and Dr. Jonathan Trow (Sequence Read Archive from NCBI) for his technical assistance during the RNA-seq data submission. We thank the Servicio General de Biología of the CITIUS from the University of Seville for allowing us to use their laboratory equipment. Author Contributions Designed the experiments: F.J.O., M.M., M.H. Performed the experiments: P.d.C., F.P.M., F.J.L.B., A.G.S. Wrote the paper: F.J.O., P.d.C., F.P.M., M.H. Funding resources: F.J.O., F.J.L.B., A.G.S., M.M. Additional Information Supplementary information accompanies this paper at http://www.nature.com/srep Competing Interests: The authors declare no competing financial interests. How to cite this article: del Cerro, P. et al. The Rhizobium tropici CIAT 899 NodD2 protein regulates the production of Nod factors under salt stress in a flavonoid-independent manner. Sci. Rep. 7, 46712; doi: 10.1038/ srep46712 (2017). Publisher's note: Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. This work is licensed under a Creative Commons Attribution 4.0 International License. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in the credit line; if the material is not included under the Creative Commons license, users will need to obtain permission from the license holder to reproduce the material. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/ © The Author(s) 2017 RESEARCH ARTICLE Osmotic stress activates nif and fix genes and induces the Rhizobium tropici CIAT 899 Nod factor production via NodD2 by up-regulation of the nodA2 operon and the nodA3 gene Pablo del CerroID 1 , Manuel Megı ´as 1 , Francisco Javier Lo ´pez-Baena 1 , Antonio Gil- Serrano 2 , Francisco Pe ´rez-Montaño 1 , Francisco Javier OlleroID 1 * 1Departamento de Microbiologı ´a, Facultad de Biologı ´a, Universidad de Sevilla, Sevilla, Spain, 2Departamento de Quı ´mica Orga ´nica, Facultad de Quı ´mica, Universidad de Sevilla, Sevilla, Spain *[email protected]. Abstract The symbiosis between rhizobia and legumes is characterized by a complex molecular dialogue in which the bacterial NodD protein plays a major role due to its capacity to activate the expression of the nodulation genes in the presence of appropiate flavonoids. These genes are involved in the synthesis of molecules, the nodulation factors (NF), responsible for launching the nodulation process. Rhizobium tropici CIAT 899, a rhizobial strain that nodulates Phaseolus vulgaris, is characterized by its tolerance to multiple environmental stresses such as high temperatures, acidity or elevated osmolarity. This strain produces nodulation factors under saline stress and the same set of CIAT 899 nodulation genes activated by inducing flavonoids are also up-regulated in a process controlled by the NodD2 protein. In this paper, we have studied the effect of osmotic stress (high mannitol concentrations) on the R.tropici CIAT 899 transcriptomic response. In the same manner as with saline stress, the osmotic stress mediated NF production and export was controlled directly by NodD2. In contrast to previous reports, the nodA2FE operon and the nodA3 and nodD1 genes were up-regulated with mannitol, which correlated with an increase in the production of biologically active NF. Interestingly, in these conditions, this regulatory protein controlled not only the expression of nodulation genes but also the expression of other genes involved in protein folding and synthesis, motility, synthesis of polysaccharides and, surprinsingly, nitrogen fixation. Moreover, the non-metabolizable sugar dulcitol was also able to induce the NF production and the activation of nod genes in CIAT 899. Introduction Legume plants can establish a symbiotic interaction with a group of soil bacteria, known as rhizobia, that fix atmospheric nitrogen in specialized root organs called nodules. This process requires a complex and evolved molecular dialogue between both organisms, which is initiated PLOS ONE | https://doi.org/10.1371/journal.pone.0213298 March 27, 2019 1 / 23 a1111111111 a1111111111 a1111111111 a1111111111 a1111111111 OPEN ACCESS Citation: del Cerro P, Megı ´as M, Lo ´pez-Baena FJ, Gil-Serrano A, Pe ´rez-Montaño F, Ollero FJ (2019) Osmotic stress activates nif and fix genes and induces the Rhizobium tropici CIAT 899 Nod factor production via NodD2 by up-regulation of the nodA2 operon and the nodA3 gene. PLoS ONE 14 (3): e0213298. https://doi.org/10.1371/journal. pone.0213298 Editor: Marie-Joelle Virolle, Universite Paris-Sud, FRANCE Received: November 7, 2018 Accepted: February 19, 2019 Published: March 27, 2019 Copyright: ©2019 del Cerro et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Data Availability Statement: All relevant data are included in the paper and its Supporting Information files, or are available in the NCBI repository. The RNA-seq data discussed in this work have been deposited in the Sequence Read Archive of NCBI under the accession numbers PRJNA470887, PRJNA326592 and PRJNA305690. Funding: PdC, MM, AMGS, FJO were supported by Ministerio de Economı ´a y Competitividad, grant by the exudation of plant flavonoids [1]. These molecules are recognized by the NodD protein, a bacterial transcriptional regulator that binds to specific promoter sequences denominated nod boxes (NB), activating the expression of the nodulation (nod) genes. Proteins encoded by these genes are responsible for the synthesis and export of specific rhizobial lipochitooligosaccharides, also called Nod factors (NF) [2,3], whose recognition by the host plant triggers both rhizobial infection and initiation of nodule organogenesis [4]. Interestingly, in Rhizobium tropici CIAT 899 (hereafter CIAT 899), a broad host-range strain microsymbiont of Phaseolus vulgaris (common bean), the synthesis and export of NF is not only triggered by inducing flavonoids but also by acidity or high concentrations of salt [5–7]. The analysis of the CIAT 899 genome indicates that this bacterium harbours in the symbiotic plasmid three different nodA genes and five different nodD genes, which are responsible for the CIAT 899 capacity to produce a large variety of NF under different environmental conditions [8–11]. During their free-living stage in the soil, rhizobia are exposed to multiple physical stresses such as high temperatures, acidity or elevated osmolarity [12]. Interestingly, CIAT 899 is also characterized for tolerating all these stressing conditions [13]. Thereby, the CIAT 899 transcriptome in the presence of salt displays many differentialy expressed genes involved in osmotic-stress tolerance and adaptation [14]. Besides, under these stressing conditions, the same set of CIAT 899 nodulation genes activated by inducing flavonoids (nodA1BCSUIJH [under the control of nod box1, NB1], nodA2hsnTnodFE [NB2], nodM [NB3], y4wEF [NB4] and two genes with unknown functions [NB5]) are also up-regulated, suggesting that synthesis and export of NF occurs in the same manner. However, the salt-mediated production of NF in this bacterium is induced by NodD2, whereas flavonoid-induced synthesis is controlled by NodD1 [14–17]. This peculiar production of symbiotic molecules seems to be a strategy of CIAT 899 to ensure nodulation under osmotic stressing conditions [14]. In this paper, we have studied the R.tropici CIAT 899 transcriptomic response to the presence of high concentrations of mannitol to establish the similarities and differences between salt- and mannitol-mediated transcriptomic responses. Besides to changes in the expression values of genes related to osmotic-stress tolerance and mannitol metabolism, RNA-seq experiments indicated that not only some nod genes were up-regulated in the presence of mannitol but also operons implied in nitrogen fixation. Moreover, other non-metabolizable sugar (dulcitol) also induce the NF production and nod genes activation in CIAT 899. Finally, we determined that the activation of nodulation genes correlated with the overproduction of NF, which directly depended on the NodD2 protein. Materials and methods Bacterial strains and plasmids Strains used in this study were grown at 28˚C on tryptone yeast (TY) medium (0 mM mannitol) for RNA-seq studies [18], B - minimal medium (55 mM mannitol) in NF-related experiments [19] or yeast extract mannitol (YM) medium (16,5 mM mannitol) in the ß-galac- tosidase assays [20], supplemented with the appropriate mannitol concentrations when necessary. Escherichia coli strains were cultured on LB medium [21] at 37˚C. When required, the media were supplemented with the appropriate antibiotics as previously described [22]. The growing curves were obtained with a Sinergy HT microplate reader (BioTek, USA) and growing the bacteria for 72 h at 28˚C with continuous orbital shaking. Measurements were made every 4 h. In this work the wild strain R.tropici CIAT 899 [15] and their nodD mutant derivative strains were used: nodD1 mutant [7], nodD2 mutant [10], nodD3,nodD4, and nodD5 mutants [11]. Plasmid pMP240 [23], which contains a transcriptional fusion between the Osmotic stress induces R.tropici CIAT 899 Nod factor synthesis PLOS ONE | https://doi.org/10.1371/journal.pone.0213298 March 27, 2019 2 / 23 reference: AGL2016-77163-R. http://www.ciencia. gob.es/portal/site/MICINN/. PdC was supported by Ministerio de Educacio ´n, Cultura y Deporte, grant reference: FPU14-00160. https://www.mecd.gob. es/portada-mecd/. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. Competing interests: The authors have declared that no competing interests exist. R.leguminosarum biovar viciae nodA promoter and the lacZ gene, was transferred by conjugation to all these strains. RNA extraction and sequencing R.tropici CIAT 899 and the ΔnodD2 mutant were grown on 7 ml of TY medium, supplemented with 400 mM mannitol when necessary. Bacteria were incubated at an orbital shaker (180 rpm) for 72 h at 28˚C. To ensure aeration, the 7 ml of TY cultures were placed in 50 ml Falcon tubes. Total RNA was isolated using a High Pure RNA Isolation Kit (Roche, Switzerland) according to the manufacturer’s protocol. Verification of the amount and quality of total RNA samples was carried out using a Nanodrop 1000 spectrophotometer (Thermo Scientific, USA) and a Qubit 2.0 Fluorometer (Invitrogen, USA). Two independent total RNA extractions were obtained for each condition and strain. Ribosomal RNA was depleted using a MICROB Express Bacterial mRNA Purification kit (Ambion, USA), following the manufacturer´s protocol. Integrity and quality of the ribosomal depleted RNA was checked with an Agilent Bioanalyzer 2100 (Agilent Technologies, USA). RNA sequencing was carried out by Sistemas Geno ´micos (https://www.sistemasgenomicos. com/web_sg/) with the Next Generation Sequencing (NGS) platform Illumina with 100pb pair-end reads using the Illumina HiSeq 2000 sequencing instrument (Illumina, USA). Ribosomal-depleted samples were used to generate whole transcriptome libraries following the manufacturer’s recommendations for sequencing on this NGS platform. Amplified cDNA quality was analyzed by the Bioanalyzer 2100 DNA 1000 kit (Agilent Technologies, USA) and quantified using the Qubit 2.0 Fluorometer (Invitrogen, USA). The RNA-seq data discussed in this work have been deposited in the Sequence Read Archive of NCBI under the accession numbers PRJNA470887, PRJNA326592 [17] and PRJNA305690 [14]. A total of 8 RNA-seq libraries corresponding to the wild-type and the nodD2 mutant strain, both under control and mannitol 400 mM conditions were generated (two independent biological experiments for each condition). Quality control of each run, sample normalizations and statistical procedures were performed as previously described [14] (S1 File). Differentially expressed genes for each strain and condition were obtained by comparing with gene expression levels of the wild-type strain grown under control conditions (S2 and S3 Files). Data set was validated by qRT-PCR as previously described [14], obtaining in all cases positive correlation degrees in fold-change values between the qRT-PCR and the RNA-seq data (Table 1,S4 File). RNA-seq data analysis In the primary analysis, a quality control of the raw data was carried out by fastq. In the secondary analysis, the initial whole transcriptome paired-end reads obtained from sequencing were mapped against the latest version of the R.tropici CIAT 899 genome (http://www.ncbi. nlm.nih.gov/genome/?term=Rhizobium_tropici_CIAT_899) using the mapping algorithm Bowtie2 v2.3.1 [24]. Low-quality reads were eliminated using Samtools [25,26] and Picard Tools (http://broadinstitute.github.io/picard/), remaining only high-quality reads. The genetic quantification was calculated using the htseq_count 0.6.1p1 method [27]. Gene differential expression and quantification were obtained by using DESeq2 [28]. In the tertiary anaylsis, the study of the concordance between the samples of the same conditions were made by a correlation study and Euclidean distance by using the statistic software R. To carry out the differential expression study among groups of samples Phyton and R software, and DESeq2 algorithm were used. Differentially expressed genes (DEG) in this study were established in those genes with a fold-change lower or higher than -2.5 or 2.5, respectively, with a pvalue adjusted to 0.05 Osmotic stress induces R.tropici CIAT 899 Nod factor synthesis PLOS ONE | https://doi.org/10.1371/journal.pone.0213298 March 27, 2019 3 / 23 by FDR [29]. Only the genes differentially expressed were considered for the biological processes represented from the Gene Ontology database (Fig 1). Quantification of nitrogenase activity One colony of R.tropici CIAT 899 was grown for 72 h at 28˚C in NFb [30] soft agar (0.4% agar) to simulate microaerobiosis conditions supplemented or not with 400 mM mannitol or Table 1. RNA-Seq data validation using qRT-PCR. Fold-change values were calculated using the ΔΔCt method and normalized to the reference gene 16S for 7 differentially expressed genes in the presence of mannitol 400 mM. Gene name ID / replicon RNA-Seq qRT-PCR CIAT 899 nodD2 mutant CIAT 899 nodD2 mutant mtlD YP_007335070.1 / chromosome 3.59 3.55 2.84±0.62 3.58±0.67 mtlE YP_007335074.1 / chromosome 6.67 5.67 5.48±0.97 4.87±0.69 fixC YP_007336103.1 / pRtrCIAT899b 5.65 5.42 3.86±0.21 7.26±1.23 nodA2 YP_007336039.1 / pRtrCIAT899b 2.57 1.57 2.78±0.33 1.16±0.16 nodA3 YP_007335966.1/ pRtrCIAT899b 3.59 2.13 3.04±0.86 2.07±0.24 nodF YP_007335966.1 / pRtrCIAT899b 3.49 2.58 4.67±1.01 2.27±0.43 nifH YP_007336128.1 / pRtrCIAT899b 11.90 9.06 12.25±2.43 8.66±1.86 https://doi.org/10.1371/journal.pone.0213298.t001 Fig 1. Percentage of genes from each Gene Ontology category differentially expressed with 400 mM mannitol. The percentage of genes shown corresponds to those genes present in the Gene Ontology database. Asteriks (�) indicate those categories with higher percentages. https://doi.org/10.1371/journal.pone.0213298.g001 Osmotic stress induces R.tropici CIAT 899 Nod factor synthesis PLOS ONE | https://doi.org/10.1371/journal.pone.0213298 March 27, 2019 4 / 23 dulcitol. After the incubation period, nitrogenase activity was quantified by acetylene reduction assays (ARA) as previously described [31]. Azospirilum brasilense Abv6 that also grows in 400 mM of mannitol, was used as positive control for ARA [32]. Determination of the non-metabolizable sugar and culture media The capacity of R.tropici CIAT 899 to use carbohydrates was studied by means of the API 50CH system (Biome ´rieux, France) according to the manufacturer’s instructions. YM and B - media were used for β-galactosidase assays and Nod factor determination, respectively, in the presence of high concentrations of the non-metabolizable sugar. The YM and B - media contained 16.5 mM and 55 mM of mannitol, respectively, sugar concentrations that ensure bacterial growth. The non-metabolizable sugar was added to culture media at the appropriated concentration. β-galactosidase assay β-galactosidase activity assays with strains harbouring plasmid pMP240 were carried out as previously described [33] by using YM medium. Units of β-galactosidase activity were calculated according to Miller [34]. The experiments were repeated three times, with six replicates each time. RP-TLC analysis of NF and biological activity determination Reversed-phase thin layer chromatography (RP-TLC) analyses were performed as previously described [19]. R.tropici CIAT 899 was grown on B - minimal medium, supplemented when necessary with inducing molecules. For the NF radiolabeling, 0.2 μCi of N-acetyl-D-[1- 14 C]- glucosamine (specific activity 0.05 mCi) (Perkin Elmer) was used. Cultures of 1 mL were grown to the end of the exponential growth phase and the supernatant was extracted with water-saturated butanol. The butanol fraction was evaporated to dryness and the resulting powder dissolved in 40 μL of water-saturated butanol. This solution (10 μL) was applied to the TLC plate (RP-18F254S) (Merck, Germany), where the Nod factors were separated with 50% acetonitrile/H 2 O (vol/vol) as the mobile phase. TLC plates were exposed to a Fuji BAS-IIIs film for 10 days and the image was digitalized using the Phosphor-image system (Fujifilm, Japan). NF were purified from 1 L of culture for each sample following the procedure previously described [35]. Purified NF were resuspended in 50 ml of acetonitrile 20% and 1 μL per mL of plant nutrient solution was added for biological activity assays. Thus, P.vulgaris Blue Bush Lake seeds were surface-sterilized and mounted in test tubes on a curled wire with the roots in 25 mL of Farhaeus medium [36]. Roots were protected from light and plants were grown for 10 days. Growth chamber conditions were 16 h at 26˚C in the light and 8 h and 18˚C in the dark, with 70% of humidity. To determine the presence of nodule primordia, roots were cleared with sodium hypochlorite and stained with methylene blue using the method of Truchet et al., 1989 [37]. Each experiment was repeated three times with six plants for each treatment. Nod factor determination by UHPLC-MS/MS NF were purified as described above. Then, NF were analyzed with an Ultra High Preasure Liquid Chromatography (UHPLC) system consisting of a quaternary UHPLC Dionex Ultimate 3000 SD connected to a quadrupole-orbitrap Qexactive hybrid mass spectrometer (MS) (ThermoFisher Scientific, USA) with HESI ionization probe. Xcalibur software was used for Osmotic stress induces R.tropici CIAT 899 Nod factor synthesis PLOS ONE | https://doi.org/10.1371/journal.pone.0213298 March 27, 2019 5 / 23 instrument control and data acquisition. Separation was carried out using a Tracer Excel 120 ODSB C18 column (2.1 x 200 mm, 5 μm) (Teknokroma, Spain) at a flow rate of 0.3 ml/min. A binary gradient consisting of (A) water and (B) acetonitrile, both containing 0.1% formic acid, was used with the following elution profile: 50% B (5 min), linear gradient to 100% B (30 min), 100% B (2 min), linear up to 50% B (3 min) and finally 50% B (5 min). The injection volume was 20 μL. A Data Dependent Adquisition method (TOP5) was used in positive mode at resolution 70000 and 17500 at m/z 200 FWHM for Full Scan and Product Ion Scan, respectively. HESI source parameters were: spray voltage, 3.5 kV; S lens level, 50; capillary temperature, 320˚C; sheath, auxiliary and sweep gas flow, 48, 11 and 2 respectively (arbitrary units); and probe heater temperature, 413˚C. For data treatment, TraceFinder 3.3 software was used. The identification was made by comparing (maximum deviation of 5 ppm) the exact masses of the pseudomolecular ion and their fragment ions with the data contained in a LCO database with 1114 possible compounds. Isotopic pattern scores higher than 80% were also required. Results Differentially expressed genes and biological processes altered in the presence of mannitol The most surprising trait of CIAT 899 relies on its ability to produce biologically active NF under salt-stressing conditions in a flavonoid-independent manner via NodD2 [7,17]. However, the question is whether NF production is induced only in the presence of salt, which generates both ionic and osmotic stresses, or whether it is also induced in the presence of other osmotic stresses such as high mannitol concentration. To shed light to these questions, we have analyzed the effect of high concentrations of mannitol on CIAT 899. First, to establish the appropriate concentration of solute, the growing curves of CIAT 899 in mannitol increasing conditions were obtained (TY medium supplemented with 0 mM to 1000 mM of mannitol). Concentrations higher than 500 mM of mannitol severely decreased bacterial growth-rate, whilst concentrations between 100 and 400 mM did not significantly affect growth (S5 File). For this reason, we established 400 mM of mannitol as the osmotic-stressing condition for further studies. To study the effect of mannitol on the global gene expression of CIAT 899, transcriptomic assays were carried out. Thus, four RNA-seq libraries corresponding to CIAT 899 grown under control (TY medium) or mannitol 400 mM conditions were constructed. Two independent biological experiments were performed for each condition, being the general features of each run displayed in S1 File. Differentially expressed genes (DEG) in each condition are shown in S2 and S3 Files. Data set was validated by qRT-PCR experiments (Table 1,S4 File). The R.tropici CIAT 899 genome harbours 6289 genes distributed among one chromosome (3672 CDS, CP004015.1) and three plasmids: pRtrCIAT899a/pA (212 CDS, CP004016.1), pRtrCIAT899b/pB/symbiotic plasmid (500 CDS, CP004017.1), and pRtrCIAT899c/pC (1905CDS, CP004018.1). The transcriptomic analysis showed a total of 743 DEG whose expression was activated or repressed 2.5-fold in the presence of 400 mM of mannitol (S2 File). Most of these genes were up-regulated (461 DEG, 62%). The replicon distribution revealed that most of these genes (468 DEG; 333 up-regulated and 135 down-regulated) were located in the chromosome, some of them in plasmid B (67 DEG; 66 up-regulated and 1 down-regulated) and the rest in plasmid C (36 DEG; 19 up-regulated and 17 down-regulated) (S6 File). Finally, to determine those functions actived or repressed by mannitol, a functional enrichment was performed to establish the significant over-represented biological processes using data available at the Uniprot database (Gene Ontology, GO). In the presence of mannitol, the biological processes statistically affected in CIAT 899 were translation, chemotaxis, Osmotic stress induces R.tropici CIAT 899 Nod factor synthesis PLOS ONE | https://doi.org/10.1371/journal.pone.0213298 March 27, 2019 6 / 23 presence of 400 mM mannitol (Table 2). However, thuAB genes involved in the trehalose catabolism were up-regulated in the presence of mannitol (Table 2). Interestingly, the analysis of DEG indicated that under mannitol conditions, CIAT 899 strongly repressed the exo and the kps genes involved in the synthesis of exopolysaccharide (EPS) and capsular polysaccharide Table 2. (Continued) ID / Replicon Gene name Function Biological Role Fold-change wild-type a Fold-change nodD2 mutant a YP_007332792.1 Chromosome atpF ATP synthase B chain (Subunit I) ATP synthesis 3.90 3.40 YP_007335253.1 Chromosome atpC ATP synthase F1, epsilon subunit ATP synthesis 4.31 3.45 YP_007335254.1 Chromosome atpD ATP synthase F1, beta subunit ATP synthesis 3.96 3.37 YP_007335255.1 Chromosome atpG ATP synthase F1, gamma subunit ATP synthesis 3.34 3.38 YP_007335256.1 Chromosome atpA ATP synthase F1, alpha subunit ATP synthesis 3.78 3.51 YP_007335257.1 Chromosome atpH ATP synthase F1, delta subunit ATP synthesis 3.31 4.40 YP_007332861.1 Chromosome -Polysaccharide deacetylase Polysaccharide synthesis -3.30 -3.01 YP_007333276.1 Chromosome -Exopolysaccharide transport EPS transport -2.73 -3.64 YP_007335159.1 Chromosome -Polysaccharide biosynthesis protein Polysaccharide synthesis -4.01 NDEG YP_007335531.1 Chromosome ndvA Cyclic beta-1,2-glucan exporter Cyclic-glucan transport 4.24 NDEG YP_007337335.1 pRtrCIAT899c kpsE KPS polysaccharide exportation KPS transport -10.59 -8.51 YP_007337336.1 pRtrCIAT899c -KPS polysaccharide exportation KPS transport -13.71 -4.87 YP_007337340.1 pRtrCIAT899c kpsC KPS polysaccharide exportation KPS transport -6.84 -3.99 YP_007337343.1 pRtrCIAT899c kpsE KPS polysaccharide exportation KPS transport -7.62 -6.14 YP_007337344.1 pRtrCIAT899c bexA ATP-binding protein Polysaccharide transport -6.40 -6.38 YP_007337347.1 pRtrCIAT899c -Polysaccharide export protein Polysaccharide transport -12.45 -6.32 YP_007337762.1 pRtrCIAT899c exoX Exopolysaccharide production repressor protein EPS synthesis repressor -3.25 -5.08 YP_007337766.1 pRtrCIAT899c exoZ Succinoglycan biosynthesis acetyltransferase EPS synthesis -2.86 NDEG YP_007336072.1 pRtrCIAT899b psiB Putative polysaccharide inhibition protein Polysaccharide synthesis repressor 3.05 NDEG YP_007334642.1 Chromosome thuA putative trehalose oxidoreductase Trehalose catabolism 6.05 5.13 YP_007334643.1 Chromosome thuB trehalose utilization protein Trehalose catabolism 6.53 5.82 a Fold induction with respect to CIAT 899 uninduced cultures. NDEG: non-differentially expressed genes. Light grey: DEG controlled by NodD2. https://doi.org/10.1371/journal.pone.0213298.t002 Osmotic stress induces R.tropici CIAT 899 Nod factor synthesis PLOS ONE | https://doi.org/10.1371/journal.pone.0213298 March 27, 2019 13 / 23 [Document text truncated for crawler view.]