Oxidative stress in sea bass (Dicentrarchus labrax) larvae fed on high DHA microdiets. Involvement of several antioxidant nutrients

Oxidative stress in sea bass (Dicentrarchus labrax) larvae fed on high DHA microdiets. Involvement of several antioxidant nutrients Mónica Beatriz Betancor Quintana Doctorado en Acuicultura: Producción controlada de organismos acuáticos Grupo de investigación en Acuicultura (GIA) Instituto Universitario de Sanidad Animal y Seguridad Alimentaria (IUSA) Thesis for the degree of Doctor of Phylosophy University of Las Palmas de Gran Canaria 2012 Directors: Prof. Mª José Caballero and Prof. Marisol Izquierdo A mis padres List of Contents Page Nº Abstract…………………………………………………………………………………………………………………..... I List of Abbreviations .………………………………………………………………………………………………… III List of Tables……………………………………………………………………………………………………………… VII List of Figures……………………………………………………………………………………………………………. XI Glossary of Common and Scientific Names……………………………………………………………….. XIX Acknowledgements…………………………………………………………………………………………………….. XXI Chapter 1: General Introduction……………………………………………………………………………….. 1 1.1 Aquaculture production………………………………………………………………………………….. 1 1.2 Rearing techniques and production considerations………………………………………… 2 1.3 Use of inert microdiets for marine fish larvae…………………………………………………. 4 1.4 Importance of lipids in marine fish larvae nutrition…………………………………………. 6 1.5 Importance of DHA for larvae…………………………………………………………………………. 10 1.6 Reactive oxygen species: Generation, detoxification and oxidative stress………. 13 1.6.1 Generation of ROS………………………………………………………………………………… 13 1.6.2 ROS detoxification: Antioxidant defence mechanisms…………………………… 14 1.6.2.1 Enzymatic systems…………………………………………………………………… 15 1.6.2.2 Non enzymatic scavengers………………………………………………………. 17 1.6.2.2.1 Vitamin E ………………………………………………………………… 17 1.6.2.2.2 Vitamin C ………………………………………………………………… 21 1.6.2.2.3 Selenium …………………………………………………………………. 24 1.6.3 Oxidative stress …………………………………………………………………………………….. 27 1.6.3.1 Auto-oxidation of lipids …………………………………………………………… 28 1.7 Pathological effects of oxidation on fish tissues ………………………………………………. 31 1.7.1 The adverse effects of oxidative stress on musculoskeletal system ………. 31 1.7.1.1 Muscular tissue ………………………………………………………………………. 31 1.7.1.2 Bone-skeletal system ………………………………………………………………. 39 Objectives ………………………………………………………………………………………………………………… 41 Chapter 2: General Materials and Methods………………………………………………………………. 43 2.1 Experimental animals and conditions ……………………………………………………………… 43 2.1.1 Fish ………………………………………………………………………………………………………… 43 2.2.2 Experimental conditions ……………………………………………………………………….. 43 2.2.2.1 Green water pre-cultures ………………………………………………………… 43 2.2.2.2 Experimental tank cultures .…………………………………………………….. 44 2.2 Diets and feeding ……………………………………………………………………………………………. 45 2.2.1 Rotifers ………………………………………………………………………………………………….. 45 2.2.2 Microdiets ……………………………………………………………………………………………… 45 2.2.2.1 Microdiets formulation …………………………………………………………….. 45 2.2.2.2 Microdiets preparation …………………………………………………………….. 46 2.2.3 Feeding ………………………………………………………………………………………………….. 46 2.3 Sampling ……………………………………………………………………………………………………….. 49 2.3.1 Biological parameters …………………………………………………………………………….. 49 2.3.2 Proximate analysis …………………………………………………………………………………. 49 2.3.3 Histology ………………………………………………………………………………………………… 49 2.3.4 Molecular biology …………………………………………………………………………………… 49 2.3.5 Activity test and survival ………………………………………………………………………… 49 2.3.6 Growth evaluation …………………………………………………………………………………. 50 2.4 Biochemical analysis………………………………………………………………………………………. 50 2.4.1 Proximate analysis …………………………………………………………………………………. 50 2.4.1.1 Moisture …………………………………………………………………………………… 50 2.4.1.2 Ash …………………………………………………………………………………………… 51 2.4.1.3 Proteins ……………………………………………………………………………………. 51 2.4.1.4 Total lipids ………………………………………………………………………………… 51 2.4.2 Fatty acid methyl esters preparation and quantification ………………………… 51 2.5 Measurement of thiobarbituric reactive substances (TBARS) ………………………… 52 2.6 Determination of vitamin E content ………………………………………………………………. 52 2.6.1 Preparation of standards and calibration curve ……………………………………… 53 2.6.2 Vitamin E extraction from feeds …………………………………………………………….. 54 2.6.3 Vitamin E extraction from larval tissues …………………………………………………. 54 2.6.4 Vitamin E quantification by HPLC …………………………………………………………… 55 2.7 Determination of vitamin C content ………………………………………………………………. 56 2.7.1 Vitamin C extraction from feeds …………………………………………………………….. 57 2.7.2 Vitamin C determination by HPLC ………………………………………………………….. 57 2.7.3 Preparation of standards and calculation of their concentration …………… 58 2.8 Selenium determination ……………………………………………………………………………….. 60 2.9 Histological analysis ………………………………………………………………………………………. 60 2.9.1 Paraffin inclusion …………………………………………………………………………………… 60 2.9.2 Resin inclusion ……………………………………………………………………………………….. 61 2.9.3 Whole mount staining ……………………………………………………………………………. 62 2.10 Molecular biology ………………………………………………………………………………………… 64 2.10.1 Total RNA extraction ……………………………………………………………………………. 65 2.10.2 RNA quality check ………………………………………………………………………………… 65 2.10.3 Synthesis of cDNA ………………………………………………………………………………… 66 2.10.4 Cloning and sequencing ……………………………………………………………………….. 66 2.10.5 Quantitative real-time RT-PCR ……………………………………………………………… 70 2.10.5.1 Generation of in vitro-transcribed cRNAs ……………………………….. 70 2.10.5.2 Generation of standard curves ……………………………………………….. 71 2.10.5.3 Quantitation of transcripts by one step RT-PCR TaqMan ………… 73 2.10.5.4 Sample quantification …………………………………………………………….. 75 2.11 Statistical analysis ………………………………………………………………………………………… 75 2.11.1 Parametric testing ………………………………………………………………………………… 75 2.11.2 Nonparametric testing ………………………………………………………………………….. 76 Chapter 3: α-tocopherol in weaning diets for European sea bass (Dicentrarchus labrax) improves survival and reduces tissue damage caused by excess dietary DHA contents …………………………………………………………………………………………………………………… 77 Chapter 4: Oxidative status and histological changes in sea bass larvae muscle in response to high dietary content of DHA ………………………………………………………………….. 95 Chapter 5: Selenium inclusion decreases oxidative stress indicators and muscle injuries in sea bass larvae fed high-DHA microdiets ………………………………………………….. 115 Chapter 6: Supplementation with vitamin C enhances the vitamin E status and reduces oxidative stress indicators in sea bass larvae fed high-DHA microdiets ……….. 145 Chapter 7: Molecular pathways involved in nutritional muscle dystrophy and healing in sea bass larvae ……………………………………………………………………………………………………… 171 Chapter 8: General Discussion ………………………………………………………………………………….. 199 Chapter 9: Conclusions …………………………………………………………………………………………….. 211 Chapter 10: Resumen en español …………………………………………………………………………………… 213 References ………………………………………………………………………………………………………………………… 285 III List of Abbreviations ALA α-linolenic acid ANOVA Analysis of variance AOE Antioxidant enzymes APROMAR Asociación Empresarial de Productores de Cultivos Marinos ATP Adenosin triphosphate BHT Butylated hydroxytoluene CAT Catalase Ct Cycle threshold cDNA Complementary desoxiribonucleic acid cRNA Complementary ribonucleic acid DEPC Diethyl pyrocarbonate DHA Docosahexaenoic acid (22:6n-3) dNTPS Deoxynucleotide triphosphates DPA Docosapentaenoic acid dph Days post hatching DTT Dithiothreitol dTTP Deoxythymidine triphosphate dUTP Deoxyuridine triphosphate DW Dry weight EFA Essential fatty acid EPA Eicosapentaenoic acid (20:5n-3) EM Electron microscope FA Fatty acid FAME Fatty acid methyl esters IV FAM-6 6-carboxyfluorescein-labeled probe FAO Food and Agriculture Organization FIED Flame ionization detector Ga Galium GLM General Linear Model HPLC High performance liquid chromatography ICCM Instituto Canario de Ciencias Marinas ICP-MS Induced coupled plasma mass spectrophotometry IGF-I Insulin-like growth factor I IGF-II Insulin-like growth factor II IPTG Isopropil-β-D-1-tiogalactopyranoside GC Gas chromatography GLC Gas liquid chromatography GPX Glutathione peroxidase GR Glutathione reductase GSSG Oxidized glutathione GSH Reduced glutathione HUFA Highly unsaturated fatty acid H&E Haematoxilin & eosin Laczα Lactose z gene LB Lysogeny broth LC-PUFA Long chain polyunsaturated fatty acid LA Linoleic acid MAP Mitogen-activated protein MDA Malonaldehyde M-MLVRT Moloney murine leukemia virus MPC Myogenic Progenitor Cell XII species (ROS). An increase in ROS leads to random cellular damages on the different cellular components. If continued along time will cause disease or even cell death.………………………………………………………... 28 Figure 1.10 Scheme showing the three phases of the free radical chain mechanism of lipid peroxidation. The RH group contains the unsaturated unit common to all PUFA. In this case the reaction is quenched by α-tocopherol, but other radical scavenger can be implicated. Although PUFA are very vulnerable and the most probable target of free radicals attack, proteins could also suffer a peroxidative attack…………………………………………. 29 Figure 1.11 Non enzymatic oxidation of DHA is initiated after free radical attack, resulting in an unstable DHA-radical state that quickly undergoes isomerisation and rearrangement of double bonds. Lipid hydroperoxides further oxidize, keeping the carbon chain intact (structure preservation) or it can be disintegrated (structure disintegration), giving place to different byproducts. Several possible isomers exist within each class…………………………………………………………. 30 Figure 1.12 Transverse section of sea bream white muscle, ha ematoxylin and eosin staining (A) and Masson´s trichrome (B). (A) Presence of adipose tissue between muscle fibres can be observed as well as blood vessels (arrow) (x200). (B) Note the collagen myosepta stained in blue (x400)……………………………………………….. 33 Figure 1.13 Fibre typing and structure of muscle fibre in cross sections of sea bass larvae, Toluidine blue. The trunk is divided into two lateral halves, supported by the vertebral column and skeletal processes. The superficial monolayer of red fibres (RF) can be observed in contact with the epidermis (EP). White fibres (WF), larger than red ones and disp laced in several layers can be seen……………………………….. 34 Figure 1.14 The environmental inputs and physiological systems that affect the functional outputs of skeletal muscle in teleost fish. If an appropriate nutritional supply is not given to fish larvae it may have an effect on the digestive system, liver and adipose tissue, reflecting their damages in musculoskeletal system………………. 36 Figure 1.15 Schematic representation of the disposition of actin and myosin myofilaments in sea bass larvae white muscle (35 dph)……………………………………………………... 37 Figure 2.1 Scheme representation of the feeding sequence and cultivation routine during the experimental period……… 44 XIII Figure 2.2 HPLC chromatograms showing identification of αtocopherol (arrows) in standard (1), diet (2) and larvae (3)……………………………………………………………. 56 Figure 2.3 HPLC chromatograms showing identification of vitamin C (arrows) in standard (1) and diet (2)…………………... 58 Figure 2.4 Agarose gel showing PCR products of each designed primer………………………………………………………. 67 Figure 2.5 (A ) Electrophoresis system employed in the present Thesis. (B ) Plate containing blue and white colonies after transfection of E. coli with vector containing PCR products…....................................................................... 68 Figure 2.6 pGem – T Vector Map and sequence and sequence reference points…………………………………………… 69 Figure 2.7 Obtained nucleotide sequences from sea bass antioxidant enzymes genes and predicted aminoacid sequences. Arrows indicate the position and sequences of primers used to amplify the cDNAs………………………………………………………. 70 Figure 2.8 Standard curve and amplification plot of myosin heavy chain gene……............................................................... 73 Figure 3.1 Survival rate of sea bass fed the experimental diets containing several DHA and vitamin E contents for 14 days…………………………………………………………. 83 Figure 3.2 Total length and dry weight of sea bass after 14 days of feeding the experimental diets containing several DHA and vitamin E contents……………………………………. 83 Figure 3.3 Survival of sea bass larvae 24 hours after the activity test.................................................................................. 84 Figure 3.4 Muscular lesions found in larvae fed diet 5/150 at 48 days old, Haematoxilin & Eosin staining (x400). A/BInitial lesion showing fibre swelling (arrows); C/DFibres start breaking down (arrows); E/FIntense mononuclear infiltrate that traverse the basal laminal of muscle fibre (arrows)………………………………………. 88 Figure 3.5 Incidence of muscular lesions in sea bass feeding the experimental diets containing several DHA and vitamin E. Larvae were considered injured when some kind of lesion showed in Figure 3.4 was observed……………… 89 XIV Figure 3.6 Vacuoles of ceroid pigment (arrows) within hepatocytes fed diet 5/150 at 48 days old (x400). H&E (A) and PAS (B) staining…………………………………………………. 90 Figure 3.7 Incidence of ceroid pigment depending on the diets…… 90 Figure 4.1 Total length of sea bass larvae (35 dph) following 21 days of feeding the experimental diets containing different DHA and vitamin E contents…………………… 104 Figure 4.2 TBARS content in sea bass larvae larvae (35 dph) following 21 days of feeding the experimental diets containing different DHA and vitamin E contents………. 104 Figure 4.3 Muscular lesions found in sea bass larvae fed diets 5/150 and 5/300 at 35 dph, longitudinal sections, haematoxylin and eosin staining. (A) Swollen portion of a muscular fibre (*), partially fragmented showing eosinophilic cytoplasm and the prese nce of some macrophages (arrow). (B ) Muscular debris (arrow) surrounded by a severe inflammatory infiltrate (*) undergoing phagocytic removal. (C ) More detailed feature of necrotic fibre showed in Figure 3A where presence of flocculated cytoplasm and partial fragmentation (arrow) can be appreciated. A marked oedema can be appreciated (arrowhead). (D) Macrophages aggregate (*) phagocytosing necrotic muscle fibre………………………………………………… 105 Figure 4.4 Incidence of muscular lesions (%) after 3 weeks of feeding the experimental diets………….......................... 106 Figure 4.5 Sea bass larvae fed diets 5/150 and 5/300 transversal thick sections, toluidine blue staining. (A and B) We can observe loss of regular architecture and oedema (arrow) between red (RF) and white fibres (WF), vacuoles (V) inside affected muscle fibres and swollen cells (*).(C and D) More detailed features of necrotic fibres are showed, observing the irregular staining of the sarcoplasm due to the presence of hypercontrac tion bands (arrow)………………………………………………. 106 Figure 4.6 Electro micrographs of 35 dph sea bass larvae fed diets 5/150 and 5/300. (A ) Different size between muscle fibres is evident, as well as the lost of continuity between them. Dilatation of sarcoplasmic reticulum (*) is observed, leading to the formation of vacuoles (v) within sarcoplasm. As well, two macrophages cells are present (m). (B&C) Detail of macrophages attached to different muscle fibres……………………………………... 107 XV Figure 4.7 (A ) Normal (MF) and disorganized (disMF) myofilaments inside a mildly affected muscle fibre. (B) Presence of a sarcoplasmic halo in the periphery of the fibre which was almost completely devoid of myofibrils and mitochondria…………………………………………... 108 Figure 4.8 Electron micrographs of transversal (A&D ) and longitudinal (B&C) sections of sea bass larvae fed diets 5/150 and 5/300. (A ) Affected fibre presenting an autophagic vacuole (av) within its sarcoplasm, adjacent to the nucleus (N). (B) Presence of numerous myelin figures (arrow) in a degenerated muscular fibre. (C) Fragmentation of an affected muscle fibre (arrow) surrounded by myelin figures. (D ) Presence of muscular satellite cells (S) between muscle fibres…….. 109 Figure 5.1 Semithin micrographs of longitudinal (A) and transversal sections (B) showing; (A ) coagulation of muscular proteins in affected fibre (arrow) and hypercontraction of the surrounding muscular fibres (*). (B) Mild affected fibres showed loss of the polyedrical structure, abundant vacuoles (*) and dilatation of sarcoplasmic membranes (arrow)……………………….. 130 Figure 5.2 Electro micrographs of transversal sections of sea bass larvae fed 5/300 diet. (A ) Damaged muscle fibre showing autophagic (AV) and hydropic vacuoles (HV) and swollen mitochondria (arrow). (B) Not affected fibre where normal mitochondria can be observed (arrow). (C) Presence of a satellite cell (SC) with a mitochondria (*) between two damaged muscle fibres, with the presence of vacuoles and degenerated mitochondria (arrow)………………………………………………………. 131 Figure 5.3 Characteristic skeletal anomalies found in sea bass larvae: pugheadness (A), lordosis (B), kyphosis (C), and vertebral compression (D)........................................ 133 Figure 5.4 Sea bass larvae bone mineralization and deformities frequency (%) at 35 dph of fishes from the different dietary treatments………………………………………………. 134 Figure 5.5 CAT, SOD and GPX expression levels measured by real-time PCR in Dicentrarchus labrax larvae when were fed diets 1/150 (♦), 5/300 (■) or 5/300+Se (●). mRNA copy number of each gene was normalized as a ratio to 100 ng total RNA………………………………….. 135 Figure 5.6 IGF-I and IGF-II expression levels measured by realtime PCR in Dicentrarchus labrax larvae when were fed diets 1/150 (♦), 5/300 (■) or 5/300+Se (●). mRNA copy number of each gene was normalized as a ratio to 100 XVI ng total RNA………………………………………………... 137 Figure 5.7 MyHC expression levels measured by real-time PCR in Dicentrarchus labrax larvae when were fed diets 1/150 (♦), 5/300 (■) or 5/300+Se (●). mRNA copy number of each gene was normalized as a ratio to 100 ng total RNA…………………………………………………………. 138 Figure 6.1 Longitudinal semithin (A) and transversal electro micrographs (B) of sea bass larvae fed 5/300 diet. (A) Damaged muscle fibres showing breakage (arrow) as well as darkening due to protein coagulation (*). (B) Affected fibre showing disarrangement of the myofilaments (arrows), swollen sarcoplasmic reticulum (SR) and myelin figures (*)……………………………… 160 Figure 6.2 Incidence of malformations (%) (A) and Ossification degree rate (%) (B ) at 35 dph in sea bass fed the experimental diets…………………………………………. 161 Figure 6.3 Skeletal deformities found in 35 dph larvae at the end of the experimental period………………………………… 162 Figure 6.4 CAT, SOD and GPX expression levels measured by real-time PCR in Dicentrarchus labrax larvae when were fed diets 1/150 (♦), 5/300 (■) or 5/300+AA (▲). mRNA copy number of each gene was normalized as a ratio to 100 ng total RNA………………………………….. 163 Figure 6.5 IGF-I and IGF-II expression levels measured by realtime PCR in Dicentrarchus labrax larvae when were fed diets 1/150 (♦), 5/300 (■) or 5/300+AA (▲). mRNA copy number of each gene was normalized as a ratio to 100 ng total RNA………………………………………………... 164 Figure 6.6 MyHC expression levels measured by real-time PCR in Dicentrarchus labrax larvae when were fed diets 1/150 (♦), 5/300 (■) or 5/300+AA (▲). mRNA copy number of each gene was normalized as a ratio to 100 ng total RNA…………………………………………………………. 165 Figure 7.1 Transversal semithin sections on the same selected morphological area of 49 dph sea bass larvae fed 5/150 (A) or 1/150 (B) diets. (A) Damaged muscular fibres showing hypercontraction of the myofilaments (*) and coagulation of proteins, observed as darkening of the fibre (arrow). Besides, loss of the polyedrical structure can be observed, espcially if compared to normal muscle (B)…………………………………………. 186 Figure 7.2 CAT, SOD and GPX expression levels measured by real-time PCR in Dicentrarchus labrax larvae when were fed diets 1/150 (○), 5/150 (■) or 5+1/150 (▲). mRNA copy number of each gene was normalized as a ratio to 100 ng total RNA………………………………….. 188 XVII Figure 7.3 IGF-I and -II expression levels measured by real-time PCR in Dicentrarchus labrax larvae when were fed diets 1/150 (○), 5/150 (■) or 5+1/150 (▲). mRNA copy number of each gene was normalized as a ratio to 100 ng total RNA………………………………………………... 189 Figure 7.4 α-actin, MyHC and µ-calpain expression levels measured by real-time PCR in Dicentrarchus labrax larvae when were fed diets 1/150 (○), 5/150 (■) or 5+1/150 (▲). mRNA copy number of each gene was normalized as a ratio to 100 ng total RNA………………. 190 Figure 8.1 Proposed pathological mechanisms on muscle during oxidative stress in sea bass larvae. ROS exert their adverse effects on bilayer membrane phospholipids, altering the fibre permeability and favoring the massive entrance of water, Na+ and Ca2+ and the decrease of K+. Increase of sarcoplasmic Ca2+ causes oedema in several organelles such as endoplasmic reticulum (ER) or mitochondria, apart from whole cell swelling. Increased c alcium may activate calpains, which will promote protein degradation, therefore affecting the cytoskeleton integrity. The entrance of water and Ca2+ into the mitochondria will lead to the opening of the mitochondrial permeability transition (MPT) pore and the consequent release of cytochrome c. If the muscle fibre is not able to counteract all these damages, the cell will die through necrosis or apoptosis, which can also happen due to the direct effect of cytochrome c. Free radicals can also attack directly the membranes of the organelles, for instance, the attack to lysosomes membranes may allow the release of enzymes that could digest different cellular components……………… 205 Figure 8.2 Electro micrographs of transversal sections of muscle of sea bass larvae fed 5/300 diet observing the presence of marked caveolae (arrows)………………….. 209 Figura 10.1 La producción de la acuicultura frente a las capturas de lubina en Europa desde 1958 hasta el 2009 (datos obtenidos de FAO FISHSTAT Plus 2.30)……………….. 214 Figura 10.2 Estadios de desarrollo y modos de nutrición larvaria. Adaptado de Gatesoupe et al., 2001…………………….. 216 Figura 10.3 Principales rutas de biosíntesis de LC-PUFA a partir de sus precursores C18, ácido α-linoleico (18:2n-6) y γlinolénico (18:3n-3). La enzima Δ6 desaturasa actúa en dos pasos, mientras que la Δ5 desaturasa lo hace sólo en uno……………………………………………………….. 221 XVIII Figura 10.4 Generación de distintos ROS por transferencia de energía o reducción secuencial univalente del oxígeno triplete. Adaptado de Apel y Hirt (2004)…………………. 226 Figura 10.5 Mecanismos antioxidantes del interior de la célula. Adaptado de Machlin y Bendich (1987)…………………. 228 Figura 10.6 Mecanismos de protección de las AOE. El superóxido (O2·) es dismutado en peróxido de hidrógeno (H2O2) por la SOD. El H2O2 es también reducido a agua por la acción de la GPX o la CAT. Se muestran los ciclos relacionados de oxidación-reducción del glutatión entre las formas oxidadas (GSSG) y reducidas (GSH) en función de las actividades de la GPX y la GR. El H2O2 puede regenerar el OH· al reaccionar con iones metálicos como el hierro en la reacción fentón………… 229 Figura 10.7 Sección transversal del músculo blanco de dorada, tinción de H&E (A) y tricrómico de Masson (B). (A) Presencia de tejido adiposo entre las fibras musculares así como vasos sanguíneos (flecha) (x200). (B ) Se puede apreciar el miosepto de colágeno teñido de azul (asterisco) (x400)…………………………………………... 242 Figura 10.8 Tipo de fibras y estructura de las fibras musculares en una sección transversal en una preparación de larva de lubina teñida con azul de toulidina . El tronco está dividido en dos mitades laterales, sirviendo la columna vertebral y los procesos esqueléticos como soporte estructural. Puede observarse que la monocapa superficial de fibras rojas (RF) está en contacto con la epidermis (EP). Las fibras blancas (WF) son de mayor tamaño que las rojas y se encuentran dispuestas en distintas capas………….................................................. 244 Figura 10.9 Representación esquemática de la disposición de los filamentos de actina y miosina en el músculo de larvas de lubina (35 dph)………………………………………….. 246 XIX Glossary index of common and scientific names used within this thesis Common name Nombre común Scientific name African catfish Pez gato Clarias gariepinus Atlantic salmon Salmón del Atlántico Salmo salar Barramundi Perca gigante Lates calcarifer Brine shrimp Artemia Artemia sp. Brook trout Trucha de arroyo Salvelinus fontinalis Brown sole Acedía del Japón Pleuronectes herzensteini Cachama Cachama Colossoma macropomum Common carp Carpa Cyprinus carpio Channel catfish Bagre de canal Ictalurus punctatus Common dentex Dentón Dentex dentex Coral reef damselfish Acanthocromis polyacanthus Fat snook Róbalo Centropomus parallelus Fine flounder Lenguado fino Paralichthys adspersus Grouper Mero malabárico Epinephelus malabaricus Halibut Fletán del Atlántico Hippoglossus hippoglossus Herring Arenque del Atlántico Clupea harengus Indian major carp Labeo Roho Labeo rohita Japanese flounder Falso halibut del Japón Paralichthys olivaceous Japanese parrotfish Calotomus japonicus Manchurian trout Brachymystax lenok Matrinxa Sábalo cola roja Brycon cephalus Milkfish Chano Chanos chanos XX Rainbow trout Trucha arcoíris Oncorhynchus mykiss Red sea bream Dorada del Japón Pagrus major Rotifer Rotífero Brachionus plicatilis Sea bass Dorada Dicentrarchus labrax Sea bream Lubina Sparus aurata Senegalese sole Lenguado senegalés Solea senegalensis Spotted wolffish Perro pintado Anharhichas minor Stripped jack Jurel dentón Pseudocaranx dentex Striped trumpeter Latris lineata Tilapia Tilapia azul Oreochromis aureus Turbot Rodaballo Psetta maxima Yellowtail Medregal del Japón Seriola quinqueradiata Zebrafish Pez cebra Danio rerio XXI Acknowledgements If I have been able to write this Thesis is thanks to the help of many people I would like to remember… Con el permiso de mis tutoras, me gustaría empezar esta sección agradeciendo el apoyo incondicional de dos personas que siempre han confiado en mí, han sido un modelo ejemplar de esfuerzo y superación y me han animado a seguir mis sueños, porque nada hay inalcanzable. Es por esto y mucho más por lo que esta Tesis va dedicada a ellos ¡Gracias papis! I would like to give my sincerest gratitude to my supervisors, Dr. Mª José Caballero and Dr. Marisol Izquierdo for their steady guidance during all these years. Your enthusiasm has influenced on me and been very important for this Thesis, as you have always encouraged me and listened to my imaginative theories. Thank you also for giving me the opportunity to present my work in different conferences and for bringing myself to make several stays that have enriched my scientific knowledge. Thanks for supporting and trusting on me! My gratitude goes to Dr. Genciana Terova for opening me the doors of her lab and letting me to introduce myself into a new and unknown world. Thanks to Samuela, Elena and Simona for your patience and guidance into the gene expression analysis. I would also like to thank Dr. Gordon Bell for accepting me into his lab and giving me the chance to complete my scientific skills. Many thanks to all the GIA members for your help during these years. I would particularly like to thank Dr. Juanma Afonso for helping me with the statistical analysis, Dr. Javier Roo for his advices on larval culture. Thanks also to Dr. Carmen Mª Hernández-Cruz for always giving a hand in samplings and for showing me the passionate world of larvae culture through university lessons… I would also like to thank my good collegues at the GIA for some funny years. Special thanks to Tibi, Silvia, Reda, Fefy, Tati, Pedro, Mohamed, Juan, Fran, Alex, Gercende, Antonio, Davinia and Laura. Although I had my ups and downs you were always there for supporting and encouraging me and thanks to your sustain I can be right here defending my Thesis. I would also like to remember those who have gone past. Without their help this document would not be real, so thanks to Eyad and Maria, because part of you is on this Thesis. General Introduction 6 vitamins and minerals. Moreover, the efficient development of microparticulate diets for the fish larvae has promoted the improvement of nutritional requirement studies. The optimum protein level for fish larvae differs, probably due to a variety of factors, such as the differences in food habits, age of larvae, water temperature, protein sources used and energy level of the diet. However, because the requirements of larval fish are still undefined, protein sources having high nutritional values are used, such as krill meal, squid meal, scallop meal or fish meal (Teshima et al., 1982). Knowledge about the vitamin requirements of larval fish are limited. Most studies on vitamin requirements of fish have been conducted on juveniles. Few studies exist on vitamin requirements in fish larvae, mainly because there were no efficient compound diets available for these developmental stages. On the other hand, many experiments have been conducted to determine the optimal lipid composition in diets formulated for marine fish larvae, paying particular attention to long chain polyunsaturated fatty acids (LCPUFA) and PL requirements (Takeuchi, 1997). Lipids included in microparticulate diets come, in part, from meals incorporated in the diet as protein sources. Other lipids, such as cod liver oil, roe oil or menhaden oil are added as triglycerides and PLs come from soy lecithin (terrestrial) or marine PLs (from fish or krill). To have a better control of the lipid fraction in the diet, meals can be defatted, so that lipids will result from the addition of different oils. 1.4 Importance of lipids in marine fish larvae nutrition Lipids are, along with proteins, the major organic constituents of fish, with carbohydrates being quantitatively less prominent. Indeed the lipid content of fish can markedly exceed the protein content, reflecting the major role of lipids (Sargent et al., 2002). Lipids are an important source of metabolic energy, components of biological membranes and precursors of essential metabolites (Sargent et al., 1989). Dietary lipids provide a rich source of energy and PLs, vital to the structure of biomembranes. Besides, dietary lipids also serve as carriers for absorption of other nutrients, including the fatsoluble vitamins A, D, E and K, and natural or synthetic pigments. On the other hand, lipids are components of hormones and precursors for synthesis of various functional metabolites, such as prostaglandins. Besides, lipids are of particular importance in teleost fish larvae, which are characterized by extremely high growth rates coupled with high demands for energy and structural components. Additionally, a relationship exists between dietary lipids and skeletal formation in aquatic animals (Cahu and Zambonino- General Introduction 7 Infante, 2003; Villeneuve et al., 2005, 2006; Roo et al., 2009; Izquierdo et al., 2010; Sandel et al., 2010; Scolamacchia, 2010). As a reflect of this importance, for instance in marine fish species such as the sea bream and the sea bass diets have become highly energetical (~25% lipid) in comparison with a decade or so ago (~12% lipid) (Izquierdo et al., 2003). The importance of lipids in marine larvae nutrition has made them the focus of numerous studies. Therefore, the success of larval rearing is greatly influenced by firstfeeding regimes and the nutritional quality of the diets used, with dietary lipids being recognized as one of the most important nutritional factors that affect larval growth and survival (Izquierdo et al., 2000). However, dietary lipid utilization by the larvae is directly or indirectly affected by several morphological and physiological changes occurring during larval development. For instance, although at the end of the larval lecithotrophic phase the enterocytes of sea bass larvae are functional, they are still poorly developed (Deplano et al., 1991; Zambonino-Infante et al., 1997), their size, number and expansion of organelles being increased in the following days. Therefore, throughout larval development the number of intestinal folds is also increased, the stomach is formed and its function improved. These changes in enterocytes and the digestive system imply an improvement in the digestion and absorption efficiency of the juvenile. Another important fact is that lipid levels may affect larval lipid digestion capability. Hoehne (1999) and Olsen et al., (2000) indicated that a high dietary lipid level might lead to lower larval digestion ability. Similarly, Kjørsvik et al., (1991) reported an overload of the digestive capacity in the hindgut of turbot larvae fed rotifers with a high lipid content. However, conversely to these results, ZamboninoInfante and Cahu (1999) proved an earlier maturation of enterocytes in sea bass larvae fed high lipid levels as well as better larval development. Lipids are constituted by fatty acids (FA), being fish rich in LC-PUFA with carbon chain lengths of 20 or more carbons and 3 or more ethylenic bonds. In order to achieve a normal growth and development including reproduction, fish require three LC-PUFA: docosahexaenoic acid (DHA; 22:6n-3), eicosapentaenoic acid (EPA; 20:5n-3) and arachidonic acid (ARA; 20:4n-6). The essentiality of these fatty acids is corroborated as they are selectively retained throughout embryonic development (Rainuzzo et al., 1993; Lie, 1993) or at the expense of other fatty acids during periods of starvation (Tandler et al., 1989). Besides, these fatty acids are considered essential in marine fish species due to the limited activity of Δ6and Δ5-desaturase and elongase enzymes to synthesize ARA, EPA and DHA when their precursors are included in the diet, in contrast to fresh water species (Figure 1.3). In this sense, although certain Δ6-desaturase expression has General Introduction 8 been found in sea bream larvae, its activity was not enough to fulfil sea bream requirements for this fatty acid (Izquierdo et al., 2008). Figure 1.3 Main biosynthesis pathways of LC-PUFA from C18 precursors, α-linoleic acid (18:2n6) and γ-linolenic acid (18:3n-3). Enzyme Δ6 desaturase acts in two steps, whereas Δ5 desaturase acts only in one (Sargent et al., 1995). The biochemical, cellular and physiological functions of these three PUFAs are broadly the same in fish as in other vertebrates and fall into two categories: (1) Role in maintaining the structural and functional integrity of cell membranes: Fish tissues have in general much higher concentrations of DHA and EPA than ARA and fish have correspondingly high dietary requirements for n-3 LCPUFA. As structural components of the membrane phospholipids, essential FA (EFA) can facilitate key-intramembranal reactions and processes, where DHA is particularly important (Izquierdo and Koven, 2010) (2) Precursors of the group of highly biologically active hormones, known as eicosanoids: Eicosanoids are a range of highly active C20 compounds formed in small or even trace amount by virtually every tissue in the body, are involved in a great variety of physiological functions and are produced in response to stressful situations. The major precursor of eicosanoids in fish is General Introduction 9 ARA with eicosanoids formed from EPA being less biologically active than those formed from ARA (Tocher, 2003). Thus, adequate levels of lipids, especially LC-PUFA, must be included in marine fish diets. However, this is not always feasible. As it has been pointed out previously, aquaculture is one of the most rapid developing animal production systems. To sustain such fast growth, an increased demand in fishmeal and fish oil is required. However, the use of ingredients of terrestrial vegetal origin is necessary to fullfil lipid sources demand. These ingredients lack essential fatty acids (EFA) and this restricts their use in diets for marine species. Therefore, requirements for such fatty acids must be precisely determined to predict optimal levels of inclusion. To study requirements of these fatty acids in any fish larvae species some premises must be taken into account: - The marked chemical similarities of the three LC-PUFA lead to competitive interactions in the plethora of biochemical and physiological reactions they and their precursors and products undergo. - Marine fish species have a limited ability to synthesize EFA from their precursors by the action of elongase and desaturase enzymes, requiring DHA, EPA and ARA to be supplied by their diets. - EFA requirements could be affected both quantitatively and qualitatively by environmental factors such as temperature (Farkas et al., 1980; Olsen et al., 1999), salinity (Borlogan and Benítez, 1992) and light (Ota and Yamada, 1971) or the presence of other nutrients such as antioxidants (Izquierdo and Koven, 2010). - As larvae grow faster than juveniles or adults, their necessity of n-3 LC-PUFA is expected to be higher than juveniles in the early stages of development (Izquierdo et al., 1989a). The necessity of these fatty acids was first pointed out by the reduced growth observed in turbot (Scophtalmus maximus) (Gatesoupe and Le Millinaire, 1985), red sea bream (Pagrus major) (Izquierdo et al., 1989a, 1989b) and gilthead sea bream (Rodríguez et al., 1993, 1994; Salhi et al., 1994) larvae fed deficient levels of EFA. Similarly, a drop in survival was observed when larvae were fed low levels of these fatty acids in red sea bream (Izquierdo et al., 1989a, 1989b), sea bream (Rodríguez et al., 1993, 1994; Salhi et al., 1994) and halibut (Hippoglossus hippoglossus) (Holmefjord and Olsen, 1991). On the other hand, insufficient contents of these EFA in the diet give rise to several alterations in larvae such as poor feeding and swimming activities (Izquierdo et al., 1989a; Rodríguez et al., 1993, 1994), altered fish larvae behavior (BenítezSantana et al., 2007), hydrops (Yamashita, 1981), deficient swim bladder inflation General Introduction 10 (Koven, 1991), abnormal pigmentation (Kanazawa, 1993; Rainuzzo et al., 1994), disaggregation of gill epithelia (Arnaiz et al., 1993), immune-deficiency and raised cortisol levels (Izquierdo, 1996). Competitive interactions exist between DHA and EPA or EPA and ARA. The DHA and EPA competition results from both molecules using the same enzymes to esterify fatty acids into PL structures (Mourente et al., 1991; Sargent et al., 1999). However, in all marine fish larvae, DHA has been demonstrated to be superior to EPA in conferring vitality to the larvae (Watanabe, 1993). Besides, although both EFA have been found to be essential to marine fish larvae, DHA is generally present at about twice the level of EPA in fish membrane PLs, being the highest levels of DHA contained in phosphatidylethanolamine (PE; Rodríguez et al., 1997; Copeman et al., 2002). All these evidences prove the essentiality of this fatty acid regarding to the other EFA. 1.5 Importance of DHA for larvae DHA is a carboxylic acid with a 22-carbon chain and six cis double bonds. As stated previously, marine fish have a limited, almost negligible, capability to synthesize EFA from their precursors, linoleic and linolenic acids, and, therefore, it must be included in sufficient amounts in larval feeds. Besides, adequate DHA supply is very important in rapidly growing and developing marine fish larvae (Table 1.1). These high requirements of DHA are reflected in larval tissue composition, being incorporated in the developing visual and neural tissues (Mourente, 2003), which, at this stage, account for a higher percentage of neural tissue in their relatively small body mass. The particular structure of DHA provides this fatty acid with many important functions in fish metabolism (Izquierdo, 2005). It is incorporated into cell membranes regulating membrane integrity and function, this fatty acid being an important component of phosphoglycerides, particularly PE and phosphatidylcholine in larvae. The essentiality of DHA for fish is corroborated by its retention in starved or low-EFA fed fish, possibly due to the lower cell oxidation rates than other fatty acids (Koven et al., 1989; Madsen et al., 1999). Still in terms of essentiality, it seems to have a greater potential than EPA to promote growth and stress resistance in red sea bream among other species (Watanabe et al., 1989; Watanabe and Kiron, 1994), being its requirement more limiting for growth and survival than those for n-3 LC-PUFA (Izquierdo, 1996). General Introduction 11 Table 1.1 DHA requirements for fish larvae of different marine species (% DW in rotifers, Artemia or microdiets) The importance of DHA for larvae, starts prior to the hatching. Eggs contain an adequate content of DHA (Laurel et al., 2010) to ensure proper larval development on hatching, and this can be achieved by controlling broodstock feeding (FernándezPalacios et al., 2011). Thus, the DHA, vital for early survival and development of newly hatched larvae is determined by the lipids derived directly from the dietary input of broodstock in the period preceding gonadogenesis (Kjørsvik et al., 1990; Sargent, 1995). However, Watanabe (1993) reported that the DHA content in marine fish larvae rapidly Species Tested parameter Requirement Reference Acanthochromys poliacanthus Growth Survival 0.5 Southgate and Kavanagh, 1999 Calotomus japonicus Growth 1-2 Kanazawa, 1993 Centropomus parallelus Growth Survival Swim bladder inflation >0.6 Seiffert et al., 2001 Dentex dentex Growth Survival 2.4 Mourente et al., 1999a Hippoglossus hippoglossus Pigmentation Eye migration 2.5 Hamre and Harboe, 2008 Latris lineata Growth Survival Behaviour 1.3 Brandsen et al., 2004 Pagrus major Growth Survival Salinity tolerance 0.95-1.62 Furuita et al., 1996a Growth Survival 1.5 Rotifers or Artemia Izquierdo et al., 1990 Pagrus pagrus Growth Survival 1.5 Hernández-Cruz et al., 1999 Paralychthis olivaceous Growth 1 Kanazawa, 1995 Psetta maxima Growth 0.8 Reitan et al., 1994 Pseudocaranx dentex Growth 1.6-2.2 Takeuchi et al., 1996 Pseudopleuronectes herzensteini Growth Survival Starvation resistance Larval development 0.6 Rotifers 1.4-2.8 Artemia Satoh and Takeuchi, 2009a Sparus aurata Growth Survival >3 Izquierdo, 2005 Scophtalmus maximus Growth 3.2 Le Milinaire, 1984 Seriola dumerilii Growth Survival 4 Izquierdo, 2005 General Introduction 12 decreases during the first ten days after hatching, therefore high contents of DHA must be supplied to larvae in order to maintain the adequate levels of DHA in growing larvae. A deficiency in this fatty acid has been shown to cause alterations of the neurological system in fish, such as impaired vision at low light intensities in herring (Clupea harengus) (Bell et al., 1995) or retarded development of normal behavior in yellowtail (Seriola quinqueradiata) (Masuda et al., 1998), striped trumpeter (Latris lineata) (Brandsen et al., 2005) and sea bream (Benítez-Santana et al., 2007) larvae. Besides, low dietary levels of DHA can increase the incidence of skeletal deformities in sea bass (Cahu et al., 2003), gilthead sea bream (Roo et al., 2010), red porgy (Pagrus pagrus) (Roo et al., 2009; Izquierdo et al., 2010) or brown sole (Pseudopleuronectes herzensteini) (Satoh and Takeuchi, 2009b) larvae, reduce tolerance to stressful situations in beluga (Huso huso) larvae (Jalali et al., 2008), cause malpigmentation and irregular eye migration in flatfish (McEvoy et al., 1998; Bell et al., 2003) or altered gut and liver structure in striped trumpeter larvae (Brandsen et al., 2005). But the main detrimental effects observed may be those related to the low culture performance and survival in different larval species (Watanabe et al., 1989; Furuita et al., 1996a, b; Copeman et al., 2002; Rezek et al., 2010). Not only the decrease in dietary DHA can cause alterations in fish, also excessive levels of this EFA may lead to several changes, especially when the increase in n-3 LCPUFA is not accompanied by adequate quantities of antioxidants. For instance, an excessive amount of PUFA accelerated osteoblasts differentiation when dietary vitamin A levels were low, causing supranumerary vertebrae in sea bass larvae (Villeneuve et al., 2006). Thus, to avoid adverse effects and improve performance, supplementation of antioxidants, such as vitamin E are necessary when high levels of n-3 LC-PUFA are incorporated into larval diets. For instance, beluga larvae fed with high LC-PUFA enriched Artemia showed a better performance in terms of growth and tolerance to salinity stress when a 20% of α-tocopherol was included in the enrichment media (Jalali et al., 2008). Similarly, Stéphan et al. (1995) reported that in vivo and in vitro oxidation of lipids in turbot larvae muscles is reduced when dietary α-tocopherol was supplemented in the diet. The supplementation with antioxidants is necessary as the susceptibility of a particular PUFA toward oxidation increases with an increase in the number of unsaturated sites in the lipid chain due to the vulnerability of the methylene group located between two double bonds (Nagaoka et al., 1990). Since DHA has five of these methylene groups, it is particularly oxidizable. Therefore, DHA will be highly at risk of suffering oxidative processes that any other PUFA. General Introduction 13 Typically, high amounts of DHA can be found in commercial preparations used to enrich the live preys (Koven et al., 2001) to compensate the reduced capability of marine fish larvae to convert linolenic acid to DHA. This trend is being followed in marine fish larvae microdiets formulation, by the premise that high DHA contents will lead to higher culture performances, therefore much money is spent to include concentrated DHA oils. However, it has been shown that too high levels of this EFA could have detrimental effects on larvae (Brandsen et al., 2005; Villeneuve et al., 2005; Izquierdo et al., submitted) or even have no effects at all (Kraul, 1993; Seiffert et al., 2001), therefore high inclusion of DHA in microdiets for marine fish larvae needs a deep revision. 1.6 Reactive oxygen species: Generation, detoxification and oxidative stress The evolution of aerobic metabolic processes such as respiration, unavoidably leads to the production of reactive oxygen species (ROS), all having a high capacity to cause oxidative damage to proteins, DNA and lipids. As it has been pointed out previously, fish and, specially, fish larvae, are highly at risk of suffering peroxidative attack to their membranes, as they contain great quantities of LC-PUFA. To counteract ROS negative effects, complex arrays of non-enzymatic and enzymatic detoxification mechanisms exist. However, when ROS production exceeds their removal by these mechanisms oxidative stress occurs and ROS may cause cellular damages and alterations on the different cellular elements. 1.6.1 Generation of ROS Molecular oxygen, essential for aerobic organisms, has a dominant role in eukaryotes being that of terminal electron acceptance in mitochondrial respiration, where it is ultimately reduced to water during the process of oxidative phosphorilation, the major source of ATP in aerobes. Oxygen may be converted to the much more reactive ROS forms either by energy transfer or by electron transfer reactions (Figure 1.4). The former leads to the formation of singlet oxygen, whereas the latter results in the sequential reduction to superoxide, hydrogen peroxide and hydroxyl radical (Klotz, 2002). Pathological effects of ROS depend on the free radical produced. Superoxide radical ion (O2·-) stimulates the production of leukocyte and other cells degrading General Introduction 14 enzymes. Can cause direct lesions to lipids, proteins and DNA and usually acts close to the place where it is produced. Hydrogen peroxide (H2O2) can be converted to hydroxyl radical (OH·) or hypochlorite (OCl-), both having capacity to destroy microbes and cells. This free radical can act away from their production site. Hydroxil radical represents the most common free radical derived from oxygen and is mainly responsible of lipid, protein and DNA attack. Figure 1.4 Generation of different ROS by energy transfer or sequential univalent reduction of ground state triple oxygen. Adapted from Apel and Hirt (2004). In addition to mitochondrial electron transport, other sources of endogenous ROS production include the electron transport chains of microsomes (Winston and Cederbaum, 1983), the respiratory burst associated with phagocytosis by leukocytes (Chung and Secombes, 1988) and the activities of enzymes, such as xanthine oxidase, tryptophan dioxygenase, diamine oxidase and prostaglandin synthase (Fridovich, 1978; Halliwell, 1978). 1.6.2 ROS detoxification: antioxidant defence mechanisms An antioxidant is any substance that, when present at low concentrations compared to those of an oxidable substrate is able to interact with free radicals to terminate the reaction (Halliwell and Gutteridge, 1990). An array of antioxidants defence mechanisms to detoxify ROS has evolved to counteract the potentially deleterious effects of activated oxygen (Yu, 1994). The antioxidant systems in living organisms may be divided in two types, one is represented by enzymes and the other one by low General Introduction 15 molecular weight molecules. These compounds may be found in the cell plasma, mitochondria or cell membranes (Figure 1.5). Antioxidants can act at different stages in the oxidation process and some may have more than one mechanism of action. They can exert their action by different mechanisms such as breaking the chain of an initiated sequence, scavenging singlet oxygen or decreasing local O2 concentrations. Figure 1.5 Antioxidant mechanisms within the cell. Adapted from Machlin and Bendich (1987). CAT= Catalase; SOD = Superoxide dismutase; GPX = Glutathione peroxidase; GSH = Reduced glutathione. 1.6.2.1 Enzymatic systems Diverse antioxidant enzymes (AOE) prevent the cascade of oxidant reactions, intercepting and inactivating the reactive intermediates of oxygen. Particularly adapted enzymes such as superoxide dismutase (SOD; EC 1.15.1.1), glutathione peroxidase (GPX; EC 1.11.1.19), glutathione reductase (GR) or catalase (CAT; EC 1.11.1.6) have been detected in most fish species studied to date (Rudneva, 1997). All these enzymes are very important in antioxidant defence, although SOD plays a crucial role being the first enzyme responding to oxygen radicals and preventing the initialization of the radical chain reaction that the superoxide anion produces (McCord and Fridovich, 1969; Winston and Di Giulio, 1991). Superoxide is converted to hydrogen peroxide by the action of SOD (Figure 1.6). SOD does not easily cross biological membranes, consequently it must be detoxified in the compartment where it is generated (Fridovich 1995). This explains the presence of different SOD in eukaryotes, which are classified in two distinct groups according to metal content; manganese SOD and copper/zinc SOD. General Introduction 22 and Atlantic salmon (Hardie et al., 1991). In agreement, restricted dietary vitamin C contents have been found to cause cartilage reduction and damage that reflects in anomalies especially in structures that undergo chondral ossification (for instance, jaws) together with an over stimulation of the vitamin C receptor (Darias et al., 2009). Since ascorbic acid is a prominent antioxidant, poor quality feeds can increase the amount of free radicals on the body thus decreasing tissue ascorbic stores (Sies et al., 1992) as observed in rainbow trout fed oxidized dietary lipids (Hung and Slinger, 1980). Another interesting role of vitamin C as an antioxidant is the regeneration of tocopheroxyl radical, which has been showed to be feasible in vitro (Tappel, 1962; Packer et al., 1979; Niki et al., 1985). The increase in vitamin C content from 0 to 60 mg kg-1 did not influence the retention of α-tocopherol in Atlantic salmon as long as the fish were not vitamin C deficient (Hamre et al. 1997). Similar results were found in yellow perch (Perca flavescens) and channel catfish (Lee and Dabrowski, 2003; Yildirim-Aksoy et al., 2008). Moreover, in Atlantic salmon, tissue vitamin E levels were independent of vitamin C supplementation between 50 and 2750 mg kg-1 (White et al. 1993). On the other hand, there was a large drop in liver vitamin E concentration in Atlantic salmon that became vitamin C deficient (Hamre et al., 1997). Liver concentration of vitamin E was also increased by dietary vitamin C in vitamin E deficient yellow perch and channel catfish (Lee and Dabrowski, 2003; Yildirim-Aksoy et al., 2008). A parallel development of liver vitamin E, vertebrae hydroxyproline, growth and mortality was observed in vitamin E supplemented salmon in response to dietary vitamin C, suggesting that vitamin C status above deficiency is necessary to maintain the body stores of vitamin E (Hamre et al. 1997). These results may be taken as support of the hypothesis that vitamin C regenerates vitamin E in vivo in adults and juveniles fish (Figure 1.8). On the other hand, high dietary vitamin E levels appears to have a prooxidant effect in fish deficient in vitamin C, as tocopheroxyl radicals are accumulated in the membranes and may promote irreversible oxidation of the remaining vitamin C (Hamre, 2011). General Introduction 23 Figure 1.8 Proposed mechanism for regeneration of α-tocopherol from the tocopheroxyl radical according to Tappel (1962) in the cell lipid bilayer. Ascorbic acid (Asc-H) is oxidized in the process, producinf the resonance-stabilized tricarbonyl ascorbate free radical (Asc·). This free radical can be regenerated by glutathione (Mrtensson and Meister, 1991) either chemically or enzimatically or enzymatically by NADH (Meister, 1994; Winkler et al., 1994). To reach this, reduced glutathione (GSH) donates a hydrogen atom to two molecules of Asc·, giving place to the formation of Asc-H and its metabolite dehydroascorbic acid (DHA). Oxidized glutathione (GSSG) is reduced by GR at the expense of NADPH generated in the pentose phosphate shunt (Meister, 1994). This scheme is an adaptation from that showed at Hamre, 2011. Fish larvae are particularly sensitive to vitamin C deficiency (Dabrowski et al., 1996), probably having higher vitamin requirements due to their rapid growth and high contents of PUFA in larval feeds (Table 1.4). Moreover, high ascorbic acid content has been found in fish eggs (Kossmann, 1988; Dabrowski and Bloom, 1994), which might be an indication of the importance of this micronutrient during early development. Addition of vitamin C to larval diets improved survival, growth performance, skeleton development, stress resistance and immune response in sea bass and turbot (Merchie et al., 1996) or sea bream (Atalah et al., 2010) larvae. Besides, it has been hypothesized that in early stages on embryogenetic development of marine organisms the low molecular weight antioxidants, such as vitamin C, play an important protective role General Introduction 24 against oxygen damage, as an enhancement of the activity of antioxidant enzymes has been observed as larvae develop (Rudneva, 1999). Thus, control of vitamin C administered to broodstock, as well as adequate supplementation of vitamin C to young larvae are of vital importance to reach a balance oxidative status in marine fish larvae. Table 1.4 Optimal vitamin C for different larval fish species 1.6.2.2.3 Selenium Selenium is a trace mineral and an essential micronutrient for vertebrates (Johansson et al., 2005), but also has the smallest window of any element between requirement and toxicity (Chassaigne et al., 2002; Polatajko et al., 2006). It is an essential component of several major metabolic pathways, including thyroid hormone metabolism, antioxidant defence systems and immune function. Selenium (Se) is widely distributed at low concentrations in freshwater (0.2-10 µg liter-1) and seawater (approximately 0.09 µg liter-1) (NRC, 1993). It also occurs naturally in foods and feedstuffs in organic complexes, primarily in the form of selenomethionine, selenocystine and selenocysteine. Fish meals and marine byproducts represent the best natural sources of Se among the common feedstuffs for fish. However, Bell and Cowey (1989), reported that selenium present in fish meal has low digestibility, whereas selenomethionine is highly digestible. The relative availability of Se in pure compounds is: Species Tested parameter Requirement Reference Cirrhina mrigala Growth Survival Behaviour Morphology 650-700 mg kg-1 Mahajan and Agrawal, 1980 Clarias gariepinus Growth 1600 mg kg-1 Merchie et al., 1997 Cyprinus carpio Growth Vitamin C content 45 mg kg-1 Gouillou-Coustans et al., 1998 Dicentrarchus labrax Growth Survival Stress resistance 2500 mg kg-1 Merchie et al., 1995 Dicentrarchus labrax Growth Survival e Deformities 30-50 mg kg -1 Darias et al., 2011 Scophtalmus maximus Growth Survival 20-130 mg kg-1 Merchie et al ., 1997 General Introduction 25 Selenite > selenate > selenomethionine > selenide > elemental selenium In fish, Se is also involved in thyroid hormone and insulin function, maintenance of fertility as well as regulation of cell growth (Table 1.5; Lall, 2002; Kohlmeier, 2003). Besides, selenium can promote either bone formation or mineralization. However, excessive intakes of this mineral have deleterious effects on vertebrates skeletal tissue metabolism (NRC, 2005). Recent work by Penglase et al. (2010) has shown that feeding cod larvae with selenium-supplemented rotifers, causes a trend of increased deformities in individual vertebra. This could be caused by an alteration in skeletal mineralization in its ionic form, or via selenoenzymes as an antioxidant (Lall and Lewis-McCrea, 2007) or by regulating thyroid hormone ratios (Power et al., 2001). Se is incorporated as selenomethionine at the active site of a wide range of proteins. In zebrafish (Danio rerio) a total of 18 selenoproteins have been identified, including three that do not have known orthologs in mammals (Kryukov and Gladyshev, 2000). One of the major Se function is as a component of the selenoproteins GPX, isoenzymes that protect lipid components and membranes at both the cellular and subcellular level from oxidative damage (Arteel and Sies, 2001). Other selenoproteins can have antioxidant functions as well, and can be observed at Table 1.5. Only selenomethionine can be incorporated into proteins, being the storage form of Se mainly in the skeletal muscle. In contrast, sodium selenite can be incorporated into active selenoproteins, such as GPX, but not into selenomethionine as storage protein in liver and muscle (Rider and Sweetman, 2008). Se deficiency can lead to oxidative stress in organs (Gatlin et al., 1986; Bell et al., 1986, 1987), reduced growth (Wang and Lovell, 1997) and increased mortality (Gatlin et al., 1986; Bell et al., 1987) in several fish species. The major effects of selenium toxicity are reduced growth, poor feed efficiency and high mortality. Besides, toxicity occurred in rainbow trout and catfish when dietary selenium exceeded 13 and 15 mg kg-1 respectively (Hilton et al., 1980; Gatlin and Wilson, 1984). It must be taken into account that selenium requirements of fish varies with the form of selenium ingested, PUFA and vitamin E content of the diet, as well as concentration of waterborne selenium (Lall, 2002). General Introduction 26 Table 1.5 Zebrafish selenoproteins and presumptive function. Adapted from Kryukov and Gladyshev (2000) Recent studies (Hamre et al., 2008a) have shown that Se content in rotifers is considerably low (0.08-0.09 mg kg-1 DW) than both fish requirements (0.5-0.3 mg kg-1 DW; NRC, 1993) and copepod levels (3-5 mg kg-1 DW) and may contain insufficient Se to meet larvae requirements. Therefore, Se could be one of the trace elements with a higher potential of being deficient in rotifers. Enrichment of rotifers with sodium selenite and sodium iodide proved to increase survival in Atlantic cod larvae, but no differences were observed in growth compared to the control group (Hamre et al., 2008b). Increase in the level of Se in rotifers enhanced the mRNA expression and activity of GPX in cod larvae (Penglase et al., 2010), suggesting that extra supplementation is needed to Selenoprotein Zebrafish Known function (mammals) 1. Glutathione peroxidase 1 GPX1a GPX1b Hydroperoxide catabolism Sperm structure 2. Glutathione peroxidase 2 GPX2 3. Glutathione peroxidase 4 GPX4a GPX4b 4. Thyroid hormone deiodinase 3 DI3 T4 activation T3 inactivation 5. Thioredoxin reductase 2 TR2 Protein thiol redox regulation Vitamin C recycling Synthesis of DNA 6. Thioredoxin reductase 3 TR3 7. Selenoprotein P SelPa Selenium transport Antioxidant 8. Selenoprotein Pb SelPb 9. Selenoprotein W1 SelW1 Antioxidant 10. Selenoprotein W2 SelW2a SelW2b 11. Selenoprotein T1 SelT1a SelT1b Unknown 12. Selenoprotein T2 SelT2 Unknown 13. 15 kDa selenoprotein Sel15 Cancer etiology?? 14. Selenoprotein R SelR Unknown 15. Selenoprotein N SelN Unknown General Introduction 27 protect larvae against lipid oxidation and the resulting oxidation products, which can be abundant in cultured live feed enriched with n-3 LC-PUFA. It is important to notice that vitamin E provides some compensation against Se deficiency (Gatlin et al., 1986; Awad et al., 1994), therefore, larvae could protect themselves from ROS by accumulating other antioxidant nutrients as it has been observed in cod larvae (Penglase et al., 2010). 1.6.3 Oxidative stress Oxidative stress occurs when the ROS generation rate exceeds that of their removal (Sies, 1985; Figure 1.9). Its deleterious effects include oxidation of proteins and DNA, as well as peroxidation of unsaturated lipids in cell membranes. This produces unstable lipid hydroperoxides which are highly reactive, threatening the cell integrity. In addition these products can break down into free radicals that can perpetuate the destructive cycle of lipid-peroxidation chain reactions. The repair of proteins damaged by ROS appears restricted to the reduction of oxidized derivatives of the sulfur-containing amino acid residues. Repair of other kinds of protein oxidation has not been demonstrated. Instead, the damaged proteins are targeted for degradation to amino acid constituents by the action of various endogenous proteases, including cathepsin and calpain. In contrast, the oxidative damage to nucleic acids is subject to repair by highly efficient excision/insertion mechanisms. Nevertheless, modifications of cellular DNA upon exposure to ROS is the likely initial event involved in the induction of the mutagenic and lethal effects of various oxidative stress agents (Basu-Modak and Tyrrel, 1993). In juvenile and adult fish some diseases have been related to free radical damage such as hemolisis (Kawatsu, 1969), anaemia (Cowey et al., 1984), jaundice (Sakai et al., 1989), liver degeneration (Cowey et al., 1984) or skeletal alterations (Hata and Kaneda, 1980; Watanabe et al., 1989; Lewis-McCrea and Lall, 2007). Among these skeletal alterations, one of the frequently most described in fish juveniles and adults is muscular dystrophy (Lovell et al., 1984; Gatlin et al., 1986; Frischknecht et al., 1994; Bowater and Burren, 2007). General Introduction 28 Figure 1.9 Sources and cellular responses to reactive oxygen species (ROS). An increase in ROS leads to random cellular damages on the different cellular components. If continued along time will cause disease or even cell death. Adapted from Finkel and Holbrook, 2000. 1.6.3.1 Auto-oxidation of lipids Lipids oxidation, which can be defined as an autocatalytic process initiated by free radicals resulting in the deterioration of PUFA, is an important consequence of oxidative stress. ROS prefer to steal electrons from the lipid membrane of a cell, initiating lipid oxidation process. Auto-oxidation of lipids proceeds by a chain reaction whereby a single radical species has the ability to abstract a hydrogen atom from a methylene group of a PUFA, yielding a lipid radical (Figure 1.10). As a consequence, a selfsustaining reaction cycle is established, where the lipid peroxyl radical formed by one General Introduction 29 turn of the cycle reacts with a new PUFA. In the absence of antioxidants, lipid oxidation may proceed as long as PUFAs are available for oxidation (Hamre, 2011). The lipid peroxidation chain can be terminated by two lipid radicals reacting to form a non-radical product or by quenching by a radical scavenger (Hølmer 1993; Frankel, 1998). Figure 1.10 Scheme showing the three phases of the free radical chain mechanism of lipid peroxidation. The RH group contains the unsaturated unit common to all PUFA. In this case the reaction is quenched by α-tocopherol, but other radical scavenger can be implicated. Although PUFA are very vulnerable and the most probable target of free radicals attack, proteins could also suffer a peroxidative attack. Adapted from Burton and Traber, 1990. In general, the overall effects of lipid peroxidation are a decrease in membrane fluidity, an increase in membrane permeability to normally impermeable substances and an inactivation of membrane-bound enzymes. The primary products of lipid oxidation are the conjugated dienes which are then converted into lipid hydroperoxides, which may undergo cleavage to form different secondary products of low molecular weight such as aldehydes and hydrocarbons (Hølmer, 1993; Frankel, 1998). Lipid hydroperoxides further oxidize, keeping the carbon chain intact into isoprostane, isofuran and monoor dihydroxy fatty acids. General Introduction 30 DHA oxidation specifically yields F4-type isoprostane, isofuran and monoor dihydroxy DHA. Eight subfamilies of F4-isoprostanes could be formed from DHA owing to free radical attack at positions C6, C9, C12, C15 and C18. Furthermore, lipid hydroperoxides can lead to a complete loss of membrane integrity with the carbon chain disintegration resulting in the formation of different molecular species of aldehydes with different carbon length alkalenes and/or alkalenes as byproducts. The most stable product from DHA oxidation is 4-hydroxyhexenal (Van Kuijk et al., 1990). A combination of water and lipid-soluble antioxidants may be necessary to reduce these oxidation products. However, the effect of each individual antioxidant molecule can vary depending on the organisms and the specific tissue (Dietrich et al., 2002). Besides, lipid oxidation-induced damage to the lyososome membrane can result in hydrolytic enzymes escaping into the cell cytoplasm, further damaging the cell. Figure 1.11 Non enzymatic oxidation of DHA is initiated after free radical attack, resulting in an unstable DHA-radical state that quickly undergoes isomerisation and rearrangement of double bonds. Lipid hydroperoxides further oxidize, keeping the carbon chain intact (structure preservation) or it can be disintegrated (structure disintegration), giving place to different byproducts. Several possible isomers exist within each class. Adapted from Siddiqui et al. (2008). General Introduction 31 Fish tissues are at a high risk of suffering from lipid oxidation, as they contain relatively large quantities of PUFA. This risk will be even higher in marine fish larvae, as their PUFA requirement is more elevated and will be reflected in their tissues. However, susceptibility of fish to lipid oxidation rate depends, to a large extent, on the tissue fatty acid profile and levels and type of antioxidants present. Thus, to avoid in vivo lipid peroxidation, sufficient amounts of antioxidants must be included in diets. 1.7 Pathological effects of oxidation on fish tissues Several studies have evidenced the adverse effects of oxidation on diverse marine and fresh water species. Apart from alteration of production parameters such as reduced growth or increased mortalities (Watanabe et al., 1970; Blazer, 1982; Wang et al., 2006) several pathological symptoms have been related to different sources of oxidative stress in adults and juveniles of different fish species (Table 1.6). As it can be observed in this Table, one of the most notorious signs is the appearance of muscular dystrophy. 1.7.1 The adverse effects of oxidative stress on musculoskeletal system 1.7.1.1 Muscular tissue In teleost fish, axial musculatures are organized into a series of segmentally arranged myotomes that have a complex three-dimensional morphology. The individual myotomes are separated by collagenous sheets called myosepta and have a complex geometry associated with the requirements for mechanical stability during body bending (Figure 1.12; Van Leeuwen, 1999). The number and shape of the myotomes show a significant variation with ontogenetic stage, position along the trunk, body morphology, phylogeny and style of locomotion (Johnston et al., 2011). Each myotome contains a superficial, wedge-shaped region lying directly beneath the lateral line, where the muscle fibres are arranged in a helical fashion, forming angles of up to 40º. This typical General Introduction 38 promoting polypeptides with structural homology to proinsulin. Depending on the biological context, IGF may stimulate cell growth, promote cell differentiation and inhibit apoptosis (Jones and Clemmons, 1995). IGF action can be influenced, both positively and negatively, by a family of IGF-binding proteins (IGFBP) and most, if not all, of their actions are mediated by the IGF-receptors (Jones and Clemmons, 1995). IGFs are one of the central pathways regulating protein synthesis in skeletal muscle. For instance, in zebrafish embryos, two IGF-II paralogues regulate midline development (White et al., 2009). Similarly, fish muscle has a substantially greater abundance of IGF-I receptors than insulin receptors (Parrizas et al., 1995). This indicates that IGF-I contributes more to the regulation of muscle function than insulin in fish, in contrast to mammals. In mammals, it has been proved that various properties of skeletal muscle render it particularly susceptible to free radical injury, even when systemic oxidative stress takes place. Thus, muscle seems to be primarily, if not selectively, affected. This may relate to the high degree of susceptibility of muscle to oxidative stress by virtue of its requirement and ability to undertake rapid and coordinated changes in energy supply and oxygen flux during contraction. This property makes muscle very prone to oxidative injury as a result of increased electron flux and from the mitochondrial respiratory chain (Haycock et al., 1996). On the other hand, there is a very high concentration of myoglobin in muscle and it is known that such a heme-containing protein confers a greater sensitivity to free radicals (Ostdal et al., 1997). Finally, the requirement of skeletal muscle membrane for PLs may render those membranes particularly susceptible to oxidative damage (Murphy and Kehrer, 1989). Thus, muscle seems to be at a higher risk of suffering the attack of ROS than any other tissue. It is logical to think that antioxidant protection mechanisms should be enhanced in muscular tissues. However, it has been showed in Atlantic salmon that retention of α-tocopherol is particularly low in white muscle, especially if compared to other organs, like liver which showed an exponential retention of vitamin E (Hardie et al., 1990; Hamre and Lie, 1997). The linear model for α-tocopherol retention for muscle and the exponential model for liver are supported by other studies with tilapia (Oreochromis aureus; Satoh et al., 1987) and rainbow trout (Hung et al., 1980; Frigg et al., 1990; Puangkaew et al., 2005). Similar results are found with other antioxidant nutrients, like Se. Monteiro et al. (2009) found a lower retention of Se in muscle of Brycon cephalus fed a diet supplemented with Se in comparison to gills or liver. Besides, SOD, CAT and GPX activities showed to be lower in Manchurian trout (Brachymystax lenok, Pallas) larvae muscle compared to viscera, brain and gills (Zhang et al., 2009). Therefore, these conditions should be considered as additional possible causes of muscle injury in fish. General Introduction 39 1.7.1.2 Bone-skeletal system The skeletal system serves many physiological functions, including the support of the body structural integrity during development and locomotion. Besides, the skeleton also provides sites for muscle attachment, protects vital organs and serves as a mineral reservoir (Lall and Lewis-McCrea, 2007). Teleost fish show a high variety of skeletal tissues. Indeed, more than bone and cartilage, fish skeletal tissue is often best described as a continuous spectrum ranging from connective tissue to cartilage and to bone (Hall and Witten, 2007). Cartilage and several other tissues with histological characteristics between bone and cartilage have been identified in fish and play an important role in skeletal development (Benjamin, 1990; Beresford, 1993; Huysseune, 2000). Bone is a specialized vascularised connective tissue consisting of cells and a mineralized extracellular matrix. Before mineralization, the extracellular matrix is composed mainly by collagen type I that subsequently becomes mineralized through the osteoblast mediated deposition of hydroxyapatite (Hall and Witten, 2007; Nordvick, 2007). Cartilage is an avascular skeletal tissue composed of chondrocytes that are embedded in an extracellular matrix, primarily composed by collagen type II and proteoglycans (Witten et al., 2010). The chondroid bone is an intermediate tissue that is found, for instance, in the mandibullar and maxillary tissue of teleost fish and has intermediate characteristics of both bone and cartilage, but may be mineralized. Different cells are involved in the formation and remodeling of axial skeleton bone. Osteoblasts are bone forming cells and their role is to secrete the non-mineralized bone matrix and control matrix mineralization. Osteoclasts are the cells involved in the resorption of the bone tissue and can be viewed as multinucleated macrophages. Osteocytes are cells trapped inside the bone matrix and are thought to be involved in the maintenance of bone substances and the exchange of ions from body fluids. Several studies dealing with the impact of first feeding on fish development showed that different nutrients play a central role in the appearance of skeletal malformation when they are not supplied during the larval phase (Cahu, 2003). Besides, the development of skeletal disorders in larval and juvenile fish may be linked to a poorly understood relationship between nutrition, environment and genetic factors. Therefore to try to avoid the appearance of skeletal deformities in cultured larvae, adequate supplementation of nutrients such as vitamins, minerals or lipids is of vital importance. Information of the role of oxidized lipids and free radicals in the development of skeletal abnormalities in teleost fish is limited. In humans, it is known that ROS General Introduction 40 contribute mostly to bone remodeling by promoting bone resorption (Bai et al., 2005). This is probably the result of an inhibition of osteoblasts and a stimulation of osteoclasts ultimately causing a net bone loss (Parhami et al., 1997; Parhami, 2003). The reduction in bone formation accompanied by a stimulation in bone resorption could result in development of skeletal abnormalities, as observed in halibut fed oxidized lipids (LewisMcCrea and Lall, 2007). Recently, studies with sea bream larvae showed that high dietary levels of DHA induced a higher percentage of skeletal deformities, finding in these larvae the highest value of TBARS, indicative peroxidative processes (Izquierdo et al., submitted). Vitamin E supplementation did not reduce the frequencies of abnormalities observed in juvenile halibut fed oxidized diets (Lewis-McCrea and Lall, 2007), neither in larval sea bream fed high DHA rotifers (Izquierdo et al., submitted), whereas vitamin E supplementation improved bone quality in adult mice who had been exposed to normal oxidative stress (Wang et al., 2000). Therefore, dietary oxidative products can cause deficiencies of antioxidant nutrients resulting in skeletal abnormalities. Further research on the effect of oxidized dietary lipid on skeletal development is required to understand the pathogenic effect on fish bone. Objectives 41 Presently, the production of juveniles is still a bottleneck in marine aquaculture. The use of a compound dry diet is crucial for sustaining production of high and constant quality juveniles. However, the exact requirements of marine fish larvae are not completely known. High dietary requirements of polyunsaturated fatty acids and particularly DHA are known to be increasing oxidative risk. However, little is known about the damages caused by free radicals in fish larvae and the potential effects of antioxidant nutrients on oxidative damages. Therefore, the objectives of this Thesis were: 1.- Determine the potential damage on sea bass larvae of high dietary levels of DHA. Traditionally high contents of PUFA, especially DHA, have been included in larval feeds to promote growth and survival. However, due to its high unsaturation, DHA is highly prone to peroxidation. This fact together with other characteristics can make marine fish larvae very susceptible of suffering oxidative stress on their tissues. 2.- Evaluate the antioxidant protective effect of vitamin E when different dietary levels of DHA are supplied. The inclusion of enough quantities of antioxidant nutrients must be included in diets to counteract the negative effects of ROS. Graded levels of α-tocopheryl acetate were tested in order to avoid oxidative stress adverse effects. 3.- Investigate the protective effect of the combination of vitamin E and selenium when high contents of DHA are included in the diet. A diet containing high DHA and vitamin E contents together with selenium supplementation was tested. 4.- Investigate the protective effect of the combination of vitamins C and E when high contents of DHA are included in the diet. To reach thos objective, high levels of vitamin C were added to a diet already containing 43 Chapter 2 General Materials and Methods 2.1 Experimental animals and conditions 2.1.1 Fish Sea bass (Dicentrarchus labrax) larvae were obtained from natural spawnings from Ecloserie Marine de Gravelines (Gravelines, France, Chapter 3) and Instituto de Acuicultura de Torre la Sal (Castellón, Spain, Chapters 4, 5 and 6). During the first days of acclimation, water temperature was monitored through coolers (16ºC) and water flow was increased up to room temperature (19.5-20ºC). Larvae were cultured in keane tanks until they were 12 dph (Chapters 4, 5, 6 and 7) or 32 dph (Chapter 3), when they were randomly distributed into the experimental tanks and after an acclimation period of two days, fed one of the experimental microdiets. 2.1.2 Experimental conditions All the experiments were carried out in Instituto Canario de Ciencias Marinas (ICCM, Telde, Canary Islands, Spain) facilities. 2.1.2.1 Green water pre-cultures Sea bass recently hatched were incubated in a well-aerated 2000 L tank under an open circulating sea water system (7 water renovations d-1) during the first five days. The sixth day, when larvae already had their mouth open, the sea water circuit was closed and larvae were cultured in green water. Everyday 20 L of Nanochloropsis gaditana (205 x 103 cells ml-1) were added and the enriched rotifers density maintained at 10 ind ml-1 General Materials and Methods 44 (Figure 2.1). For this purpose fresh rotifers were supplied twice a day (8:00; 15:00). The non-ingested rotifers were removed from the tank by filtration, thus avoiding the presence of starved low nutritional value rotifers in the tank. Larvae were cultured under natural photoperiod (around 10 h light) for 12 (Chapters 4, 5, 6 and 7) or 32 (Chapter 3) days until larvae were transferred to the experimental tanks. 2.1.2.2 Experimental tank cultures Each tank (170 L light grey colour cylinder fibreglass tanks) was supplied with filtered sea water (about 34 g L-1 salinity) previously stored at a 500 L tank for degasification. Water was filtered with a 50 μm mesh and entered in tanks at an increasing rate of 1.0 - 1.5 L min-1 in an open circulation system. Water was continuously aerated (125 ml min-1), attaining 5-8 g L-1 dissolved O2 and saturation ranged between 60 and 80%. Temperature and oxygen were daily measured by using an Oxy Guard-handy beta instrument (Zeigler Bros, Gardners, USA). Light intensity was kept at 1700 lux (digital Lux Tester YF-1065, Powertech Rentals, Western Australia, Australia). The photoperiod was kept at 12 h light: 12 h dark. Tanks were daily manually cleaned between 18:00 and 20:00 with a hose by a siphon system. 0 5 10 15 20 25 30 35 dph Figure 2.1 Scheme representation of the feeding sequence and cultivation routine during the experimental period. WATER MANAGEMENT Siphoning/cleaning of culture tank bottom Water change (% of tank volume) 25% day-1 50% day-1 75% day-1 FEEDING SCHEME Nanochloropsis gaditana Green water 205x103 cel ml-1 Clear water Enriched rotifers Rotifers 10 rotif ml-1 5 rotif ml-1 Microdiets General Materials and Methods 45 2.2 Diets and feeding 2.2.1 Rotifers Rotifers (Brachionus plicatilis) were cultivated in 1700 L cylindrical containers. The container was provided with a central aeration system through a porous stone that was maintained at 20 cm from the bottom. The cultures contained a combination of natural sea water (80%) and freshwater (20%). Rotifers, strain S-1, of 150-250 µm length, were inoculated at initial densities of 100 ind ml-1. They were fed with 1.2 g fresh yeast extract 106 ind-1 d-1, ration divided in two doses. Every four days the rotifers were carefully filtered through a 64 µm mesh, rinsed in water, the container washed and the culture resuspended in clean water at optimum culture densities of 100-250 ind ml-1. The rotifers were used to feed sea bass larvae during green water culture and during the first five days of microdiet trials. The rotifers supplemented along the green water cultures were previously enriched (24 h), at densities of 300 rotifers ml-1, with emulsified DHA Protein Selco® (INVE, Belgium; 0.125 g Selco l-1 ration in two doses). During the first five days of microdiet testing, yeast-fed rotifers were directly supplemented in a co-feeding regime to the experimental larval tanks, providing no source of LC-PUFA (Figure 2.1). 2.2.2 Microdiets Several isonitrogenous and isolipidic microdiets containing different levels of DHA, vitamin E, vitamin C or selenium were formulated. Diets were expected to contain around a 65% of protein and a 15% of lipids. 2.2.2.1 Microdiets formulation EPA 50 and DHA 50 (Croda, East Yorkshire, United Kingdom) oils in tryglicerides form were used as sources of DHA and EPA. Vitamin E in α-tocopheryl acetate form was obtained from Sigma-Aldrich (Madrid, Spain) and ROVIMIX Stay-C-35 (ascorbyl monophosphate; Roche, Paris, France) was employed as vitamin C source. An organic General Materials and Methods 46 form of selenium extracted from yeast (Sel-Plex, Alltech Inc, Lexington, KY) was employed. The desired lipid content was completed with a non essential fatty acid source, oleic acid (Merck, Darmstadt, Germany). Soybean lecithin (Acrofarma, Barcelona, Spain) containing around 50% of polar lipids was used as a source of phospholipids. The attractants mixture according to Kanazawa et al. (1989), the hydroand lipo-soluble vitamins mixture and minerals mixture according to Teshima et al. (1982) with some modifications is shown in Table 2.1. The protein source used was squid powder (Riber and Son, Bergen, Norway). To guarantee a best control of the microdiet fatty acid profile, squid powder was defatted three consecutive times with a chloroform:meal ratio of 3:1. Squid meal was suspended in three volumes of solvent and agitated for a few minutes. The particles of the mixture were filtered under a vacuum pump and the defatted meal was separated from the chloroform fraction. After each extraction, the defatted squid meal was spread in a laboratory tray and the remaining solvent was evaporated during 12 h at 38ºC. Fatty acid composition of these dietary components are shown (Table 2.2). 2.2.2.2 Microdiets preparation The microdiets were prepared according to Liu et al. (2002). Firstly, squid powder was mixed with water soluble components (Table 2.1) in a mortar. Separately, oils and fat-soluble vitamins were combined to obtain a homogeneous mix which was afterwards joined together with the powder mix. Then gelatine was dissolved in warm water and added to the previously mixed ingredients. The paste was compressed, pelleted (Severin, Suderm, Germany) and dried in an oven at 38ºC for 24 h (Ako, Barcelona, Spain). Pellets were grounded (Braun, Kronberg, Germany) and sieved (Filtra, Barcelona, Spain) to obtain the desired particle size (from 125-500 μm). Diets were analyzed for proximal and fatty acid composition of dry basis and each diet was tested in triplicates (Chapters 3, 5 and 6) or quadruplicates (Chapters 4 and 7). 2.2.3 Feeding Diets were manually supplied every 45 min from 8:00 to 19:00. Larvae were fed twice a day for at least five days with rotifers that had been fed only with baker´s yeast to avoid any n-3 LC-PUFA content. Initial density was 2 individuals ml-1 and then reduced to General Materials and Methods 47 1 individual ml-1. To guarantee feed availability, daily dry supply was initially 2.0 g and increased 0.5 g each week. Table 2.1 Mix of attractants, minerals and vitamins employed in the formulation of experimental microdiets Vitamins mg 100g-1 DW Attractants mg 100g-1 DW Hydro-soluble vitamins Inosine 5monophosphate 500 Cyanocobalamin 0.030 Betaine 660 Astaxanthin 5.000 L-Serine 170 Folic Acid 5.440 L-Tyrosine 170 Pyridoxine-HCl 17.280 L-Phenilalanine 250 Thiamine-HCl 21.770 DL-Alanine 500 Riboflavin 72.530 L-Sodium aspartate 330 Calcium Pantothenate 101.590 L-Valine 250 p-aminobenzoic acid 145.000 Glycine 170 Ascorbic polyphosphate 180.000 Total 3000 Nicotinic acid 290.160 Minerals mg 100g-1 DW myo-Inositol 1450.900 NaCl 215.133 Subtotal 2289.700 MgSO 4 .7H 2 O 677.545 NaH 2 PO 4 .H 2 O 381.453 Lipo-soluble vitamins K 2 HPO 4 758.949 Retinol acetate 0.180 Ca(H 2 PO 4 ).2H 2 O 671.610 Ergocalciferol 3.650 FeC 6 H 5 O 146.884 Menadione 17.280 C 3 H 5 O 3 .1/2Ca 1617.210 α-Tocopherol acetate 150.000 Al2(SO4)3 . 6H2O 0.693 Subtotal 171.110 ZNSO4 . 7H2O 14.837 CuSO4.5H2O 1.247 Choline chloride 2965.800 MnSO4 . H20 2.998 Total 5426.610 KI 0.742 CoSO4 . 7H2O 10.706 Total 4500.007 General Materials and Methods 48 Table 2.2 Main fatty acids of the major dietary lipids sources used in the different experiments. (% total identified fatty acids) n.d., not determined. EPA 500 DHA 500 Oleic acid Soy lecithin 14:0 0.20 0.08 0.50 0.07 15:0 n.d. n.d. 0.02 0.04 15:1n-5 n.d. n.d. n.d. 0.02 16:0 0.22 0.61 6.69 17.29 16:1n-7 0.33 0.38 0.14 0.07 16:2n-6 0.19 0.12 n.d. n.d. 16:2n-4 0.16 0.20 0.03 0.11 17:0 0.18 0.09 0.04 0.06 16:3n-3 0.11 0.07 n.d. n.d. 16:4n-3 0.20 n.d. n.d. n.d. 18:0 0.62 2.64 1.56 3.50 18:1n-9 2.75 5.33 76.77 16.99 18:1n-7 1.14 0.97 n.d. 1.24 18:1n-5 0.04 0.03 n.d. 0.05 18:2n-9 0.35 n.d. n.d. n.d. 18:2n-6 1.49 0.71 13.20 54.12 18:2n-4 0.76 0.08 n.d. n.d. 18:3n-6 0.47 0.30 n.d. n.d. 18:3n-4 0.36 0.09 n.d. n.d. 18:3n-3 0.95 0.27 0.16 5.41 18:3n-1 0.12 n.d. n.d. n.d. 18:4n-3 4.54 0.29 n.d. n.d. 18:4n-1 0.51 n.d. n.d. n.d. 20:0 0.14 0.60 0.14 0.23 20:1n-9+n-7 0.65 2.75 0.41 n.d. 20:1n-5 n.d. 0.28 n.d. n.d. 20:2n-9 0.41 0.03 n.d. n.d. 20:2n-6 0.23 0.50 n.d. 0.03 20:3n-6 0.53 0.16 n.d. 0.03 20:4n-6 3.71 2.37 n.d. n.d. 20:3n-3 0.10 0.37 n.d. n.d. 20:4n-3 2.13 0.70 n.d. n.d. 20:5n-3 62.91 9.93 0.03 0.03 22:1n-11 0.10 1.04 0.07 0.45 22:1n-9 0.93 0.62 0.05 n.d. 22:4n-6 1.60 0.50 n.d. n.d. 22:5n-6 0.35 3.31 n.d. n.d. 22:5n-3 1.87 3.60 n.d. n.d. 22:6n-3 8.65 60.93 0.21 0.23 General Materials and Methods 55 2.6.4 Vitamin E quantification by HPLC Conditions employed for vitamin E determination in feed and larval tissues are shown in Table 2.4. Table 2.4 HPLC conditions for vitamin E determination Chromatograph Thermo liquid chromatograph equipped with an injection valve type 7125 (100 µl), a LDC 4100 and a multi-wavelength UV-VIS detector. Column 150 x 4.60 mm reverse phase Luna 5µm C18 column (Phenomenox, California, USA). Mobile phase 98% methanol (methanol:ultrapure water) Flow 1.0 ml min-1 Pressure < 1000 psi Detection UV Wavelength 293 nm Tº of column Room temperature Injection volume 50 µl Run time Approximately 25 min Elution order was δ-tocopherol, β-tocopherol, γ-tocopherol and α-tocopherol. Retention time of α-tocopherol was estimated approximately at 12 min (Figure 2.2). Calculations to know vitamin E content are: Vitamin E (µg/g) = weightinjectedV MeOHV removedlayerV hexaneisoV areastdaverage areapeak 1 ×× − × General Materials and Methods 56 Figure 2.2 HPLC chromatograms showing identification of α-tocopherol (arrows) in standard (1), diet (2) and larvae (3). 2.7 Determination of vitamin C content Ascorbil-2-monophosphate was extracted from feeds using a phosphate buffer and quantitated by reversed-phase HPLC with UV detection as developed by Roche Vitamins Ltd. Vitamin C analysis was performed during a stay at the Institute of Aquaculture, University of Stirling (Scotland, UK). 1 3 2 General Materials and Methods 57 2.7.1 Vitamin C extraction from feeds Samples were grinded and 5 g weighed into a 100 ml conical flask. 50 ml of 0.4 M phosphate buffer pH 3.0 was added and tubes stirred for 15 min at room temperature. Two aliquots of 1.5 ml were centrifuged (1610 x g) for 5 min at room temperature and supernatant was transferred into a 7 ml glass bottle. One ml was removed with a disposable syringe and filter through a disposable 0.45 µm filter unit into a 2 ml glass bottle. Vials were kept in fridge (4ºC) until HPLC analysis. 2.7.2 Vitamin C determination by HPLC Conditions employed for vitamin C determination in feed and larval tissues are shown in Table 2.5. Retention time for ascorbic acid was estimated approximately 7.4 min (Figure 2.3). Table 2.5 HPLC conditions employed for vitamin C determination Chromatograph Thermo liquid chromatograph equipped with an injection valve type 7125 (100 µl), a LDC 4100 and a multi-wavelength UV-VIS detector. Column 150 x 4.60 mm reverse phase Gemini 5µm C18 column (Phenomenox, California, USA) f itted with a Gemini precolumn. Mobile phase 30% eluant 1a and 70% eluant 2b Flow 0.8 ml min-1 Pressure < 1000 psi Detection UV Wavelength 293 nm Tº of column Room temperature Injection volume 50 µl Run time Approximately 9 min Absorbance range 0.1 AUFS aEluant 1: Dissolve 21.6 g KH2PO4 in 1.8 l of filtered water, add 4 ml of 1,5-dimethyhexylamine and adjust the pH to 3.0 with phosphoric acid. Adjust the volume to 2.0 l with filtered water. Filter through a white nylon 0.45 µm filter to degas the solvent. b Eluant 2: Mix 900 ml of eluant 1 with 140 ml acetonitrile/ethanol 7:3 (v/v). General Materials and Methods 58 Figure 2.3 HPLC chromatograms showing identification of vitamin C (arrows) in standard (1) and diet (2). 2.7.3 Preparation of standards and calculation of their concentration To prepare stock solution approximately 15 mg of 2-phospho-L-ascorbic acid tri sodium salt were weighed into a 20 ml volumetric flask, dissolved and volume adjusted with 0.4 M phosphate buffer pH 3.0. One ml of the stock solution was diluted to 25.0 ml using 0.4 M phosphate buffer pH 3.0 to make an approximately 0.1 mM solution. The concentration of ascorbyl-2-monophosphate (CAMP) was calculated in our working standard according to the following formula: CAMP = 463.0 100500 100 ×× ×P mst 2 1 General Materials and Methods 59 Where: mst = the weight of tris-(cyclohexylammonium) ascorbic acid-2-phospate 1000 = Conversion from mg to µg; mst is the dilution factor P = Purity of tris-(cyclohexylammonium) ascorbic acid-2-phospate 100 = Conversion of % purity 0.4363 = Conversion from tris-(cyclohexylammonium) ascorbic acid-2-phospate (MW = 553.7) To calculate the response factor (RF) of ascorbyl-2-monophosphate (mVsml/µg) the next formula was applied: RFAMP = Ast/CAMP Where: Ast = Mean peak area from injection of working standard solution (mVs) CAMP = Calculated concentration of ascorbyl-2-monophosphate Experimental determinations are given as ascorbic acid equivalents (AAE) CAMP (mg/kg) = 2 31 V VV msaRFamp Asa × × × CAAE (mg/kg) = CAMP 1.256 61.17 × = CAMP 6876.0× Where, CAMP = Content of ascorbyl-2-monophosphate in sample (mg kg-1) CAAE = Content of ascorbic acid equivalents in sample (mg kg-1) ASa = Area obtained from the injection of the sample (mVs) RFAMP = Calculated response factor of ascorbyl-2-monophosphate (mVsml µg-1) msa = weight of sample (g) V1 = Volume of the sample extract (ml) V2 = Volume of the aliquot taken for dilution (ml) V3 = Volume of the diluted sample solution (ml) 176.1 = MW of ascorbic acid (g mol-1) 256.1 = MW of ascorbyl-2-monophosphate (g mol-1) 0.6876 = Conversion factor of AMP to AAE General Materials and Methods 60 2.8 Selenium determination Total selenium concentration was measured in total larvae and feeds. Samples were acidified in a microwave digestor (MarsXpress, CEM, Kamp-Lintfort, Germany) with 5 ml of 69% pure nitric acid. The resultant solution was poured after digestion into a 10 ml volumetric flask and made up to volume with distilled water. A total of 0.4 ml of this solution was then added to a 10 ml sample tube, 10 µl of the internal standard (Ga and Sc, 10 ppm) included and 0.3 ml of methanol added. The tubes were made up to volume with distilled water and total selenium measured in a collision/reaction cell ICP-MS (Thermo Scientific, Cheshire, UK) using argon and hydrogen as carrier gas. Collision/reaction cell ICP-MS is a technique that uses ion-molecule chemistry to eliminate polyatomic interferences from the mass spectrum of an ICP-MS. In this way, this technique has enabled ICP-MS to become virtually free of polyatomic interferences. Selenium determination was performed during a stay at Institute of Aquaculture, University of Stirling (Scotland, UK). 2.9 Histological analysis 2.9.1 Paraffin inclusion Sea bass larvae were fixed in 10% buffered formalin for 1 or 2 days when they were processed. For its histological process larvae were dehydrated through graded alcohols (70-96º) thanks to Histokinette 2000 tissue processor (Leica, Nussloch, Germany), then xylene and finally embedded in paraffin wax (Jung Histoembedder, Leica, Nussloch, Germany). Paraffin blocks were sectioned at 3 μm on a microtome (Leica, RM2135, Leica Instruments, Nussloch, Germany) and stained with Haematoxilyn and Eosin (H&E) staining for its histopathological evaluation (Martoja and MartojaPearson, 1970). As well, several special staining techniques were employed, such as Periodic-acid-Schiff (PAS), Perl´s Prussian blue (PB), modified long Ziehl-Neelsen (ZN) and Sudan black (SB) staining (Martoja and Martoja-Pearson, 1970) to check the presence of different components (Table 2.6). The mounted sections were examined under light microscopy using a Olympus CX41 binocular microscope (Olympus, Hamburg, Germany) connected to an Olympus XC30 camera (Olympus, Hamburg, Germany), which was linked to a computer using image capturing software (CellB®, Olympus, Hamburg, Germany). General Materials and Methods 61 Table 2.6 Staining techniques employed in the present Thesis and their significance Technique Significance Results H&E Histopathological evaluation Collagen – Pale pink Muscle – Deep pink Acidophilic cytoplasm – Red Basophilic cytoplasm – Purple Nuclei – Blue Erythrocytes – Cherry red PB Demonstrates the presence of ferric iron, d erivated from erythrocyte lysis Ferric iron – Blue Nuclei – Red PAS Detects substances resultants from lipid peroxidation, such as lipofucsins or ceroid pigment Ceroid – Magenta Nuclei – Blue ZN Detects substances resultant from oxidation of lipids and lipoproteins, such as lipofucsins or ceroid pigment Ceroid – Magenta Nuclei – Blue Background – Pale magenta to pale blue SB Detects substances resultant from oxidation of lipids and lipoproteins, such as lipofucsins or ceroid pigment Ceroid and red blood cells – Black Background – Pale grey 2.9.2 Resin inclusion Ten larvae per tank were fixed for 24 h at 4º in 2.5% glutaraldehyde in 0.2 M phosphate buffer (pH 7.2) and stored in cacodylate buffer until processed according to Millonig (Bancroft and Stevens, 1996). Samples were then rinsed in phosphate buffer and post-fixed for 1 h in 2% osmium tetraoxide in 0.2 M potassium ferrocyanide and dehydrated in acetone. Each larva was then embedded in an Araldite (Durcupan, Fluka, Buchs, Switzerland) resin block and kept in the oven at 60ºC overnight. Serial transverse and longitudinal larvae thick sections were cut at 1 µm on the ultramicrotome (Leica LKB Ultratome Nova, Nussloch, Germany), stained with 1% toluidine blue in 1% sodium General Materials and Methods 62 tetraborate and examined under light microscopy (Hoffman et al., 1983). This inclusion technique is used as a method to select regions to obtain ultrathin sections for TEM and to obtain a higher resolution for optical microscopy. Once the region was selected, thin sections were cut at 50 nm with a diamond blade, placed on a copper grid and stained with lead citrate before its observation at a ZEISS EM 910 (Carl ZEISS, Oberkochen, Germany) transmission electron microscope at the Electron Microscope Service of University of Las Palmas de Gran Canaria. Microphotographs were taken employing a proscan Slow-scan CCD-Camera (Froscan Elektronische Systeme, Germany) which was linked to a computer using an image capturing software (Soft Imaging System, Germany). 2.9.3 Whole mount staining A whole mount staining protocol was applied in order to determine tissue mineralization and the incidence of deformities in early larval stages at Chapters 4 and 5. At 35 dph (end of the experimental trial) 100 larvae per tank were stored in buffered formalin to examine skeletal deformities and 50 larvae to determine the ossification level. Larvae were stained with Alizarin red S to demonstrate bone following the protocol of Vandewalle et al. (1998) (Table 2.7). Larvae from the different experimental groups were stained simultaneously in order to prevent any technical variability. After staining larvae were measured by a Profile Projector (V-12A Nikon, Nikon Co., Tokyo, Japan) under a magnification objective of 50X and classified in three total length size classes (<10 mm; 10-12 mm and >12 mm). Larvae belonging to the second size class were considered for deformities study and observed under a stereomicroscope (Leica DM2500, Nussloch, Germany). Deformities were classified in three groups attending to their localization: - Head deformities: Include deformities such as pugheadness, alteration of brachistegals rays and opercula. - Lordosis: Defines an inward curvature of the vertebral column. - Kyphosis: Defined as the curvature of the upper spine. - Others: Including deformities such as scoliosis, vertebral compression or coiled vertebrae. General Materials and Methods 63 Table 2.7 Single staining protocol according to Vandewalle et al. (1998) Step Duration Solutions Hydratation Ethanol 95% 1 h For 100 ml: 95 ml absolute ethanol 5 ml distilled water Ethanol 95% 1 h Ethanol 95% 1 h Ethanol 75% 1 h For 100 ml: 75 ml absolute ethanol 25 ml distilled water Ethanol 40% 1 h For 100 ml: 40 ml absolute ethanol 60 ml distilled water Ethanol 15% 1 h For 100 ml: 15 ml absolute ethanol 75 ml distilled water Distilled water 1 h or overnight Tissue digestion Trypsin solution 1 h 90 mg porcine pancreas trypsin 70 ml distilled water 30 ml saturated solution of Na2B4O7 Ca staining Alyzarin red 1´30 h 1 gL-1 alizarin red in 0.5% KOH solution Clearing Gylcerin:KOH 1:3 12-24 h For 100 ml: 25 ml glycerine 75 ml KOH (0.5%) Gylcerin:KOH 1:1 12-24 h For 100 ml: 50 ml glycerine 50 ml KOH (0.5%) Gylcerin:KOH 3:1 12-24 h For 100 ml: 75 ml glycerine 25 ml KOH (0.5%) Storage Glycerin Pure glycerine with some grains of thymol to avoid the proliferation of microorganisms General Materials and Methods 64 The surface corresponding to bone in whole larvae was visualized and quantified using a computerized image analysis package (Image-Pro Plus®, Media Cybernetics, Maryland, USA) after staining with Alizarin red S. A list of image processing commands was used, encompassing the selection of pixel colour range and quantification. Selecting ranges of pixel values in colour images allowed the pixels associated with red to be distinguished. A mask was applied in order to turn all the selected pixels in bright objects. The number of selected pixels was then quantified using a particle analysis operation and by counting the area of all bright objects (in pixels). Larval size was estimated by calculating the surface areas (in pixels) covered by whole stained larvae. 2.10 Molecular biology All processes indicated in this section were performed during a stay at the University of Insubria, Department of Biotechnology and Lifer Sciences (Varese, Italy). Studied genes are showed in Table 2.8. Catalase (CAT), superoxide dismutase (SOD) and glutathione peroxidase (GPX) enzyme gene sequences were reconfirmed prior to its use for quantitative real time PCR (RT-PCR). Primers of these genes were ordered to Eurofins (Ebersberg, Germany) (Table 2.9). Table 2.8 Genes studied in the present Thesis Gene Accession number Superoxide dismutase FJ860004 Catalase FJ860003 Glutathione peroxidase FM013606 Insulin-like Growth Factor I AY800248 Insulin-like Growth Factor II AY839105 α-Actin FJ716131 Myosin heavy chain DQ317302 Calpain 1 FJ821591 General Materials and Methods 71 mRNAs of each gene. For this, a forward and a reverse primer were designed (Table 2.7) based on the mRNA sequences of Dicentrarchus labrax. These primer pairs were used to create templates for the in vitro transcription of cRNAs for each gene. The forward primers were engineered to contain a T7 or a T3 phage polymerase promoter gene sequence to their 5’ end and used together with the reverse specific primer in a conventional RT-PCR of total sea bass larvae RNA. RT-PCR products were then checked on a 2.5% agarose gel stained with ethidium bromide, cloned using pGEM®-T Easy cloning vector system (Promega, Milan, Italy) and subsequently sequenced in the SP6 direction. In vitro transcription was performed using T7 or T3 RNA polymerase and other reagents supplied in the Promega RiboProbe In Vitro Transcription System kit according to the manufacturer’s protocol. The molecular weight (MW) of the in vitro-transcribed RNAs were calculated according to the following formula: MW = [(nº of A bases) x 329.2) + (nº of U bases) x 306.2) + (nº of C bases) x 305.2) + (nº of G bases) x 345.2)] + 159. Spectrophotometry at 260 nm gave a concentration of each cRNA. Therefore, the concentration of the final working solutions were calculated and expressed as n° of molecules μl-1 (Table 2.10). 2.10.5.2 Generation of standard curves The cRNAs produced by in vitro transcription were used as quantitative standards in the analysis of experimental samples. Defined amounts of cRNAs at 10-fold dilutions were subjected in triplicates to real-time PCR using one-step TaqMan EZ RT-PCR Core Reagents (Applied Biosystems, Italy), including 1X Taqman buffer, 3 mM MnOAc, 0.3 mM deoxynucleotide triphosphates (dNTP) except deoxythymidine triphosphate (dTTP), 0.6 mM deoxyuridine triphosphate (dUTP), 0.3 μM forward primer, 0.3 μM reverse primer, 0.2 μM FAM-6 (6-carboxyfluorescein-labeled probe), 5 units rTH DNA polymerase, and 0.5 units AmpErase UNG enzyme in a 25 μl reaction. AmpErase® uracil-N-glycosylase (UNG) is a 26-kDa recombinant enzyme encoded by the General Materials and Methods 72 Escherichia coli uracil-N-glycosylase gene. UNG acts on single-and double-stranded dUcontaining DNA. It acts by hydrolyzing uracil-glycosidic bonds at dU-containing DNA sites. The enzyme causes the release of uracil, thereby creating an alkali-sensitive apyrimidic site in the DNA. The enzyme has no activity on RNA or dT-containing DNA. For TaqMan® assays, AmpErase® UNG treatment can prevent the reamplification of carry over PCR products from previous PCR reactions. When dUTP replaces dTTP in PCR amplification, AmpErase® UNG treatment can remove up to 200,000 copies of amplicon per 50 µl reaction. RTPCR conditions were: 2 min at 50°C, 30 min at 60°C, and 5 min at 95°C, followed by 40 cycles consisting of 20 s at 92°C, 1 min at 62°C. The Ct (cycle threshold) values obtained by amplification were used to create standard curves for target genes (Figure 2.8). Table 2.10 Molecular weights and number of molecules µl-1 of genes Gene Molecular weight Molecules µl-1 Superoxide dismutase 51833.8 3.25 x 10 12 Catalase 53428.2 5.53 x 10 12 Glutathione peroxidase 54530.6 3.43 x 10 12 Insulin growing factor I 181336.2 1.07 x 10 12 Insulin growing factor II 208412.8 1.44 x 10 11 Myosin 112235.0 1.39 x 10 11 αactin 156736.6 5.69 x 1011 Calpain 1 191785.2 5.21 x 1011 Cathepsin-L 144192.0 1.00 x 1012 General Materials and Methods 73 Figure 2.8 Standard curve and amplification plot of myosin heavy chain gene. 2.10.5.3 Quantitation of transcripts by one-step RT-PCR TaqMan® system A hundred nanograms of total RNA extracted from the experimental samples were subjected, in parallel to triplicates of 10-fold-diluted, defined amounts of standard General Materials and Methods 74 cRNAs, to real-time PCR under the same experimental conditions as for the establishment of the standard curves. Real-time Assays-by-Design™ PCR primers and gene-specific fluorogenic probes were designed by Applied Biosystems (ABI; Monza, Italy). TaqMan® probes of the obtained target genes are showed at Table 2.11. Table 2.11 TaqMan® probes of genes employed in the present Thesis Genes Kind of primer Sequence (5´→3´) Forward primer ATGGTGTGGGACTTCTGGAG CAT Reverse primer GCTGAACAAGAAAGACACCTGATG TaqMan® probe CAGACACTCAGGCCTCA Forward primer TGGAGACCTGGGAGATGTAACTG SOD Reverse primer TCTTGTCCGTGATGTCGATCTTG TaqMan® probe CAGGAGGAGATAACATTG Forward primer AGTTAATCCGGAATTCGTGAG GPX Reverse primer AGCTTAGCTGTCAGGTCGTAAAAC TaqMan® probe AATGGCTGGAAACGTG Forward primer GCAGTTTGTGTGTGGAGAGAGA IGF-I Reverse primer GACCGCCGTGCATTGG TaqMan® probe CTGTAGGTTTACTGAAATAAAA Forward primer TGCAGAGACGCTGTGTGG IGF-II Reverse primer GCCTA CTGAAATAGAAGCCTCTGT TaqMan® probe CAAACTGCAGCGCATCC Forward primer ACTTTACAGGCGGCGTGA Calpn Reverse primer GGCTCTGCTGATGATGTTGTAGA TaqMan® probe TCAGATCGTACATTTCCG Forward primer CCTCTTCCAGCCTTCCTTCA α-actin Reverse primer TGTTGTAGGCGGTCTCATGGATA TaqMan ® probe CCAGCAGACTCCATACCGA Forward primer TGGAGAAGATGTGCCGTACTCT MyHC Reverse primer CGTGTCATTGATTTGACGGACATTT TaqMan® probe AACTGAGTGAACTGAAGACC General Materials and Methods 75 TaqMan® PCR was performed on a StepOne Real Time PCR System (Applied Biosystems; Monza, Italy). To reduce pipetting errors, master mixes were prepared to set up duplicate reactions (2 x 30 μl) for each sample. 2.10.5.4 Sample quantification Data from TaqMan® PCR runs were collected with StepOne™ Software v 2.0. Ct values corresponded to the number of cycles at which the fluorescence emission monitored in real time exceeded the threshold limit. The Ct values were used to create standard curves to serve as a basis for calculating the absolute amounts of mRNA in total RNA (nº molecules/ng total RNA). 2.11 Statistical analysis The statistical analysis showed within this Thesis were performed using the SPSS software package (SPSS for Windows 14.0; SPSS Inc., Chicago, IL, USA, 2005). A significance level of 5% (P<0.05) was used for all tests performed. The arithmetic or sample mean was used to provide as an estimate of the population mean together with the standard deviation (SD) to represent sample distribution and was calculated for each parameter measured. 2.11.1 Parametric testing Parametric tests were performed based on the assumptions that the observations were made at random and that the test variances independent. Furthermore, the sample variances must be homogeneous and the data normally distributed. Where data failed to meet these requirements, non-parametric tests were employed (Section 2.11.2). A Levene´s test was used to determine the normality and homogeneity of variances and once met the assumptions, were analyzed using a one-way analysis of variance (ANOVA) and where data differed significantly (P<0.05), Duncan multiple comparison post-hoc test was applied using a SPSS software (SPSS for Windows 14.0; SPSS Inc., Chicago, IL, USA, 2005). For analysis of one-way ANOVA the following general linear model was used: General Materials and Methods 76 Yij = µ + α i + ε ij where Yij is the mean value of the tank, µ is the mean population, Di is the fixed effect of the diet and eij is the residual error. In addition, the two variables general linear model (GLM) features was used to analyze the molecular biology data sets. In this sense, the factor “sampling time” was incorporated into the model, thus allowing to observe differences between variables diets, effect of time and interactions. The model employed was: Yijk = µ + α i + δ j + ( αδ )ij + ε ijk Where Yij is the mean value of the tank, µ is the mean population, α i is the fixed effect of the diet, δ j is the fixed effect of the time, ( αδ )ij is the interaction between diet and time and eij is the residual error. 2.11.2 Nonparametric testing Data failing to meet the assumptions for parametric tests or categoric data were analyzed using nonparametric statistical methods. A Kruskall-Wallis test was performed using a SPSS software (SPSS for Windows 14.0; SPSS Inc., Chicago, IL, USA, 2005). Means bearing significant differences (P<0.05) were further tested using squared Chi post-hoc test. Chapter 3 α-tocopherol in weaning diets for European sea bass (Dicentrarchus labrax) improves survival and reduces tissue damage caused by excess dietary DHA contents This work was published in Betancor et al. (2011) Aquaculture Nutrition, 17(2): e112e122. ABSTRACT The objective of the present study was to investigate the combined effect of several dietary contents of vitamin E and polyunsaturated fatty acids, mainly DHA, on growth, survival, biochemical composition and tissue morphology of sea bass along early development. A feeding experiment was conducted in sea bass larvae using five different diets with the same proximate composition and different ratios of DHA concentrated fish oil (1, 3 and 5 % dry weight) and vitamin E (α-tocopheryl acetate) (150 and 300 mg 100 g-1 dry weight). DHA was readily deposited in fish tissues and associated to higher sea bass mortalities probably due to increased peroxidation risks. Besides, the elevation of dietary DHA contents up to 5% severely increased the incidence of muscular lesions and the presence of ceroid pigment within hepatocytes. However, elevation of dietary vitamin E levels markedly reduced the incidence of these symptoms in sea bass, increasing the tissue content in several polyunsaturated fatty acids and improving growth and stress resistance. Moreover, when sea bass was fed diets containing high vitamin E levels, fish showed a significant improvement in growth when dietary DHA was raised from 1 to 3 %. Therefore, in sea bass larvae a ratio of 3% DHA and 300 mg 100 g-1 vitamin E seems to be adequate to achieve a good larval performance and to avoid muscular lesions. Keywords: DHA larvae myopathy oxidative stress sea bass vitamin E Vitamin E/DHA imbalances in sea bas larvae 78 3.1 Introduction Most marine fish larvae require high amounts of n-3 LC-PUFA (long chain polyunsaturated fatty acid) such as eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA) in their diets as essential fatty acids for normal growth and development, differing from freshwater species that can produce these fatty acids from linolenic acid (Sargent et al., 1999). Dietary levels of these essential fatty acids in marine fish larvae vary over a range between 0.3 and 39 g kg-1 (formulated diet or live prey) dry weight (DW; Izquierdo, 1996). Besides, an increase of dietary n-3 LC-PUFA in larval sea bream (Sparus aurata) up to 8% improves larval growth and survival (Liu et al., 2002); meanwhile inclusion levels of 1.5% promote maximum growth in sea bream juveniles (Ibeas et al., 1994), proving the essentiality of these fatty acids in larval stages. These fatty acids are very sensitive to peroxidation and they are even more exposed in formulated diets for marine fish larvae which are formed by micro-particles with a large surface area to volume ratio. On the other hand, fish larval tissues are known to be very rich in those polyunsaturated fatty acids (PUFA) (Salhi et al., 1997) and require the action of antioxidants to protect them intraand extra-cellularly from free radical compounds (Sargent et al., 1997). Vitamin E (α-tocopherol; α-TOH) is a structural component of cell membranes which has an important role as an antioxidant, controlling peroxidation of unsaturated fatty acids (Putnam and Comben, 1987). Thus, for physiological protection against oxidation, the increasing in dietary PUFA must be combined to an increase in α-TOH (Sargent et al., 1997). Mourente et al., (1999a) reported that Dentex dentex larvae fed Artemia enriched with apparently supra-optimal levels of n-3 LC-PUFA showed significantly lower α-TOH contents and poorer performance indicating increased oxidative stress. Tocher et al., (2003) have shown that supplementation of α-TOH to an oxidized diet improves sea bream juveniles growth and reduces lipid peroxidation products content in sea bream and turbot (Psetta maxima) tissues. Indeed, tissue α-TOH contents are closely related with tissue PUFA levels (Izquierdo and Fernandez-Palacios, 1997), both nutrients showing a synergistic effect on the non-specific immune responses and disease resistance in Japanese flounder (Paralychthis olivaceous) (Wang et al., 2006). Dietary vitamin requirements of fish decrease as the age and weight of the animal increases and as the growth rate decreases (Amezaga and Knox, 1990). Growth rates are much higher for larvae than for adult fish (Gatesoupe 1994), and therefore, young fish are more susceptible to a lack of vitamins in their food than are juveniles or Vitamin E/DHA imbalances in sea bas larvae 79 subadults (Dabrowski, 1986). Thus, early nutritional studies have showed that α-TOH is essential for marine fish larvae (Watanabe et al., 1970; Murai and Andrews, 1974; González et al., 1995). In gilthead sea bream larvae, González et al. (1995) found that the increase in microdiet α-TOH content improves larval growth and survival. Lipid peroxidation as a consequence to an imbalance between PUFA and antioxidants will damage the biomembranes, producing several pathological conditions in fish (Sakai et al., 1989) and could cause irreversible changes in the developing tissues of marine fish larvae. Thus, lipid oxidation in marine fish larvae could be at least partly responsible for the higher disease incidence and subsequent larval mortalities as suggested by some authors (Tocher et al., 2002). However, there is a complete lack of studies regarding the combined effect of dietary PUFA levels and α-TOH and its relation on potential pathological damages on fish larvae. Thus, the objective of the present study was to investigate the combined effect of several dietary contents of α-TOH and PUFA, mainly DHA, on growth, survival, larval fatty acid composition and tissue morphology of sea bass along early development. 3.2 Materials and methods 3.2.1 Fish Sea bass (Dicentrarchus labrax) larvae were obtained from natural spawnings from France (Ecloserie Marine de Gravelines, Nord-Pas-de-Calais), the experiment was carried out in the Instituto Canario de Ciencias Marinas facilities (Telde, Canary Islands, Spain). A trial was conducted to test 5 microdiets in triplicates. Larvae were previously fed a commercial microdiet until they reached 34 days old. Larvae (total length 12.11 ± 1.06 mm, dry body weight 1.9 mg) were randomly distributed into the experimental tanks at a density of 600 larvae tank-1 and were fed one of the experimental diets tested in triplicates for 14 days, at a water temperature of 19.5 to 20ºC. All tanks (170 L light grey colour cylinder fibreglass tanks) were supplied with filtered sea water (34 g L-1 salinity) at an increasing rate of 1.0 - 1.5 L min-1 along the feeding trials. Water entered the tank from the bottom and get out from the top; water quality was daily tested and no deterioration was observed. Water was continuously aerated (125 ml min-1), attaining 5-8 g L-1 dissolved O2 and saturation ranged between 60 and 80%. Vitamin E/DHA imbalances in sea bas larvae 80 3.2.2 Diets Five isonitrogenous and isolipidic experimental microdiets (pellet size<250 μm) similar in their EPA content and different in DHA and vitamin E content were formulated (Table 3.1) using concentrated fish oils EPA500 and DHA500 (CRODA, East Yorkshire, England, UK) as sources of EPA and DHA. The α-TOH (DLαTocopheryl Acetate) contents were tested in 150 and 300 mg 100 g-1 DW (Sigma-Aldrich, Madrid, Spain). Given the scarcity of works focusing on the initial requirements of α-TOH in marine fish larvae, these levels were based on previous studies performed by Tocher et al. (2002) and Ortuño et al. (2000) in fry sea bream. The protein source used (squid meal) was defatted (3 consecutive times with a chloroform:squid meal ratio of 3:1) to allow a complete control of the fatty acid profile of the microdiet. The microdiet based on defatted squid meal (2.6% lipid content), EPA500 and DHA500 were added in different quantity to obtain the desired ratios, and the oleic acid was added to equalize the lipid content in each diet (Table 3.1). The microdiets were prepared according to Liu et al. (2002) by mixing squid powder and water soluble components, then the lipid and fat soluble vitamins and, finally, warm water solved gelatine. The paste was pelleted and dried in oven at 38ºC for 24 h. Pellets were ground and sieved to obtain particle size below 250 µm. Diets were analyzed for proximate and fatty acid composition of dry basis. Diets were manually supplied; fourteen times per day every 45 min from 9:0019:00. Daily feed supplied was 2.0 and 2.5 g tank-1 during the first and second week of feeding, respectively. 3.2.3 Growth and survival Before the end of the experiment an activity test was conducted by handling 20 larvae tank-1 out of the water in a scoop net for 1 min and, subsequently allocating them in another tank supplied with clean seawater and aeration, to determine survival after 24 hours. Final survival was calculated by individually counting all the live larvae at the beginning and at the end of the experiment. Growth was determined by measuring dry body weight (105 ºC 24 hours) and total length (Profile Projector V-12A Tokyo, Nikon) of 30 fish tank-1 at the beginning, in the middle and at the end of the trial. Vitamin E/DHA imbalances in sea bas larvae 87 Table 3.3 Lipid levels (g kg -1) and fatty acid composition (% total identified fatty acid) of total lipids from sea bass at 34 dph and after 14 days of feeding the experimental diets (48 dph) Data are means ± SD. Values within the same row bearing different superscript letter are significantly different (P< 0.05); n.d., not detected. LC-PUFA, long chain polyunsaturated fatty acid; ARA, arachidonic acid; EPA, eicosapentenoic acid; DHA, docosahexaenoic acid; OLA, oleic acid Dietary DHA/vit E Initial 1/150 1/300 3/150 3/300 5/150 Total lipids (g kg-1) 291±0.0 189±1.9 164±1.9 172±2.1 167±1.1 175±1.0 14:0 0.5±0.1 0.9±0.1 0.8±0.1 0.9±0.1 0.9±0.1 0.7±0.1 14:1n-7 1.5±0.0 0.1±0.0 0.1±0.0 0.1±0.0 0.1±0.0 0.0±0.0 15:0 0.3±0.1 0.4±0.0 0.2±0.1 0.3±0.0 0.3±0.0 0.3±0.0 15:1n-5 0.1±0.0 0.2±0.1 0.1±0.1 0.1±0.0 0.1±0.0 0.1±0.0 16:0 19.0±1.2 14.0±2.1 12.1±1.7 14.8±1.4 15.3±2.7 13.9±1.4 16:1n-9 n.d. 0.9±0.1 0.8±0.2 0.8±0.1 0.8±0.1 0.620.0 16:1n-7 2.9±0.21 2.2±0.2 2.0±0.5 1.9±0.2 1.9±0.3 1.3±0.1 16:1n-5 0.2±0.0 0.2±0.0 0.1±0.0 0.1±0.0 0.2±0.0 0.1±0.0 16:2n-6 n.d. 0.5±0.0 0.5±0.1 0.4±0.1 0.5±0.0 0.3±0.0 16:2n-4 0.2±0.0 0.2±0.1 0.1±0.0 0.2±0.1 0.2±0.1 0.3±0.1 17:0 0.5±0.0 0.4±0.1 0.4±0.1 0.5±0.1 0.5±0.1 0.5±0.0 16:3n-4 0.1±0.0 0.9±0.1 0.8±0.2 0.8±0.1 0.8±0.1 0.5±0.1 16:4n-3 0.6±0.0 0.6±0.1 0.5±0.1 0.6±0.1 0.6±0.1 0.5±0.0 16:4n-1 0.3±0.0 0.7±0.0 0.6±0.1 0.6±0.0 0.6±0.1 0.4±0.0 18:0 7.3±1.0 6.2±1.0 5.1±0.6 6.5±0.4 6.6±1.2 6.6±0.6 18:1n-9 11.7±4.2 31.2±3.3 27.5±7.0 26.3±3.0 26.4±4.1 18.4±2.1 18:1n-7 2.6±0.9 4.1±0.5 3.4±0.8 3.6±0.2 3.7±0.5 2.0±1.7 18:2n-6 15.7±0.3 5.8±0.2 5.6±0.9 6.0±0.17 5.8±0.5 5.8±0.4 18:2n-4 0.1±0.0 0.2±0.0 0.2±0.1 0.3±0.0 0.2±0.0 0.2±0.0 18:3n-6 0.2±0.0 0.2±0.0 0.2±0.0 0.2±0.0 0.2±0.0 0.3±0.0 18:3n-3 1.4±0.0 0.5±0.0 0.5±0.1 0.6±0.0 0.6±0.0 0.6±0.0 18:3n-1 0.7±0.0 0.1±0.0 0.2±0.0 0.2±0.1 0.1±0.0 0.1±0.0 18:4n-3 n.d. 0.4±0.1 0.5±0.2 0.4±0.0 0.4±0.0 0.4±0.0 20:0 n.d. 0.2±0.0 0.2±0.0 0.3±0.0 0.2±0.0 0.3±0.0 20:1n-9 2.1±0.23 2.0±0.3 1.6±0.4 2.0±0.2 1.9±0.3 2.0±0.2 20:2n-9 n.d. 0.8±0.1 0.7±0.1 0.9±0.0 0.9±0.1 1.0±0.1 20:3n-9 n.d. 0.1±0.0 0.1±0.0 0.1±0.0 0.1±0.0 0.1±0.0 20:4n-6 1.7±0.0 2.0±0.3 2.0±0.3 2.2±0.3 2.3±0.3 2.5±0.2 20:4n-3 0.2±0.0 0.3±0.0 0.3±0.1 0.2±0.0 0.2±0.0 0.2±0.0 20:5n-3 7.4±0.0 10.3±3.6 11.6±2.7 8.3±1.8 8.4±2.2 7.9±1.2 22:1n-11 1.1±0.0 0.1±0.1 0.1±0.0 0.1±0.0 0.1±0.0 0.2±0.0 22:4n-6 0.3±0.0 0.3±0.0 0.2±0.0 0.8±0.2 0.9±0.2 1.5±0.1 22:5n-3 1.2±0.2 0.9±0.3 1.0±0.2 0.9±0.2 0.9±0.2 1.0±0.1 22:6n-3 17.7±3.9 11.0±3.7 11.0±3.0 19.0±7.0 19.3±6.9 28.4±6.3 Saturated 27.7±4.2 22.3±3.3 19.0±2.5 23.6±2.0 24.2±4.2 22.7±2.3 Monoenoics 20.4±5.4 41.4±4.4 36.0±8.9 35.5±4.0 35.5±5.5 24.9±4.7 n-3 28.5±6.1 24.1±7.8 25.4±6.1 29.9±9.0 27.6±10.6 39.2±7.6 n-6 19.7±0.0 8.8±0.1 8.5±1.2 7.7±3.1 9.6±0.7 10.4±0.2 n-9 13.8±4.9 34.3±3.7 30.0±7.5 29.3±3.2 29.3±4.5 21.0±2.8 n-3 LC-PUFA 26.5±6.5 22.5±7.3 23.9±5.6 28.4±8.8 26.1±10.5 37.6±7.5 ARA/EPA 0.2±0.0 0.2±0.0 0.2±0.0 0.3±0.0 0.3±0.0 0.3±0.0 EPA/DHA 0.4±0.0 0.9±0.0 1.1±0.1 0.4±0.1 0.4±0.0 0.3±0.0 OLA/DHA 0.7±0.9 3.1±1.2 2.7±1.2 1.5±0.7 1.6±0.8 0.7±0.2 OLA/n-3 LC-PUFA 0.4±0.1 1.6±0.6 1.3±0.5 1.0±0.4 1.2±0.5 0.5±0.2 n-3/n-6 1.6±0.8 2.7±0.9 3.0±0.7 4.9±4.0 2.9±1.3 3.8±0.8 Vitamin E/DHA imbalances in sea bas larvae 88 B A B C D E F Figure 3.4 Muscular lesions found in larvae fed diet 5/150 at 48 days old, Haematoxilin & Eosin staining (x400). A/BInitial lesion showing fibre swelling (arrows); C/DFibres start breaking down (arrows); E/FIntense mononuclear infiltrate that traverse the basal lamina of muscular fibre (arrows). Vitamin E/DHA imbalances in sea bas larvae 89 Figure 3.5 Incidence of muscular lesions in sea bass feeding the experimental diets containing several DHA and vitamin E. Larvae were considered injured when some kind of lesion showed in Figure 3.4 was observed. Another morphological alteration was observed in the hepatocytes which showed a pink (H&E) vacuolar intracytoplasmatic pigment (Figure 3.7, A-B). This material stained Sudan Black and PAS positively, moderately Ziehl–Neelsen and Prussian Blue negative, suggesting its ceroid nature. A higher incidence of ceroid hepatocytes was found in larvae fed the low α-TOH content (150 mg 100 g-1), which was increased by the rise in dietary DHA up to 5% (Figure 3.8). A lower incidence was found in fish fed higher dietary α-TOH diets (300 mg 100 g-1) (Figure 3.8), hence the highest incidence being found in fish fed diet 5/150 (40.4%) and the lowest in fish fed diet 1/300 (11.1%) (P=0.002) (Figure 3.8). The incidence of ceroid pigment was increasing along the experimental period, observing no pigment at the beginning of the trial, being the 68.7% of the observed larvae affected at 48 dph. No other morphological alterations or pathologies were found in liver or any other tissue. 0 5 10 15 20 25 30 35 1/150 1/300 3/150 3/300 5/150 Incidence % Dietary treatments Incidence of muscular lesions ab ab b ab a Vitamin E/DHA imbalances in sea bas larvae 90 Figure 3.7 Incidence of ceroid pigment depending on the diets. 0 5 10 15 20 25 30 35 40 45 1/150 1/300 3/150 3/300 5/150 Incidence % Dietary treatments Incidence of ceroid pigment Figure 3.6 Vacuoles of ceroid pigment (arrows) within hepatocytes fed diet 5/150 at 48 days old (x400). H&E (A) and PAS (B) staining. Vitamin E/DHA imbalances in sea bas larvae 91 3.4 Discussion DHA was readily deposited in fish tissues reaching almost 30% of total lipids in fish fed the highest dietary contents. But, since elevation of dietary DHA markedly increases peroxidation risks, the higher sea bass mortalities found in fish fed increased DHA levels suggested the proliferation of free radicals derived from this fatty acid and the formation of toxic oxidized compounds. Indeed increased DHA multiplies two, four and eight times the oxidation potential of the diet in comparison to the same increase in arachidonic, linolenic or linoleic acid, respectively (Zhang and Chen, 1997). Oxidation of PUFA produces compounds such as fatty acid hydroxyperoxides, fatty acid hydroxides, aldehydes and hydrocarbons, several of them being toxic, binding to proteins amino groups, nucleic acid and phospholipid bases and damaging membrane lipids, proteins and DNA (Frankel, 1998). Thus, lipid peroxidation is highly deleterious in fish, resulting in damage to cellular and sub-cellular membranes (Puangkaew et al., 2005), structural proteins and different fish tissues and organs (Watanabe et al., 1970; Moccia et al., 1984; Sakai et al., 1989; Bai and Lee, 1998). Indeed, in the present study the elevation of dietary DHA contents up to 5% severely increased the incidence of muscular lesions, including hyaline degeneration and fragmentation of myofibres, which denoted the severe damage in both membranes and structural proteins, necrosis and mononuclear infiltrates. Another pathological finding in sea bass associated to the high dietary DHA levels was the presence of ceroid pigment within hepatocytes, which has been also found to be related to an imbalance between antiand pro-oxidants (Porta et al., 2002). It has been shown that the presence of ceroid pigments can be used as an estimation of lipid peroxidation as it is usually associated to other consequences of oxidative stress (Moccia et al., 1984; Sakai et al., 1998). Both muscular distrophy and ceroid pigment deposits have been described among the symptoms of deficiency in α-TOH (Lovell et al., 1984; Gatlin et al., 1986; Frischknecth et al., 1994; Bowater and Burren, 2007), which being a fat-soluble vitamin it is deposited in the lipid fraction of tissues, including biomembranes, and plays an important role in protecting them from lipid peroxidation. In the present study, elevation of dietary α-TOH levels markedly reduced the incidence of these symptoms in sea bass, increasing the fish tissue content in several PUFAs, which denotes the antioxidant and protective role of this vitamin, and improving survival. Moreover, an increase in PUFA could be seen in fishes fed with diets deficient in α-TOH (Baker and Davies, 1996; Bell et al., 2000). The cause of this phenomenon is not clear, but it is likely that α-TOH has an Vitamin E/DHA imbalances in sea bas larvae 92 effect on fatty acids desaturation and elongation (Mourente et al., 2007). The kind and degree of incidence of muscular lesions associated to dietary α-TOH imbalances differ among fish species, nutritional status, age, size, diet quality and feeding period (Moccia et al., 1984). For instance, α-TOH liver storage can greatly prevent the development of this pathology in rainbow trout (Cowey et al., 1981) and young Atlantic salmon showed severe muscular dystrophy when fed a α-TOH deficient diet (Poston et al., 1976), whereas this type of lesion could not be found in bigger fish (Bell et al., 1985). On the other hand, it is known that DHA is a significant component of the cell membrane phospholipids of the skeletal muscle (Infante, 1987; Salem et al., 2001) and is profoundly susceptible to oxidative stress (Song et al., 2000). It has been suggested that DHAcontaining phospholipids are important for very active Na+K+ATPase (Else and Wu, 1999) and Ca2+ATPase (Infante, 1987; Infante et al., 2001) in muscle. This increased metabolism probably results in a greater consumption of oxygen, being these phospholipids important substrates for damage by the free radicals (Hulbert et al., 2002). These data could explain the fact that the adverse effects of a DHA/α-TOH imbalance are seen before in the muscular tissue than in any other localization. The present study suggests that larvae and very young marine fish are very sensitive to oxidative imbalances what is probably related to several factors such as the high water resorption which occurs during this later period of metamorphosis, the high oxidative metabolism, fast growth or the high requirements for PUFAs (Fontagnè et al., 2006; Fontagnè et al,. 2008). In addition, it is possible that larval marine fish may not have sufficiently welldeveloped antioxidant capability, as many of their biological and physiological systems are poorly developed (Mourente et al., 1999b). Thus, a too high elevation of dietary PUFA, and particularly DHA, may easily cause an oxidative imbalance in this very young fish even when α-TOH is supplied in high amounts in the diet as in the present experiment, increasing the anti-oxidant requirements. In fact, copepods, natural preys for these fish have a very high content of several antioxidant nutrients such as α-TOH, Se, vitamin C, phospholipids or carotenoids (Hamre et al., 2008a). Moreover, muscular lesions in such a young larvae could interfere in the normal development of larvae, increasing the potential to develop skeleton deformities. Rainbow trout fry syndrome, characterized by several pathologies including muscle degeneration, has been also associated with an increased incidence of vertebral deformities (Madsen and Dalsgaard, 1999). Ceroid pigment within hepatocytes has been associated with numerous pathological conditions in which the main pathogenic factor is the deficiency of α-TOH or Vitamin E/DHA imbalances in sea bas larvae 93 imbalances between antiand pro-oxidants. In this study ceroid pigment did not affect extensively the liver denoting the mildness of the pathology, since fish given diets containing rancid oil show severe ceroidosis in addition to myopathy (Miyazaki, 1995). Moreover, in acute cases ceroid deposits are found mainly in Kupffer cells and secondarily inside of hepatocytes (Lovell et al., 1984; Lewis et al., 1985) since hepatocytes containing ceroid pigments are phagocytized by Kupffer cells and macrophages, as it has been shown in liver of other animal species (Elleder et al., 1995; Terman and Brunk, 1998; Isobe et al., 2008). In sea bass, this process was not complete and ceroid pigments were directly found in the hepatocytes what could be related to a milder affection denoted by the low incidence, the appearance only in restricted areas of the liver and the lack of affection in other tissues. The presence of this pigment exclusively in the liver could be due to the active lipid metabolism and accumulation in this organ, which might motivate the lipid peroxidation and consequently the ceroid pigment deposition. Evolution of α-TOH content in sea bass body along larval development shows a steady increase from the first days of feeding until the end of metamorphosis (Guerriero et al., 2004), suggesting the high requirement of α-TOH during early development. In the present study, the best growth was performed by fish larvae fed diets containing 300 mg 100 g-1 DW α-TOH. Similarly, elevation of dietary α-TOH levels from 50 mg 100 g-1 to 300 mg 100 g-1 in microdiets, significantly improves growth of larval gilthead sea bream (Atalah et al., 2011). Growth improvement by dietary α-TOH elevation has been also found in juveniles of Atlantic salmon (Salmo salar) (Hamre et al., 1994) or rainbow trout (Onchorhynchus mykiss) (Cowey et al. 1984; Frischknecht et al., 1994). In juvenile gilthead sea bream, increase in α-TOH dietary contents improves growth particularly when oxidized oils are present in the diet (Tocher et al. 2003), associating once more the beneficial effect of α-TOH to their antioxidant properties. However, Puangkaew et al., (2005) noticed that in rainbow trout high doses of dietary α-TOH did not promote growth, denoting the interaction between dietary n3 LC-PUFA and α-TOH. In this sense, in the present study, sea bass larvae fed diets containing 300 mg 100 g-1 α-TOH showed a significant improvement in growth when dietary DHA was raised from 1 to 3 %. DHA is an essential fatty acid for fish growth (Watanabe et al., 1989; Watanabe, 1993; Izquierdo, 1996), as it is incorporated in cell membrane regulating membrane integrity and function (Izquierdo, 2005). Nevertheless, the positive effect of α-TOH on fish growth is not only related to its antioxidant properties, but also to other functions of this molecule in cellular metabolism, signal transduction (Traber and Parker, 1995) or modulation of eicosanoid synthesis (Cornwell and Parganamala, 1993). Vitamin E/DHA imbalances in sea bas larvae 94 Finally, sea bass fed high α-TOH also showed a significantly improved stress resistance. In gilthead sea bream, increase in α-TOH enhanced resistance to both chronic and acute stress (Montero et al., 2001), the fish fed higher α-TOH showing lower post-stress plasma cortisol levels (Montero et al., 1998). The addition of dietary α-TOH has been also shown to increase stress resistance in mammals as showed by the decrease in plasma corticosteroids (Watson and Petro, 1982; Mudron et al., 1996). In summary, elevation of dietary DHA increased DHA deposition in sea bass tissues increasing peroxidation risks and causing increased mortalities and incidence of muscular and hepatic lesions. However, increase in dietary α-TOH markedly reduced the incidence of these symptoms in sea bass, protecting PUFA from oxidation and improving growth and survival after activity test. Elevation of dietary α-TOH levels up to 300 mg 100 g-1 significantly improved fish growth in terms of total length. Finally, sea bass fed high vitamin E also showed a significantly improved stress resistance. Chapter 4 Oxidative status and histological changes in sea bass larvae muscle in response to high dietary content of DHA This study is in press at Journal of Fish Diseases as Betancor et al. (2012) ABSTRACT In previous studies we observed dystrophic alterations in muscle of 48 day-old sea bass fed imbalanced DHA and vitamin E diets. In order to better understand the whole pathological process associated to oxidative stress, a deeper histological study was performed feeding 14 day-old sea bass larvae with microdiets containing different ratios of DHA/vitamin E (1/150, 5/150 and 5/300). Larvae fed diet 1/150 showed no lesions in contrast to larvae fed diet 5/150 and 5/300 where the highest incidence of muscle lesions and TBARS content was observed. Semithin sections showed focal lesions consisted of degenerated fibres with hypercontracted myofilaments and extensive sarcoplasm vacuolization affecting both red and white muscle. Ultrathin sections of these degenerating muscle fibres showed diffuse dilatation of sarcoplasmic reticulum, disorganized myofilaments and autophagic vacuoles eventually containing myelin figures and dense bodies. In addition, some monocyte - macrophage cells were observed among injured fibres as numerous satellite cells. The results of the present work reinforced the conclusions observed in our previous study and demonstrate the pathological potential of free radicals in sea bass larvae musculature, which could not be attenuated by dietary vitamin E. The implication of other nutrients related to cell protection against oxidative stress is being studied at present. Keywords: Sea bass larvae oxidative stress DHA muscle dystrophy ultrastructure High DHA alters sea bass larvae muscle 96 4.1 Introduction It is widely known that marine fish larvae have higher requirements of docosahexaenoic acid (DHA; 22:6n-3) than juveniles (LeMillinaire, 1984; HernándezCruz et al., 1999; Mourente et al., 1999a; Izquierdo, 2005) to reach a good culture performance in terms of growth and survival (Mourente et al., 1993; Brinkmeyer and Holt, 1998; Furuita et al., 1998; Copeman et al., 2002; Liu et al., 2002) and stress resistance (Watanabe and Kiron, 1994; Kanazawa, 1997). Moreover, these high requirements are reflected in the large larval DHA content, accounting for 30% of the total larval tissue fatty acid. Due to the high unsaturation of this fatty acid, it is very susceptible to lipid peroxidation. Thus, larval tissues may be more at risk of suffering peroxidative attack than adult tissues (Hamre et al., 2010). Lipid peroxidation may be initiated by any reactive oxygen species (ROS) that has sufficient reactivity to substract a hydrogen atom from a polyunsaturated fatty acid (PUFA) side chain in membrane lipids (Aruoma, 1998). ROS are continuously produced as byproducts of various metabolic pathways in all organisms. To counter its potentially deleterious effect an array of endogenous and exogenous antioxidant mechanisms has evolved (Yu, 1994). The endogenous antioxidants comprise of a series of enzyme scavengers of oxyradicals and other free radicals. Among exogenous antioxidants, vitamin E-type compounds may be widely regarded as primary lipidsoluble antioxidants (Wang and Quinn, 1999), as they are present among the lipid constituents of cell membranes and lipoproteins. These compounds are not produced by animals and must be obtained from the diet. It is therefore important to supplement marine fish larval diets with vitamin E (Hamre et al., 2010), as the requirement of this vitamin must increase in diets containing high concentrations of PUFA (Stéphan et al., 1995; Atalah et al., 2010). When an imbalance between the generation and removal of ROS by cellular defences occurs a status of oxidative stress takes place. This status may lead to the oxidation of various cellular constituents like lipids, proteins or DNA. Such condition may lead to acute cellular dysfunction, chronic tissue degeneration or even cell death if such changes accumulate (Rando, 2002). In fish some diseases have been related to free radical damage such as hemolysis (Kawatsu, 1969), anaemia (Cowey et al., 1984), jaundice (Sakai et al., 1989), liver degeneration (Cowey et al., 1984) or skeletal alterations (Watanabe et al., 1989; Lewis-McCrea and Lall, 2007). Among these skeletal alterations, one of the most described in fish juveniles and adults is muscular High DHA alters sea bass muscle 103 Table 4.3 Lipid levels (g kg-1) and main fatty acid compositions of total lipids from sea bass larvae fed experimental diets for 21 days (% total identified fatty acid) Each value represents mean ± SD (n=12). * P < 0.05, ** P < 0.005 versus larvae fed diet 1/150. Histopathological examination revealed segmental necrosis affecting the axial musculature in studied fish larvae (Figure 6.3). The earliest recognizable stage in necrosis was the swelling of affected muscle fibres, which stood up in sharp contrast to the adjacent fibres that were often displaced by pressure (Figure 6.3A). In addition, affected fibres showed typical features of hyaline degeneration as marked eosinophilia, loss of striations and marked oedema (Figure 4.3, A and C). Necrotic fibres were phagocytized by macrophages (Figure 4.3, B and D) which first appeared at the periphery of affected fibres. The incidence of these muscular lesions at the end of the experimental period was higher in those dietary treatments containing 5% of DHA, whereas no lesions were found in larvae fed 1% of DHA (Figure 4.4). The increase in vitamin E content from 150 to 300 mg did not reduce the incidence of muscle injuries, Initial 1/150 5/150 5/300 Total lipids (g kg-1) 287±0.0 188±1.7 170±1.9 168±2.1 14:0 1.1±0.0 0.5±0.1 0.5±0.1 0.5±0.0 15:0 0.2±0.1 0.5±0.3 0.4±0.2 0.4±0.2 16:0 16.4±3.3 14.4±1.2 15.6±3.7 13.8±0.4 16:1n-7 9.7±1.7 0.7±0.2 0.8±0.1 1.6±0.4 16:1n-5 0.5±0.0 0.2±0.1 0.2±0.0 0.3±0.0 16:2n-6 0.9±0.1 0.3±0.0 0.4±0.0 0.4±0.0 16:2n-4 0.9±0.0 0.5±0.1 0.7±0.2 0.7±0.0 17:0 1.0±0.0 0.2±0.0 0.3±0.0 0.3±0.0 16:4n-3 0.4±0.1 0.5±0.1 0.4±0.0 0.5±0.1 16:4n-1 0.2±0.0 0.6±0.1 0.2±0.0 0.3±0.1 18:0 7.4±0.8 8.7±0.5 9.8±2.5 8.2±0.2 18:1n-9 16.1±2.1 26.1±2.3a 17.4±1.1ab 16.2±0.1b 18:1n-7 6.3±0.4 2.1±0.3 2.0±0.4 2.3±0.2 18:1n-5 0.6±0.1 0.2±0.0 0.2±0.1 0.2±0.0 18:2n-6 3.7±1.1 7.8±1.2 5.0±0.0 4.9±0.2 18:3n-3 0.8±0.1 0.3±0.1 0.4±0.0 0.4±0.1 20:0 0.2±0.1 0.3±0.0 0.6±0.2 0.4±0.0 20:1n-9 2.0±0.3 2.3±0.2 2.4±0.2 2.2±0.1 20:1n-5 0.5±0.2 0.1±0.0 0.2±0.0 0.2±0.0 20:2n-6 0.7±0.5 0.9±0.1 1.0±0.1 1.0±0.1 20:4n-6 3.3±0.7 2.8±0.1 3.3±0.1* 3.4±0.1* 20:5n-3 7.6±0.3 9.5±0.6 6.3±1.4** 7.4±0.4* 22:1n-9 0.3±0.0 0.3±0.0 0.4±0.1 0.6±0.0 22:5n-6 0.6±0.2 0.4±0.1 1.2±0.2 1.3±0.0 22:5n-3 1.6±0.2 1.3±0.1 0.8±0.2 1.0±0.0 22:6n-3 14.2±4.2 16.8±3.0 27.2±7.5 29.4±2.7** Saturated 26.2±3.3 24.6±2.2 27.2±4.8** 23.7±0.4* Monoenoics 36.6±2.7 32.0±3.2 20.7±2.3 24.0±0.9 n-3 FA 25.4±3.4 28.4±3.7 35.8±8.7* 39.1±2.0* n-6 FA 9.7±1.1 4.5±0.2 5.8±0.1 6.6±0.6 n-3 LC-PUFA 23.7±2.1 27.7±3.6 34.5±6.5* 38.1±2.1** n-3/n-6 2.6±0.7 6.4±0.8 6.2±0.9 5.9±0.8 High DHA alters sea bass larvae muscle 104 with muscular lesions increased through the experimental period. Moreover, a positive correlation was found at the end of the feeding trial between the TBARS content and the incidence of muscular lesions (y = 0.0408 – 4.781; R2 = 0.9122). Figure 4.1 Total length of sea bass larvae (35 dph) following 21 days of feeding the experimental diets containing different DHA and vitamin E contents. Each value represents mean ± SD (n=120). Figure 4.2 TBARS content in sea bass larvae larvae (35 dph) following 21 days of feeding the experimental diets containing different DHA and vitamin E contents. Each value represents mean ± SD (n=12). 0 100 200 300 400 500 600 700 800 Initial 1/150 5/150 5/300 nM MDA g tissue-1 MDA b ab a 0 2 4 6 8 10 12 1/150 5/150 5/300 mm Total lenght a a b High DHA alters sea bass muscle 105 More detailed features of these lesions could be observed in thick sections (Figure 4.5). Although not all muscle fibres were affected, both the red and white muscle were involved. A marked oedema was observed between muscular fibres, observing the loss of the normal myotome architecture (Figure 4.5, A and B). Transversal sections showed a great variation in the size of individual fibres, some of which presented a dark cytoplasm most probably related to myofilament concentration. Necrotic fibres showed protein coagulation in their sarcoplasm as well as irregular staining (Figure 4.5, C). Additionally, clear vacuoles could be observed inside some muscular fibres that apparently did not show any other alteration (Figure 4.5, A and B). Figure 4.3. Muscular lesions found in sea bass larvae fed diets 5/150 and 5/300 at 35 dph, longitudinal sections, haematoxylin and eosin staining. (A) Swollen portion of a muscular fibre (*), partially fragmented showing eosinophilic cytoplasm and the presence of some macrophages (arrow). (B) Muscular debris (arrow) surrounded by a severe inflammatory infiltrate (*) undergoing phagocytic removal. (C) More detailed feature of necrotic fibre showed in Figure 3A where presence of flocculated cytoplasm and partial fragmentation (arrow) can be appreciated. A marked oedema can be appreciated (arrowhead). (D) Macrophages aggregate (*) phagocytosing necrotic muscle fibre. SK, skin; NT, notochord. High DHA alters sea bass larvae muscle 106 Figure 4.4 Incidence of muscular lesions (%) after 3 weeks of feeding the experimental diets. Each value represents mean ± SD (n=120). Figure 4.5 Sea bass larvae fed diets 5/150 and 5/300 transversal thick sections, toluidine blue staining. (A and B) We can observe loss of regular architecture and oedema (arrow) between red (RF) and white fibres (WF), vacuoles (V) inside affected muscle fibres and swollen cells (*).(C and D) More detailed features of necrotic fibres are showed, observing the irregular staining of the sarcoplasm due to the presence of hypercontraction bands (arrow). 0 5 10 15 20 25 30 1/150 5/150 5/300 % Incidence of muscular lesions b a a High DHA alters sea bass muscle 107 Figure 4.6 Electro micrographs of 35 dph sea bass larvae fed diets 5/150 and 5/300. (A) Different size between muscle fibres is evident, as well as the lost of continuity between them. Dilatation of sarcoplasmic reticulum (*) is observed, leading to the formation of vacuoles (v) within sarcoplasm. As well, two macrophages cells are present (m). (B and C) Detail of macrophages attached to different muscle fibres. High DHA alters sea bass larvae muscle 108 Figure 4.7 (A) Normal (MF) and disorganized (disMF) myofilaments inside a mildly affected muscle fibre. (B) Presence of a sarcoplasmic halo in the periphery of the fibre which was almost completely devoid of myofibrils and mitochondria. Sections examined at TEM level revealed irregular size and shape of fibres and loss of continuity between them (Figure 4.6, A). It seems that one of the first alterations would be the swelling of organelles, such as sarcoplasmic reticulum (Figure 4.6, A). This change could lead to the rupture of the cisternae of endoplasmic reticulum and the formation of large translucent vacuoles within the sarcoplasm (Figure 4.6, A). This series of alterations is defined as hydropic degeneration. Macrophages containing cellular debris and numerous lysosomes were observed in severely affected fibres (Figure 4.6, A). Some fibres presented disarrangement of the myofilaments (Figure 4.6, B) as well as sarcoplasmic “halos” devoid of myofibrils and mitochondria (Figure 4.6, C). Autophagic vacuoles were frequently noticed inside affected fibres (Figure 4.7, A) just like numerous myelin figures (Figure 4.7, B and C), as a result of intracellular lipid peroxidation. Fragmentation of affected fibres was observed with subsequent degeneration of the fragments and disintegration of myofilaments (Figure 4.7, B and C). Finally, frequent satellite cells were observed in sea bass larvae fed diet 5/300 (Figure 4.7, D). No morphological signs of apoptosis were observed. High DHA alters sea bass muscle 109 Figure 4.8 Electron micrographs of transversal (A and D) and longitudinal (B and C) sections of sea bass larvae fed diets 5/150 and 5/300. (A) Affected fibre presenting an autophagic vacuole (av) within its sarcoplasm, adjacent to the nucleus (N). (B) Presence of numerous myelin figures (arrow) in a degenerated muscular fibre. (C) Fragmentation of an affected muscle fibre (arrow) surrounded by myelin figures. (D) Presence of muscular satellite cells (S) between muscle fibres. High DHA alters sea bass larvae muscle 110 4.4 Discussion The results of this study determine the muscle response to high levels of dietary DHA. As expected, the different dietary fatty acid compositions were reflected in the fatty acid compositions of larval tissues. Thus, diets high in DHA resulted in increased levels of n-3 LC-PUFA, particularly DHA, whereas diets with a low DHA inclusion resulted in high larval contents of oleic acid. Therefore, the potential for lipid peroxidation was theoretically higher in larvae fed diets containing 5% of DHA due to its high unsaturation. Oxidation products may potentially lead to suppressed growth (Hung et al., 1981; Murai et al., 1988; Koshio et al., 1994; Baker and Davies, 1997; Fontagné, et al., 2006). Thus, growth in 5/150 larvae which did not significantly differ from that of 1/150 larvae could have been suppressed by oxidation products. However, elevation in vitamin E in 5/300 larvae, despite not completely preventing oxidation, lead to a significantly higher n-3 LC-PUFA content in larval tissues and allowed for growth promotion. Similarly, in juvenile gilthead sea bream, an increase in vitamin E dietary content improves growth particularly when oxidized oils are present in the diet (Tocher et al., 2003), further demonstrating the beneficial effect of vitamin E to their antioxidant properties. In this sense the inclusion of high levels of vitamin E (300mg/100g) in sea bream, Sparus aurata, larval microdiets improved larvae performance in terms of growth and survival, especially when supplemented with vitamin C (Atalah et al., 2010). TBARS were significantly influenced by dietary DHA levels, being significantly increased in sea bass larvae fed the highest dietary DHA content, irrespective of vitamin E content suggesting its ineffective protective role against oxidation. Moreover, TBARS values obtained in the present work are quite elevated compared to other studies in sea bass adults and juveniles exposed to different pollutants (Passi et al., 2004; Almeida et al., 2010). The fact that TBARS values were higher in the present study could be due to the poor activity of the antioxidant system in fish larvae. Mourente et al. (1999b) for example, found a decrease in TBARS values during early Dentex dentex development probably due to an enhancement of the antioxidant systems or an increased excretion rate. A reduction in TBARS value could be expected when vitamin E contents are increased in diets containing high DHA levels (Stéphan et al., 1995). However, there are several other antioxidants involved that could contribute to reduce aldehyde production in fish (Bell and Cowey, 1985; Nakano et al., 1999; Hidalgo et al., 2002). High DHA alters sea bass muscle 111 In mammals, many studies have focused on the relation between oxidative stress and cell damage (Kannan and Jain, 2000; Kowaltowski et al., 2001; Lin and Beal, 2006), particularly aging and neurodegenerative diseases, although the effects of free radicals on muscular cells are not well studied. However, some studies have focussed on the potential role of free radicals in genetic muscular dystrophies (Rando, 2002). For example, it has been observed that vitamin E deficiency in animals leads to muscle degeneration with pathologic characteristics very similar to those of muscular dystrophies (Kakulas and Adams, 1966; Hadlow, 1973; Bradley and Fell, 1980). Many of the typical pathological features of genetic muscle disorders, such as peripheric sarcoplasmic halos (Farkas et al., 1974), have been observed in sea bass larvae muscle, supporting the idea that the mechanism of muscle injury is the same as in mammalian genetic muscular dystrophies. Lesions observed by optical microscopy are similar to those found in our previous work (Chapter 3), corroborating the pathological effect of excess dietary DHA in the appearance of muscular lesions. Moreover, the increase in dietary levels of vitamin E reduced the incidence of these muscular lesions (Chapter 3). However, this beneficial effect of vitamin E was not observed in the present study when 5% of DHA was included in the diet, suggesting that the addition of vitamin E alone as an antioxidant is not enough to control lipid peroxidation when high levels of DHA are included in fish larvae diets. For example, it has been well studied that vitamin E has a sparing effect by dietary vitamin C in fish (Hamre et al., 1997; Shiau and Hsu, 2002; Lee and Dabrowsky, 2003) or how α-tocopherol and selenium seem to interact synergistically (Poston et al., 1976; Bell and Cowey, 1985). On thick sections, hypercontracted myofilaments could be observed, probably due to the attack of free radicals on muscle proteins. Although red fibres were affected, the highest incidence of alterations was found in white fibres. It has been hypothesized that muscle fibres that are minimally affected or unaffected by the disease process may have enhanced antioxidant defences as the basis for this protection (Rando, 2002). In humans, a selective involvement of type II fibres over type I fibres has been observed in vitamin E deficiency myopathy (Lazaro et al., 1986; Tomasi, 1979). Although it could be assumed, a priori, that red fibres would be more affected by disorders of oxidative stress due to their metabolism being primarily oxidative, it does not take into account potential differences between red and white fibres in free radical scavenging capacity and their oxidative repair mechanisms, as happens in humans (Salminen and Vihko, High DHA alters sea bass larvae muscle 112 1983; Asayama et al., 1986). Thus, although red fibres may generate lower levels of reactive oxygen species during normal metabolism, white fibres may be more susceptible to an increase in oxidative stress as they have less robust antioxidant defences. Ultrastructurally, one of the first changes observed in sea bass larvae muscle was the presence of large translucent vacuoles within the sarcoplasm, defined as hydropic degeneration, which is caused by the distension of the sarcoplasmic reticulum. These non-lethal lesions are related to adaptative cellular changes but, if continued in time could cause cellular lysis (Cotran et al., 2004). The appearance of these vacuoes is due to the failure of ion pumps and Na+ and water influx to the endoplasmic reticulum, causing the alteration of this structure and the subsequent formation of vacuoles. This kind of alteration is a common response to free radical injury (Cotran et al., 2004). Another cellular change observed was the presence of autophagic vacuoles containing cellular debris found in the intermyofibrillar spaces and sarcoplam throughout affected muscle fibres. Autophagic vacuoles are considered to be secondary lysosomes and are a frequent feature in numerous mammalian neuromuscular disorders, forming an emerging new group of conditions called autophagic vacuolar diseases (Nishino, 2006). In the tropical fish Colossoma macropomum, autophagic vacuoles have been described in skeletal muscle after treatment with 2-chloro-4,6-bis-ethylamine-s-tryazine, a drug employed for the control of aquatic weeds in fish cultivation ponds (Medina et al., 2000). This chemical drug produces skeletal muscle alterations, describing the pathology as a neurogenic atrophy because of the changes in motor nerve and end – plates. Medina et al. (2000) also described the finding of myelin figures that represent endogenous material produced by intracellular lipid peroxidation in mammals (DeGritz et al., 1994). Numerous macrophages were observed around affected fibres ready to phagocytate cellular debris. Tissue injury can itself cause ROS generation by the activation of phagocytes, which may contribute a worsening effect on the injury (Aruoma, 1998). These cells contribute to oxidative stress in large part because they contain the potent NADPH oxidase system. Once activated the NADPH system produces large amounts of superoxide (Finkel and Holbrook, 2000). The increase in the number of satellite cells is a common finding in several kind of genetics muscle dystrophies. These undifferentiated muscle precursor cells are stem cells located between the plasmalemma and basal lamina of the skeletal muscle fibre Selenium in high DHA microdiets for sea bass 120 until complete solvent evaporation. EPA500 and DHA500 were added in different quantities to the defatted meal (2.4% lipid content) to obtain the desired ratios. Oleic acid (Merck, Darmstadt, Germany) was added to equalize the lipid content in each diet (Table 5.1) and soy bean lecithin (Acrofarma, Barcelona, Spain) was included as a source of phospholipids (Table 5.1). The microdiets were processed as previously described (Liu et al. 2002). Briefly, the squid powder and water soluble components were mixed, followed by the lipid and fat soluble vitamins and, before adding gelatine (Panreac, Barcelona, Spain) dissolved in warm water, as a binder. The paste was pelleted and oven dried at 38ºC for 24 h. Pellets were ground and sieved to obtain particles size below 250 µm. To avoid peroxidation, diets were stored under nitrogen at -20ºC until use. Diets were analyzed for proximate and fatty acid composition on a dry basis and manually supplied; fourteen times per day at 45 min intervals from 9:00-19:00. Daily feed supplied was 2, 2.5 and 3 g/tank during the first, second and third week of feeding respectively. 5.2.3 Growth and survival Final survival was determined by counting live larvae at the beginning, middle and end of the experiment. Growth was determined by measuring dry body weight (105ºC for 24 hours) and total length (Profile Projector V-12A Tokyo, Nikon) of 30 fish tank-1 at the beginning, middle and at the end of the trial. 5.2.4 Biochemical analysis All remaining larvae in each tank were washed with distilled water, sampled and kept at -80ºC for biochemical composition, TBARS, selenium and vitamin E analysis after 12 hours of starvation at the end of the trial. Moisture (A.O.A.C., 1995), protein (A.O.A.C., 1995) and lipid (Folch et al., 1957) contents of larvae and diets were analyzed. 5.2.4.1 Total lipid fatty acid analysis Fatty acid methyl esters (FAMEs) were obtained by transmethylation of total lipids as described by Christie (1982). FAMEs were separated by GLC, quantified by FID (GC - 14A, Shimadzu, Tokyo, Japan) under the conditions described in Izquierdo et al. (1992) and identified by comparison to previously characterized standards and GLC-MS. Selenium in high DHA microdiets for sea bass 121 5.2.4.2 Determination of vitamin E content Vitamin E concentrations were determined in diets and total larvae using HPLC at the University of Stirling (Scotland, UK). Samples were weighed, homogenised in pyrogallol and saponified as described by McMurray et al. (1980) for diets or according to Cowey et al. (1981) for larval tissues. HPLC analysis was performed using 150 x 4.60 mm reverse phase Luna 5µm C18 column (Phenomenox, California, USA). The mobile phase was 98% methanol supplied at a flow rate of 1.0 ml min-1, the effluent from the column was monitored at a wavelength of 293 nm and quantification achieved by comparison with (+)-α-tocopherol (Poole, UK) as external standard. 5.2.4.3 Selenium determination Total selenium concentration was measured in total larvae and diets. Samples were acidified in a microwave digestor (MarsXpress, CEM, Kamp-Lintfort, Germany) with 5 ml of 69% pure nitric acid, then poured after digestion into a 10 ml volumetric flask and made up to volume with distilled water. A total of 0.4 ml of this solution was then added to a 10 ml sample tube, 10 µl of the internal standard (Ga and Sc, 10 ppm) included and 0.3 ml of methanol added. The tubes were made up to volume with distilled water and total selenium measured by collision/reaction by ICP-MS (Thermo Scientific, Cheshire, UK) using argon and hydrogen as carrier gas. 5.2.4.4 Measurement of thiobarbituric acid reactive substances (TBARS) TBARS from triplicate samples were determined using a method adapted from that used of Burk et al. (1980). Approximately 20-30 mg of larval tissue per sample were homogenized in 1.5 ml of 20% trichloroacetic acid (w/v) containing 0.05 ml of 1% BHT in methanol. To this 2.95 ml of freshly prepared 50mM thiobarbituric acid solution was added before mixing and heating for 10 minutes at 100ºC. After cooling protein precipitates were removed by centrifugation (Sigma 4K15, Osterode am Harz, Germany) at 2000 x g, the supernatant was read in a spectrophotometer (Evolution 300, Thermo Scientific, Cheshire, UK) at 532 nm. The absorbance was recorded against a blank at the same wavelength. The concentration of TBA-malondialdehyde (MDA) expressed as µmol MDA per g of tissue was calculated using the extinction coefficient 0.156 µM-1 cm-1. Selenium in high DHA microdiets for sea bass 122 5.2.5 Histopathological sampling 5.2.5.1 Paraffin inclusion Thirty larvae from every tank were collected each seven days from the beginning of the feeding trial, and fixed in 10% buffered formalin for 1 or 2 days, dehydrated through graded alcohols, then xylene and finally embedded in paraffin wax. Six paraffin blocks containing 5 larvae per tank were sectioned at 3 µm, and stained with Haematoxilin and Eosin (H&E) for histopathological evaluation (Martoja and MartojaPearson, 1970). 5.2.5.2 Resin inclusion Ten larvae per tank were fixed for 24 hours at 4º in 2.5% glutaraldehyde in 0.2 M phosphate buffer (pH 7.2). Samples were then rinsed in phosphate buffer and post-fixed for 1 hour in 2% osmium tetraoxide in 0.2 M potassium ferrocyanide. Each larva was then embedded in an Eppon/Araldite resin block. Serial transverse and longitudinal larvae thick sections were cut at 2 µm, stained with toluidine blue and examined under light microscopy (Hoffman et al., 1983). Thin sections were cut at 50 nm and stained with lead citrate before observing with a ZEISS EM 910 transmission electron microscope (Germany) at the Electron Microscope Service of the University of Las Palmas de Gran Canaria. 5.2.5.3 Whole mount staining Besides, one hundred larvae from each tank at 35 dph were fixed in 10% buffered formalin in order to perform deformities analysis. Prior to staining, larvae were measured under a Profile Projector (Mitutoyo, PJ 3000, Japan) and divided in three size classes (< 10.0 mm, 10.0-12.0 mm and >12.0 mm) and therefore stained with Alizarin red following Vandewalle et al. (1998) to demonstrate bone. Larvae from the different experimental group were stained simultaneously in order to prevent any technical variability. Deformities were classified in three different groups according to their localization: cranial deformities, lordosis, kyphosis and others, including deformities such as lordosis, vertebral compression or neural processes alterations. The surface corresponding to bone in whole coloured larvae was visualized and quantified using a computerized image analysis package (Image-Pro Plus®, Media Cybernetics, Maryland, USA). Selecting Selenium in high DHA microdiets for sea bass 123 ranges of pixel values in colour images allowed the pixels associated with red to be distinguished. The number of selected pixels was then quantified using a particle analysis operation and by counting the area of all bright objects (in pixels). Larval size was estimated by calculating the surface areas (in pixels) covered by whole stained larvae. 5.2.6 RNA extraction and quantitative RT-PCR Molecular biology analysis was carried out at the University of Insubria (Varese, Italy). Total RNA was extracted from sea bass larvae (≈200 mg; pool per tank), using PureYield RNA Midiprep System (Promega, Italy). The quantity and purity of RNA was assessed by spectrophotometer. Visualization on 1% agarose gel stained with ethidium bromide showed that RNA was not degraded. After DNAse treatment (Invitrogen, Milan, Italy), 3 μg of total RNA was reverse transcribed into complementary DNA (cDNA) in a volume of 12 μl, including 1 μl of oligo dT16 primer (50 pmol) and 1 μl of 10 mM deoxynucleotide triphosphates (dNTPS). This mix was heated at 65ºC for 5 minutes, chilled on ice and then 4 μl of 5X reverse transcription buffer, 2 μl 0.1M DTT, 1 μl RNAse out and 1 μl of Moloney murine leukemia virus (M-MLVRT) was added. After incubation at 37ºC for 50 minutes, the reaction was stopped by heating at 75ºC for 15 minutes. PCR primer sequences used for the PCR amplification of the cDNAs of target genes were CAT, SOD, GPX, IGF-I, IGF-II and MyHC. To perform PCR, a 4 µl aliquot of cDNA was amplified using 25 µl GoTaq Green Master Mix (Promega, Italy) in 50 µl of final volume and 50 pmol of each designed primer. A total of 31 PCR amplification cycles (eight touchdown) were performed for all primer sets, using an automated Thermal Cycler (MyCycler, BioRad, Italy). An aliquot of each sample was then subjected to electrophoresis on a 1% agarose gel in 1X TAE buffer (Bio-Rad, Italy) and bands were detected by ethidium bromide staining. Samples were run with a 100 bp-1.5 kb DNA Ladder to control the molecular weight of DNA. The negative control (a reaction mixture without cDNA) confirmed the absence of genomic contamination. The PCR products from each primer set amplification were cloned using pGEM®-T easy vector (Promega, Italy) and subsequently sequenced in both directions (T7 and SP6). Selenium in high DHA microdiets for sea bass 124 TaqMan® real time reverse transcription PCR was performed on a StepOne Real Time PCR System (Applied Biosystems, Italy) using Assays-by-DesignSM PCR primers (Applied Byosystems) and gene-specific fluorogenic probes. Primer sequences and TaqMan® probes of target genes were as follows: Target gene: Sea bass CAT Forward primer: 5’- ATGGTGTGGGACTTCTGGAG - 3’ Reverse primer: 5’- GCTGAACAAGAAAGACACCTGATG - 3’ TaqMan® probe. 5’- CAGACACTCAGGCCTCA - 3’ Target gene: Sea bass SOD Forward primer: 5’- TGGAGACCTGGGAGATGTAACTG - 3’ Reverse primer: 5’- TCTTGTCCGTGATGTCGATCTTG - 3’ TaqMan® probe. 5’- CAGGAGGAGATAACATTG - 3’ Target gene: Sea bass GPX Forward primer: 5’- AGTTAATCCGGAATTCGTGAG - 3’ Reverse primer: 5’- AGCTTAGCTGTCAGGTCGTAAAAC - 3’ TaqMan® probe. 5’- AATGGCTGGAAACGTG - 3’ Target gene: Sea bass IGF-I Forward primer: 5’- GCAGTTTGTGTGTGGAGAGAGA3’ Reverse primer: 5’- GACCGCCGTGCATTGG - 3’ TaqMan® probe. 5’- CTGTAGGTTTACTGAAATAAAA - 3’ Target gene: Sea bass IGF-II Forward primer: 5’- TGCAGAGACGCTGTGTGG - 3’ Reverse primer: 5’- GCCTA CTGAAATAGAAGCCTCTGT - 3’ TaqMan® probe. 5’- CAAACTGCAGCGCATCC - 3’ Selenium in high DHA microdiets for sea bass 125 Target gene: Sea bass MyHC Forward primer: 5’- TGGAGAAGATGTGCCGTACTCT - 3’ Reverse primer: 5’- CGTGTCATTGATTTGACGGACATTT - 3’ TaqMan® probe. 5’- AACTGAGTGAACTGAAGACC - 3’ Data from TaqMan® PCR runs were collected using ABI´s Sequence Detector Program. Cycle threshold (Ct) values corresponded to the number of cycles at which the fluorescence emission monitored in real time exceeded the threshold limit. The Ct values were used to create standard curves to serve as a basis for calculating the absolute amounts of mRNA in total RNA. To reduce pipetting errors, master mixes were prepared to set up duplicate reactions (2 x 30 μl) for each sample. 5.2.7 Calculations Larval survival was determined by comparing the number of larvae at the beginning of the trial with the larvae number measured in individual tanks at 35 dph to which the average number of larvae sampled from tanks during the trial was added. Percentage survival could then be calculated for each tank to get a mean and SD per treatment. The incidence of muscular lesions was calculated as the percentage of injured larvae per tank compared to the total larvae observed, with SD refering to deviation among tanks. Specific growth rate (SGR) was calculated as: SGR = [(lnW1-lnW0)]*100/t2-t1 Where W0 and W1 are the initial and final dry weights (tank means) respectively, and t2-t1 is the time interval in days between the beginning and end of the experimental trial (21 days). 5.2.8 Statistical analysis Survival, growth and molecular biology data were tested for normality and homogeneity of variances with Levene´s test. Where necessary data were log Selenium in high DHA microdiets for sea bass 126 transformed before further statistical analysis. Chi-squared test was employed for incidence of muscular lesions and TBARS content. Survival, growth and biochemical analysis data were treated using one-way ANOVA and molecular biology results were treated using a general linear model (GLM). Means were compared by Duncan’s test. Results are presented as means and standard deviation. The tank was considered as the experimental unit, except for the estimation of the incidence of muscular lesions, where each individual larvae was considered as a unit. For percentage data (final survival), arcsine transformation was performed before analysis. For analysis of one-way ANOVA the following general linear model was used: Yij = µ + α i + ε ijk where Yijk is the mean value of the tank, µ is the mean population, αi is the fixed effect of the diet and ε ij is the residual error. For analysis of molecular biology data a two variables GLM was employed to analyze possible interactions between treatment and time: Yijk = µ + α i + δ j + ( αδ )ij + ε ijk Where Yij is the mean value of the tank, µ is the mean population, α i is the fixed effect of the diet, δ j is the fixed effect of the time, ( αδ )ij is the interaction between diet and time and eij is the residual error. Significance was accepted at P≤0.05. Statistical analysis was performed using SPSS software (SPSS for Windows 14.0; SPSS Inc., Chicago, IL, USA, 2005). 6.3 Results Diet containing about 1% DHA (1/150) showed a higher monoenoic fatty acid level than diets containing 5% DHA (5/300, 5/300+Se) due to a higher oleic acid content in the former diet (Table 5.2). Elevation of dietary DHA (5/300 diets) increased n-3 and n-3 LCPUFA fatty acids contents, as well as n-3/n-6 ratio. Vitamin E levels were more than 2 times higher in diets containing 300 mg 100g-1 compared to the control diet (1/150) (Table 5.3). Selenium contents differed among dietary treatments, with a higher level of this mineral found in the diet supplemented with selenium as compared to others (Table 5.3). Selenium in high DHA microdiets for sea bass 127 Table 5.2 Main fatty acids (% total identified fatty acids) of the experimental diets fed to European sea bass for three weeks. Diet 1/150 5/300 5/300+Se 14:0 1.54 1.26 0.78 14:1n-7 0.15 0.25 0.06 14:1n-5 0.22 0.35 0.09 15:0 0.28 0.43 0.15 15:1n-5 0.02 0.14 n.d. 16:0ISO 0.14 0.23 0.07 16:0 7.86 5.59 5.15 16:1n-7 3.59 2.26 2.00 16:1n-5 0.19 0.23 0.11 16:2n-4 0.32 0.39 0.25 17:0 1.21 0.82 0.65 16:3n-3 0.08 0.12 0.07 16:4n-3 0.09 0.13 0.10 18:0 1.29 2.29 2.21 18:1n-9+n-7 55.70 31.12 29.67 18:1n-5 0.72 0.46 0.45 18:2n-9 0.25 0.13 0.12 18:2n-6 7.40 6.99 6.87 18:2n-4 0.46 0.28 0.26 18:3n-6 0.11 0.11 0.10 18:3n-4 0.13 0.10 0.09 18:3n-3 0.72 0.83 0.82 18:4n-3 0.83 0.94 1.00 18:4n-1 0.08 0.08 0.09 20:0 0.10 0.31 0.29 20:1n-9+n-7 1.10 1.53 1.45 20:1n-5 0.05 0.12 0.11 20:2n-9 0.05 0.04 0.02 20:2n-6 0.09 0.21 0.21 20:3n-6 0.09 0.13 0.13 20:4n-6 0.71 1.57 1.50 20:3n-3 0.07 0.18 0.16 20:4n-3 0.32 0.52 0.55 20:5n-3 8.66 11.04 12.20 22:1n-11 0.17 0.51 0.50 22:1n-9 0.08 0.25 0.25 22:4n-6 0.02 0.19 0.20 22:5n-6 0.19 1.75 1.78 22:5n-3 0.32 1.29 1.43 22:6n-3 4.58 24.55 27.95 Saturated 12.28 10.70 9.22 Monoenoics 61.99 37.23 34.69 n-3 15.68 39.61 44.27 n-6 8.61 11.14 10.85 n-9 57.19 33.10 31.54 n-3 LC-PUFA 13.96 37.58 42.28 n-3/n-6 1.82 3.56 4.08 Selenium in high DHA microdiets for sea bass 128 All experimental diets were well accepted by the larvae. Dietary increase of vitamin E or Se did not significantly affect larval survival (P= 0.158; Table 5.4). The highest larval growth, in terms of total length, was found in larvae fed the positive control diet containing the lowest vitamin E and DHA contents (1/150). However, increases in vitamin E and DHA (diet 5/300) significantly reduced larval growth (P= 0.001), whereas Se inclusion (diet 5/300+Se) significantly increased this parameter (P=0.02 Table 5.4). The average SGR was higher (P=0.024) in larvae fed the 1/150 diet, although no differences were found with larvae fed 5/300+Se. In terms of fatty acid composition, larvae fed 5/300 diets resulted in higher concentration of n-3 and n-3 LC-PUFA, reflecting the higher content of these components in the diets (Table 5.5). However, larvae fed diet 1/150 showed a higher retention rate of DHA (279.26%) and EPA (68.24%) compared to larvae fed 5/300 (73.48 and 43.93% respectively) and 5/300+Se diets (77.00 and 44.75% respectively) and also a higher content of 18:1n-9, displaying levels similar to those found in the former microdiet. In contrast, 5/300 larvae showed a higher retention rate of arachidonic acid (around 50%) compared to 1/150 larvae (29.83%). The level of lipid oxidation, as indicated by MDA content (µmol g-1 larval tissues) was significantly higher (P=0.001) in larvae fed diets with the highest DHA content. Nevertheless, the inclusion of selenium showed a beneficial effect preventing the formation of hydroperoxides, as denoted by the decrease in MDA levels (Table 5.4). The lowest peroxidation level was observed in larvae fed diet 1/150. Despite the increase in dietary α-tocopherol in diets 5/300 and 5/300+Se, the content of this nutrient in larvae did not significantly increase in comparison to larvae fed diet 1/150 (P=0.601; Table 5.4). Therefore, the retention rate of dietary vitamin E in larvae fed 5/300 (17.87%) and 5/300+Se (17.38%) diets was lower than 1/150 larvae (44.68%). Sea bass larvae fed diets supplemented with selenium showed a significantly higher (P=0.001) content of this mineral compared to other larvae, this level being 1.7 times higher than the larvae fed 1/150 diet and 2.4 times higher than the 5/300 larvae (Table 5.4). Thus, although Se contents in diets 1/150 and 5/300 were similar, larvae fed the latter diet showed lower Se levels together with the highest TBARS value. Selenium in high DHA microdiets for sea bass 129 Table 5.3 Gross composition, α-tocopherol and selenium content in experimental diets fed to sea bass larvae. Data are means ± SD Histopathological examinations revealed the presence of lesions affecting larvae axial musculature. These lesions showed the typical features of necrotic degeneration of muscle, characterized by marked eosinophilia, loss of striations and adjacent nucleous. The incidence of muscular lesions increased with an increase in DHA dietary content (Table 5.4). However, inclusion of Se was shown to reduce this incidence to almost half. Table 5.4 Sea bass larvae performance and levels of lipid peroxidation products (TBARS), vitamin E (α-tocopherol) and selenium content of sea bass larvae at the beginning and after eating the experimental diets Data are means ± SD Diets 1/150 5/300 5/300+Se Protein (%) 66.79±0.52 67.77±0.09 66.24±0.36 Ash (%) 4.49±0.11 4.76±0.12 4.87±0.13 Moisture (%) 10.31±0.46 9.99±0.28 9.09±0.27 Lipids (% DW) 14.98±0.31 15.80±0.02 15.97±0.05 α-tocopherol (µg/g DW) 1410.12±38.77 3033.01±43.33 3217.37±14.45 Selenium (µg/mg) 1.54±0.12 1.33±0.26 6.27±0.26 Diets Initial 1/150 5/300 5/300+Se Results of dietary trial Larval total length (mm) 8.58 ± 0.64 12.60 ± 0.93a 10.89 ± 1.24c 11.35 ± 1.29b Larval dry weight (mg) 0.36 ± 0.00 1.46 ± 0.47 0.94 ± 0.05 1.08 ± 0.10 Survival (%) - 60.51 ± 9.10 48.42 ± 4.00 49.03 ± 8.02 Incidence muscular lesions (%) - 17.5 ± 14.14 b 52.63 ± 15.93 a 27.6 ± 6.94 ab Vitamin E (α-tocopherol) µg g dry mass-1 111.45±43.26 630.24±12.39 542.10±80.51 559.23±88.58 TBARS nMol g dry mass-1 62.85±0.61 166.62±25.08c 2402.15±67.91a 282.29±92.48b Selenium µg mg dry mass-1 1.38±0.10 1.58±0.12b 1.11±0.31c 2.65±0.27a Resumen 231 estómago así como la absorción del alcohol libre, actuando como un antioxidante intra y extracelular. El α-tocoferol es un componente estructural de las membranas biológicas (Putnam y Comben, 1987), además de tener una potente función antioxidante (Sargent et al., 1997). Por otro lado, se cree que tanto en peces como en otros animales, la vitamina E ejerce un cierto efecto sobre la salud y la resistencia a enfermedades a través de la modulación de la respuesta inmune (Waagbø, 1994, 2006; Montero et al., 1998; Verlach Trichet, 2010). Los tocoferoles actúan como antioxidantes inter e intracelulares para mantener el equilibrio de metabolitos lábiles tanto en plasma como en las células. El α-tocoferol es capaz de detener la cascada de la oxidación, interceptando al radical peróxil (ROO-) más rápidamente que un PUFA. El α-tocoferol puede donar su átomo de hidrógeno fenólico al radical, quedando así convertido en un producto del hidroperóxido y rompiendo de este modo la cadena de reacciones de la auto-oxidación lipídica. De esta reacción resulta el radical tocoferoxil, que es lo suficientemente estable como para impedir que continúe la cadena de oxidación y que puede ser neutralizado si se une con otro radical peroxil, dando lugar a la formación de un producto no radical. Además, el radical tocoferoxil es muy estable y reacciona lentamente con los PUFA, pudiendo ser reducido por el ascorbato, regenerando de este modo a la vitamina E. Por tanto, a no ser que sea regenerada, para mantener un nivel adecuado de vitamina E en el organismo esta debe ser obtenida de reservas corporales o a través de la dieta (Burton y Traber, 1990). Ya que el α-tocoferol tiene mayor afinidad por los radicales peroxil que los PUFA, una pequeña cantidad de esta vitamina es suficiente para proteger una gran cantidad de ácidos grasos. En este sentido, Burton y colaboradores (1983) calcularon que una sola molécula de α-tocoferol era capaz de proteger aproximadamente a 1000 moléculas de de PUFA de la oxidación. Además, se ha observado que la suplementación de vitamina E mejora la calidad del filete en distintas especies piscícolas como la trucha arcoíris (Frigg et al., 1990; Chaiyapechara et al., 2003; Yildiz, 2004), el salmón atlántico (Salmo salar) (Hamre et al., 1998; Scaife et al., 2000), el rodaballo (Psetta maxima) (Ruff et al., 2003; 2004) y la lubina (Gatta et al., 2000; Pirini et al., 2000). También se ha comprobado que el α-tocoferol es capaz de proteger al filete de la oxidación, mejorar su vida útil, evitar el deterioro del color y prevenir la aparición de la rancidez. De hecho, se ha propuesto que el α-tocoferol es el factor más importante responsable de la estabilidad post-mortem de las membranas celulares (Baker, 1997). Resumen 232 El papel que desempeña la vitamina E en la integridad esquelética ha sido estudiado de manera extensa en los mamíferos, al contrario que en los peces. La vitamina E es necesaria para el desarrollo adecuado del sistema esquelético (Xu et al., 1995; Jilka et al., 1996. El tocoferol se asocia con la membrana bicapa de las células óseas convirtiéndose así en la primera línea de defensa frente a los radicales libres (Arjmandi et al., 2002). Los radicales endógenos y exógenos estimulan la diferenciación de los osteoclastos e inhiben la actividad de los osteoblastos (Tintut et al., 2002; Parhami, 2003). Esto podría causar resorción del hueso y causar formación inadecuada del mismo, así como anormalidades. No existen muchos estudios sobre el efecto de los ROS en los huesos de los peces. Lewis-McCrea y Lall (2007) describieron las consecuencias de alimentar juveniles de fletán con aceites moderadamente oxidados, observando un incremento de la incidencia de escoliosis en relación con el incremento de la oxidación. Por otro lado, existen algunos estudios sobre los efectos de la contaminación química sobre la columna vertebral (Karen et al., 2001; Mochida et al., 2008; Danion et al., 2011). La intoxicación con estos productos tiene efectos similares a aquellos observados cuando se genera una situación de estrés oxidativo mediante la dieta, ya que los contaminantes suelen ejercer sus efectos negativos alterando también el estado oxidativo. No se conocen los requerimientos exactos de vitamina E para las larvas de especies marinas, ya que la mayoría de estudios se han enfocado en juveniles o adultos, con valores que oscilan entre 25 y 120 mg kg-1. De forma general, se cree que los requerimientos nutricionales de las larvas son mayores que los de adultos o juveniles, por tanto, si se emplean los niveles estimados para adultos se podría estar infravalorando las necesidades de las larvas (Tabla 10.2). Tabla 10.2 Requerimientos de vitamina E para larvas de diferentes especies Por otro lado, hay que tener en cuenta que los altos requerimientos de LC-PUFA en larvas tienen que estar asociados a niveles elevados de vitamina E, como ya se ha sugerido para algunas especies como la carpa (Cyprinus carpio) (Watanabe et al., Especie Parámetro Requerimiento Referencia Latris lineata Crecimiento 437 mg kg-1 Brown et al., 2005 Salmo salar Crecimiento 120 mg kg-1 Hamre y Lie, 1995a Sparus aurata Crecimiento Supervivencia 136 mg kg-1 González et al., 1995 Sparus aurata Crecimiento Supervivencia 3000 mg kg-1 Atalah et al., 2008 Resumen 233 1981; Schwarz et al., 1988), el salmón atlántico (Hamre y Lie, 1995b) y la dorada (Atalah et al., 2008). En este sentido, Izquierdo y Fernández-Palacios (1997) observaron un incremento del contenido de vitamina E en larvas de dorada desde la eclosión a los 10 días, mientras que este contenido se redujo a partir de este día y hasta llegar a los 20 días post eclosión. Curiosamente, esta diminución en los niveles de vitamina E es paralela a la reducción de los contenidos de PUFA durante el desarrollo larvario (Izquierdo, 1988), lo cual sugiere una cercana relación entre ambos nutrientes. Por otro lado, además de contener altos niveles de PUFA, las microdietas presentan elementos pro-oxidantes, como por ejemplo los minerales. Además, la mayor superficie de las partículas alimenticias respecto a su volumen favorece los procesos oxidativos, ya que los ácidos grasos están más expuestos. Por tanto, es de gran importancia aportar suficiente cantidad de vitamina E en las dietas para larvas de peces marinos. 10.1.6.2.2.2 Vitamina C El ácido ascórbico (vitamina C) es una vitamina hidrosoluble, considerada un componente esencial en las dietas para teleósteos dado que estos carecen de capacidad para sintetizarla o de sintetizarla con suficiente rapidez como para satisfacer sus requerimientos, debido a la ausencia de la enzima gulonolactona oxidasa (Chatterjee, 1973; Dabrowski, 1990). Es un compuesto blanco, inodoro, cristalino, soluble en agua pero insoluble en solventes lipídicos. Además, el ácido ascórbico es capaz de formar sales y es lábil frente al oxígeno libre. El ácido ascórbico reducido es muy estable en soluciones ácidas debido a la conservación del anillo lactona, mientras que en soluciones alcalinas la vitamina C se hidroliza rápidamente perdiendo así su actividad. La vitamina C es muy lábil a altas temperaturas y susceptible a la oxidación atmosférica, especialmente en presencia de cobre, hierro u otros catalizadores metálicos. La forma reducida es la más activa desde un punto de vista biológico, pero se pueden formar distintas sales o derivados con distinto grado de actividad biológica (Woodruff, 1964; WHO, 1974). El ácido ascórbico actúa como cofactor en muchos procesos biológicos incluyendo la síntesis de colágeno, así como funciones relacionadas con la neuromodulación, los sistemas hormonales e inmune. Es necesario suplementar las dietas de bagre de canal (Ictalurus punctatus) con suficiente cantidad de vitamina C para la adecuada formación de componentes estructurales tales como cartílago, Resumen 234 colágeno o hueso (Wilson y Poe, 1973). Además. el ácido ascórbico actúa como cofactor en la hidroxilación de la prolina y la lisina, paso necesario para la conversión del procolágeno en colágeno maduro (Barnes y Kodicek, 1972; Padh, 1991). Los peces deficientes en ácido ascórbico muestran menores proporciones de hidroxilisina e hidroxiprolina, lo que origina colágeno poco hidroxilado (Sato et al., 1982). Cuando los niveles de ácido ascórbico son bajos, se aprecia una disminución de la enzima fosfatasa alcalina, indicando una reducción de la actividad de los osteoblastos. Por tanto, la deficiencia de vitamina C genera una baja osificación y metabolismo óseo (Tietz et al., 1983; Johnston et al., 1994). Es por esto que los peces deficientes en vitamina C muestran deformidades esqueléticas causada por la biosíntesis irregular de colágeno (Halver, 2002). Una menor hidroxilación de la prolina causa huesos débiles y quebradizos tal y como ya ha sido observado en bagre del canal y en rodaballo (Wilson y Poe, 1973; Coustans et al., 1990), mientras que en labeo roho (Labeo rohita) se observó una baja concentración de calcio en hueso, músculo, branquias y piel (Agrawal y Mahajan, 1980). Uno de los primeros síntomas de la deficiencia de vitamina C son las vértebras engrosadas y ligeramente curvadas como ha sido observado en el bagre del canal (Lim y Lovell, 1978). Así mismo, se han detectado algunas alteraciones esqueléticas como la lordosis o la escoliosis en la trucha de arroyo (Salvelinus fontinalis) (Poston, 1967), trucha arcoiris (Dabrowski et al., 1990) y salmón atlántico (Hardie et al., 1991). De acuerdo con esto, se ha visto que restringir los niveles de vitamina C causa reducción y daño del cartílago, generando anomalías en estructuras que experimentan osificación condral (por ejemplo, la mandíbula) así como una sobre estimulación de los receptores de vitamina C (Darias et al., 2009). Dado que el ácido ascórbico es un potente antioxidante, la cantidad de radicales libres puede verse incrementada cuando se emplean piensos de mala calidad, disminuyendo así las reservas tisulares de ascórbico (Sies, 1993) como ya ha sido descrito en trucha arcoíris alimentada con lípidos oxidados (Hung y Slinger, 1980). Otro papel importante de la vitamina C como antioxidante reside en su capacidad para regenerar el radical tocoferoxil, tal y como ha sido demostrado in vitro (Tappel, 1962; Packer et al., 1979; Niki et al., 1985). Así, un incremento en el contenido de vitamina C de 0 a 60 mg kg-1 no afectó a la retención de α-tocoferol en salmón del atlántico, ya que los peces no mostraron deficiencia en vitamina C (Hamre et al., 1997). Se han encontrado resultados similares en otras especies piscícolas como la perca amarilla (Perca flavescens) o el bagre de canal (Lee y Dabrowski, 2003; Yildirim-Aksoy et al., 2008). Además, en salmón del Atlántico, los niveles tisulares de vitamina E fueron Resumen 235 independientes del nivel de vitamina C cuando este se suplementó entre 50 y 2750 mg kg-1 (White et al., 1993). Por otro lado, se observó una caída marcada en el nivel de vitamina E hepática en salmones del Atlántico deficientes en vitamina C (Hamre et al., 1997). Así mismo, también se observó un incremento en los niveles hepáticos de vitamina E cuando se administraba vitamina C en perca amarilla y bagre de canal siendo alimentados con una dieta deficiente en vitamina E (Lee y Dabrowski, 2003; Yildirim-Aksoy et al., 2008). Salmones alimentados con un suplemento de vitamina E mostraron un desarrollo paralelo entre la vitamina E hepática, la hidroxiprolina de las vértebras, crecimiento y mortalidad en respuesta a la vitamina C, sugiriendo que son necesarios niveles de vitamina C superiores a los requerimientos para mantener las reservas corporales de vitamina E (Hamre et al., 1997). Estos resultados apoyan la hipótesis de que la vitamina C puede regenerar a la vitamina E in vivo en adultos y juveniles de peces. Por otro lado, se ha observado un efecto prooxidante de la vitamina E cuando se administran niveles altos a peces deficientes en vitamina C, ya que los radicales tocoferoxil se acumulan en las membranas y pueden causar oxidación irreversible de vitamina C remanente (Hamre, 2011). Las larvas son especialmente sensibles a la deficiencia de vitamina C (Dabrowski et al., 1996), debido probablemente a que tienen un mayor requerimiento en vitaminas por su rápido crecimiento, así como elevados contenidos de PUFA en sus alimentos (Tabla 10.3). Además, se han encontrado altos niveles de vitamina C en huevos de peces (Kossmann, 1988; Dabrowski y Bloom, 1994), lo cual podría ser indicativo de la importancia de este micronutriente durante el desarrollo larvario. En larvas de lubina, rodaballo (Merchie et al., 1996) y dorada (Atalah et al., 2010) la adición de vitamina C mejoró la supervivencia, el crecimiento, el desarrollo esquelético, la resistencia al estrés y la respuesta inmune. Además, existe la hipótesis de que en los primeros estadios de desarrollo larvario los antioxidantes de bajo peso molecular, como por ejemplo la vitamina C, juegan un papel primordial ante el daño oxidativo, mientras que a medida que va creciendo la larva, se incrementa la actividad de las enzimas antioxidantes (Rudneva, 1999). Por tanto, para que las larvas puedan mantener un equilibrio oxidativo es necesario prestar atención a la vitamina C administrada a los reproductores, así como suministrar la suficiente cantidad de vitamina C a las larvas. Resumen 236 Tabla 10.3 Requerimientos de vitamina C para larvas de distintas especies marinas 10.1.6.2.2.3 Selenio El selenio es un mineral traza y un micronutriente esencial para los vertebrados (Johansson et al., 2005), pero también es el elemento con menor rango entre requerimiento y toxicidad (Chassaigne et al., 2002; Polatajko et al., 2006). Es un componente esencial de distintas rutas metabólicas, incluyendo el metabolismo de las hormonas tiroideas, los sistemas de defensa antioxidante o la función inmune. El selenio se distribuye a bajas concentraciones en agua dulce (0,2-10 µg litro-1) y salada (aproximadamente 0,09 µg litro-1) (NRC, 1976). También aparece de forma natural en alimentos en forma de complejos orgánicos, principalmente en forma de selenometionina, selenocistina y selenocisteína. Las harinas de pescado y productos de origen marino representan la mejor fuente natural de selenio de todos los productos empleados normalmente para elaborar piensos de peces. Sin embargo, Bell y Cowey (1989) demostraron que el selenio presente en la harina de pescado presenta una baja digestibilidad, mientras que la selenometionina era muy digestible. La disponibilidad relativa del selenio de los compuestos puros es: Selenito > selenato > selenometionina > selenido > selenio elemental En los peces, el selenio también está involucrado en el funcionamiento de hormonas tiroideas y la insulina, la fertilidad y la regulación del crecimiento celular (Lall, 2002; Kohlmeier, 2003). Además, el selenio puede promover tanto la formación del Especie Parámetro Requerimiento Referencia Cirrhina mrigala Crecimiento Supervivencia Comportamiento Morfología 650-700 mg kg-1 Mahajan y Agrawal, 1980 Clarias gariepinus Crecimiento 1600 mg kg-1 Merchie et al., 1997 Cyprinus carpio Crecimiento Contenido vitC 45 mg kg-1 Gouillou-Coustans et al., 1998 Dicentrarchus labrax Crecimiento Supervivencia Resistencia estrés 2500 mg kg-1 Merchie et al., 1995 Dicentrarchus labrax Crecimiento Supervivencia Deformidades 30-50 mg kg -1 Darias et al., 2011 Scophtalmus maximus Crecimiento Supervivencia 20-130 mg kg-1 Merchie et al ., 1997 Resumen 237 hueso como la mineralización. Sin embargo, la ingesta excesiva de este mineral tiene efectos negativos sobre el metabolismo del tejido esquelético en los vertebrados (NRC, 2005). Penglase y colaboradores (2010) demostraron que larvas de bacalao alimentadas con rotíferos suplementados con selenio presentaron una mayor incidencia de deformidades vertebrales. Esto podría estar causado por una alteración en la mineralización esquelética causado por el selenio en su forma iónica, o a través de las selenoenzimas como agentes antioxidantes (Lall y Lewis-McCrea, 2007) o por la alteración de las hormonas tiroideas (Power et al., 2001). El selenio se incorpora en forma de selenometionina en el sitio activo de una amplia gama de proteínas. En el pez cebra (Danio rerio) se han identificado un total de 18 selenoproteínas, incluyendo tres tipos que no presentan ortólogos en mamíferos (Kryukov y Gladyshev, 2000). Una de las principales funciones del selenio es actuar como componente de las selenoproteínas GPX, una serie de isoenzimas que protegen los componentes lipídicos y las membranas del estrés oxidativo tanto a nivel celular como subcelular (Arteel y Sies, 2001). Otras selenoproteínas pueden presentar también función antioxidante, tal y como puede observarse en la Tabla 10.4. Únicamente la selenometionina puede incorporarse a las proteínas, siendo éste el principal reservorio de selenio en el músculo esquelético. Por el contrario, el selenito de sodio puede incorporarse a selenoproteínas activas como la GPX, pero no a la selenometionina que sirve de reservorio en hígado y músculo (Rider y Sweetman, 2008). La deficiencia de selenio puede llevar a la aparición de estrés oxidativo en los órganos (Gatlin et al., 1986; Bell et al., 1986, 1987), reducción del crecimiento (Wang y Lovell, 1997) e incremento de la mortalidad (Gatlin et al., 1986; Bell et al., 1987) en distintas especies piscícolas. Los principales efectos de la intoxicación por selenio son disminución del crecimiento, baja eficiencia nutricional y alta mortalidad. Por otro lado, niveles de selenio superiores a 13 y 15 mg kg-1 fueron suficientes para causar signos de toxicidad en trucha arcoíris y bagre del canal respectivamente (Hilton et al., 1980; Gatlin y Wilson, 1984). Se debe tener en cuenta que el requerimiento de selenio de los peces varía junto a la forma de selenio ingerido, el contenido de LC-PUFA y vitamina E de la dieta, así como la concentración de selenio en el agua (Lall, 2002). Recientemente se ha demostrado que el contenido de selenio de los rotíferos es considerablemente bajo (0,08-0,09 mg kg-1 peso seco) en comparación tanto con los requerimientos de los peces (0,5-0,3 mg kg-1 peso seco; NRC, 1993) como con el selenio contenido en los copépodos (3-5 mg kg-1 peso seco), por lo que podrían no contener suficiente selenio para cubrir los requerimientos de las larvas (Hamre et al., Resumen 238 2008a). Por tanto, el selenio podría ser uno de los elementos traza con mayor potencial de ser deficiente en los rotíferos. Enriquecer rotíferos con selenito de sodio y yoduro de sodio aumenta la supervivencia de larvas de bacalao, aunque no se observaron diferencias en cuanto a crecimiento respecto al grupo control (Hamre et al., 2008b). Así mismo, un incremento en el nivel de selenio en los rotíferos incrementó la actividad y expresión del mRNA de la GPX en larvas de bacalao (Penglase et al., 2010), sugiriendo que es necesaria una dosis extra de selenio para proteger a las larvas de la oxidación lipídica y a los productos de la oxidación, ya que pueden ser abundantes en las presas vivas enriquecidas con niveles altos de n-3 LC-PUFA. Cabe resaltar que la vitamina E puede compensar en situaciones de deficiencia de selenio (Gatlin et al., 1986; Awad et al., 1994), por tanto, las larvas podrían protegerse de los ROS acumulando otros nutrientes antioxidantes, como ya ha sido observado en las larvas de bacalao (Penglase et al., 2010). Tabla 10.4 Selenoproteínas presentes en el pez cebra y su función Selenoproteína Pez cebra Función conocida (mamíferos) 1. Glutatión peroxidasa 1 GPX1a GPX1b Catabolismo hidroperóxidos Estructura del esperma 2. Glutatión peroxidasa 2 GPX2 3. Glutatión peroxidasa 4 GPX4a GPX4b 4. Deionidasa 3 DI3 Activación T4 Inactivación T3 5. Tioredoxina reductasa 2 TR2 Regulación del redox proteico Reciclaje de vitamina C Síntesis de ADN 6. Tioredoxina reductasa 3 TR3 7. Selenoproteína P SelPa Transporte de selenio Antioxidante 8. Selenoproteína Pb SelPb 9. Selenoproteína W1 SelW1 Antioxidante 10. Selenoproteína W2 SelW2a SelW2b 11. Selenoproteína T1 SelT1a SelT1b Desconocida 12. Selenoproteína T2 SelT2 Desconocida 13. 15 kDa selenoproteína Sel15 ¿¿Etiología cancer?? 14. Selenoproteína R SelR Desconocida 15. Selenoproteína N SelN Desconocida Resumen 239 10.1.6.3 Estrés oxidativo El estrés oxidativo aparece cuando la tasa de generación de ROS es superior a su eliminación (Sies, 1986; Figure 10.9). Sus efectos adversos incluyen oxidación de proteínas y ADN, así como peroxidación de los lípidos insaturados de las membranas celulares. Todo esto produce hidroperóxidos inestables altamente reactivos que amenazan la integridad de la célula. Además, estos productos pueden convertirse en radicales libres, pudiendo perpetuar el ciclo destructivo de reacciones de peroxidación lipídica. La reparación de las proteínas dañadas por los ROS se limita a la reducción de los derivados oxidados de los residuos de aminoácidos que contienen sulfuro. No se ha demostrado la reparación de otros tipos de proteínas oxidadas. Es más, las proteínas dañadas son degradadas a aminoácidos por la acción de diversas proteasas, incluyendo catepsinas y calpaínas. Por el contrario, el daño oxidativo a los ácidos nucleicos es reparado por mecanismos de excisión/inserción altamente eficaces. Sin embargo, las modificaciones en el ADN tras la exposición a ROS pueden ser el inicio de la inducción de efectos mutagénicos y letales de distintos productos con potencial oxidante (BasuModak y Tyrrel, 1993). En juveniles y adultos de distintas especies de peces, se han relacionado algunas enfermedades con el daño de las radicales libres, como por ejemplo la hemolisis (Kawatsu, 1969), anemia (Cowey et al., 1984), ictericia (Sakai et al., 1989), degeneración hepática (Cowey et al., 1984) o alteraciones esqueléticas (Hata y Kaneda, 1980; Watanabe et al., 1989; Lewis-McCrea y Lall, 2007). Entre las alteraciones esqueléticas, una de las más frecuentemente descritas en juveniles y adultos es la distrofia muscular (Lovell et al., 1984; Gatlin et al., 1986; Frischknecht et al., 1994; Bowater y Burren, 2007). 10.1.6.3.1 Auto-oxidación de los lípidos La oxidación de los lípidos puede ser definida como un proceso autocatalítico iniciado por radicales libres que resulta en el deterioro de los PUFA y es una consecuencia importante del estrés oxidativo. Los ROS ejercen su acción quitando electrones de la membrana lipídica de la célula, iniciando así el proceso de oxidación lipídica. La auto-oxidación de los lípidos continúa como una reacción en cadena, en la que una especie radical tiene la capacidad de quitar un átomo de hidrógeno al grupo metileno de los PUFA, convirtiéndolo en un radical lipídico. Como consecuencia, se establece una reacción cíclica en la que el radical peróxido formado por otro radical Resumen 240 reacciona con un nuevo PUFA. En ausencia de antioxidantes, la oxidación de los lípidos continuará hasta que queden PUFA por oxidar (Hamre, 2011). La cadena de peroxidación lipídica puede terminar cuando dos radicales lipídicos reaccionan para formar un producto no radical o cuando es neutralizado por un neutralizador de radicales (Hølmer 1993; Frankel, 1998). En general, los efectos de la peroxidación lipídica son disminución de la fluidez de membrana, incremento de la permeabilidad de membrana a sustancias normalmente impermeables e inactivación de las enzimas de unión de membrana. Los productos primarios de la oxidación de lípidos son los dienos conjugados que se convertirán en hidroperóxidos, que pueden dar lugar a la formación de distintos productos secundarios de bajo peso molecular como los aldehídos o los hidrocarbonos (Hølmer, 1993; Frankel, 1998). Los hidroperóxidos se pueden oxidar, manteniendo la cadena de carbono intacta y formar isoprostanos, isofuranos y ácidos grasos mono o dihidroxi. La oxidación del DHA da lugar específicamente al isoprostano de tipo F4, isofurano y mono o dihidroxi DHA. Se pueden formar ocho subfamilias de isoprostanos F4 a partir del DHA, resultado del ataque de los radicales libres a las posiciones C6, C9, C12, C15 and C18. Además, los hidroperóxidos pueden ocasionar una pérdida completa de la integridad de membrana con una desintegración de la cadena de carbonos, formándose diferentes especies moleculares de aldehídos. El producto más estable resultante de la oxidación del DHA es el 4-hidroxihexenal (Van Kuijk et al., 1990). Para reducir la formación de estos productos de la oxidación es necesario una adecuada combinación de antioxidantes hidro y liposolubles. Sin embargo, el efecto de cada una de estas moléculas antioxidantes puede variar en función de los organismos y de tejidos específicos (Dietrich et al., 2002). Además, el daño oxidativo a la membrana puede liberar enzimas hidrolíticas que causen más daño a la célula. Los tejidos de los peces están en riesgo de sufrir oxidación de sus lípidos, ya que contienen cantidades relativamente altas de LC-PUFA. Este riesgo será incluso mayor en las larvas de especies marinas, ya que su mayor requerimiento de PUFA supone una mayor presencia en sus tejidos. Sin embargo, la susceptibilidad de los peces a la oxidación depende en gran parte del perfil de ácidos grasos y de los niveles y tipo de antioxidantes presentes. Por tanto, para evitar la peroxidación in vivo, se debe de incluir cantidad suficiente de antioxidantes en las dietas. Resumen 247 (IGF-I y II). Las IGF son polipéptidos de cadena simple, homólogos estructuralmente a la proinsulina y capaces de promover el crecimiento. Dependiendo del contexto biológico, la IGF puede estimular el crecimiento celular, promover la diferenciación celular e inhibir la apoptosis (Jones y Clemmons, 1995). La acción de las IGF puede verse influenciada tanto positiva como negativamente por una familia de proteínas vinculadas a las IGF (IGFBP) y la mayoría, si no todas sus acciones, están mediadas por los receptores de IGF (Jones y Clemmons, 1995). Las IGFs conforman una de las rutas centrales de regulación de síntesis de proteínas en el músculo esquelético. Por ejemplo, en embriones de pez cebra, dos parálogos de la IGF-II regulan el desarrollo de la línea media (White et al., 2009). Así mismo, el músculo de los peces tiene una mayor abundancia de receptores de la IGF-I que de receptores de insulina (Parrizas et al., 1995). Esto indica que la IGF-I contribuye más a la regulación de la función muscular que la insulina en los peces, al contrario de lo que ocurre en los mamíferos. Se ha comprobado que algunas de las propiedades biológicas del músculo de los mamíferos lo vuelven particularmente susceptible al daño de los radicales libres, incluso en situaciones de estrés oxidativo sistémico. Por tanto, parece ser que el músculo se ve afectado de manera primaria o incluso selectivamente. Esto podría ser debido a la capacidad del músculo para asumir cambios rápidos y coordinados en el aporte de energía y el flujo de oxígeno durante la contracción. Esto podría hacer al músculo muy susceptible de padecer estrés oxidativo como resultado de un mayor flujo de electrones (Haycock et al., 1996). Por otro lado, hay una alta concentración de hemoglobina en el músculo, y se sabe que las proteínas que contienen el grupo hemo son muy sensibles al ataque de los radicales libres (Ostdal et al., 1997). Finalmente, los fosfolípidos de las membranas musculares las hacen particularmente susceptibles a padecer oxidación (Murphy y Kehrer, 1989). Por tanto, parece ser que el músculo tiene una mayor probabilidad de sufrir estrés oxidativo que cualquier otro tejido. Es lógico pensar que los mecanismos de protección antioxidante deberían estar mejorados en el tejido muscular. Sin embargo, en salmón del Atlántico se ha demostrado que la retención de α-tocoferol es particularmente baja en el músculo blanco, especialmente si se compara con otros órganos como por ejemplo el hígado, que muestra una retención exponencial de vitamina E (Hardie et al., 1990; Hamre y Lie, 1997). El modelo lineal de retención de vitamina E en el músculo y el exponencial para el hígado están confirmados en otras especies como la tilapia (Oreochromis aureus; Satoh et al., 1987) y la trucha arcoíris Hung et al., 1980; Frigg et al., 1990; Puangkaew et al., 2005). Se han encontrado resultados similares en otros nutrientes antioxidantes como el selenio. Monteiro y Resumen 248 colaboradores (2009) encontraron una baja retención de selenio en el músculo de Brycon cephalus alimentados con una dieta rica en selenio, en comparación con las branquias o el hígado. Además, las actividades de la SOD, CAT y GPX fueron más bajas en el músculo de larvas de Brachymystax lenok en comparación con las vísceras, cerebro y branquias (Zhang et al., 2009). Por tanto, todas estas condiciones tendrían que considerarse como causas adicionales a la aparición de lesiones musculares en peces. 10.1.6.3.2.2 Sistema esquelético El sistema esquelético tiene muchas funciones fisiológicas, incluyendo la de dar integridad estructural durante el desarrollo y el movimiento. Además, el esqueleto permite la inserción de los músculos, protege a los órganos vitales y sirve como reservorio de minerales (Lall y Lewis-McCrea, 2007). Los teleósteos muestran una amplia variedad de tejidos esqueléticos. Es más, más que hueso o cartílago, el tejido esquelético de los peces se puede describir como un espectro continuo, variando desde el tejido conectivo al cartílago y al hueso (Hall y Witten, 2007). Por tanto, se han identificado en peces, el cartílago y otros muchos tejidos con características histológicas entre hueso y cartílago y se sabe que juegan un papel fundamental en el desarrollo esquelético (Benjamin, 1990; Beresford, 1993; Huysseune, 2000). El hueso es un tejido conectivo vascularizado especializado constituido por células y matriz extracelular mineralizada. Antes de la mineralización, la matriz extracelular está compuesta principalmente de colágeno tipo I que se va mineralizando subsecuentemente debido a la deposición de hidroxiapatita mediada por los osteoblastos (Hall y Witten, 2007; Nordvick, 2007). El cartílago es un tejido avascular compuesto por condrocitos que están incluidos en una matriz extracelular, compuesta principalmente por colágeno tipo II y proteoglicanos (Witten et al., 2010). El hueso condroide es un tejido intermedio que se halla, por ejemplo, en los tejidos mandibular y maxilar de los teleósteos. Tiene características intermedia tanto de hueso como de cartílago, pudiendo estar mineralizado. En la formación y remodelado del esqueleto óseo axial están implicados distintos tipos celulares. Los osteoblastos son células formadoras de hueso y su función es la de secretar matriz ósea no mineralizada así como controlar la mineralización de la matriz. Los osteoclastos intervienen en la resorción del tejido óseo y pueden ser visualizados como macrófagos multinucleados. Los osteocitos son células atrapadas en el interior de Resumen 249 la matriz ósea y están implicados en el mantenimiento de las sustancias del hueso y el intercambio de iones desde los fluidos orgánicos. Distintos estudios relacionados con el impacto de la primera alimentación en el desarrollo de los peces han demostrado que algunos nutrientes juegan un papel fundamental en la aparición de deformidades esqueléticas cuando no se administran durante la fase larvaria (Cahu, 2003). Además, el desarrollo de alteraciones esqueléticas en larvas y juveniles puede estar relacionado al poco conocimiento que se tiene de las interrelaciones entre nutrición, ambiente y factores genéticos. Por tanto, para intentar evitar la aparición de deformidades esqueléticas en larvas cultivadas, hay que prestar una especial atención al aporte adecuado de nutrientes como las vitaminas, minerales o lípidos. No existe mucha información sobre el papel de los lípidos oxidados y los radicales libres en el desarrollo de anomalías esqueléticas en teleósteos. En humanos, se sabe que los ROS contribuyen principalmente a la remodelación del hueso al promover la resorción ósea (Bai et al., 2005). Esto probablemente se deba a una inhibición de los osteoblastos y una estimulación de los osteoclastos, causando una pérdida neta del hueso (Parhami et al., 1997; Parhami, 2003). La reducción en la formación del hueso, acompañada de una estimulación de la resorción del mismo, podría causar anormalidades esqueléticas, como ya ha sido observado en fletán alimentado con lípidos oxidados (Lewis-McCrea y Lall, 2007). Estudios recientes en larvas de dorada demostraron que altos niveles de DHA en la dieta causan un mayor porcentaje de deformidades esqueléticas, encontrando además en estas larvas el mayor contenido de TBARS, lo cual es indicativo de procesos peroxidativos (Izquierdo et al., enviado). El aporte de vitamina E no redujo la frecuencia de las anomalías observada en fletán juvenil alimentado con dietas oxidadas (Lewis-McCrea y Lall, 2007), ni tampoco en larvas de lubina alimentadas con rotíferos enriquecidos con altos niveles de DHA (Izquierdo et al., enviado). Sin embargo, el aporte de vitamina E mejoró la calidad del hueso en ratones adultos expuestos a estrés oxidativo (Wang et al., 2000). Por tanto, dietas oxidadas pueden causar deficiencias de nutrientes antioxidantes, lo cual puede llevar a la aparición de deformidades. Sería importante llevar a cabo más estudios sobre el efecto de los lípidos oxidados sobre el desarrollo del sistema esquelético para poder entender su efecto patológico sobre el hueso de los peces. Resumen 250 10.2 Objetivos Hoy en día, la producción de juveniles sigue representando el cuello de botella en la acuicultura de especies marinas. El uso de una dieta compuesta seca para mantener la alta producción de juveniles de calidad es crucial. Sin embargo, se desconocen los requerimientos exactos de las larvas de peces. Se sabe que altos requerimientos de PUFA, y particularmente de DHA, incrementan el riesgo de padecer estrés oxidativo. Sin embargo, poco se sabe sobre los daños causados por los radicales libres en las larvas de especies marinas y del efecto de los distintos nutrientes antioxidantes. Por tanto, los objetivos de la presente tesis fueron los siguientes: 1.- Determinar el daño potencial de niveles altos de DHA en larvas de lubina. Tradicionalmente en las dietas para larvas se han empleado gran cantidad de PUFA, especialmente DHA para promover su crecimiento y supervivencia. Sin embargo, debido a su alta insaturación, el DHA es muy susceptible de padecer peroxidación lipídica. Este hecho junto con otras características, puede exponer a las larvas a sufrir estrés oxidativo en sus propios tejidos. 2.- Evaluar el efecto protector antioxidante de la vitamina E cuando se administran distintos niveles de DHA. Se deben de incluir en las dietas cantidades suficientes de nutrientes antioxidantes para contrarrestar los efectos adversos de los ROS. Se probaron distintos niveles de α-tocoferil acetato para intentar evitar los efectos negativos del estrés oxidativo. 3.- Investigar el efecto protector de la combinación de vitamina E y selenio cuando se emplean niveles altos de DHA en la dieta. Se probó una dieta con niveles elevados de DHA y vitamina E y suplementada con Se, otro nutriente con potencial antioxidante. 4.- Investigar el efecto protector de la combinación de vitaminas C y E cuando se emplean niveles altos de DHA en la dieta. Para alcanzar este objetivo se añadió niveles altos de vitamina C a una dieta con alto potencial de causar estrés oxidativo. Resumen 251 10.3 Material y Métodos Generales 10.3.1 Condiciones y animales experimentales Se obtuvieron larvas de lubina de puestas naturales de la Ecloserie Marine de Gravelines (Gravelines, Francia, Capítulo 3) y del Instituto de Acuicultura de Torre la Sal (Castellón, España, Capítulos 4, 5 y 6). Durante los primeros días de aclimatación se controló la temperatura por medio de enfriadores (16ºC), incrementándose la tasa de renovación paulatinamente hasta llegar a la temperatura ambiente (19.5-20ºC). Las larvas se cultivaron en tanques madre hasta alcanzar los 12 (Capítulos 4, 5, 6 y 7) o 32 (Capítulo 3) dph cuando se distribuyeron al azar para, tras un periodo de aclimatación de dos días, dar comienzo a los distintos experimentos. Todos los experimentos se realizaron en las instalaciones del Instituto Canario de Ciencias Marinas (ICCM, Telde, Islas Canarias, España). 10.3.1.2 Cultivo en agua verde Las larvas de lubina recién eclosionadas se cultivaron en tanques de 2000 L de capacidad, en sistema abierto (7 renovaciones al día) durante los primeros cinco días. Al sexto día, cuando las larvas ya habían abierto la boca, se cerró el circuito abierto y las larvas se cultivaron en agua verde. Para ello, cada día se añadían 20 L de Nanochloropsis gaditana (205 x 103 células ml-1) y se mantuvo la densidad de rotíferos a 10 ind ml-1. Para conseguir este propósito, se añadían rotíferos dos veces al día (8:00; 15:00). Los rotíferos restantes en el tanque se eliminaron por filtración, evitando así la presencia de rotíferos con bajo valor nutricional en el tanque. Se siguió el fotoperiodo natural (alrededor de 10 h de luz) durante 12 (Capítulos 4, 5, 6 y 7) o 32 días (Capítulo 3), hasta que las larvas se transfirieron a los tanques experimentales. 10.3.1.3 Cultivo en tanques experimentales Cada tanque (tanques cilíndricos de fibra de vidrio y color gris de 170 L) fue abastecido por agua de mar filtrada (salinidad de alrededor de 34 g L-1) almacenada previamente en una tanque de 500 L para facilitar la eliminación del exceso de gases disueltos. El agua se filtró a través de una malla de 50µm y entró en los tanques a una tasa creciente de 1.0 - 1.5 L min-1 en un sistema abierto. El agua era continuamente aireada (125 ml min-1), alcanzando niveles de oxígeno de 5-8 g L-1 y entre un 60 y 80% de saturación. La temperatura y el oxígeno se midieron diariamente utilizando el oxímetro Guard-handy beta (Zeigler Bros, Gardners, EEUU). La intensidad de la luz se mantuvo a 1700 lux (digital Lux Tester YF-1065, Powertech Rentals, Western Australia, Resumen 252 Australia). Se utilizó un fotoperiodo artificial de 12 h luz: 12 h oscuridad mediante luces fluorescentes. Los tanques se limpiaron diariamente de manera manual entre las 18:00 y las 20:00 mediante un sifón. 10.3.2 Dietas y alimentación 10.3.2.1 Rotíferos Los rotíferos (Brachionus plicatilis) se cultivaron en tanques cilíndricos de 1700 L de capacidad. Estos tanques poseían un sistema central de aireación a través de una piedra porosa separada del fondo 20 cm. Los cultivos se hicieron con una mezcla de agua salada (80%) y dulce (20%), siendo inoculados los rotíferos (línea S-1; 150-250 µm de longitud) a una densidad inicial de 100 ind ml-1. La alimentación de los rotíferos se basó en levadura de panificación (1,2 g 106 ind-1 d-1), repartida en dos tomas diarias. Los rotíferos se emplearon para alimentar a las larvas de lubina durante el cultivo en agua verde y los primeros cinco días de experimentación. Los rotíferos usados en el agua verde estaban enriquecidos (24 h) con DHA Selco® (INVE, Bélgica; 0,125 g Selco l1 en dos dosis). Durante los cinco primeros días de ensayo con microdietas, se administraron rotíferos alimentados con levadura en un régimen de co-alimentación, por lo que no existió aporte de LC-PUFA diferente del aportado por la dieta. 10.3.2.2 Microdietas Para la realización de esta Tesis se formularon distintas dietas isolípidicas e isoprotéicas, pero con niveles variables de DHA, vitaminas C y E o selenio. El contenido proteico y lipídico osciló alrededor del 65 y 15% respectivamente. 10.3.2.2.1 Formulación de las microdietas Como fuente de EPA y DHA se empleó EPA 50 y DHA 50 en forma de triglicéridos (Croda, East Yorkshire, Reino Unido). La vitamina E, en forma de tocoferil acetato, se obtuvo de Sigma-Aldrich (Madrid, España), mientras que el ROVIMIX StayC-35 (ascorbil monofosfato; Roche, Paris, Francia) se usó como fuente de vitamina C. Además, se usó selenio orgánico extraído de levaduras (Sel-Plex, Alltech Inc, Lexington, KY, EEUU). Para ecualizar el contenido lipídico, se empleó un aceite que no es fuente de ácidos grasos esenciales, como es el ácido oléico (Merck, Darmstadt, Alemania). La lecitina de soja (Acrofarma, Barcelona, España), con un contenido de alrededor del 50% de lípidos polares, fue la fuente elegida de fosfolípidos. La mezcla de atractantes se basó en la estimada por Kanazawa et al. (1989), mientras que las vitaminas se basaron Resumen 253 en la de Teshima et al. (1982) con algunas modificaciones. Como fuente de proteína, se empleó la harina de calamar, la cual fue desengrasada tres veces consecutivas para poder controlar el perfil de ácidos grasos de la dieta. Para ello, se mezcló un volumen de harina con 3 volúmenes de cloroformo, se agitó unos minutos y se filtró a través de silica con la ayuda de una bomba de vacío. Tras cada extracción se dejó evaporar el cloroformo introduciendo la harina en una estufa a 38º durante al menos 12 horas. 10.3.2.2.2 Preparación de las microdietas Las microdietas se prepararon siguiendo el protocolo establecido por Liu et al. (1992). Primero, se mezcló la harina con los componentes hidrosolubles en un mortero hasta conseguir una mezcla lo más fina posible. Por separado se preparó la mezcla de vitaminas liposolubles y aceites, que se añadió a los componentes hidrosolubles. Se preparó gelatina, disolviéndola en agua caliente y se añadió a la mezcla. La pasta resultante fue comprimida, moldeada en trozos pequeños (Severin, Suderm, Alemania) y secada en una estufa a 38ºC durante 24 horas. A continuación se molió (Braun, Kronberg, Alemania) y tamizó (Filtra, Barcelona, España) la dieta hasta obtener el tamaño de partícula deseado (alrededor de 125-500 μm). Las dietas fueron analizadas para conocer su contenido proximal y de ácidos grasos, testando cada dieta en triplicado (Capítulos 3, 5 y 6) o cuadriplicado (Capítulos 4 y 7). 10.3.2.3 Alimentación Las dietas se administraron cada 45 min desde las 8:00 hasta 19:00. Se alimentó a las larvas al menos durante los cinco primeros días de vida con rotíferos alimentados con levadura, para así evitar cualquier aporte de LC-PUFA. La densidad inicial fue de 2 rotíferos ml-1 y fue luego reducida a 1 rotífero ml-1. Para garantizar la disponibilidad de alimento, la administración de las dietas experimentales fue al inicio 2.0 g y se fue incrementando 0.5 g cada semana. 10.3.3 Muestreos 10.3.3.1 Evaluación del crecimiento Se determinó el crecimiento de las larvas valorando su peso corporal y longitud total. El peso total se calculó en tres réplicas de 10 larvas en inanición, lavadas con agua destilada y secadas en un portaobjetos en un horno a 110ºC hasta alcanzar un peso constante, aproximadamente tras 24 h. Para los estudios de longitud total, se midieron 30 larvas por tanque en el proyector de perfiles (V-12A Nikon, Nikon Co., Tokio, Japón). Resumen 254 10.3.3.2 Análisis proximal Para analizar la composición bioquímica se tomaron todas las larvas que restaron en los tanques experimentales, tras un periodo de inanición de 12 h, se lavaron con agua destilada y se mantuvieron a -80ºC hasta su posterior análisis. Antes del inicio de las pruebas experimentales se tomaron muestras de los tanques madre para conocer la composición bioquímica inicial. 10.3.3.3 Histología En cada punto de muestreo se fijaron 30 larvas por tanque en formol tamponado al 10%. Otras 30 larvas se fijaron durante 24 h a 4ºC en glutaraldehído al 2,5% en tampón fosfato 0,2M (pH 7,2) para el estudio de microscopía electrónica de transmisión (TEM). 10.3.3.4 Biología molecular Se tomaron aproximadamente 200 mg de larvas no alimentadas durante 12 h en cada punto de muestreo. Estas larvas fueron lavadas con agua DEPC (dietil pirocarbonato) y conservadas en 1000 µl de RNA later (Sigma-Aldrich, Madrid, España) durante toda una noche a 4ºC. A continuación se retiró el RNAlater y las larvas se conservaron a -80ºC hasta la extracción del ARN. 10.3.3.5 Test de actividad y supervivencia final Antes del final de algunos de los experimentos (Capítulos 3 y 4) se llevó a cabo un test de actividad, manteniendo 20 larvas en una red fuera del agua durante 1 min, para después ponerlas de nuevo en el agua y observar la supervivencia a las 24 h. La supervivencia final se calculó tras contar todas las larvas remanentes en los tanques experimentales. 10.3.4 Análisis bioquímicos 10.3.4.1 Análisis proximales 10.3.4.1.1 Humedad Se determinó el contenido de humedad secando en la estufa las muestras a 110ºC hasta alcanzar peso constante. Se anotó el peso de la muestra (aproximadamente 100 mg) antes y después de secarlas, después de dejarlas enfriar en un desecador. La humedad se expresó como un porcentaje del peso siguiendo el Resumen 255 Método Oficial de la Asociación Química Analítica de los EEUU (A.O.A.C., 1995), empleando la siguiente ecuación: Siendo A el peso del tubo vacío, B el peso de la muestra húmeda y el tubo y C el peso de muestra seca y tubo. 10.3.4.1.2 Cenizas El contenido de cenizas se midió tras secar las muestras (aproximadamente 200 mg) en una estufa a 450º hasta que se alcanzó un peso constante (A.O.A.C., 1995). 10.3.4.1.3 Proteínas Las proteínas se estimaron a partir del nitrógeno total contenido en la muestra (~250 mg) usando el método Kjeldhal (A.O.A.C., 1995) tras la digestión de la misma con ácido sulfúrico a una temperatura de 420ºC. El nitrógeno total fue convertido en proteínas crudas totales tras multiplicar por el factor empírico 6,25. 10.3.4.1.4 Lípidos totales Los lípidos se extrajeron siguiendo el método de Folch et al. (1957). La extracción comienza con el homogeneizado de la muestra (50-200 mg) en un Ultra Turrax (IKA-Werke, T25 BASIC, Staufen, Alemania) durante 5 min en una solución de 5 ml de cloroformo:metanol (2:1) con BHT al 0,01%. La solución resultante fue filtrada y a continuación se añadió KCl al 0,88% para incrementar la polaridad de la fase acuosa. Esto fue seguido de decantación y centrifugación a 2000 rpm durante 5 min para así separar la fase acuosa de la orgánica. Una vez descartada la fase acuosa, se evaporó el solvente bajo atmósfera de nitrógeno y se pesaron los lípidos. 10.3.4.2 Preparación y cuantificación de ésteres metílicos de ácidos grasos Los ésteres metílicos de ácidos grasos (FAMEs) se obtuvieron por transmetilación ácida de los lípidos totales con 1% de ácido sulfúrico en metanol según el método de Christie (1982). La reacción se llevó a cabo en la oscuridad durante 16 h a 50ºC en atmósfera de nitrógeno. Después, los ésteres metílicos de los ácidos grasos se extrajeron con hexano:éter dietílico (1:1; v:v) y fueron purificados por cromatografía de adsorción en cartuchos NH2 Sep-pack (Waters S.A., Massachussets, EEUU) tal y como describió Christie (1982). Los FAME fueron separados por GLC (GC-14A, Shimadzu, Tokyo, Japan) en una columna capilar de sílica (Supercolvax-10-fused; longitu: 30 mm, AB ACAB Humedad − −−−− =)()(100 (%) Resumen 256 diámetro interno: 0.32 mm; Supelco, Bellefonte, EEUU) utilizando helio como gas transportador. La temperatura de la columna fue de 180ºC durante los primeros 10 min, aumentando a 215ºC durante 10 min, según las condiciones descritas por Izquierdo et al., (1992). Los FAME se cuantificaron por FID y se identificaron por comparación con estándares externos y aceites de pescado bien caracterizados (EPA 28, Nippai, Ltd. Tokio, Japón). 10.3.5 Medida de las sustancias reactivas al ácido tiobarbitúrico (TBARS) La medida de TBARS en triplicado se determinó según el método de de Burk et al. (1980) con algunas modificaciones. Se homogeneizaron aproximadamente 20-30 mg de larvas en 1,5 ml de ácido tricoloroacético al 20% con 0,05 ml de BHT (Ultra Turrax; IKAWerke, T25 BASIC, Staufen, Alemania). A continuación se añadieron 2,95 ml de ácido tiobarbitúrico 50mM, antes de mezclarlo y calentarlo 10 min a 100ºC. Tras dejarlo enfriar y retirar los precipitados de proteína por centrifugación (Sigma 4K15, Osterode y Harmz, Alemania) a 2000 X g. El sobrenadante se leyó en un espectrofotómetro (Evolution 300, Thermo Scientific, Cheshire, Reino Unido) a 532 nm. La concentración de malonaldehído se expresó como nmol de MDA por g de tejido usando el coeficiente de extinción 0.156 µM-1 cm-1 aplicando la siguiente fórmula: nmol MDA/g tejido = muestraPeso A50 156.0 × 10.3.6 Determinación del contenido de vitamina E La concentración de vitamina E (α-tocoferol) se estimó en muestras de dietas y larvas usando cromatografía líquida de alta presión (HPLC) con detección UV tras la saponificación de las muestras. Este análisis se realizó durante una estancia en el Instituto de Acuicultura de la Universidad de Stirling (Escocia, Reino Unido). 10.236.1 Preparación de los estándares y curva de calibrado La cuantificación de la vitamina E se llevó a cabo tras la comparación con (+)-αtocoferol (Sigma-Aldrich, Madrid, España) como estándar externo. Para preparar los estándares, se preparó una solución madre de 1 mg ml-1 en 25 ml de metanol, añadiendo 37 mg de aceite en 25 ml de metanol. Se tomaron 200 µl de la solución madre y se añadieron a 10 ml de metanol para así obtener una concentración de trabajo de 20 µg ml-1. Su absorbancia se leyó a una longitud de 293 nm en una cubeta de plástico usando como blanco el metanol. Se empleó la siguiente ecuación para calcular la concentración de vitamina E: Resumen 263 Clearing Column dentro de un tubo de 50 ml, para ser centrifugadas a 12000 x g durante 10 min a una temperatura de 20-25ºC. Se traspasó el lisado y se le añadió 4 ml de isopropanol. La purificación del ARN se llevó a cabo usando una bomba de vacío (Vacuum Manifold, Promega, Milán, Italia), por lo que no fue necesario centrifugar las muestras. Se vertieron las muestras lisadas dentro de una columna PureYieldTM Binding Column y a continuación se le aplicó el vació, para que así la muestra pasase a través de la columna. Sucesivamente, se añadieron 20 y 10 ml de la solución de lavado del ARN a la columna y se volvió a aplicar el vacío. Después de 3 min de vacío en seco, se añadió 1 ml de agua libre de nucleasas a la columna, se incubó a temperatura ambiente durante 2 min y se aplicó nuevamente el vacio. El ARN purificado se almacenó en el - 80ºC en eppendorf libres de ARNasas. 10.3.10.2 Control de calidad del ARN La medida de la concentración del ARN así como de su calidad se hizo usando un espectrofotómetro Bio-Rad SmartSpec Plus. La pureza se estimó a un radio de absorbancia 260:280, estimando que un ratio mayor de 1,8 indicaba que la muestra poseía un alto nivel de pureza y que no estaba contaminada por proteínas (McKenna et al., 2000). Además, se estimó la degradación del ARN al analizar 2µg de ARN total por electroforesis en un gel de agarosa al 1%. Las muestras se sometieron a una corriente eléctrica de 90 V durante 45 min y a continuación el gel fue visualizado con un transluminador de UV (Bio-Rad UV Transluminator 2000). 10.3.10.3 Síntesis de cADN El ADN complementario (cADN) se genera típicamente del ARN mensajero (mARN) por la acción de la transcriptasa retroviral reversa que retrotranscribe una única hebra de ARN en un único cADN. Tras el tratamiento con ADNasa (Invitrogen, Milán, Italia), se retrotranscribieron 3 μg de ARN total en cADN en un volumen de 12 μl, incluyendo 1 μl de cebadores dT16 (50pmol) y 1 μl de trifosfatos deoxynucleotido 10 mM (dNTPS). Esta mezcla se calentó a 65ºC durante 5 min, después se enfrió en hielo y se añadieron 4 μl de tampón de transcripción 5x, 2 μl de ditiotreitol 0,1 M, 1 μl de ARNase out y 1 μl de virus de leucemia murina de Moloney (M-MLVRT). Tras la incubación a 37ºC durante 50 min, la reacción se paró al calentarla a 75ºC durante 15 min. Resumen 264 10.3.10.4 Clonado y secuenciación Para amplificar las secuencias seleccionadas de los cebadores, se llevó a cabo una PCR “touch up”. La selección de este tipo específico de PCR se debió a la amplia variedad de temperaturas de “melting” de los primers. En este sentido, con una PCR “touch up”, la temperatura inicial de 54ºC incrementa 0,5ºC en cada ciclo, llegando a una temperatura final de 72ºC. Se llevaron a cabo un total de 30 ciclos para todos los cebadores, usando un termociclador (Mycycler, Bio-Rad, Italia). Se amplificó una alícuota de 4 µl de cADN usando 25 µl de GoTaq Green Master Mix (Promega, Milán, Italia) en 50 µl de volumen final, conteniendo 5 µl de tampón de alta fidelidad, 10 mM dNTPS y 50 pmol de cada cebador diseñado. Se realizaron un total de 31 ciclos de amplificación de PCR para todos los cebadores utilizando un termociclador automatizado (MyCycler, BioRad, Italia). Una alícuota de cada muestra se sometió a electroforesis en gel de agarosa al 1% en tampón 1X tris-acetato-EDTA (TAE) (BioRad, Italia) y se detectaron las bandas con bromuro de etidio. Junto a las muestras se aplicó un marcador de peso molecular (100 bp+1,5 Kb) para controlar el peso molecular del ADN, así como con un control negativo que constaba de la mezcla de reacción sin contener el cADN, conformando de este modo la ausencia de contaminación genómica. Antes de clonar, se purificó el producto de la PCR cortando un fragmento de ADN del peso molecular previsto del gel y procesándolo con el kit Wizard Clean-up System (Promega, Milán, Italia) de acuerdo a las instrucciones de los fabricantes. Tras disolver el fragmento de gel se colocó en una minicolumna SV y se incubó durante 1 min a temperatura ambiente. Las columnas se centrifugaron a 14000 x g durante 1 min, se desechó la fase acuosa y se lavó con 700 µl de la solución de lavado de membrana diluída en etanol al 95%. Tras la centrifugación, la minicolumna se dispuso en un nuevo tubo de microcentrifugación y se disolvió con 50 µl de agua libre de ARNasas. La concentración del producto de PCR purificado se midió utilizando el espectrofotómetro. La cantidad de producto de PCR a incluir en la reacción de clonación se calculó con la siguiente fórmula: ratiomolarVectorInsert VectorKb InsertKbVectorng Insertng :× × = Resumen 265 Siendo: ng vector = 50 ng Kb vector = 3,0 Kb Radio molar Inserción:Vector = 3:1 Kb inserción = En este caso los genes tenían una longitud de 200 pares de bases, por tanto 0.2 Kb. El vector de clonaje empleado en este estudio fue pGEM®-T Easy cloning vector system (Promega, Milán, Italia). La unión del producto de PCR se realizó gracias a la actividad intrínseca de la topoisomerasa asociada con preparación comercial del vector de clonación. La reacción de clonación se realizó a 4ºC durante una noche y al día siguiente se añadió 50 µl de bacteria Escherichia coli (Promega, Milán, Italia) a la mezcla y se incubó en hielo durante 30 min. A continuación se realizó un choque térmico en un baño maría (40ºC) sin agitar durante 45 seg para posteriormente ponerlo en hielo durante 2 min. A continuación se añadieron 940 µl de medio SOC (Sigma) y la mezcla se incubó a 37ºC durante 2 h en un agitador. La mezcla conteniendo las células transformadas se extendió en tres placas de petri por gen, con el medio selectivo LB Agar y fueron incubadas durante la noche a 37ºC. Las placas de petri contenían además ampicilina (100µg ml-1), X-gal e IPTG. Como resultado, sólo las células que contenían un fragmento de PCR ligado, que contiene un gen resistente a la ampicilina podían crecer. Además, la selección de células con un fragmento de PCR ligado se basó en la reacción metabólica colorimétrica del X-gal por el gen Laczα, ya que la ligación del producto de PCR resultaría en una interrupción del gen, lo que causa colonias blancas. Se eligieron cinco colonias por gen, que fueron disueltas en 20 µl de agua libre de ARNasas, utilizando 4 µl de esta solución para hacer una nueva PCR. De acuerdo a la calidad de las bandas, se eligió una colonia y se cultivó toda la noche a 37ºC en agar LB con ampicilina. El vector del plásmido fue purificado usando el kit Pureyield Midiprep System (Promega, Milán, Italia), siguiendo las indicaciones del manual. La columna se purificó con 30 µl de agua libre de ARNasas, se calculó su concentración con un espectrofotómetro y se conservó a -20ºC. Los extractos se secaron y se enviaron a BMR Genetics (Padova, Italia) para su secuenciación en ambas direcciones (T7 y SP6). 10.3.10.5 Cuantificación por “one-step” RT-PCR con sondas TaqMan Cien nanogramos del ARN total extraído de las muestras experimentales se sometieron a PCR a tiempo real en las mismas condiciones que se emplearon para Resumen 266 crear curvas estándares, necesarias para determinar la concentración absoluta del ARNm. Los cebadores de tiempo real Assays-by-Design™ y las sondas fluorogénicas específicas de cada gen se diseñaron por Applied Biosystems (ABI). Las sondas TaqMan® usadas se muestran en la Tabla 10.9. Table 10.9 Sondas TaqMan® de los genes empleados en la presente Tesis Genes Tipo de cebador Secuencia (5´→3´) Cebador Forward ATGGTGTGGGACTTCTGGAG CAT Cebador Reverse GCTGAACAAGAAAGACACCTGATG Sonda TaqMan® CAGACACTCAGGCCTCA Cebador Forward TGGAGACCTGGGAGATGTAACTG SOD Cebador Reverse TCTTGTCCGTGATGTCGATCTTG Sonda TaqMan® CAGGAGGAGATAACATTG Cebador Forward AGTTAATCCGGAATTCGTGAG GPX Cebador Reverse AGCTTAGCTGTCAGGTCGTAAAAC Sonda TaqMan® AATGGCTGGAAACGTG Cebador Forward GCAGTTTGTGTGTGGAGAGAGA IGF-I Cebador Reverse GACCGCCGTGCATTGG Sonda TaqMan® CTGTAGGTTTACTGAAATAAAA Cebador Forward TGCAGAGACGCTGTGTGG IGF-II Cebador Reverse GCCTA CTGAAATAGAAGCCTCTGT Sonda TaqMan® CAAACTGCAGCGCATCC Cebador Forward ACTTTACAGGCGGCGTGA Calpn Cebador Reverse GGCTCTGCTGATGATGTTGTAGA Sonda TaqMan® TCAGATCGTACATTTCCG Cebador Forward CCTCTTCCAGCCTTCCTTCA α-actin Cebador Reverse TGTTGTAGGCGGTCTCATGGATA Sonda TaqMan ® CCAGCAGACTCCATACCGA Cebador Forward TGGAGAAGATGTGCCGTACTCT MyHC Cebador Reverse CGTGTCATTGATTTGACGGACATTT Sonda TaqMan® AACTGAGTGAACTGAAGACC La PCR se llevó a cabo en un sistema de PCR a tiempo real StepOne (Applied Biosystems). Para reducir errores de pipeteo, se prepararon cantidad suficiente de mezcla para hacer reacciones en duplicado (2 x 30 μl) de cada muestra. Resumen 267 10.3.10.5.4. Cuantificación de las muestras Los datos de las PCR se recogieron con el programa StepOne™ v 2.0. Los valores de Ct corresponden con el número de ciclos en los que la emisión fluorescente superaba el límite umbral. Los valores Ct se usaron para crear curvas estándares que sirviesen como base para el cálculo de las cantidades absolutas de ARNm en el ARN total (nº de moléculas/ng de ARN total). 10.4.11 Análisis estadístico Los análisis estadísticos realizados en la presente Tesis se llevaron a cabo empleando en programa SPSS (SPSS para Windows 14.0; SPSS Inc., Chicago, IL, EEUU, 2005). Se consideró un nivel de significancia del 5% (P<0.05) en todas las pruebas estadísticas. Para cada parámetro medido se calculó la media aritmética como una estima de la media poblacional junto con la desviación estándar (SD) para representar así la distribución de las muestras. 10.4.11.1 Pruebas paramétricas Las pruebas paramétricas se realizaron una vez que se comprobó que las observaciones se hicieron al azar y que las varianzas eran independientes. Además, las varianzas debían de ser homogéneas y los datos estar distribuidos normalmente. Cuando los datos no cumplían estos requisitos, se realizaba una prueba no paramétrica (Sección 10.2.11.2). Se usó el test de Levene para determinar la normalidad y homogeneidad de las varianzas y una vez que se cumplieron los supuestos, se analizaron usando un análisis de varianza de una vía (ANOVA) y cuando existieron diferencias entre los datos (P<0.05), se aplicó la comparación post-hoc de Duncan usando el SPSS. Para la aplicación del ANOVA de una vía se usó el siguiente modelo linear general: Yij = µ + α i + ε ij donde Yij es la media del valor del tanque, µ es la media de la población, α i es el efecto fijo de la dieta y ε ij es el error residual. Además, se usó un modelo lineal general de dos variables para analizar los datos de biología molecular. Así, el factor “tiempo de muestreo” se incluyó dentro del modelo, permitiendo observar diferencias entre las variables dieta, efecto del tiempo y sus interacciones. El modelo empleado fue: Resumen 268 Yijk = µ + α i + δ j + ( αδ )ij + ε ijk Donde Yij es el valor medio del tanque, µ es la media de la población, α i es el valor fijo de la dieta, δ j es el factor fijo del tiempo, ( αδ )ij es la interacción entre dieta y tiempo y eij es el error residual. 10.4.11.2 Pruebas no paramétricas Los datos que no cumplieron los supuestos de las pruebas paramétricas o los categóricos se analizaron usando pruebas no paramétricas. Se utilizó el test de KruskallWallis y las medias con diferencias significativas se identificaron con el post-hoc chi cuadrado. Resumen 269 10.5 Resúmenes de los experimentos 10.5.1 Capítulo 3: La inclusión de α-tocoferol en microdietas para larvas de lubina (Dicentrarchus labrax) mejora la supervivencia y reduce la incidencia de lesiones musculares causadas por un exceso de DHA El objetivo del presente trabajo fue investigar el efecto de distintos niveles de vitamina E y ácidos grasos poliinsaturados (LC-PUFA), principalmente DHA, sobre el crecimiento, supervivencia, composición bioquímica y morfología muscular de la lubina durante los primeros estadios de su desarrollo larvario. Para ello, se llevó a cabo un experimento empleando dietas con la misma composición proximal y distintos niveles de aceite concentrado en DHA (1, 3 y 5 % peso seco) y vitamina E, α-tocoferil acetato; (150 y 300 mg 100 g-1 peso seco). El DHA se depositó rápidamente en los tejidos y se asoció a alta mortandad larvaria, probablemente debido a efectos de la peroxidación. Además, el incremento del DHA en dietas hasta un 5% aumentó plausiblemente la incidencia de lesiones musculares y la presencia de pigmento ceroide en los hepatocitos. Sin embargo, el aumento de vitamina E redujo marcadamente la incidencia de estos signos, incrementando el contenido de diversos PUFA en los tejidos larvarios así como mejorando el crecimiento y la resistencia al estrés. Además, cuando las larvas ingirieron altos niveles de vitamina E, mostraron una mejora en su crecimiento cuando el DHA se incrementó de un 1 a un 3%. Por tanto, un nivel de 3 % de DHA y 300 mg 100 g -1 de vitamina E parecen ser adecuados para conseguir un buen rendimiento en larvas de lubina y evitar la aparición de lesiones musculares. Resumen 270 10.5.2 Capítulo 4: Estado oxidativo y cambios estructurales en el músculo de larvas de lubina alimentadas con dietas con un alto contenido de DHA En el estudio anterior se observó distrofia muscular en larvas de lubina de 48 días de edad alimentadas con dietas desequilibradas en DHA y vitamina E. Para comprender los efectos asociados al estrés oxidativo, se llevó a cabo un estudio estructural tras alimentar a larvas de 14 días de edad con microdietas con distintos ratios de DHA/vitamina E (1/150, 5/150 y 5/300). No se apreciaron lesiones en las larvas alimentadas con la dieta 1/150, en contraposición con las larvas alimentadas con un 5% de DHA, en las que se observaron lesiones musculares y valores altos de TBARS. En las secciones semifinas se apreciaron lesiones focales constituidas por miofilamentos hipercontraidos, así como extensa vacuolización citoplasmática afectando tanto a músculo blanco como rojo. En las secciones ultrafinas se observó la dilatación difusa del retículo sarcoplásmico, desorganización de miofilamentos y vacuolas autofágicas conteniendo cuerpos densos y figuras de mielina. Además se observaron algunos monocitos-macrófagos alrededor de las fibras afectadas, así como numerosas células satélite. Los resultados del presente trabajo refuerzan las conclusiones observadas en el Capítulo 3 donde se muestra el potencial patológico de los radicales libres en la musculatura de las larvas de lubina, sin que este efecto haya podido ser atenuado mediante la inclusión de vitamina E en las dietas. Resumen 271 10.5.3 Capítulo 5: La inclusión de selenio disminuye los indicadores de estrés oxidativo en larvas de lubina alimentadas con microdietas altas en DHA En los estudios anteriores se demostró que el músculo de las larvas de lubina es muy sensible al daño de los radicales libres generados por un exceso de ácido docosahexaenóico (DHA) en sus dietas. Sin embargo, el incremento de vitamina E combinado con un alto nivel de DHA no consigue reducir la incidencia de estas lesiones. Este hecho sugiere que la inclusión de otros nutrientes con función antioxidante, como el selenio (Se), podría ayudar a prevenir estas lesiones. Por tanto, el objetivo del presente trabajo fue estudiar el efecto de la inclusión de Se en microdietas con un alto contenido de DHA y vitamina E (5/300 y 5/300+Se) sobre el crecimiento, supervivencia, composición bioquímica, morfología muscular, así como la expresión de miosina, IGFs y enzimas antioxidantes. La inclusión de Se favoreció el crecimiento de las larvas y redujo la incidencia de lesiones musculares, contenido de malonaldehído (MDA) y la expresión de las enzimas antioxidantes. Por el contrario, la expresión de IGFs se vio incrementada en las larvas alimentadas con la dieta 5/300 sugiriendo un aumento de la mitogénesis a nivel muscular, hecho que fue corroborado por el incremento en la expresión de miosina en las mismas. Los resultados del presente estudio confirman el efecto beneficioso del Se en la prevención del estrés oxidativo, no solo como una cofactor de la GPX, si no probablemente debido a otras funciones fisiológicas no tan conocidas. Resumen 272 10.5.4 Capítulo 6: La adición de vitaminas C y E mejora la disponibilidad de la vitamina E y reduce los marcadores del estrés oxidativo en larvas de lubina (Dicentrarchus labrax) alimentadas con contenidos altos de DHA. El ácido docosahexaenóico (DHA) es un ácido graso esencial necesario para muchas funciones bioquímicas, celulares y fisiológicas. Sin embargo, el músculo de las larvas de lubina es muy sensible a altos niveles de DHA en la dieta. A pesar de que niveles altos de vitamina E (α-tocoferol, α-TOH) pueden reducir la incidencia de las lesiones, estas aún aparecen. Por tanto, la inclusión de otros nutrientes con funciones antioxidantes complementarias, como la vitamina C (ácido ascórbico, AA), podrían contribuir a prevenir estas lesiones. El objetivo de este estudio fue determinar el efecto de la inclusión de AA en microdietas para larvas de lubina con niveles elevados de DHA y αTOH (5/300 and 5/300+AA) en comparación con una dieta control (1/150). Para ello se estudió el crecimiento, la supervivencia, la composición bioquímica, el contenido en malonaldehído, la morfología del músculo, las deformidades esqueléticas y la expresión de las enzimas antioxidantes, IGFs y miosina (MyHC). El AA demostró ser efectivo para controlar el daño oxidativo en el músculo y reducir el contenido de MDA, aunque no se observó ningún efecto en la prevención de las deformidades. La expresión de las IGFs fue elevada en las larvas 5/300 sugiriendo un incremento en la mitogénesis muscular, hecho que fue corroborado por el incremento en las copias de ARNm de la MyHC. Los resultados del presente estudio demuestran el sinergismo entre las vitaminas E y C cuando las dietas para larvas de lubina contienen altos niveles de DHA. Resumen 279 En estadios más tardíos (a partir de los 35 dph), parece ser que un 5% de DHA es adecuado para alcanzar un mayor crecimiento, tal y como se observó en el Capítulo 7, aunque la incidencia de lesiones musculares aún era mayor que en las larvas alimentadas con la dieta 1/150. Quizás en estos estadios de desarrollo la inclusión de 300 mg 100 g-1 de vitamina E es adecuada para evitar la incidencia de lesiones musculares, no obstante, no se probó esta dieta en larvas mayores de 35 dph y además estas larvas comieron una dieta con el 5% de DHA a partir de los 14 dph. Atendiendo a los resultados obtenidos en el Capítulo 3, la dieta con un 3% de DHA y 300 mg 100 g-1 de vitamina E fue la más adecuada para conseguir mejor rendimiento del cultivo y más baja incidencia de lesiones musculares. A falta de otros parámetros, a partir de los 35 dph, la dieta 3/300 parece ser la idónea. Por tanto, es necesario un incremento de DHA cuando las larvas están creciendo. Este hallazgo indica que aunque las larvas tienen mayor tasa metabólica que los juveniles, la cantidad de cada nutriente en las dietas para larvas no tiene que ser necesariamente mayor que en el caso de los juveniles para satisfacer las demandas fisiológicas de las larvas. ¿Cuáles son los cambios fisiológicos implicados en la distrofia muscular en larvas de lubina? Las lesiones microscópicas observadas en el músculo esquelético muestran las características típicas de la distrofia muscular nutricional, caracterizada por una necrosis segmentaria que afecta a ambos tipos de fibra. Ya se había descrito la distrofia muscular en relación con el déficit de vitamina E en adultos y juveniles de distintas especies de peces (Lovell et al., 1984; Gatlin et al., 1986; Frischknecht et al., 1994; Bowater y Burren, 2007). Sin embargo no hay información disponible en larvas o sobre las alteraciones implicadas en la aparición de estas lesiones. Los cortes semifinos aportaron más información sobre la cronología de la distrofia muscular nutricional (Capítulos 4, 5, 6 y 7). Uno de los cambios más evidentes fue la presencia de vacuolas grandes y claras dentro del citoplasma, que desplazaban otros elementos del sarcoplasma. Además, se apreciaron variaciones en el diámetro de las fibras en los cortes transversales, así como un marcado edema entre las fibras musculares, con pérdida de la arquitectura normal del miotomo. Además se observaron fibras oscuras y encogidas rodeadas por una membrana celular intacta, lo cual se correspondía con una condensación del sarcoplasma. Resumen 280 Las secciones de TEM revelaron la dilatación de los orgánulos, especialmente del retículo sarcoplásmico y de las mitocondrias. Una consecuencia conocida del ataque de los ROS es la modificación oxidativa de los lípidos de unión de membrana, lo que causa daño en la membrana (Farooqui y Horrocks, 1998) junto a la inhibición de enzimas responsables de la regulación del metabolismo celular como la Na/K-ATPasa. La alteración de estas enzimas puede causar entrada masiva de Ca2+, Na+ y agua en el retículo endoplásmico, lo que causa la alteración de esta estructura y la consiguiente formación de vacuolas. Además, el incremento del Ca2+ sarcoplásmico puede ocasionar la apertura del poro de permeabilidad transitoria de la mitocondria, lo que causa una pérdida de componentes de la matriz, alteración en la funcionalidad mitocondrial e hinchazón de los orgánulos con la subsecuente ruptura de la membrana externa y liberación del citocromo c (Green y Reed, 1998; Kolkatowski y Vercesi, 1999). El incremento en Ca2+ ha sido corroborado por la mayor expresión de la µ-calpaína (Capítulo 7), ya que las concentraciones de Ca2+ intracelular estimulan la actividad de las calpaínas (Mongini et al., 1988; Hopf et al., 1996). El citocromo c es un factor inductor de la apoptosis y su liberación al sarcoplasma puede disparar la apoptosis. Sin embargo, en el presente estudio no se observaron signos morfológicos de apoptosis. El análisis morfológico de la apoptosis es difícil, debido a la rapidez de la destrucción celular y a que normalmente solo implica la muerte de una célula aislada (Fidzianska, 2002). Por tanto, el único tipo de muerte celular observado en este estudio fue la necrosis, sin embargo, la apoptosis no puede ser descartada como muerte celular en el músculo de lubina. En términos generales, los hallazgos de TEM fueron similares a los encontrados en mamíferos con trastornos neuromusculares, como la distrofia muscular de Duchene, la isquemia o la atrofia por denervación. Por ejemplo, las figuras de mielina representan material endógeno producido por peroxidación lipídica en mamíferos (DeGritz et al., 1994) o las vacuolas autofágicas son lisosomas secundarios frecuentes en muchas alteraciones neuromusculares de los mamíferos (Nishino, 2006). Finalmente, los halos sarcoplásmicos son un hallazgo común en las alteraciones musculares genéticas de los humanos (Farkas et al., 1974). Para resumir, un exceso de producción de ROS debido al mayor contenido de PUFA en los tejidos es el causante de la distrofia muscular, que posee rasgos similares a las distrofias musculares genéticas de los mamíferos. Resumen 281 ¿Hay un proceso de regeneración muscular en peces? Se sabe poco sobre la regeneración tisular en peces, pero parece lógico pensar que podría haber cierta regeneración en las larvas, dado que son organismos de crecimiento rápido, con una gran capacidad para formar células nuevas. Uno de los estudios que versan sobre regeneración muscular en peces (Rowlerson et al., 1997) demostró una regeneración marcada en juveniles de dorada tras un daño mecánico, siendo la expresión de miosina en las fibras regeneradas similar a la de las nuevas fibras producidas en el músculo blanco post-larval. Igualmente, en la presente tesis se observó una mayor expresión de la MyHC en las larvas alimentadas con un 5% de DHA independientemente del nivel de vitamina E (Capítulos 5, 6 y 7). En este sentido, se encontró una correlación positiva entre la incidencia de lesiones musculares y el número de copias de ARNm de la MyHC (Capítulos 5 y 6). Sin embargo, la expresión de la αactina no indicó ningún proceso regenerativo, al contrario de lo que ha sido establecido en mamíferos (Takano et al., 2010). Otro indicador de la regeneración muscular en mamíferos es el incremento en la expresión de la IGF-I (Chargé y Rudnicki, 2004). En los Capítulos 5, 6 y 7 se relacionó el incremento de la IGF-I con las larvas con mayor incidencia de lesiones musculares, confirmando que estas larvas estaban experimentando regeneración muscular. Además la IGF-I parece ser capaz de regular la población de células satélite, que son las responsables de la capacidad de regeneración del músculo. Sin embargo en la presente tesis no se cuantificó ni el número ni el diámetro de estas células, aunque parecía que el mayor número de las mismas estaba relacionado con la mayor incidencia de lesiones musculares (observación personal, Capítulo 4). Además, se ha comprobado que las IGFs pueden activar la proliferación celular y la síntesis de ADN en las células embrionarias del pez cebra, sugiriendo que el incremento del número de copias del mARN del IGF-I observado en la presente tesis en las larvas con mayor número de lesiones puede ser debido al proceso regenerativo llevado a cabo por las células satélite. ¿Niveles altos de DHA pueden afectar a la mineralización en larvas de lubina? A la vista de los resultados obtenidos en la presente tesis, la respuesta a esta pregunta es rotundamente sí. En contraste con trabajos previos en los que el DHA parecía tener un efecto positivo en la mineralización y la incidencia de deformidades en el chano (Chanos chanos; Gapasin y Duray, 2001) y en el bocinegro (Pagrus pagrus, Roo et al., 2009), en esta tesis el incremento de la peroxidación debido a niveles Resumen 282 elevados de DHA reducen la mineralización e incrementan las deformidades, como ha sido señalado en larvas de dorada (Izquierdo et al., enviado). Por tanto, el ajuste de los niveles de DHA es necesario para reducir las deformidades y favorecer la mineralización ósea. Por otro lado, la inclusión de selenio orgánico en dietas con un 5% de DHA no parece reducir la incidencia de deformidades (Capítulo 5), en contraste a la adición de vitamina C. Estos resultados no son sorprendentes ya que indican que la vitamina C juega un papel más activo que el selenio en el desarrollo óseo. En este sentido, un trabajo previo en el que se estudió el efecto del selenio en el desarrollo óseo de larvas de bacalao demostró que este mineral no tenía efectos sobre la tasa de deformidades (Penglase et al., 2010). Resumen 283 10.7 Conclusiones 1. Las dietas con niveles altos de DHA causan bajo crecimiento y supervivencia, aumento de deformidades esqueléticas y favorecen la aparición de lesiones musculares en larvas de lubina. 2. La distrofia muscular aparece como consecuencia de la peroxidación lipídica in vivo causada por niveles excesivos de DHA, tal y como indican los contenidos elevados de TBARS y la sobreexpresión de las enzimas antioxidantes. 3. La evaluación microscópica de las lesiones reveló que una de las primeras alteraciones tiene lugar en la membrana muscular, probablemente debido al ataque directo de los radicales libres a la membrana de fosfolípidos, causando alteración de la permeabilidad y consecuente hinchazón de los orgánulos. El calcio entra de forma masiva en la célula activando la µ-calpaína, induciendo la lisis de las proteínas. 4. Las secciones ultrafinas mostraron dilatación difusa del retículo sarcoplásmico, desorganización de los miofilamentos y vacuolas autofágicas. Así mismo, se observaron figuras de mielina y cuerpos densos, así como halos sarcoplásmicos. No se encontraron signos de apoptosis, sugiriendo que la muerte celular que acontece en la distrofia nutricional muscular en las larvas de lubina es preferentemente la necrosis. 5. Cuando se incluye un 1 o un 3% de DHA en las dietas para larvas de lubina, el incremento de vitamina E de 150 a 300 mg 100 g-1 mejora el crecimiento y la supervivencia. Sin embargo cuando el nivel de DHA sube hasta un 5%, aparece distrofia muscular en las larvas, sin que el incremento de vitamina E hasta 300 mg 100 g-1 pueda evitarlo. 6. Niveles de DHA del 5% en combinación con 300 mg 100 g-1 de vitamina E indujeron de manera contundente la expresión de las enzimas antioxidantes, como un intento para dismutar las especies reactivas al oxígeno y defender a las células de su ataque. 7. Con la inclusión de selenio orgánico (5 mg kg-1) en dietas con un 5% de DHA y 300 mg 100 g-1 de vitamina E se controló la peroxidación lipídica in vivo, se disminuyó la incidencia de lesiones musculares y se incrementó el crecimiento en comparación con la dieta sin este mineral, pero no tuvo ningún efecto en las deformidades. No se Resumen 284 observó ningún efecto directo entre la suplementación con selenio y la expresión de la enzima glutatión peroxidasa. 8. La adición de 180 mg 100 g-1 de vitamina C a dietas con alto riesgo de causar oxidación ayudó a reducir el estrés oxidativo en las larvas de lubina, aumentando el crecimiento y reduciendo la incidencia de lesiones musculares y deformidades craneales. La falta de efectos en la expresión de las enzimas antioxidantes indicó que la vitamina C ejerce su función antioxidante mediante otro mecanismo. 9. Se encontró un crecimiento muscular compensatorio en las larvas alimentadas con contenidos altos de DHA, tal y como indica el incremento de expresión de los factores de crecimiento insulínico y de la cadena pesada de la miosina, así como por las abundantes células satélites observadas alrededor de las fibras musculares dañadas. 285 References Aceto A, Amicarelli F, Sacchetta P, Dragani B, Bucciarelli T, Masciocco L, Miranda M and Di Ilio C (1994) Developmental aspects of detoxifying enzymes in fish (Salmo salar). Free Radical Research 21, 285-294. Agarwal A, Gupta S, Sikka S (2006) The role of the free radicals and antioxidants in reproduction. Current Opinion in Obstetrics and Gynecology 18, 325-332. Agrawal NK and Mahajan CL (1980) Nutritional deficiency disease in an Indian major carp, Cirrhina mrigala Hamilton, due to avitaminosis C during early growth. Journal of Fish Diseases 3, 231-248. Almeida JR, Oliveira C, Gravato C and Guillermino L (2010) Linking behavioral alterations with biomarkers responses in the European sea bass Dicentrarchus labrax L. exposed to the organophosphate pesticide fenitrothion. Ecotoxicology 19, 1369-1381. Allen RE and Boxhorn LK (1989) Regulation of skeletal muscle satellite cell proliferation and differentiation by transforming growth-factors beta, insulin-like growth factor I and fibroblast growth factor. Journal of Cell Physiology 138, 311-315. Al-Moudi MM, El-Nakkadi AMN and El-Nouman (1992) Evalution of optimum dietary requirement of vitamin C for the growth of Oreochromis spilurus fingerlings in water from the Red Sea. Aquaculture 105, 165-173. Álvarez MJ, López-Bote CJ, Diez A, Corraze G, Arzel J, Dias J, Kaushik SJ and Bautista MJ (1998) Dietary fish oil and digestible protein modify susceptibility to lipid peroxidation in the muscle of rainbow trout (Oncorhyncus mykiss) and sea bass (Dicentrarchus labrax). British Journal of Nutrition 80, 281-289. Alves Martins D, Betancor MB, Caballero MJ, Mesa-Rodríguez A, Roo J, Izquierdo MS (2011) Interactions of pro-oxidant and anti-oxidant nutrients in relation to skeleton development in Dicentrarchus labrax larvae. II International Workshop: Interdisciplinary Approaches in Fish Skeletal Biology, Tavira, Portugal. Amezaga MR and Knox D (1990) Riboflavin requirements in on-growing rainbow trout, Oncorhynchus mykiss. Aquaculture 88, 87-98. A.O.A.C. (1995) Official methods for analysis, 16th ed. A.O.A.C International, Washington, D.C. Apel K and Hirt H (2004) Reactive oxygen species: metabolism, oxidative stress and signal transduction. Annual Review in Plant Biology 55, 373-399. APROMAR (2010) La acuicultura marina de peces en España. 69 pp. Arjmandi BH, Juma S, Beharka A, Bapna MS, Akhter M and Meydani SN (2002) Vitamin E improves bone quality in the aged but not young adult male mice. The Journal of Nutritional Biochemistry 13, 543-549. Arnaiz R, Coo A, Corcobado-Oñate F, Rua N and Amoedo F (1993) Una hipótesis nutricional de la mortalidad larvaria asociada al periodo crítico. Órganos y desarrollo larvario del General Introduction 286 rodaballo (Scophtalmus maximus) y la dorada (Sparus aurata). Necesidades de DHA. Actas del IV Congreso Nacional de Acuicultura, 73-78. Arteel GE and Sies H (2001) The biochemistry of selenium and the glutathione system. Enviromental Toxicology and Pharmacology 10, 153-158. Aruoma OI (1998) Free radicals, oxidative stress and antioxidants in human health and disease. Journal of the American Oil Chemists´ Society 75, 199-212. Asada K, Kiso K and Yoshikawa K (1974) Univalent reduction of molecular oxygen by spinach chloroplasts on illumination. The Journal of Biological Chemistry 249, 2175-2181. Asayama K, Dettbarn WD and Burr IM (1986) Differential effect of denervation on free radical scavenging enzymes in slow and fast muscle of rat. Journal of Neurochemistry 46, 604609. Atalah E (2008) Importance of the proportions of dietary polyunsaturated fatty acids and antioxidants in larval development of marine fish. PhD Thesis. University of Las Palmas de Gran Canaria, pp 242. Atalah E, Hernández-Cruz CM, Ganuza E, Benítez-Santana T, Ganga R, Roo J, FernándezPalacios H. and Izquierdo MS (2011) Enhancement of gilthead sea bream (Sparus aurata) larval growth by dietary vitamin E in relation to two different levels of essential fatty acids. In press at Aquaculture Research DOI: 10.1111/j.1365-2109.2011.02989.x Atalah E, Hernández-Cruz CM, Ganuza E, Benítez-Santana T, Ganga R, Roo J, FernándezPalacios H and Izquierdo MS (2010) Combined effect of vitamin C and vitamin E microdiets for gilthead sea bream, Sparus aurata. XIVth Inthernational Symposium on Fish Nutrition and Feeding. May 31-June 4, Quingdao, China. Awad JA, Morrow JD, Hill KE, Roberts LJ and Burk RF (1994) Detection and localization of lipid peroxidation in selenium and vitamin E deficient rats using F-2-isoprostanes. Journal of Nutrition 124, 810-816. Ayala MD, López-Albors O, Gil F, Ramírez-Zarzosa G, Abellán E and Moreno F (1999) red muscle development of gilthead sea bream Sparus aurata (L): structural and ultrastructural morphometry. Anatomia, Histologia, Embryologia 28, 17-21. Bai SC and Lee KJ (1998) Different levels of dietary DL-alpha-tocopheryl acetate affect the vitamin E status of juvenile Korean rockfish Sebastes schlegeli. Aquaculture 161, 403412. Bai XC, Lu D, Liu AL, Zhang ZM, Li XM, Zou ZP, Zeng WS, Cheng BL and Luo SQ (2005) Reactive oxygen species stimulates receptor activator of NF-kappaB ligand expression in osteoblast. The Journal of Biological Chemistry 280, 17497-17506. Baker RTM and Davies SJ (1996) Increased production of docosahexaenoic acid (22:6 n-3, DHA) in catfish nutritionally stressed by the feeding of oxidized oils and the modulatory effect of α-tocopheryl acetate. Journal of Fish Biology 49, 748-752. Baker RTM (1997) The effect of dietary α-tocopherol and oxidized lipid on post-thaw drip from catfish muscle. Animal Feed Science Technology 65, 35-43. 287 Baker RTM and Davies SJ (1997) Modulation of tissue α-tocopherol in African catfish, Clarias gariepinus (Burchell), fed oxidized oils, and the compensatory effect of supplemental dietary vitamin E. Aquaculture Nutrition 3, 91-97. Bancroft JD and Stevens A (1996) Theory and practice of histological techniques. 4th edition. Churchill-Livinsgtone. New York. Barnabé G (1974) Mass rearing of the bass Dicentrarchus labrax. Pp. 749-753. In: The life history of fish, JHS Blaxter (Ed.) Symp. Oban. Scotland, May 1973. Barnabé G and Guissi A (1994) Adaptation of the feeding behaviour of larvae of the sea bass, Dicentrarchus labrax (L.) to an alterning live-food/compound-food regime. Aquatic Fisheries Management 25, 537-546. Barnes MJ and Kodicek E (1972) Biological hydroxylations and ascorbid acid with special regard to collagen metabolism. Vitamins and Hormones 30, 1-43. Baskerville-Bridges B and Kling LJ (2000) Development and evaluation of microparticulate diets for early weaning of Atlantic cod (Gadus morhua) larvae. Aquaculture Nutrition 6, 171182. Basu-Modak S and Tyrrel RM (1993) Singlet oxygen: A primary effector in the ultraviolet A/nearvisible light induction of the human heme oxygenase gene. Cancer Research 53, 45054510. Beer AM, Wegener T (2011) Vitamin E for gonarthrosis and coxarthrosis – Results of a postmarkerting surveillance study. MMW Fortschr Med 153, 14-20. Bell JG and Cowey CB (1985) Roles of vitamin E and selenium in the prevention of pathologies related to fatty acid oxidation in salmonids. In: Nutrition and Feeding in Fish. (ed. by: C.B. Cowey, A.M. Mackie & J.G. Bell), pp. 333-347. Bell Academic Press, London. Bell JG, Cowey CB, Adron JW and Shanks AM (1985) Some effects of vitamin E and selenium deprivation on tissue enzyme levels and indices of tissue peroxidation in rainbow trout (Salmo gairdneri). British Journal of Nutrition 53, 149-157. Bell JG, Pirie BJS, Adron JW and Cowey CB (1986) Some effects of selenium deficiency on glutathione peroxidase (EC 1.11.19) activity and tissue pathology in rainbow trout (Salmo gairdneri). British Journal of Nutrition 55, 305-311. Bell JG, Cowey CB, Adron JW and Pirie BJS (1987) Some effects of selenium deficiency on enzyme activities and indices of tissue peroxidation in Atlantic salmon parr (Salmo salar). Aquaculture 65, 43-54. Bell JG and Cowey CB (1989) Digestibility and bioavailability of dietary selenium from fishmeal, selenite, selenomethionine and selenocystine in Atlantic salmon (Salmo salar). Aquaculture 81, 61-68. Bell MV, Batty RS, Dick JR, Fretwell K, Navarro JC and Sargent JR (1995) Dietary deficiency of docosahexaenoic acid impairs vision at low light intensities in juvenile herring (Clupea harengus L.). Lipids 30, 443-449. Bell JG, McEvoy J, Tocher DR and Sargent JR (2000) Depletion of α-tocopherol and astaxanthin in Atlantic salmon (Salmo salar) affects autoxidative defense and fatty acid metabolism. Journal of Nutrition 130, 1800-1808. General Introduction 288 Bell JG, Tocher DR, Henderson RJ, Dick JR and Crampton VO (2003a) Altered fatty acids composition in Atlantic salmon (Salmo salar) fed diets containing linseed and rapseed oils can be partially restored by a subsequent fish oil finishing diet. Journal of Nutrition 133, 2793-2801. Bell JG, McGhee F, Campbell PJ and Sargent JR (2003b) Rapeseed oil as an alternative to marine fish oil in diets of post-smolt Atlantic salmon (Salmo salar): changes in flesh fatty acid composition and effectiveness of subsequent fish oil “wash out”. Aquaculture 218, 515-528. Benítez-Santana T, Masuda R, Juárez-Carrillo E, Ganuza E, Valencia A, Hernández-Cruz CM and Izquierdo MS (2007) Dietary n-3 HUFA deficiency induces a reduced visual response in gilthead seabream Sparus aurata larvae. Aquaculture 264, 408-417. Benjamin M (1990) The cranial cartilages of teleost and their classification. Journal of Anatomy 169, 153-172. Beresford WA (1993) Cranial skeletal tissues: diversity and evolutionary trends. In: Hanken J, Hall BK (Eds.), The Skull: Patterns of Structural and Systematic Diversity, vol. 2. University of Chicago Press, Chicago, pp. 69-130. Betancor MB, Atalah E, Caballero MJ, Benítez-Santana T, Roo J, Montero D and Izquierdo MS (2011) αtocopherol in weaning diets for European sea bass (Dicentrarchus labrax) improves survival and reduces tissue damage caused by excess dietary DHA contents. Aquaculture Nutrition 17, e112-e122. Betancor MB, Caballero MJ, Benítez-Santana T, Raleh R, Roo J, Atalah E and Izquierdo MS. Oxidative status and histological changes in sea bass larvae muscle in response to high dietary content of DHA. Accepted at Journal of Fish Diseases. Betancor MB, Caballero MJ, Terova G, Saleh R, Atalah E, Benítez-Santana T, Bell JG and Izquierdo MS. Selenium inclusion decreases oxidative stress indicators and muscle injuries in sea bass larvae fed high DHA microdiets. Accepted at British Journal of Nutrition. Bischoff R (1994) The satellite cell and muscle regeneration. In: Myology, edited by Engel AG and Franzini-Armstrong C. New York: McGraw-Hill, p. 97-118. Blaxter JHS (1988) Pattern and variety in development. In: Hoar WS, Randall DJ (Eds) The physiology of developing fish Part A. Fish Physiology XI. Academic Press, New York, pp 1-58. Blazer VS (1982) The effect of marginal deficiencies of ascorbic acid and α-tocopherol on the natural resistance and immune response of rainbow trout (Salmo gairdneri). PhD. dissertation, University of Rhode Island. Blomhoff R (2005) Dietary antioxidants and cardiovascular disease. Current Opinion in Lipidology 16, 47-54. Boddeke R, Slijper EJ and Van der Stelt (1959) Histological characteristics of the body musculature of fishes in connection with their mode of life. Proceedings of the Koninklijke Nederlandse Akademie van Wetenschappen 62, 576-588. Bone Q (1966) On the function of the two types of myotomal muscle fibre in Elasmobranch fish. Journal of the Marine Biologist Association UK 46, 321. 295 Gatesoupe FJ (1994) Development of fish larvae and rearing conditions in hatcheries. In: B. Lahlou & P. Vitiello (Eds.), Aquaculture: Fundamental and Applied Research. Am. Geoph. Soc., Washington D.C., 159-172. Gatesoupe FJ and LeMillinaire C (1985) Adaptation de la qualité alimentaire des filtreurs-proies aux besoins nutritifs des larvaes des poissons marins. Coll. Fr-Japan. Oceanogr Marseille 85, 51-63. Gapasin RSJ and Duray MN (2001) Effects of DHA-enriched live food on growth, survival and incidence of opercular deformities in milkfish (Chanos chanos). Aquaculture 193, 49-63. Gatesoupe FJ, Zambonino-Infante JL, Cahu C and Bergot P (2001) Ontogeny, development and digestive physiology of fish larvae. In: Guillaume, J, Kaushik S, Bergot P, Métailler R (Eds), Nutrition and Feeding if Fish and Crustacean. Praxis Publishing Ltd. Chichester, pp 199-212. Gatlin DM and Wilson RP (1984) Dietary selenium requirement of fingerling channel catfish. Journal of Nutrition 114, 627-633. Gatlin DM, Poe WE and Wilson RP (1986) Effects of singular and combined dietary deficiencies of selenium and vitamin E on fingerling channel catfish (Ictalurus punctatus). Journal of Nutrition 116, 1061-1067. Gatta PP, Pirini M, Testi S, Vignola G and Monetti PG (2000) The influence of different levels of dietary vitamin E on sea bass Dicentrarchus labrax flesh quality. Aquaculture Nutrition 6, 47-52. Gebski BL (2009) Investigating TNF inhibition of IGF-1 signalling via JNK in cell culture models of skeletal muscle atrophy. PhD Thesis, University of Western Australia. Geesink J, Morton J, Kent M and Bickerstaffe R. (2000) Partial purification and characterization of Chinook salmon (Oncorhynchus tshawytscha) calpains and an evaluation of their role in post mortem proteolysis. Journal of Food Science 65, 1318-1324. Goldspink G, Wilkes D and Ennion S (2001) Myosin expression during ontogeny, post-hatching growth and adaptation. In: Muscle Development and Growth. Pp. 43-66. Edited by IA Johnston. Academic Press, California. González MM, Izquierdo MS, Salhi M, Hernández-Cruz CM and Fernández-Palacios H (1995) Dietary vitamin E for Sparus aurata larvae. European Aquaculture Society Special Publication 24, 239-242. Gouillou-Coustans MF, Bergot P and Kaushik SJ (1998) Dietary ascorbic acid needs of common carp (Cyprinus carpio) larvae. Aquaculture 161, 453-461. Green DR and Reed JC (1998) Mitochondria and apoptosis. Science 281, 1309-1312. Greer-Walker M (1970) Growth and development of skeletal muscle fibres of cod (Gadus morhua L.). J Cons Perm Int Explor Mer 33, 228-244. Grounds MD (1999) Muscle regeneration: molecular aspects and therapeutic implications. Current Opinion in Neurology 12, 535-543. General Introduction 296 Grounds MD, Radley HG, Gebski BL, Bogoyevitch MA and Shavlakadze T (2008) Implications of cross-talk between tumour necrosis factor and insulin-like growth factor-1 signalling in skeletal muscle. Clinical and Experimental Pharmacology and Physiology 35, 846-851. Guerriero G, Ferro R, Russo GR and Ciarcia G (2004) Vitamin E in early stages of sea bass (Dicentrarchus labrax) development. Comparative Biochemistry and Physiology 138, 435439. Hadlow W.J. (1973) Myopathies in animals. In: The striated muscle (ed. by: C.M. Pearson, F.K. Mostofi), pp. 364-409. Williams and Wilkins, Baltimore. Hall BK and Witten PE (2007) Plasticity of and transitions between skeletal tossues in vertebrate evolution and development. In: Anderson J and Sues DH (eds). Major transactions in vertebrate evolution. Bloominghton Indiana University Press, 56 pp. Halliwell B (1978) Superoxide dependent formation of hydroxyl radicals in the presence of iron chelates. FEBS Letters 92, 321-326. Halliwell B and Gutteridge JM (1990) Role of free radicals and catalytic metal ions in human disease: an overview. Methods in Enzymology 186, 1-85. Halliwell B and Gutteridge JMC (1996) Lipid peroxidation: a radical chain reaction. In: Free Radicals in Biology and Medicine. Pp. 188-266. Edited by B. Halliwell and JMC Gutteridge. Clarendon Press, Oxford. Halliwell B (2006) Reactive species and antioxidants. Redox biology is a fundamental theme of aerobic life. Plant Physiology 141, 312-322. Halver JE (1989) Vitamin C requirements for fish growth and health. In: Shiau SY (ed) Progress in Fish Nutrition. Marine Food Science, Keelung, pp 27-39. Halver JE (2002) The minerals. In: Halver JE, Hardy RW (Eds.), Fish Nutrition, 3rd edition. Academic Press, San Diego, pp 61-141. Hamre K, Hjeltnes B, Kryvi H, Sandberg S, Lorentzen M and Lie Ø (1994) Decreased concentration of hemoglobin, accumulation of lipid oxidation products and unchanged skeletal muscle in Atlantic Salmon (Salmo salar) fed low dietary vitamin E. Fish Physiology and Biochemistry 12, 421-429. Hamre K and Lie Ø (1995a) Minimum requirement of vitamin E for Atlantic salmon (Salmo salar L.) at first feeding. Aquaculture Research 26, 175-184. Hamre K and Lie Ø (1995b) Alpha-tocopherol levels in different organs of Atlantic salmon (Salmo salar L) effect on smoltification, dietary levels of n-3 polyunsaturated fatty acids and vitamin E. Comparative Biochemistry and Physiology A 111, 547-554. Hamre K and Lie Ø (1997) Retained levels of dietary αγand δ-tocopherol in tissue and body fluids of Atlantic salmon (Salmo salar). Aquaculture Nutrition 3, 99-107. Hamre K, Waagbø R, Berge RK and Lie Ø (1997) Vitamins C and E interact in juvenile Atlantic salmon (Salmo salar). Free Radical Biology and Medicine 22, 137-149. Hamre K, Opstad I, Espe M, Solbakken J, Hemre PI and Pittman K (2002) Nutrient composition and metamorphosis success of Atlantic halibut (Hippoglossus hippoglossus) larvae fed natural zooplankton or Artemia. Aquaculture Nutrition 8, 139-148. 297 Hamre K and Harboe T (2008) Critical levels of essential fatty acids for normal pigmentation in Atlantic halibut (Hippoglossus hippoglossus L.) larvae. Aquaculture 227, 101-108. Hamre K, Srivastava A, Rønnestad I, Mangor-Jensen A and Stoss J (2008a) Several micronutrients in the rotifer Brachionus sp. may not fulfil the nutritional requirements of marine fish larvae. Aquaculture Nutrition 14, 51-60. Hamre K, Mollan TA, Sæle Ø and Erstad B (2008b) Rotifers enriched with iodine and selenium increase survival in Atlantic cod (Gadus morhua) larvae. Aquaculture 284, 190-195. Hamre K, Krossoy C, Lock EJ and Moren M (2010) Roles of lipid – soluble vitamins during ontogeny of marine fish larvae. Aquaculture Research 41, 745-750. Hamre K (2011) Metabolism, interactions, requirements and functions of vitamin E in fish. Aquaculture Nutrition 17, 98-115. Hardie LJ, Fletcher TC and Secombes CJ (1990) The effect of vitamin E on the immune response of the Atlantic salmon (Salmo salar L.). Aquaculture 87, 1-13. Hardie LJ, Fletcher TC and Secombes CJ (1991) The effect of dietary vitamin C on the immune response of the Atlantic salmon (Salmo salar L.). Aquaculture 95, 201-214. Hata K and Kaneda T (1980) Effect of autoxidized oil on carp. Bulletin of the Japanese Society for the Science of Fish 46, 997-1000. Haycock JW, Jones P, Harris JB and Mantle D (1996) Differential susceptibility of human skeletal muscle proteins to free radical induced oxidative damage: a histochemical, inmunocytochemical and electron microscopical study in vitro. Acta Neuropathologica 92, 331-340. Hernández-Cruz CM, Salhi M, Bessonart M, Izquierdo MS, González MM and FernándezPalacios H (1999) Rearing techniques for red porgy (Pagrus pagrus) during larval development. Aquaculture 179, 489-497 Hevrøy EM, Jordal AEO, Hordvik I, Espe M, Hemre GI and Olsvik PA (2006) Myosin heavy chain mRNA expression correlates higher with muscle protein accretion than growth in Atlantic salmon, Salmo salar. Aquaculture 252, 453-461. Hevrøy EM, Azpeleta C, Shimizu M, Lanzén A, Kaiya H, Espe M and Olsvik PA (2011) Effects of short-term starvation on ghrelin, GH-IGF system and IGF-binding proteins in Atlantic salmon. Fish Physiology and Biochemistry 37, 217-232. Hidalgo MC, Expósito A, Palma JM and de la Higuera M (2002) Oxidative stress generated by dietary Zn-deficiency: Studies in rainbow trout. International Journal of Biochemistry and Cell Biology 34, 183-193. Hilton JW, Hodson PV and Slinger SJ (1980) The requirement and toxicity of selenium in rainbow trout (Salmo gairdneri). Journal of Nutrition 110, 2527-2535. Hoehne K (1999) Lipid digestive enzymes in developing larvae of the Atlantic cod (Gadus morhua) and turbot (Scophtalmus maximus). PhD Thesis, University of Karlsruhe. Hoffman EO, Flores TR, Coover J and Garret HB (1983) Polychrome stains for high resolution light microscopy. Laboratory Medicine 14, 779-781. General Introduction 298 Holt GJ (1993) Feeding larval red drum on microparticulate diets in a closed recirculating water system. Journal of the World Aquaculture Society 24, 225-230. Hølmer G (1993) Mechanisms of oxidationautooxidation and enzymic oxidation. In: Antioxidants, Free Radicals and Polyunsaturated Fatty Acids in Biology and Medicine (Diplock JM, Gutteridge C & Shukla VKS, eds), pp 15-30. International Food Science Centre A/S, Lystrup, Denmark. Hopf FW, Turner PR, Denetclaw WF Jr, Reddy P and Steinhardt (1996) A critical evaluation of resting intracellular free calcium regulation in dystrophic mdx muscle. American Journal of Physiology 271, C1325-C1339. Hughes FJ, Turner W, Belibasakis G and Martuscelli G (2006) Effects of growth factors and cytokines on osteoblast differentiation. Periodontology 41, 48-72. Hulbert AJ, Faulks S, Buttemer WA and Else PL (2002) Acyl composition of muscle membranes varies with body size in birds. The Journal of Experimental Biology 205, 3561-3569. Hung SSO and Slinger SJ (1980) Measurement of oxidation in fish oil and its effect on vitamina E nutrition on rainbow trout (Salmo gairdneri). Canadian Journal of Fisheries and Aquatic Sciences 37, 1248-1253. Hung SSO, Cho CY and Slinger SJ (1981) Effect of oxidized fish oil, DL-α-tocopheryl acetate and ethoxyquin supplementation on the vitamin E nutrition of rainbow trout (Salmo gairdneri) fed practical diets. Journal of Nutrition 111, 648-654. Huysseune A (2000) Skeletal system. In: Ostrander GK (Ed.), The Laboratory Fish. Part 4. Microscopic Functional Anatomy. Academic Press, San Diego, pp. 307-317. Ibeas C, Izquierdo MS and Lorenzo-Hernández A (1994) Effect of different levels of n-3 highly unsaturated fatty acids on growth and fatty acid composition of juvenile gilthead seabream (Sparus aurata). Aquaculture 127, 177-188. Ikeda D, Ono Y, Snell P, Edwards YJ, Elgar G and Watabe S (2007) Divergent evolution of the myosin heavy chain gene family in fish and tetrapods: evidence from comparative genomic analysis. Physiological Genomics 32, 1-15. Imsland AK, Le François RL, Lamarre SG, Ditlecadet D, Sigurðsson S and Foss A (2006) Myosin expression levels and enzyme activity in spotted wolfish (Anarhichas minor) muscle: a method for monitoring growth rates. Canadian Journal of Fisheries and Aquatic Sciences 63, 1959-1967. Infante JP (1987) Docosahexaenoate-containing phospholipids in sarcoplasmic reticulum and retinal photoreceptors. A proposal for a role in Ca2+-ATPase calcium transport. Molecular and Cellular Biochemistry 74, 111-116. Infante JP, Kirwan RC and Brenna JT (2001) High levels of dosahexaenoic acid (22:6n – 3)- containing phospholipids in high-frequency contraction muscles of hummingbirds and rattlesnakes. Comparative Biochemistry and Physiology B 130, 291-298. Ingerslev HC, Lunder T and Nielsen ME (2010) Inflammatory and regenerative responses in salmonids following mechanical tissue damage and natural infection. Fish and Shellfish Immunology 29, 440-450. 299 Ingold KU, Bowry VW, Stocker R and Walling C (1993) Autooxidation of lipids and antioxidation by alpha tocopherol and ubiquinol in homogeneous solution and aqueous dispersions of lipids: unrecognized consequences of lipid particle size as exemplified by oxidation of human low density lipoprotein. Proceedings of the National Academy of Sciences of the USA 90, 45-49. Isobe K, Nakayama H and Uetsuka K (2008) Relation between lipogranuloma formation and fibrosis, and the origin of brown pigments in lipogranuloma of the canine liver. Comparative Hepatology 7, 5. Izquierdo MS (1988) Estudio de los requerimientos de ácidos grasos esenciales en larvas de peces marinos. Modificación de la composición lipídica de las presas. PhD Thesis, University of La Laguna, 205 pp. Izquierdo MS, Watanabe T, Takeuchi T, Arakawa T and Kitajima C (1989a) Optimal EFA levels in Artemia to meet the EFA requirements of red seabream Pagrus major. In: Takeda M, Watanabe T (eds). The Current Status of Fish Nutrition in Aquaculture. Japan Translation Centre, Tokyo, Japan, pp 221-232. Izquierdo MS, Watanabe T, Takeuchi T. Arakawa T and Kitajima C (1989b) Requirement of larval red seabream Pagrus major for essential fatty acids. Nippon Suisan Gakkaishi 55, 859867. Izquierdo MS, Watanabe T, Takeuchi T, Arakawa T and Kitajima C (1990) Optimum EFA levels in Artemia to meet the EFA requirements of red seabream (Pagrus major). In. M. Takeda and T. Watanabe (editors). Status of Fish Nutrition in Aquaculture. Proc. Third Int. Symp. on Feeding and Nutr. In Fish. Japan Translation Center Ltd., Tokyo, pp. 221-232. Izquierdo MS, Arakawa T, Takeuchi T, Haroun R and Watanabe T (1992) Effect of n-3 HUFA levels in Artemia on growth of larval Japanese flounder (Paralichthys olivaceous). Aquaculture 105, 73-82. Izquierdo MS (1996) Essential fatty acid requirements of cultured marine fish species. Aquaculture Nutrition 2, 183-191. Izquierdo MS and Fernández-Palacios H (1997) Nutritional requirements of marine fish larvae and broodstock. Cahiers Options Mediterranéennes 22, 243-264. Izquierdo MS, Socorro J, Arantzamendi L and Hernández-Cruz CM (2000) Recent advances in lipid nutrition in fish larvae. Fish Physiology and Biochemistry 22, 97-107. Izquierdo MS, Obach A, Arantzamendi L, Montero D, Robaina L and Rosenlund G (2003) Dietary lipid sources for seabream and seabass: growth performance, tissue composition and flesh quality. Aquaculture Nutrition 9, 397-407. Izquierdo MS, Montero D, Robaina L, Caballero MJ, Rosenlund G and Ginés R (2004) Alterations in fillet fatty acid profile and flesh quality in gilthead seabream (Sparus aurata) fed vegetable oils for a long term period. Recovery of fatty acid profiles by fish oil feeding. Aquaculture 250, 431-444. Izquierdo MS (2005) Essential fatty acid requirements in Mediterranean fish species. Cahiers Options Mediterranéennes 63, 91-102. Izquierdo MS, Robaina L, Juárez-Carrillo E, Oliva V, Hernández-Cruz CM and Afonso JM (2008) Regulation of growth, fatty acid composition and delta 6 desaturase expression by dietary General Introduction 300 lipids in gilthead seabream larvae Sparus aurata. Fish Physiology and Biochemistry 34, 117-127. Izquierdo MS, Socorro J and Roo J (2010) Studies on the appearance of skeletal anomalies in red porgy: effect of culture intensiveness, feeding habits and nutritional quality of live preys. Journal of Applied Ichthyology 26, 320-326. Izquierdo MS and Koven W (2010) Lipids. On Larval Fish Nutrition, J. Holt Ed., Wiley-Blackwell, John Wiley and Sons Publishers, Pp 47-82. Izquierdo MS, Scolamacchia M, Betancor MB, Roo J, Caballero MJ, Terova G and Witten PE. Increased dietary DHA promotes early mineralization in Sparus aurata (Linnaeus, 1758) preventing lordosis and kyphosis occurrence, whereas an excess level increases chondroid bones anomalies. Submitted to British Journal of Nutrition. Iwamoto M, Yagami K, Shapiro IM, Leboy PS, Adams SL and Pacifici M (1994) Retinoic acid is a major regulator of chondrocyte maturation and matrix mineralization. Microscopy Research and Technique 28, 483-491. Jalali MA, Hosseini SA and Imanpour MR (2008) Effect of vitamin E and highly unsaturated fatty acid-enriched Artemia urmiana on growth performance, survival and stress resistance of Beluga (Huso huso) larvae. Aquaculture Research 39, 1286-1291. Jaramillo F Peng L and Gatlin D (2009) Selenium nutrition of hybrid striped bass (Morone chrysops x M. Saxatalis) bioavailability, toxicity and interaction with vitamin E. Aquaculture Nutrition 15, 160-165. Järva L, Alev K and Seene T (1997) Myosin heavy chain composition in regeneration skeletal muscle grafts. Basic and Applied Myology 7, 137-141. Ji H, Om AD, Umino T and Nakagawa H (2003) Comparison of ascorbate content in hatcheryreared and wild black sea bream, Acanthopagrus schlegeli (Pisces). Proc 20th Symp Trace Nutr Res 61-65. Ji H, Om AD, Yoshimato T, Umino T, Nakagawa H and Sakamoto S (2010) Effect of dietary ascorbate on lipogenesis and lipolysis activities in black sea bream, Acanthopagrus schlegeli. Fish Physiology and Biochemistry 36, 749-755. Ji H, Li J and Liu P (2011) Regulation of growth performance and lipid metabolism by dietary n-3 highly unsaturated fatty acids in juvenile grass carp, Ctenopharyngodon idellus. Comparative Biochemistry and Physiology B 159, 49-56. Jilka RL, Winstein RS, Takahashi K, Parffit AM and Manologas SC (1996) Linkage of decreased bone mass with impaired osteoblastogenesis in a murine model of accelerated senescense. Journal of Clinic Investigation 97, 1732-1740. Johansson L, Gafvelin G and Arnér ESJ (2005) Selenocysteine in proteins – properties and biotechnological use. Biochimica et Biophysica Acta (BBA)-General Subjects 1726, 1-13. Johnston IA, Frearson N and Goldspink G (1972) Myofibrillar ATPase activities of red and white myotomal muscles of marine fish. Experientia 28, 713-714. Johnston IA (1980) Specializations of fish muscle. In: Goldspink, DF (Ed), Development and Specializations Muscle, Soc. Exp. Biol. Sem. Ser. Vol. 7, pp. 123-148. 301 Johnston IA, Vieira VLA and Abercromby M (1995) Temperature and myogenesis in embryos of the Atlantic herring Clupea harengus. Journal of Experimental Biology 198, 1389-1403. Johnston CE, Horney BD, Deluca S, MacKenzie A, Eales JG and Angus R (1994) Changes in alkaline phosphatase isoenzyme activity in tissues and plasma of Atlantic salmon (Salmo salar) before and during smoltification and gonadal maturation. Fish Physiology and Biochemistry 12, 485-497. Johnston IA, Manthri S, Alderson R, Smart A, Campbell P, Nickell D, Robertson B, Paxton CGM and Burt LM (2003) Freshwater environment affects growth rate and muscle fibre recruitment in seawater stages of Atlantic salmon (Salmo salar L.). The Journal of Experimental Biology 206, 1337-1352. Johnston IA and Hall TE (2004) Mechanisms of muscle developmentand responses to temperature change in fish larvae. American Fisheries Society Symposium 40, 85-116. Johnston IA (2006) Environment and plasticity of myogenesis in teleost fish. The Journal of Experimental Biology 209, 2249-2264. Johnston IA, Bower NI and Macqueen DJ (2011) Growth and regulation of myotomal muscle mass in teleost fish. The Journal of Experimental Biology 214, 1617-1628. Jones DA, Kamurudin MS and Levay L (1993) The potential for replacement of live feeds in larvae culture. Journal of the World Aquaculture Society 24, 191-210. Jones IJ and Clemmons DR (1995) Insulin-like growth factors and their binding proteins: biological actions. Endocrine Reviews 16, 3-34. Kakulas BA and Adams RD (1980) Principles of myopathology as illustrated in the nutritional myopathy of the Rottnest quokka (Setonix brachyurus). Annals of the New York Academy of Sciences 138, 90-101. Kanan K and Jain SJ (2000) Oxidative stress and apoptosis. Patophysiology 7, 153-163. Kanazawa A, Koshio S and Teshima S (1989) Growth and survival of larval red sea bream Pagrus major and Japanese flounder Paralichthys olivaceus fed microbound diets. Journal of the World Aquaculture Society 20, 31-37. Kanazawa A (1993) Importance of dietary docosahexaenoic acid on growth and survival of fish larvae. Pages 87-95 in C.S. Lee, M.S. Su and I.C. Liao, eds. Finfish Hatchery in Asia. Proceedings of Finfish Hatchery in Asia´91. TML Conference Proceedings 3, Tungkang Marine Laboratory, Taiwan Fisheries Research Institute, Tungkang, Taiwan. Kanazawa A (1995) Nutrition of larval fish. Pages 50-59 in C.E. Lim and D.J. Sessa, eds. Nutrition and Utilization Technology in Aquaculture. American Oils´ Chemist Society Press, Champaign, Illinois. Kanazawa A (1997) Effects of docosahexaenoic acid and phospholipids on stress tolerance of fish. Aquaculture 155, 129-134. Karen DJ, Klaine SJ and Ross PE (2001) Further considerations of the skeletal system as a biomarker of episodic chlorpyrifos exposure. Aquatic Toxicology 52, 285-296. General Introduction 302 Kawatsu H (1969) Studies on the anemia of fish-III. An example of macrocyticanemia found in brook trout, Salvelinus fontinalis. Bulletin of Freshwater Fisheries Research Laboratory 19, 161-167. Kim S, Ji K, Lee S, Lee J, Kim J, Kim S, Kho Y and Choi K (2010) Perfluorooctane sulfonic acid (PFOS) exposure increases cadmium toxicity in early life stage of zebrafish (Danio rerio). Environmental Toxicology and Chemistry 30, 870-877. Kiron V, Puangkaew J, Ishizaka K, Satoh S and Watanabe T (2004) Antioxidant status and nonspecific immune response in rainbow trout (Oncorhynchus mykiss) fed two levels of vitamin E along with three lipid sources. Aquaculture 234, 361-379. Kjørsvik E, Mangor-Jensen A and Holmefjord I (1990) Egg quality in fishes. Advances in Marine Biology 26, 71-113. Kjørsvik E, Olsen Y, Rosenlund G and Vadstein O (1991) Effect of various lipid enrichment in rotifers and the development of early stages in turbot. In: Proceedings of the Fish and Crustaceans Larviculture Symposium, Larvi´91. (P Lavens, Sorgeloos P, Jaspers E and Ollevier F, eds.) European Aquaculture Society Special Publication, vol 15. Ghent, Belgium: European Aquaculture Society. Klein-Ogus C and Harris JB (1983) Preliminary observations of satellite cells in undamaged fibres of the rat soleus muscle assaulted by a snake – venom toxin. Cell and Tissue Research 230, 671-776. Klotz LO (2002) Oxidant-induced signaling: effect of peroxynitrite and singlet oxygen. Biology and Chemistry 383, 443-456. Knapen MHJ, Jie G, Hamulyak K and Vermeer C (1993) Vitamin K-induced changes in marker for osteoblast activity and urinary calcium loss. Calcified Tissue International 53, 81-85. Koedijk RM, LeFrancois NR, Blier PU, Foss A, Folkvord A, Ditlecadet D, Lamarre SG, Stefansson SO and Imsland AK (2010) Ontogenetic effects of diet during early development on growth performance, myosin mRNA expression and metabolic enzyme activity in Atlantic cod juveniles reared at different salinities. Comparative Biochemistry and Physiology A 156, 102-109. Kohlmeier (2003) Nutrient Metabolism. Academic Press, San Diego, CA, USA. Pp. 722-728. Kolkatowski AJ and Vercesi AE (1999) Mitochondrial damage induced by conditions of oxidative stress. Free Radical Biology and Medicine 26, 463-471. Kolkovski S, Tandler A, Kissil GW and Gertler A (1993) The effect of dietary exogenous digestive enzymes on ingestion, assimilation, growth and survival of gilthead seabream (Sparus aurata, Sparidae, Linnaeus). Fish Physiology and Biochemistry 12, 203-209. Kolkovski S, Koven W and Tandler A (1997) The mode of action of Artemia in enhancing utilization of microdiets by gilthead seabream Sparus aurata larvae. Aquaculture 155, 193-205. Kolkovski S, Czesny S and Dabrowsky K (2000a) Use of krill hydrolysate as feed attractant in fish diets. Journal of the World Aquaculture Society 31, 81-88. Kolkovski S, Czesny S, Yackey C, Moreau R, Cihla F, Mahan D and Dabrowsky K (2000b) The effect of vitamins C and E in (n-3) highly unsaturated fatty acids-enriched Artemia nauplii 303 on growth, survival and stress resistance of fresh water walleye Stizostedion vitreum larvae. Aquaculture Nutrition 6, 199-206. Kolkovski S (2001) Digestive enzymes in fish larvae and juveniles – implications and applications to formulated diets. Aquaculture 200, 181-201. Kolkovski S (2006) Amino acids as feed attractants for marine fish larvae. World Aquaculture Symposium 2006, Florence, Italy. Kolkovski S (2008) Advances in marine fish larvae diets. IX Simposio Internacional de Nutrición Acuícola, Monterrey, Nuevo León, Mexico. Koshio S, Ackman RG and Lall SP (1994) Effects of oxidized herring and canola oils in diets on growth, survival and flavour of Atlantic salmon, Salmo salar. Journal of Agricultural and Food Chemistry 42, 1164-1169. Kossmann CH (1988) How do fish get their vital vitamin C? Fish Farming International 5, 30. Koumans JTM and Akster HA (1995) Myogenic cells in development and growth of fish. Comparative Biochemistry and Physiology A 110, 3-20. Koven WM, Kissil GW and Tandler A (1989) Lipid and n-3 requirement of Sparus aurata larvae duerin starvation and feeding. Aquaculture 79, 185-192. Koven WM (1991) The combined effects of dietary n-3 highly unsaturated fatty acids and age on growth, survival and lipid composition in larval gilthead seabream (Sparus aurata, Perciformes, Teleostei). PhD Thesis, Hebrew University, Israel. Koven W, Barr Y, Lutzky S, Ben-Atia I, Weiss R, Harel M, Behrens P and Tandler A (2001) The effects of dietary arachidonic acid (20:4n-6) on growth, survival and resistance to handling stress in gilthead seabream Sparus aurata larvae. Aquaculture 193, 107-122. Kowaltowski AJ, Castilho RF and Vercesi AE (2001) Mitochondrial permeability transition and oxidative stress. Federation of the Societies of Biochemistry and Molecular Biology Letters 495, 12-15. Kraul S (1993) Larviculture of the mahi-mahi Coryphaena hippurus in Hawaii, USA. Journal of the World Aquaculture Society 24, 410-421. Kroemer G (1995) The pharmacology of T lymphocyte apoptosis. Advances in Immunology 58, 211-296. Kryukov GV and Gladyshev VN (2000) Selenium metabolism in zebrafish: multiplicity of selenoprotein genes and expression of a protein containing 17 selenocysteine residues. Genes to Cells 5, 1049-1060. Kvåle A, Yúfera M, Nygård E, Aursland K, Harboe T and Hamre K (2006) Leaching properties of three different microparticulate diets and preference of the diets in cod (Gadus morhua L.) larvae. Aquaculture 251, 402-415. Kwak KB, Chung SS, Kim OM, Kang MS, Ha DB and Chung CH (1993) Increase in the level of mcalpain correlates with the elevated cleavage of filamin during myogenic differentiation of embryonic muscle cells. Biochimica et Biophysica Acta 1175, 243-249. Koedijk RM, Le François NR, Blier PU, Foss A, Folkvord A, Ditlecadet D, Lamarre SG, Stefansson SO and Imsland AK (2010) Ontogenetic effects of diet during early General Introduction 304 development on growth performance, myosin mRNA expression and metabolic enzyme activity in Atlantic cod juveniles reared at different salinities. Comparative Biochemistry and Physiology A 156, 102-109. Lall SP and Bishop FJ (1977) Studies on mineral and protein utilization by Atlantic salmon (Salmo salar) grown in sea water. Fisheries and Marine Service, Enviroment Canada, Ottawa, ON, Tech. Rep. No. 688, pp. 16. Lall SP and Lewis-McCrea LM (2007) Role of nutrients in skeletal metabolism and pathology in fish – An overview. Aquaculture 267, 3-19. Lall SP (2002) The minerals. In: Fish Nutrition (Halver JE & Hardy RW, eds.) pp.259-307. Academic Press, San Diego, CA, USA. Laurel BJ, Copeman LA, Hurst TP and Parrish CC (2010) The ecological significance of lipid/fatty acid synthesis in developing eggs and unfed larvae of Pacific cod (Gadus macrocephalus). Marine biology 157, 1713-1724. Laurel BJ, Hurst TP and Ciannelli L (2011) An experimental examination of temperature interactions in the match-mismatch hypothesis for Pacific cod larvae. Canadian Journal of Fisheries and Aquatic Sciences 68, 51-61. Lazaro RP, Dentinger MP, Rodichok LD, Barron KD and Satya-Murti S (1986) Muscle pathology in Bassen-Kornzweig syndrome and vitamin E deficiency. American Journal of Clinical Pathology 86, 378-387. Lee KJ and Dabrowski K (2003) Interaction between vitamins C and E affects their tissue concentrations, growth, lipid oxidation and deficiency symptoms in yellow perch (Perca flavescens). British Journal of Nutrition 89, 589-596. LeMilinaire C (1984) Contribution àl etude du besoin in acides gras essentiels pour la larve du turbot pendant la phase; alimentation avec le rotifer Brachionus plicatilis (O.F. Muller). In: These 3eme cycle. Universitè de Brest (France) 168 pp. LeRoith D, McGuinness M, Shemer J, Stannard B, Lanau F, Faria TN, Kato H, Werner H, Adamo M and Roberts CT (1992) Insulin-like growth factors. Biological Signals 1, 173-181. Leu MY, Liou CH and Wu CH (1991) Feasibility of using microcoated-diet fed to larval yellowfinned black porgy Acanthopagrus latus. Journal of Fisheries Society, Taiwan 18, 287294. Levine M (1986) New concepts in the biology and biochemistry of ascorbic acid. New England Journal of Medicine 314, 892-902. Lewis-McCrea LM and Lall SP (2007) Effects of moderately oxidized dietary lipid and the role of vitamin E on the development of skeletal abnormalities in juvenile atlantic halibut (Hippoglossus hippoglossus). Aquaculture 262, 142-155. Lewis DH, Marks JE and Stickney RR (1985) Degenerative myopathy in channel catfish, Ictalurus punctatus (Rafinesque), maintained on rations containing purified fatty acids. Journal of Fish Diseases 8, 563-565. Li Q, Li B, Wang X, Leri A, Jana KP, Liu Y, Kajstura J, Baserga R and Anversa P (1997) Overexpression of Insulin-like growth factor-1 in mice protects from myocite death after 311 Perrot V, Moiseeva EB, Gozes Y, Chan SJ, Ingleton P and Funkenstein B (1999) Ontogeny of the insulin-like growth factor system (IGF-I, IGF-II and IGF-IR) in gilthead seabream (S. aurata): expression and cellular localization. General and Comparative Endocrinology 116, 445-460. Person Le Ruyet J, Alexandre JC, Thébaud L and Mugnier C (1993) Marine fish larvae feeding: Formulated diets or live prey? Journal of the World Aquaculture Society 24, 211-224. Peters LD and Livingstone DR (1996) Antioxidant enzyme activities in embryologic and early larval stages of turbot. Journal of Fish Biology 49, 986-997. Phelan JN and Gonyea WJ (1997) Effect of radiation on satellite cell activity and protein expression in overloaded mammalian skeletal muscle. Anatomical Record 247, 179-188. Pirini M, Gatta PP, Testi S, Trigari G and Monetti PG (2000) Effect of refrigerated storage on muscle lipid quality of sea bass (Dicentrarchus labrax) fed on diets containing different levels of vitamin E. Food Chemistry 68, 289-293. Polatajko A, Jakubowski N and Spuznar J (2006) State of the art report of selenium speciation in biological samples. Journal of Analytical Atomic Spectrometry 21, 639-654. Porta EA, Berra A, Monserrat AJ and Benavides SH (2002) Differential lectin histochemical studies on lipofucsin (age-pigment) and on selected ceroid pigments. Archives of Gerontology and Geriatrics 34, 193-203. Poston HA (1967) Effect o dietary L-ascorbic acid on immature brook trout. Fisheries Research Bulletin 31, 45-51. Poston HA, Combs GF Jr and Leibovitz L (1976) Vitamin E and selenium interactions in the diet of Atlantic salmon (Salmo salar): gross, histological and biochemical signs. Journal of Nutrition 106, 892-904. Pousão-Ferreira P, Santos P, Carvalho AP, Morais S and Narciso L (2003) Effect of an experimental microparticulated diet on the growth, survival and fatty acid profile of gilthead seabream (Sparus aurata L.) larvae. Aquaculture International 11, 491-504. Power DM, Llewellyn L, Faustino M, Nowell MA, Björnsson BT, Einarsdottir IE, Canario AVM and Sweeney GE (2001) Thyroid hormones in growth and development of fish. Comparative Biochemistry and Physiology C 130, 447-459. Pozios KC, Ding J, Degger B, Upton Z and Duan C (2001) IGFs stimulate zebrafish cell proliferation by activating MAP kinase ans PI3-kinase-signalling parhways. American Journal of Physiology – Regulatory, Integrative and Comparative Physiology 280, R1230R1239. Puangkaew J, Kiron V, Satoh S and Watanabe T (2005) Antioxidant defense of rainbow trout (Oncorhynchus mykiss) in relation to dietary n-3 HUFA highly unsaturated fatty acids and vitamin E contents. Comparative Biochemistry and Physiology C 140, 187-196. Putnam ME and Comben M (1987) Vitamin E. Veterinary Records 121, 541-545. Radaelli G, Patruno M, Maccatrozzo L and Funkenstein B (2003) Expression and cellular localization of insulin-like growth factor-II protein and mRNA in Sparus aurata during development. Journal of Endocrinology 178, 285-299. General Introduction 312 Rainuzzo JR, Farestveit R and Jorgensen L (1993) Fatty acid and aminoacid composition during embryonic and larval development in plaice (Pleuronectes platessa). In: Physiological and Biochemical aspects of Fish Development. Pp290-295. Edited by BT Walther and HJ Fhyn. Bergen University, Norway. Rainuzzo JR, Reitan KY, Jorgensen L and Olsen Y (1994) Lipid composition in turbot larvae fed live feed cultured by emulsions of different lipid classes. Comparative Biochemistry and Physiology B 103, 21-26. Ramírez-Zarzosa G, Gil F, Latorre R, Ortega A, García-Alcázar A, Abellán E, Vázquez JM, López-Albors O, Arencibia A. Moreno F (1995) The larval development of lateral musculature in gilthead sea bream (Sparus aurata) and sea bass (Dicentrarchus labrax). Cell and Tissue Research 280, 217-224. Rando TA (2002) Oxidative stress and the pathogenesis of muscular dystrophies. American Journal of Physical Medicine and Rehabilitation 81, 175-186. Reinecke M, Björnsson BT, Dickhoff WW, McCormick SD, Navarro I, Power DM and Gutiérrez J (2005) Growth hormone and insulin-like growth factor in fish: where are we and where to go. General and Comparative Endocrinology 142, 20-24. Reitan KI, Rainuzzo JR and Olsen Y (1994) Influence of lipid composition of live feed on growth, survival and pigmentation of turbot larvae. Aquaculture International 2, 33-48. Rezek TC, Watanabe WO, Harel M and Seaton PJ (2010) Effects of dietary docosahexaenoic acid (22:6n-3) and arachidonic acid (20:4n-6) on the growth, survival, stress resistance and fatty acid composition in black sea bass Centropristis striata (Linnaeus 1758) larvae. Aquaculture Research 41, 1302-1314. Rider S and Sweetman J (2008) Aquaculture turns eye on organic selenium. Feed Mix 16 (1). Rider SA, Davies SJ, Jha AN, Clough R and Sweetman J (2010) Bioavailability of cosupplemented organic and inorganic zinc and selenium sources in white fishmeal-based rainbow trout (Oncorhynchus mykiss) diet. Journal of Animal Physiology and Animal Nutrition 94, 99-110. Roald SO, Armstrong D and Landsverk T (1981) Histochemical, fluorescent and electron microscopical appearance of hepatocellular ceroidosis in the Atlantic salmon (Salmo salar). Journal of Fish Diseases 4, 1-14. Roberts ML, Davies SJ and Pulsford AL (1995) The influence o ascorbic acid (vitamin C) on nonspecific immunity in the turbot (Scophtalmus maximus L.). Fish and Shellfish Immunology 5, 27-38. Rodríguez C, Pérez JA, Izquierdo MS, Mora J, Lorenzo A and Fernández-Palacios H (1993) Essential fatty acid requirements of larval gilthead seabream, Sparus aurata L. Aquaculture and Fisheries Management 24, 295-304. Rodríguez C, Pérez JA, Lorenzo A, Izquierdo MS and Cejas JR (1994) n-3 HUFA requirement of larval gilthead seabream Sparus aurata when using high levels of eicosapentaenoic acid. Comparative Biochemistry and Physiology A 107, 693-698. Rodríguez C, Pérez JA, Díaz M, Izquierdo MS, Fernández-Palacios H and Lorenzo A (1997) Influence of EPA/DHA ratio in rotifers on gilthead seabream (Sparus aurata) larval development. Aquaculture 150, 77-89. 313 Rome LC and Sosnicki AA (1990) The influence of temperature on power output and scup red muscle in carp. Journal of Physiology (London) 427, 151-169. Roo J, Hernández-Cruz CM, Socorro JA, Fernández-Palacios H, Montero D and Izquierdo MS (2009) Effect of DHA content in rotifers on the occurrence of skeletal deformities in red porgy Pagrus pagrus (Linnaeus, 1758). Aquaculture 287, 84-93. Roo et al., 2010 Roselund G, Stoss J and Talbot C (1997) Co-feeding marine fish larvae with inert and live diets. Aquaculture 155, 183-191. Rosen CJ, Dimai HP, Vereault D, Donahue LR, Beamer WG, Farley J, Linkhart S, Linkhart T, Mohan S and Baylink DJ (1997) Circulating and skeletal insulin-like growth factor-I (IGF-I) concentrations in two inbred strains of mice with different bone mineral densities. Bone 21, 217-223. Rowlerson A, Mascarello A, Radaelli G and Veggetti A (1995) Differentiation and growth of muscle in the fish Sparus aurata (L.). Hyperplastic and hypertrophic growth of lateral muscle from hatching to adult. Journal of Muscle Research and Cell Motility 16, 223-236. Rowlerson A, Radaelli G, Mascarello F and Veggetti A (1997) Regeneration of skeletal muscle in two teleost fish: Sparus aurata and Brachydanio rerio. Cell and Tissue Research 289, 311-322. Rudneva II (1997) Blood antioxidant system of Black Sea elasmobranch and teleost. Comparative Biochemistry and Physiology C 118, 255-260. Rudneva II (1999) Antioxidant system of Black Sea animals in early development. Comparative Biochemistry and Physiology C 122, 265-271. Ruff N, FitzGerald RD, Cross TF, Teurtrie G and Kerry JP (2002) Slaughtering method and dietary α-tocopheryl acetate supplementation affect rigor mortis and fillet shelf-life of turbot Scophtalmus maximus L. Aquaculture Research 33, 703-714. Ruff N, FitzGerald RD, Cross TF, Hamre K and Kerry JP (2003) The effect of dietary vitamin E and C level on market-size turbot (Scophtalmus maximus) fillet quality. Aquaculture Nutrition 9, 91-103. Saal FJ, Roederer M, Herzenberg LA and Herzenberg LA (1990) Intracellular thiols regulate activation of nuclear factor kappa B and transcription of human immunodeficiency virus. Proceedings of the National Academy of Sciences USA 87, 9943-9947. Sakai T, Murata H, Endo M, Yamauchi K, Tabata N and Fukudome M (1989) 2-Thiobarbituric acid values and contents of α-tocopherol and bile pigments in the liver and muscle of jaundiced yellowtail, Seriola quinqueradiata. Agricultural and Biological Chemistry 53, 1739-1740. Sakai T, Murata H, Endo M, Shimomura T, Yamauchi K, Ito T, Yamaguchi T, Nakahima H and Fukudome M (1998) Severe oxidative stress is thought to be a principal cause of jaundice of yellowtail Seriola quinqueradiata. Aquaculture 160, 205-214. Salem Jr N, Litman B, Kim HK and Gawrisch K (2001) Mechanisms of action of docosahexaenoic acid in the nervous system. Lipids, 36, 945-959. General Introduction 314 Salhi M, Izquierdo MS, Hernández-Cruz CM, Socorro J and Fernández-Palacios H (1997) The improved incorporation of polyunsaturated fatty acids and changes in liver structure in larval gilthead seabream fed on microdiets. Journal of Fish Biology 51, 869-879. Salminen A and Vihko V (1983) Endurance training reduces the susceptibility of mouse skeletal muscle to lipid peroxidation in vitro. Acta Physiologica Scandinavica 117, 109-113. Sandel E, Nixon O, Lutzky S, Ginsbourg B, Tandler A, Uni Z and Koven W (2010) The effect of dietary phosphatidylcoline/phosphatidylinositol ratio on malformation in larvae and juvenile gilthead sea bream (Sparus aurata). Aquaculture 304, 42-48. Sanger JW, Wang J, Holloway B, Du A and Sanger JM (2009) Miofribrillogenesis in skeletal muscle fibres in zebrafish. Cell Motility and the Cytoskeleton 66, 556-566. Sargent JR (1995) Origins and functions of lipids in fish eggs: nutritional implications. In: NR Bromage and RJ Roberts (eds), Broodstock Management and Egg and Larval Quality, Blackwell Science, Oxford, pp 353-372. Sargent JR, Henderson RJ and Tocher DR (1989) The Lipids. In: Fish Nutrition (Halver JE, ed.). Academic Press, New York, pp 154-218. Sargent JR, Bell JG, Bell MV, Henderson RJ and Tocher DR (1995) Requirement criteria for essential fatty acids. Journal of Applied Icthyology 11, 183-198. Sargent JR, McEvoy LA and Bell JG (1997) Requirements, presentation and sources of polyunsaturated fatty acids in marine fish larval feeds. Aquaculture 155, 117-127. Sargent JR, Bell JG, McEvoy L, Tocher DR and Estevez A (1999) Recent developments in the essential fatty acid nutrition of fish. Aquaculture 177, 191199. Sargent JR, Tocher DR and Bell JG (2002) The lipids. In: Halver JE, Hardy RW (Eds.), Fish Nutrition, 3rd edition. Academic Press, San Diego, pp 181-258. Satoh M, Yoshinaka R, Kondo T and Ikeda S (1982) Accumulation of underhydroxylated collagen in ascorbic acid-deficient rainbow trout. Bulletin of the Japanese Society for the Science of Fisheries 48, 953-957. Satoh ST, Takeuchi T and Watanabe T (1987) Requirement of tilapia for α-tocopherol. Nippon Suisan Gakkaishi 53, 119-124. Satoh N and Takeuchi T (2009a) Docosahexaenoic acid (DHA) requirement of larval brown sole Pleuronectes herzensteini. Nippon Suisan Gakkaishi 75, 28-37. Satoh N and Takeuchi T (2009b) Estimation of the period sensitive for the development of abnormal morphology in brown sole Pseudopleuronectes herzensteini fed live food enriched with docosahexaenoic acid. Fisheries Science 78, 985-991. Scaife JR, Onibi GE, Murray I, Fletcher TC and Houlihan DF (2000) Influence of α-tocopherol acetate on the shortand long-term storage properties of fillets from Atlantic salmon Salmo salar fed a high lipid diet. Aquaculture Nutrition 6, 65-71. Scapolo PA, Veggetti A, Mascarello F and Romanello MG (1988) Developmental transitions of myosin isoforms and organization of the lateral muscle in the teleost Dicentrarchus labrax (L). Anatomy and Embryology 178, 287-295. 315 Schrauzer GN (2001) Nutritional selenium supplements: Product types, quality and safety. Journal of the American College of Nutrition 20, 1-4. Schultz E and Lipton BH (1978) The effect of Marcaine on muscle and non – muscle cells in vitro. Anatomical Record 191, 351-369. Schultz E and McCormick KN (1994) Skeletal muscle satellite cells. Reviews of Physiology Biochemistry and Pharmacology 123, 213-257. Schwarz FJ, Kirchgessner M, Steinhart H and Runge G (1988) Influence of different fats with varying additions of alpha-tocopheryl acetate on growth and body composition of carp (Cyprinus carpio). Aquaculture 69, 57-67. Seale P and Rudnicki MA (2000) A new look at the origin, function and “stem-cell” status of muscle satellite cells. Developmental Biology 218, 115-124. Sealey WM and Gatlin DM (2002) Dietary vitamin C and vitamin E interact to influence growth and tissue composition of juvenile hybrid striped bass (Morone chrysops ♀ x M. saxatilis ♂) but have limited effects on immune responses. The Journal of Nutrition 132, 748-755. Seiffert MB, Cerqueira VR and Madureira LAS (2001) Effect of dietary (n-3) highly unsaturated fatty acids (HUFA) on growth and survival of fat snook (Centropomus parallelus; Pisces: Centropomidae) larvae during first feeding. Brazilian Journal of Medical and Biological Research 34, 645-651. Semsarian C, Wu MJ, Ju YK, Marciniec T, Yeoh T, Allen DG, Harvey RP and Graham RM (1999) Skeletal muscle hypertrophy is mediated by a Ca2+-dependent calcineurin signaling pathway. Nature 400, 576-581. Shanely RA, Zwetsloot KA, Childs TE, Lees SJ, Tsika RW and Booth FW (2009) IGF-I activates the the mouse type II-b myosin heavy chain gene. American Journal of Physiology - Cell Physiology 297, C1019-C1027. Shiau SY and Hsu CY (2002) Vitamin E sparing effect by dietary vitamin C in juvenile hybrid tilapia, Oreochromis niloticus x O. aureus. Aquaculture 210, 335-342. Shindo K, Tsuchiya T and Matsumoto JJ (1986) Histological study on white and dark muscles of various fishes. Bulletin of the Japanese Society for the Science of Fisheries 52, 13771399. Sen CK (1995) Oxygen toxicity and antioxidants: state of the art. Indian Journal of Physiology and Pharmacology 39, 177-196. Shiau SY and Hsu CY (2002) Vitamin E sparing effect by dietary vitamin C in juvenile hybrid tilapia, Oreochromis niloticus x O. aureus. Aquaculture 210, 335-342. Siddiqui RA, Harvey K and Stillwell W (2008) Anticancer properties of oxidation products of docosahexaenoic acid. Chemistry and Physics of Lipids 153, 47-56. Sies H (1985) Oxidative stress: Introductory remarks. In: H. Sies (ed), Oxidative Stress. Academic Press, London, pp. 18. Sies H, Stahl W and Sundquist AR (1992) Antioxidant functions of vitamins. Vitamins E and C, beta-carotene and other carotenoids. Annals of the NY Academy of Science 30, 7-20. General Introduction 316 Silva P, Rowlerson AM, Valente LMP, Olmedo M, Monteiro RAF and Rocha E (2008) Muscle differentiation in blackspot seabream (Pagellus bogavareo, Brunnich): Histochemical and immunohistochemical study of the fibre types. Tissue and Cell 40, 447-458. Smart EJ, Ying YS, Conrad PA and Anderson RGW (1994) Caveolin moves from caveolae to the golgi apparatus in response to cholesterol oxidation. The Journal of Cell Biology 127, 1185-1197. Smith CE (1979) The prevention of liver lipid degeneration (ceroidosis) and microcytic anaemia in rainbow trout (Salmo gairdneri Richardson) fed rancid diets: a preliminary report. Journal of Fish Diseases 2, 429-437. Solé M, Potrykus J, Fernández-Díaz C and Blasco J (2004) Variations on stress defences and metallothionein levels in the Senegal sole, Solea senegalensis, during early larval stages. Fish Physiology and Biochemistry 30, 57-66. Song JH, Fujimoto K and Miyazawa T (2000) Polyunsaturated (n-3) fatty acids susceptible to peroxidation are increased in plasma and tissue lipids of rats fed Docosahexaenoic acidscontaining oils. American Society for Nutrition 130, 3028-3033. ` Southgate PC and Kavanagh K (1999) The effect of dietary n-3 highly unsaturated fatty acids on growth, survival and biochemical composition of the coral reef damselfish Acanthocromis polyacanthus. Aquatic Living Resources 12, 31-36. Stéphan G, Guillaume J and Lamour F (1995) Lipid peroxidation in turbot Scophtalmus maximus tissue: effect of dietary vitamin E and dietary n-6 or n-3 polyunsaturated fatty acids. Aquaculture 130, 251-268. Stickland NC (1983) Growth and development of muscle fibres in the rainbow trout (Salmo gairdneri). Journal of Anatomy 137, 323-333. Stocker R and Frei B (1991) In Oxidative stress: Oxidants and antioxidants. H Sies (ed.) 213-243. Academic Press, London. Stoick-Cooper CL, Moon RT and Weidinger G (2007) Advances in signalling in vertebrate regeneration as a prelude to regenerative medicine. Genes and Development 21, 12921315. Sukhanov S, Higashi Y, Shai SY, Vaughn C, Mohler J, Li Y, Song YH, Titterington J and Delafontaine P (2007) IGF-1 reduces inflammatory responses, suppresses oxidative stress and decreases atherosclerosis progression in Apo-E deficient mice. Arteriosclerosis, Thrombosis, and Vascular Biology 27, 2684-2690. Takeuchi T and Watanabe T (1979) Effect of excess amounts of essential fatty acids on growth of rainbow trout. Bulletin of the Japanese Society for the Science of Fisheries 45, 15171519. Takeuchi T, Masuda R, Ishizaki Y, Watanabe T, Kanematsu M, Imaizumi K and Tsukamoto K (1996) Determination of the requirement of larval striped jack for eicosapentaenoic acid and docosahexaenoic acid using enriched Artemia nauplii. Fisheries Science 62, 760765. [Document text truncated for crawler view.]