Optimun phospholipids and antioxidant levels to develop novel microdiets for gilthead seabream larvae
Abstract
Programa de doctorado: Acuicultura: producción controlada de animales acuáticos
Full text
! ! Optimum phospholipids and antioxidant levels to develop ! novel microdiets for gilthead ! seabream larvae " Reda Saleh Mohamed Ibrahim" Las Palmas of Gran Canaria, " Spain 2013" PhD Thesis" University of Las Palmas of Gran Canaria
! ! !
ªAD DE LAS PALMAS DE GRAN CANARIA Anexo 1 Dª. MARÍA SORAYA DÉNIZ SUÁREZ, SECRETARIA DEL INSTITUTO UNIVERSITARIO DE SANIDAD ANIMAL Y SEGURIDAD ALIMENTARIA DE LA UNIVERSIDAD DE LAS PALMAS DE GRAN CANARIA. CERTIFICA Que el Consejo de Doctores del Departamento en su sesión de fecha 12 de diciembre de 2012 tomó el acuerdo de dar el consentimiento para su tramitación, a la tesis doctoral titulada: "NIVELES ÓPTIMOS DE FOSFOLÍPIDOS Y ANTIOXIDANTES EN EL DESARROLLO DE MICRODIETAS PARA LARVAS DE DORADA" presentada por el doctorando D. Reda Saleh y dirigida por los Ores. María Soledad Izquierdo López y Francisco Javier Moyana López. Y para que así conste, y a efectos de lo previsto en el Artº 73.2 del reglamento de Estudios de Doctorado de esta Universidad, firmo la presente en Las Palmas de Gran Canaria, a trece de diciembre de dos mil doce.
!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! Anexo II UNIVERSIDAD DE LAS PALMAS DE GRAN CANARIA Departamento: Instituto Universitario de Sanidad Animal y Seguridad Alimentaria ! Programa de Doctorado: Acuicultura: Producción Controlada de Animales Acuáticos Título de la Tesis ! Optimum phospholipids and antioxidant levels to develop novel microdiets for gilthead seabream larvae! ! Tesis Doctoral presentada por D. Reda Saleh Mohamed Ibrahim ! Dirigida por La Doctora María Soledad Izquierdo López y El Doctor Francisco Javier Moyano López La Directora El Director El Doctorando !"#$%#!&'()*#*!!!!!!!!!!!!!!!!!!! Francisco Javier Reda Saleh +,-./)$*'!012),!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!Moyano López Mohamed Ibrahim Las Palmas de Gran Canaria, a 01 de Febrero de 2013 !
! ! ! Optimum phospholipids and antioxidant levels to develop novel microdiets for gilthead seabream larvae Reda Saleh Mohamed Ibrahim Doctorado en Acuicultura: Producción Controlada de Animales Acuáticos Grupo de Investigación en Acuicultura (GIA) Instituto Universitario de Sanidad Animal y Seguridad Alimentaria (IUSA) Thesis for the degree of Doctor of Phylosophy University of Las Palmas de Gran Canaria 2013 Directors: Prof. María Soledad Izquierdo and Prof. Francisco Javier Moyano
! ! ! ! ! ! ! ! !
List of Contents -------------------------------------------------------------------------------! Page Nº Summary ………………………………….……………………………………... I List of Abbreviations. …………………………………………………………... III List of Tables ……………………………………………………………………. V List of Figures ………………………………….……………………………….. VIII Acknowledgements …………………………..…………………………………. XVIII Chapter 1: Introduction ………………………………………….…………….. 1 1.1 Aquaculture ………………………………….…………………………... 1 1.2 Marine fish larvae and microdiets utilization .………………………… 3 1.3 Importance of phospholipids in marine fish larvae nutrition ………… 6 1.3.1 Phospholipids as source of essential fatty acids………………… 7 1.3.2 Phospholipid requirements ……………………………………… 8 1.3.3 Phospholipid digestion, absorption and transport …………….. 10 1.3.3.1 Phospholipid digestion…………………………………. 10 1.3.3.2 Phospholipid absorption and transport ………………. 13 1.3.4 Phospholipid classes………………………………….…………… 18 1.3.5 Effect of phospholipids on skeletal development ………………. 20 1.4 Oxidative stress: Antioxidant defense mechanism ………………………. 24 1.4.1 Enzymatic defenses ………………………………….…………… 24 1.4.2 Non enzymatic defenses ……………………………….…………. 26 1.4.2.1 Vitamin E (!-tocopherol) ……………………………… 27 1.4.2.2 Selenium ………………………………….…………….. 29 1.5 Objectives ……………….……………..……………….…………………… 30 Chapter 2: Materials and Methods ……………………………………………. 32 2.1 Larvae ……………………………………………………………………... 32 2.1.1 Gilthead sea bream larvae .…………………………………. …….. 32 2.2 Experimental conditions ………………………………………….………. 32 2.3 Diets and feeding ……………………………………………….………... 32 2.3.1 Rotifers ……………………………………………………….…….. 32 2.3.2 Microdiets ………………………………………….………………. 33 2.3.2.1 Microdiets formulation.………………………………….. 33 2.3.2.2 Microdiets preparation…………………………………... 33 2.3.3 Feeding………………………………….…………………………... 35 2.4 Sampling.…………………………………. ……………………………... 35 2.4.1 Biological parameters………………………………….…………... 35 2.4.2 Proximate analysis………………………………….……………… 35 2.4.3 Digestive enzymes………………………………….……………… 35
2.4.4 Histological studies………………………………….……………… 35 2.4.5 Molecular biology………………………………….………………. 36 2.4.6 Activity test and survival………………………………….……….. 36 2.4.7 Growth ……………………………………………………………... 36 2.5 Biochemical analysis…………………………………………………….. 36 2.5.1 Proximate analysis ………………………………………………… 36 2.5.1.1 Moisture ………………………………….………………. 36 2.5.1.2 Ash ………………………………….…………………….. 37 2.5.1.3 Proteins ………………………………….……………….. 37 2.5.1.4 Total lipids ………………………………….……………. 37 2.5.1.4.1 Lipid Classes …………………………………… 38 2.5.1.4.2 Fatty acid methyl esters preparation and quantification ……………………………………………….. 38 2.5.2 Digestive enzymes activity…………………………………………. 39 2.6 Measurement of thiobarbituric reactive substances (TBARS) ………. 40 2.7 Selenium determination ………………………………….……………... 40 2.8 Whole mount staining for skeleton studies…………………………….. 41 2.9 Molecular biology ………………………………….…………………….. 42 2.10 Statistical analysis ………………………………….…………………... 44 Chapter 3: Optimum krill phospholipids content in microdiets for gilthead seabream (Sparus aurata) larvae………………………………….……………. 45 Chapter 4: Optimum soybean lecithin content in microdiets for gilthead seabream (Sparus aurata) larvae………………………………….……………. 68 Chapter 5: Effect of krill phospholipids vs soybean lecithin in microdiets for gilthead seabream (Sparus aurata) larvae on molecular markers of antioxidative metabolism and bone development……………………………... 91 Chapter 6: Biomarkers of bone development and oxidative stress in gilthead seabream larvae fed microdiets with several levels of polar lipids and !– tocopherol ………………………………….…………………………………..... 123 Chapter 7: Selenium levels in early weaning diets for gilthead sea bream larvae. ………………………………………………….………………………… 150 Chapter 8: Conclusions ………………………………………………………… 174 Chapter 9: Resumen en español………………………………….…………….. 175 References …………………………………………….…………………………. 228 !
! "! Summary ----------------------------------------------------------------------------- Phospholipids (PL) are particularly important in fish larvae production for their essential function as necessary components for cellular bio-membranes and organelles formation, as well as for being an endogenous energy source during early development. Besides, during early development, PL seems to induce digestive system maturation, may promote digestive enzymes activities, and consequently play an important role on larval digestive physiology and the metabolic pathways of the assimilated nutrients. However, despite the many studies available denoting the importance of dietary PL, few of them have intended to determine quantitative PL requirements testing diets with at least five different levels of this nutrient. Thus, the aim of the present thesis was to determine the optimum requirements of krill PL (KPL) and soybean lecithin (SBL) for gilthead seabream (Sparus aurata) larvae, and its influence on larval production performance and digestive enzymes activity (Chapter 3 & 4). Another aim was to compare the effectiveness of dietary KPL and soybean lecithin on the seabream larval rearing performance, oxidative status, vertebral mineralization, skeletal anomalies and bone formation related genes expression (Chapter 5). However, dietary PL have high levels of polyunsaturated fatty acids which are molecules with a great susceptibility to peroxidation resulting in production of harmful peroxides that affect their biological and physiological functions, so it was important that investigate the combined effect of graded levels of antioxidant nutrients such as !-tocopherol with dietary KPL and SBL, and the effect of graded levels of Se derived yeast, on the seabream larval rearing performance, oxidative status, vertebral mineralization, skeletal anomalies and bone formation related genes expression (Chapter 6 & 7). In the light of these experiments, the results have shown that dietary KPL are an excellent source of lipids and the optimum inclusion levels of this ingredient in microdiets to completely substitute live preys at larval age of 16 dph were found to be 12% KPL, providing about 10% total PL, and 8% SBL, providing about 8.8% total PL. These levels significantly improved digestive enzymes activities, utilization and deposition of dietary essential fatty acids and larval growth, as a consequence of a better digestion, absorption, transport and deposition of dietary nutrients. However, despite increased on dietary SBL up to 9% total PL improved larval survival, stress resistance, growth and skeletal development,
! "###! List of Figures ----------------------------------------------------------------------------- Page Nº Figure 1.1 Factors affecting food particle utilization (Adapted from Kolkovski et al., 2009)…………………………………. 5 Figure 1.2 Absorption and metabolism of triacylglycerides (Adapted from Smith et al., 1983)……………………... 13 Figure 1.3 Schematic diagram of triacylglycerol biosynthetic pathway………………………...……………………..... 15 Figure 1.4 Schematic lipoprotein structure………………………… 16 Figure 1.5 Schematic lipoproteins metabolism……………………. 17 Figure 1.6 Figure 8 Biosynthetic pathways for the major phospholipid classes (Tocher et al., 2008). CDP-Cho, CDP-choline; CDP–DAG, CDP-diacylglycerol; CDPEtn, CDP-ethanolamine; DAG, diacylglycerol; PA, phosphatidic acid: PC, phosphatidylcholine; PE, phosphatidylethanolamine; PI, phosphatidylinositol; PS, phosphatidylserine; SM, sphingomyelin. The enzymes are; 1, CDP– DAG synthases; 2, PA-phosphatases; 3, PI synthase; 4, PS synthase; 5, CDP-choline:DAG phosphotransferase; 6, CDP-ethanolamine:DAG phosphotransferase; 7, PE methyltransferase; 8, PS decarboxylase; 9, SM synthase; 10 and 11, PS synthases via base exchange ……………………………………… 19 Figure 1.7 A simplified diagram of the differentiation of (A) osteoclast precursors into osteoclasts and (B) osteoblast precursors into osteoblasts. PU.1, Transcription factor PU.1; M-CSF, macrophage-colony stimulating factor; c-fms, c-fms genes; MITF, microphthalmia-associated transcription factor; c-fos, c-fos gene; NF!", nuclear factor !"; NFATc1, nuclear factor of activated T cells 1; TRAF6, tumor necrosis factor receptor-associated factor-6; c-src, cellular-sarcoma gene; !v"3, !v"3integrin; RANKL, receptor activator of nuclear factor !" ligand; OPG, osteoprotegerin; Osx, osterix; PPAR#2, peroxisome proliferator activated receptor #2 (Adapted from Kruger et al., 2010)………………......... 21 Figure 1.8 Antioxidants mechanisms within the cell. Adapted from Machlin and Bendich (1987). Catalase (CAT); Superoxide dismutase (SOD); Glutathione peroxidase; (GPX); Reduced glutathione (GSH)…………………… 26
! "#! Figure 1.9 Proposed mechanism for the reaction of a-tocopherol with oxidising lipids. The peroxyl radical group formed during lipid oxidation is polar and floats to the surface of the membrane where it can react with atocopherol, rendering a lipid hydroperoxyde and the tocopheroxyl radical (Buettner, 1993)……………………………...…. 28 Figure 3.1 Survival rate (% of population) of larvae reared from 16 to 31 dph on five dietary KPL levels. Values (mean ± standard deviation) with the same letters are not significantly different (P>0.05)………………………… 52 Figure 3.2 Survival 24 h after activity test of larvae (31 dph) fed five dietary KPL levels. Values (mean ± standard deviation) with the same letters are not significantly different (P>0.05)………………………………………. 52 Figure 3.3 Total length of larvae (31 dph) fed five dietary KPL levels. Values (mean ± standard deviation) with the same letters are not significantly different (P>0.05)………………………………………………… 53 Figure 3.4 Dry weight of larvae (31 dph) fed five dietary KPL levels. Values (mean ± standard deviation) with the same letters are not significantly different (P>0.05)………………………………………………… 53 Figure 3.5 Alkaline phosphatase activity in seabream larvae (31 dph) fed five dietary KPL. Values (mean ± standard deviation) with the same letters are not significantly different (P>0.05)………………………………………. 54 Figure 3.6 Trypsin activity in seabream larvae (31 dph) fed five dietary KPL. Values (mean ± standard deviation) with the same letters are not significantly different (P>0.05)………………………………………………… 55 Figure 3.7 Lipase activity in seabream larvae (31 dph) fed five dietary KPL. Values (mean ± standard deviation) with the same letters are not significantly different (P>0.05).. 55 Figure 3.8 Phospholipase A2 activity in seabream larvae (31 dph) fed five dietary KPL. Values (mean ± standard deviation) with the same letters are not significantly different (P>0.05)………………………………………. 56 Figure 4.1 Survival rate (% of population) of larvae reared from 16
! "! to 31 dph on five levels of SBL. Values (mean ± standard deviation) with the same letters are not significantly different (P>0.05)………………………… 75 Figure 4.2 Survival 24 h after activity test of larvae (30 dph) fed increased levels of SBL for 15 days. Values (mean ± standard deviation) with the same letters are not significantly different (P>0.05)………………………… 75 Figure 4.3 Total length of larvae (30 dph) fed increased levels of SBL for 15 days. Values (mean ± standard deviation) with the same letters are not significantly different (P>0.05)………………………………………………… . 76 Figure 4.4 Dry body weight of larvae (30 dph) fed increased levels of SBL for 15 days. Values (mean ± standard deviation) with the same letters are not significantly different (P>0.05)………………………………………………… 76 Figure 4.5 Alkaline phosphatase activity in seabream larvae (30 dph) fed increased levels of SBL for 15 days. Values (mean ± standard deviation) with the same letters are not significantly different (P>0.05).……………………. 77 Figure 4.6 Trypsin activity in seabream larvae (30 dph) fed increased levels of SBL for 15 days. (mean ± standard deviation) with the same letters are not significantly different (P>0.05) .……………………………………... 77 Figure 4.7 Lipase activity in seabream larvae (30 dph) fed increased levels of SBL for 15 days. (mean ± standard deviation) with the same letters are not significantly different (P>0.05).……………………...………………. 78 Figure 4.8 Phospholipase A2 activity in seabream larvae (30 dph) fed increased levels of SBL for 15 days. Values (mean ± standard deviation) with the same letters are not significantly different (P>0.05) ………………………... 78 Figure 5.1 Survival rate of larvae (44 dph) fed three dietary PL levels using two different PL sources. Values (mean ± standard deviation) with the same letters were not significantly different (P>0.05).……………………….. 101 Figure 5.2 Survival rate (24 hours after activity test) of larvae (44 dph) fed three dietary PL levels using two different PL sources. Values (mean ± standard deviation) with the same letters were not significantly different (P>0.05).… 101 Figure 5.3 Total length of larvae (44 dph) fed three dietary PL
! "#! levels using two different PL sources. Values (mean ± standard deviation) with the same letters were not significantly different (P>0.05).………………………... 102 Figure 5.4 Correlation between total length of larvae (44 dph) fed three dietary PL levels using two different PL sources and dietary n-3 HUFA. Values (mean ± standard deviation) with the same letters were not significantly different (P>0.05).……………………………………… 102 Figure 5.5 Dry whole body weight of larvae (44 dph) fed three dietary PL levels using two different PL sources. Values (mean ± standard deviation) with the same letters were not significantly different (P>0.05).……………………. 103 Figure 5.6 Representative pictures of mineralized vertebrae of larvae (44 dah) fed three dietary PL levels using two different PL sources, (A: Control; B: 7MPL; C: 9MPL; D: 7SBL; E: 9SBL.……………………………………... 104 Figure 5.7 Graphical representation of the average number of mineralized vertebrae for each size class of larvae (44 dah) fed three dietary PL levels using two different PL sources.…………………………………………………. 105 Figure 5.8 Incidence of skeleton anomalies of larvae (44 dah) fed three dietary PL levels using two different PL sources. (P>0.05). Values (mean ± standard deviation) with the same letters were not significantly different (P>0.05)…. 106 Figure 5.9 The malondialdehyde (MDA) content in larvae (44 dph) fed five dietary phospholipid levels. Values (mean ± standard deviation) with the same letters were not significantly different (P>0.05).……………………….. 113 Figure 5.10 The correlation between the malondialdehyde (MDA) content and the dietary phospholipid levels in larvae (44 dph) fed five dietary phospholipid levels.……………… 113 Figure 5.11 Catalase (CAT) gene expression level measured by realtime PCR in seabream larvae fed five dietary phospholipid levels. Values (mean ± standard deviation) with the same letters were not significantly different (P>0.05).……………………………………………….. 114 Figure 5.12 Superoxide dismutase (SOD) gene expression level measured by real-time PCR in seabream larvae fed five dietary phospholipid levels. Values (mean ± standard deviation) with the same letters were not significantly different (P>0.05).……………………………………… 114
! "##! Figure 5.13 Glutathione peroxidase (GPX) gene expression level measured by real-time PCR in seabream larvae fed five dietary phospholipid levels. Values (mean ± standard deviation) with the same letters were not significantly different (P>0.05).……………………………………… 115 Figure 5.14 BMP4 (Bone Morphogenetic Proteins 2) gene expression level measured by real-time PCR in seabream larvae fed five dietary phospholipid levels. Values (mean ± standard deviation) with the same letters were not significantly different (P>0.05)……….. 115 Figure 5.15 Runx2 (Runt-related transcription factor 2) gene expression level measured by real-time PCR in seabream larvae fed five dietary phospholipid levels. Values (mean ± standard deviation) with the same letters were not significantly different (P>0.05)……….. 116 Figure 5.16 Alkaline Phosphatase gene expression level measured by real-time PCR in seabream larvae fed five dietary phospholipid levels. Values (mean ± standard deviation) with the same letters were not significantly different (P>0.05).……………………………………………….. 116 Figure 5.17 Osteocalcin gene expression level measured by realtime PCR in seabream larvae fed five dietary phospholipid levels. Values (mean ± standard deviation) with the same letters were not significantly different (P>0.05).……………………………………………….. 117 Figure 5.18 Osteopontin gene expression level measured by realtime PCR in seabream larvae fed five dietary phospholipid levels. Values (mean ± standard deviation) with the same letters were not significantly different (P>0.05).………………………………………………... 117 Figure 5.19 Osteonectin gene expression level measured by realtime PCR in seabream larvae fed five dietary phospholipid levels. Values (mean ± standard deviation) with the same letters were not significantly different (P>0.05).……………………………………………….. 118 Figure 5.20 Matrix Gla Protein gene expression level measured by real-time PCR in seabream larvae fed five dietary phospholipid levels. Values (mean ± standard deviation) with the same letters were not significantly different (P>0.05).……………………………………………….. 118 Figure 6.1 Survival rate of gilthead seabream larvae (44 dph) fed different dietary contents of two phospholipid sources
! "###! combined with two !-tocopherol levels. Values (mean ± standard deviation) with the same letters are not significantly different (P>0.05).………………………... 132 Figure 6.2 Survival rate (24 hours after activity test) of gilthead seabream larvae (44 dph) fed different dietary contents of two phospholipid sources combined with two !- tocopherol levels. Values (mean ± standard deviation) with the same letters are not significantly different (P>0.05).……………………………………………….. 132 Figure 6.3 Total length of gilthead seabream larvae (44 dph) fed different dietary contents of two phospholipid sources combined with two !-tocopherol levels. Values (mean ± standard deviation) with the same letters are not significantly different (P>0.05).……………………….. 133 Figure 6.4 Dry weight of gilthead seabream larvae (44 dph) fed different dietary contents of two phospholipid sources combined with two !-tocopherol levels. Values (mean ± standard deviation) with the same letters are not significantly different (P>0.05).……………………….. 133 Figure 6.5 Bone mineralization percent for each size class (centimeter) of gilthead seabream larvae (44 dph) fed different dietary contents of two phospholipid sources combined with two !-tocopherol levels. Values (mean ± standard deviation) with the same letters for a given fish size are not significantly different (P>0.05).…………… 134 Figure 6.6 Anomalies (craneal deformities; alteration of cephalic, pre-hemal, hemal and caudal vertebral bodies; dorsal, anal and caudal fins and vertebral arch and spines) of gilthead seabream larvae (44 dph) fed different dietary contents of two phospholipid sources combined with two !-tocopherol levels. Values (mean ± standard deviation) without letters are not significantly different (P>0.05).……………………………………………….. 135 Figure 6.7 The malondialdehyde (MDA) content in gilthead seabream larvae (44 dph) fed different dietary contents of two phospholipid sources combined with two !- tocopherol levels.. Values (mean ± standard deviation) with the same letters are not significantly different (P>0.05).………………………………………………. 139 Figure 6.8 Catalase (CAT) gene expression level measured by realtime PCR in gilthead seabream larvae (44 dph) fed different dietary contents of two phospholipid sources
! "#$! combined with two !-tocopherol levels.. Values (mean ± standard deviation) with the same letters are not significantly different (P>0.05).……………………….. 140 Figure 6.9 Superoxide dismutase (SOD) gene expression level measured by real-time PCR in gilthead seabream larvae (44 dph) fed different dietary contents of two phospholipid sources combined with two !-tocopherol levels.. Values (mean ± standard deviation) with the same letters are not significantly different (P>0.05)…… 140 Figure 6.10 Glutathione peroxidase (GPX) gene expression level measured by real-time PCR in gilthead seabream larvae (44 dph) fed different dietary contents of two phospholipid sources combined with two !-tocopherol levels.. Values (mean ± standard deviation) with the same letters are not significantly different (P>0.05)…… 141 Figure 6.11 BMP4 (Bone morphogenetic protein 4) gene level expression measured by real-time PCR in gilthead seabream larvae (44 dph) fed different dietary contents of two phospholipid sources combined with two !- tocopherol levels.. Values (mean ± standard deviation) with the same letters are not significantly different (P>0.05).……………………………………………….. 142 Figure 6.12 RUNX2 (Runt-related transcription factor 2) gene expression level measured by real-time PCR in gilthead seabreamm larvae (44 dph) fed different dietary contents of two phospholipid sources combined with two !-tocopherol levels.. Values (mean ± standard deviation) with the same letters are not significantly different (P>0.05).……………………………………… 142 Figure 6.13 Alkaline phosphatase gene level expression measured by real-time PCR in gilthead seabream larvae (44 dph) fed different dietary contents of two phospholipid sources combined with two !-tocopherol levels.. Values (mean ± standard deviation) with the same letters are not significantly different (P>0.05).………………….. 143 Figure 6.14 Osteocalcin gene expression level measured by realtime PCR in gilthead seabream larvae (44 dph) fed different dietary contents of two phospholipid sources combined with two !-tocopherol levels. Values (mean ± standard deviation) with the same letters are not significantly different (P>0.05).………………………... 143 Figure 6.15 Osteopontin gene level expression measured by realtime PCR in gilthead seabream larvae (44 dph) fed
! "#! different dietary contents of two phospholipid sources combined with two !-tocopherol levels. Values (mean ± standard deviation) with the same letters are not significantly different (P>0.05).……………………….. 144 Figure 6.16 Osteonectin gene expression level measured by realtime PCR in gilthead seabream larvae (44 dph) fed different dietary contents of two phospholipid sources combined with two !-tocopherol levels.. Values (mean ± standard deviation) with the same letters are not significantly different (P>0.05).……………………….. 144 Figure 6.17 Matrix Gla protein gene level expression measured by real-time PCR in gilthead seabream larvae (44 dph) fed different dietary contents of two phospholipid sources combined with two !-tocopherol levels. Values (mean ± standard deviation) with the same letters are not significantly different (P>0.05).……………………….. 145 Figure 7.1 Survival rate of larvae (44 dph) fed five dietary selenium levels. Values (mean ± standard deviation) with the same letters are not significantly different (P>0.05).……………………………………………….. 158 Figure 7.2 Survival rate 24 h after thermal shock of 24ºC of larvae (44 dph) fed five dietary selenium levels. Values (mean ± standard deviation) with the same letters are not significantly different (P>0.05).………………………... 159 Figure 7.3 The selenium content in larvae (44 dph) fed diets containing five selenium levels. Values (mean ± standard deviation) with the same letters are not significantly different (P>0.05).……………………….. 160 Figure 7.4 The malondialdehyde (MDA) content in larvae (44 dph) fed diets containing five selenium levels. Values (mean ± standard deviation) with the same letters are not significantly different (P>0.05).……………………….. 163 Figure 7.5 Catalase (CAT) gene expression level measured by realtime PCR in seabream larvae fed diets containing five selenium levels. Values (mean ± standard deviation) with the same letters are not significantly different (P>0.05).……………………………………………….. 164 Figure 7.6 Superoxide dismutase (SOD) gene expression level measured by real-time PCR in seabream larvae fed diets containing five selenium levels. Values (mean ± standard deviation) with the same letters are not significantly different (P>0.05).………………………... 165
! "#$! Figure 7.7 Glutathione peroxidase (GPX) gene expression level measured by real-time PCR in seabream larvae fed diets containing five selenium levels. Values (mean ± standard deviation) with the same letters are not significantly different (P>0.05).……………………….. 165 Figure 7.8 BMP4 (Bone morphogenetic protein 4) gene expression level measured by real-time PCR in seabream larvae fed diets containing five selenium levels. Values (mean ± standard deviation) with the same letters are not significantly different (P>0.05).……………………….. 166 Figure 7.9 Runx2 (Runt-related transcription factor 2) gene expression level measured by real-time PCR in seabream larvae fed diets containing five selenium levels. Values (mean ± standard deviation) with the same letters are not significantly different (P>0.05).…... 167 Figure 7.10 Alkaline phosphatase gene expression level measured by real-time PCR in seabream larvae fed diets containing five selenium levels. Values (mean ± standard deviation) with the same letters are not significantly different (P>0.05).………………………... 167 Figure 7.11 Osteocalcin gene expression level measured by realtime PCR in seabream larvae fed diets containing five selenium levels. Values (mean ± standard deviation) with the same letters are not significantly different (P>0.05).………………………………………………. 168 Figure 7.12 Osteopontin gene expression level measured by realtime PCR in seabream larvae fed diets containing five selenium levels. Values (mean ± standard deviation) with the same letters are not significantly different (P>0.05).……………………………………………….. 168 Figure 7.13 Osteonectin gene expression level measured by realtime PCR in seabream larvae fed diets containing five selenium levels. Values (mean ± standard deviation) with the same letters are not significantly different (P>0.05).………………………………………………. 169 Figure 7.14 Matrix Gla gene expression level measured by real-time PCR in seabream larvae fed diets containing five selenium levels. Values (mean ± standard deviation) with the same letters are not significantly different (P>0.05).……………………………………………….. 169 Figura 9.1 Factores que afectan la utilización de las partículas de alimento (Adaptado de Kolkovski et al., 2009)……….. 180
! "#$$! Figura 9.2 Absorción y metabolismo de triglicéridos (Adaptado de Smith et al., 1983).……………………………………... 189 Figura 9.3 Representación esquemática de la estructura de una lipoproteína……………………………………………... 191 Figura 9.4 Representación esquemática de la estructura de una lipoproteína……………………………………………... 192 Figura 9.5 Vías de biosíntesis de las clases principales de fosfolípidos (Tocher et al., 2008). CDP-Cho, CDPcolina, CDP-DAG, CDP-diacilglicerol, CDP-Etn, CDPetanolamina; DAG, diacilglicerol, PA, ácido fosfatídico: PC, fosfatidilcolina, PE, fosfatidiletanolamina, PI, fosfatidilinositol, PS, fosfatidilserina, SM , esfingomielina. Las enzimas son; 1, CDP-DAG sintasa; 2, PA-fosfatasa; 3, PI-sintasa; 4, PS-sintasa; 5, CDP-colina:DAG fosfotransferasa; 6, CDP-etanolamina:DAG fosfotransferasa; 7, PE metiltransferasa; 8, PSdescarboxilasa; 9, SM-sintasa; 10 y 11, PS-sintasa a través de intercambio de base…… 194 Figura 9.6 Diagrama simplificado de la diferenciación de precursores de osteoclastos (A) en los osteoclastos y los precursores de osteoblastos (B) en osteoblastos. PU.1, factor de transcripción PU.1; M-CSF, factor estimulante de colonias de macrófago, c-fms, genes c-fms; MITF, factor de transcripción asociado a microftalmia; c-fos, gen c-fos; NF!", factor nuclear !"; NFATc1,factor nuclear de células T1 activadas; TRAF6, factor de necrosis tumoral asociado al receptor factor-6; c-src, gen del sarcoma celular-; ! v ß 3, ! v ß 3-integrina; RANKL, activador del receptor del factor nuclear de ! v "; OPG , osteoprotegerina, OSX, osterix; PPAR#2, receptores activados por proliferador de peroxisoma, (Adaptado de Kruger et al., 2010).……………………. 196 Figura 9.7 Mecanismos antioxidantes dentro de la célula. Adaptado de Machlin y Bendich (1987). Catalasa (CAT), Superóxido dismutasa (SOD), Glutatión peroxidasa, (GPX), Glutatión reducido (GSH).……….. 201 Figura 9.8 Mecanismo propuesto para la reacción del !-tocoferol con lípidos oxidantes. El grupo de radicales peroxilo formado durante la oxidación de lípidos es polar y flota a la superficie de la membrana donde puede reaccionar con el ! -tocoferol, resultando en un hidroperóxido lipídico y el radical tocoferoxilo (Buettner, 1993)………………………………... 204
Introduction ………………………………………………………………………………………… 5 Figure 1.1 Factors affecting food particle utilization (Adapted from Kolkovski et al., 2009). According to (Kolkovski et al.,2009), microparticulated diets can be classified in three general types: I. Microbound type is the simplest microdiet, where the powdered ingredients are microbound with a water stable matrix such as agar or carrageenan (LópezAlvarado et al., 1994). II. Microcoated type, its manufacturing process relied on coating the powdered ingredients with a glucidic (carraggeenan, alginate), proteic (gelatin, zein) or lipid binder to reduce leaching (Önal and Langdon, 2004). III. Microencapsulated diets are made by encapsulating a solution, colloid or suspension of diet ingredients within a membrane, and it is produced with a cross linking agent (Yúfera et al., 1999; Kolkovski, 2009). ! ! ! ! "#$%&'#()! "#$#%&! '()*+#,&! -,.(+%#+,*&! /)#&*0(+! ! *++#,#-.)#&/!0!.1+&%2)#&/! !"#$%&'(")*"$& +,-"(.,/,,& 0"12$3("4*"$&/,3(3"(4*,2$& 3#4(+)#&/! 1#.+&*#2+!+,345+&! '+(#&*67*#8!5)2+5+,*&! 1#.+&*#2+!*(68*!%+2+7)$5+,*! 98#%!&+8(+*#),:!;#7+!&67*&! 5/4(+)#&/! 6#7(!! 8.+)(! 69.2(! +(.*5*24$& :9(,#$.-!;.$)&%+! ! 6**)&144"1-4124$& 6"**&15,2(&1-,)$& 155(2,#5&& $1/4$7&8*4-9&! ! <#+=.-!;.$)&%+! ! :&-&%! 69.2(! 6#7(! "&>(,(/)!
Introduction ………………………………………………………………………………………… 6 1.3 Importance of phospholipids in marine fish larvae nutrition In fish, as in other vertebrates, phosphoglycerides are particularly important in fish larvae production for their essential function as necessary components for cellular bio-membranes and organelles formation (Izquierdo and Koven, 2010). Besides, phosphoglycerides can also serve as an energy source during egg development and endogenous feeding in the pre-larval stages of marine fish (Izquierdo and Koven, 2010). Moreover, phosphoglycerides can act as emulsifiers in the formation of mixed micelles in the digestive tract (Olsen and Ringø, 1997). Indeed, young fish contain abundant phospholipids received during embryo and larval development either from endogenous yolk sac or exogenous live preys lipids (Rainuzzo et al., 1997; van der Meeren et al., 2008). Studies on dietary phospholipids were initiated by Kanazawa et al., (1981, 1983a, b), who showed that despite their significant roles in fish metabolism, developing fish possess a limited ability for phospholipids synthesis (Kanazawa et al., 1985) and, consequently, they must be included in young fish diets. Moreover, lipid digestion, absorption and transport are very limited in the first feeding larvae with a poorly developed digestive system, and phospholipids playing different important roles in all these processes. However, fish larvae may be unable to efficiently synthesize phospholipids in an enough quantity to cover this high demand and therefore need to be included in the diet (Izquierdo and Koven, 2010). Indeed, in the first feeding larvae, enterocytes are poorly developed and phospholipid synthesis is scarce (Deplano et al., 1991). In gilthead seabream, isolating microsomes from enterocytes demonstrated that phospholipid synthesis occurs mainly through the glycerol-3-phosphate pathway, whose activity is modulated by dietary lipids (Caballero et al., 2003). Moreover, restrictions in the rate of phospholipid synthesis may constrain lipoprotein synthesis (Liu et al., 2002) that is crucial for lipid transport (Salhi et al., 1999; Caballero et al., 2006a). Thus, addition of 20 g kg-1 dry weight diet of soybean lecithin in microdiets for 15 dph gilthead seabream containing 220 g kg-1 dw lipids, significantly increased the occurrence of lipoprotein particles in the lamina propria, promoting transport and utilization of dietary lipids as well as growth (Liu et al., 2002). Dietary PL not only increases synthesis and release of lipoproteins in the lamina propria by enterocytes, but also significantly reduces lipoprotein size by promoting very low density lipoprotein (VLDL; higher in PL) synthesis, rather than
Introduction ………………………………………………………………………………………… 7 chylomicron production (higher in NL) (Liu et al., 2002; Caballero et al., 2003, 2006b). Thus, phospholipids inclusion in young fish diets has been found to improve culture performance of various fresh water and marine fish species (Izquierdo and Koven 2011), enhancing growth and survival (Kanazawa 1993; Salhi et al., 1999; Izquierdo et al., 2001; Kjørsvik. 2009). Besides their importance for growth and dietary lipid utilization, dietary phospholipids have been also found to be necessary to improve stress resistance, skeleton development and flatfish metamorphosis and pigmentation (Kanazawa et al., 1981; Kanazawa, 1993; Fontagné et al., 2000; Koven, 2003; ZamboninoInfante and Cahu, 2007; Hamza et al., 2008). 1.3.1 Phospholipids as source of essential fatty acids Phospholipids can be an important source of energy (fatty acids) in fish, particularly during embryonic and early larval development in species that produce phospholipidrich eggs (Tocher, 1995). Larval fish at first feeding may be predisposed to digestion and metabolism of phospholipids and the use of fatty acids from phospholipids for energy (Sargent et al., 1997). The main roles of fatty acids in fish larvae are consistent with those in juveniles and adults. Thus, they function as a source of metabolic energy, structural components in the phospholipids of cellular membranes and precursors of bioactive molecules (Sargent et al., 1999; Izquierdo et al., 2000; Tocher, 2003). Dietary phospholipids tend to be a richer source of essential fatty acid (EFA) than neutral lipids such as triacylglycerols (Tocher, 1995). In addition, phospholipids may be superior to neutral lipids as a source of EFA in larval fish due to improved digestibility (Sargent et al., 1997, 1999). Recently it was shown that phospholipids were the more efficient mode of supply dietary EPA and DHA to sea bass larvae than triglycerides (Gisbert et al., 2005; Tocher et al., 2008). In any case, most of the studies to determine phospholipid requirements have been performed with soybean or egg lecithin that are rich in 18:2n-6 but also deficient in n-3 HUFA, EPA and DHA, essential fatty acids for marine fish (Watanabe et al., 1984; Coutteau et al., 1997; Sargent et al., 2002; Tocher et al., 2008).
Introduction ………………………………………………………………………………………… 8 1.3.2 Phospholipid requirements Studies conducted on a large number of species, marine as well as fresh water, confirmed an essential dietary requirement for PL. Optimal level of dietary PL supplementation was found to depend on the species, the PL source and classes, and the criteria used to evaluate this effect: growth, survival, stress resistance, malformations in larvae. Tocher et al., (2008) reported the dietary requirements of different species both at larval and juvenile stages (Table 1.1). Table 1.1 Quantitative and qualitative phospholipid requirements of teleost fish (Adapted from Tocher et al., 2008) Species Developmental stage Phospholipid supplementa and levels studiedb Optimal requirement and criteria usedc Feeding period Reference Ayu (Plecoglossus altivelis) Larvae 0 and 3% SBL or EL 3% (G,S,M) 20 days Kanazawa et al., (1981) Larvae 0, 1, 3 and 5% SL 3% (M), 5% (G,S) 50 days Kanazawa et al., (1983b) Larvae 0 and 3% EL or BPL 3% (G,S,M) 50 days Kanazawa et al., (1983b) Juvenile 0 and 3% SBL or BPL 3% (G) 33 days Kanazawa et al., (1981) Juvenile 0, 1, 3 and 5% EL 3% (G) 33 days Kanazawa et al., (1981) Japanese flounder (Paralichthys olivaceus) Larvae 0, 3, 5 and 7% SBL 7% (G,S) 30 days Kanazawa (1993) Juvenile 0, 3, 5 and 7% SBL 7% (G) 30 days Kanazawa (1993) Knife jaw (Oplegnathus fasciatus) Larvae 0, 2.5, 5 and 7.4% SBL 7.4% (G,S) 22 days Kanazawa et al., (1983a) Larvae 0, 3, 5 and 7% SBL 5% (G,S,R) 28 days Kanazawa (1993) Juvenile 0, 3, 5 and 7% SBL 3% (G) 60 days Kanazawa (1993) European sea bass (Dicentrarchus labrax) Larvae 3, 6, 9 and 12% SBL 12% (G,S,M) 40 days Cahu et al., (2003a) Juvenile 0 and 3% SBL 3% (G) 40 days Geurden et al., (1995b) Juvenile 0 and 2% EPC or SPC 2% (G) 40 days Geurden et al., (1995a) Red seabream (Pagrus major) Larvae 0 and 5% SBL 5% (G,S) 20 days Kanazawa et al., (1983a) Common carp (Cyprinus carpio) Larvae 0 and 2% EL 2% (G,S) 25 days Geurden et al. (1995b) Larvae 0 and 2% PL 2% (G,S) 21 days Geurden et al., (1995a) Larvae 0 and 2% SPC, SPI or EL 2% (G,S, M except El) 25 days Geurden et al., (1997a)
Introduction ………………………………………………………………………………………… 9 Pikeperch (Sander lucioperca) Larvae 1, 5 and 9% SBL 9% (G) 24 days Hamza et al., (2008) Gilthead seabream (Sparus aurata) Larvae 9, 11 and 15% SL >9% (G,S) 23 days Seiliez et al., (2006) Larvae 6, 7, 9, 10 and 11 KPL 10% (G,S,R) 30 days Saleh et al., (2012a) Larvae 5, 6, 7, 9 and 10 SBL 9% (G,S,R) 30 days Saleh et al., (2012b) Striped Jack (Pseudocaranx dentex) Juvenile 0, 0.5, 1, 1.5 and 2% SPC 1.5% (G,S,R) 6 weeks Takeuchi et al., (1992) Juvenile 0 and 1.5% SPE 1.5% (G) 6 weeks Takeuchi et al., (1992) Rainbow trout (Oncorhynchus mykiss) Juvenile 0, 2, 4 and 8% SL 4% (G) 20 weeks Poston (1990a) Juvenile 0 and 14% 14% (G) 8 weeks Rinchard et al., (2007) Turbot (Psetta maximus) Juvenile 0 and 2% EL 2% (G) Geurden et al., (1997b) Atlantic salmon (Salmo salar) Juvenile (180 mg) 0, 2, 4, 6 and 8% SBL/CPL 6% (G) 14 weeks Poston (1991) Juvenile (180 mg) 0 and 4% SBL 4% (G) 16 weeks Poston (1990b) Juvenile (1.0 g) 0 and 4% SBL 4% (G) 12 weeks Poston (1990b) Juvenile (1.7 g) 0 and 4% SBL 4% (G) 12 weeks Poston (1990b) Juvenile (7.5 g) 0 and 4% SBL 0% (no requirement) 12 weeks Poston (1990b) White sturgeon (Acipenser transmontanus) Juvenile (5-10 g) 0 and 8% SBL 0% (no requirement) 6 weeks Hung and Lutes (1988) aBPL, bonito egg polar lipid; CPL, corn polar lipid; EL, chicken egg lecithin; EPC, purified egg phosphatidylcholine; KPL, Krill phospholipid; PL, various phospholipid sources supplemented to supply 2% dietary phospholipids including EL, SL, sunflower, rapeseed and marine phospholipids: SBL, soybean lecithin; SPC, purified soybean phosphatidylcholine; SPE, purified soybean phosphatidylethanolamine; SPI, purified soybean phosphatidylinositol; bPercentage of diet weight; cG, growth; S, survival; M, malformations; R, stress resistance. These authors evidenced a trend suggesting that quantitative PL requirements decrease from larval stages to small juveniles. No requirements were observed in fish greater than 5 g. Phospholipids requirements have been found to be related to the larval age and the degree of digestive system development (Kanazawa, 1993; Izquierdo and Koven, 2010). However, both optimal PL level and composition, as well as the role of dietary PL remain unclear for most species. Sargent et al., (1999) considered that the egg lipid composition give a valuable approximation of the optimal lipid composition of a larval diet. The quantitative requirements of phospholipids for larval fish range from 2 to 12% of diet, being lower in the larvae of common carp (Cyprinus carpio) (2% chicken egg) (Geurden et al., 1995a), followed
Introduction ………………………………………………………………………………………… 10 by red seabream (Pagrus major) (5% SBL) and knife jaw (Oplegnathus fasciatus) (7.4 % SBL) (Kanazawa et al., 1983a) and Japanese flounder (Paralichthys olivaceus) larvae (7 % SBL) (Kanazawa, 1993), with the highest reported value being for gilthead seabream (Sparus aurata) (15 % SBL) (Seiliez et al., 2006). However, for the later species, our recent studies (Chapter 3) have found an optimum inclusion of about 10% using krill oil as phospholipids source (Saleh et al., 2012a). 1.3.3 Phospholipid digestion, absorption and transport 1.3.3.1 Phospholipid digestion The digestion and assimilation efficiency in marine fish larvae may be lower than in adult fish because the marine fish larvae have digestive features different from that of juveniles (Cahu and Zambonino-Infante, 1995a, b). It has been hypothesized that marine fish larvae have insufficient digestive capacity to thrive on a compound diet (Lauff and Hofer, 1984). The change from a primary to an adult mode of digestion characterizes developing animals and has been extensively described in upper vertebrates (Henning, 1987). The activities of digestive enzymes in fish larvae are low at first feeding and increase along with development (Govoni et al., 1986). The digestion of ingested food occurs in the larval intestine, where the pH remains alkaline and trypsin-like enzyme activity accounts for the proteolytic activity (Walford and Lam 1993). At first feeding, the pancreatic and intestinal enzyme activities are generally low (Cousin et al., 1987). Digestive enzymes activity increase during the first 10 dph in Solea senegalensis (Ribeiro et al., 1999), whereas an increase in alkaline phosphatase activity has been found to reflect the development of the brush border membranes of enterocytes in Atlantic cod (Gadus morhua) (Wold et al., 2007). Moreover, the addition of dietary PL enhanced gut maturation index in this species, based on the relation between brush border alkaline phosphatase and cytosolic leucine-alanine aminopeptidase. Enhancement of gut maturation by dietary PL could be related with a higher intracellular availability of PL for cell membrane and cell organelles formation, since dietary PL promotes re-acylation of digested lipids, increasing intracellular PL availability for lipoprotein synthesis in gilthead seabream (Caballero et al., 2003; Liu et al., 2002). It is known that lipids are generally well digested by fish (Olsen and Ringo, 1997). In general, the digestibility of dietary lipids in fish is high, about 95%,
Introduction ………………………………………………………………………………………… 11 although the digestibility of different fatty acids is different depending on the degree of unsaturation and chain length. Thus, saturated and monounsaturated are less digestible than polyunsaturated fatty acids (Lied and Lambertsen, 1982, Olsen and Ringo, 1997). Therefore, it has been suggested that the absorption of some fatty acids is more efficient than that of others (Olsen et al., 1998). Dietary lipids are hydrolyzed in the digestive tract lumen by lipolytic enzymes producing mainly free fatty acids, monoacylglycerols and diacylglycerols. While in higher vertebrates the hydrolysis of dietary lipids is mainly catalyzed by a specific pancreatic lipase, which hydrolyzes the fatty acids sn-1 and sn-3 releasing 2monoacylglycerols, in fish, the main enzyme responsible for digestion of neutral lipid is a neutral non specific lipase dependent bile salts (bile salt activated lipase, BAL) (Iijima et al., 1998; Izquierdo and Henderson, 1998), which hydrolyzes the ester bonds of various fatty acids with glycerol molecule. Despite this enzyme is characterized by acting on a wide range of substrates, it also appears to have a greater specificity for polyunsaturated fatty acids (Lied and Lambrtsen, 1982; Iijima et al., 1998; Izquierdo et al., 2000). Several types of lipases have been found in the digestive tract of juvenile or adult fish. Among them, the non-specific neutral lipase activated by bile salts (BAL) appears to play a major role in digestion of neutral lipids in most fish species such as seabass, anchovy, rainbow trout, red seabream, turbot or gilthead seabream (Patton, et al., 1975; Ijima et al., 1990, Iijima et al., 1998; Izquierdo and Henderson, 1998; Caballero et al., 2002). This enzyme catalyzes the hydrolysis not only of acylglycerides, but also of other dietary lipids including cholesterol esters and esters of vitamins. There is also evidence of the presence of specific pancreatic lipase (MPL) in several species, it is activated in the presence of bile salts and is specific for triacylglycerols (lijima et al., 1998). Lipids containing polyunsaturated fatty acids of the n-3 series, which are essential for marine fish, are more resistant to hydrolysis by the MPL. On the contrary, it has been demonstrated that the BAL is specific for these fatty. Thus, although the MPL preferentially hydrolyzes esters of 18:1n-9 than 18:2 n-6 or 18:3n3, the BAL shows a preference for 20:5 n-3 and 20:4 n-6 than 18:2 n-6 and 18:1n-9 (lijima et al., 1998). The distribution patterns of lipase activity along the digestive tract of juvenile and adult fish appear to differ between species (Izquierdo and Henderson, 1998). This difference in lipolytic activity distribution in adult fish, almost disappears in juveniles
Introduction ………………………………………………………………………………………… 12 and larvae, suggesting less functional differentiation in the digestive tract in the early stages of development. Digestion of dietary phospholipids is relatively unstudied in fish, but it is presumed that the mechanisms are generally similar to those in mammals, whereby phospholipids are digested by intestinal phospholipase A2, secreted by the pancreas, in the intestine and specifically recognizes the sn-2 acyl bond of phospholipids and catalytically hydrolyzes the bond resulting in the formation of 1-acyl lysophospholipids and free fatty acids (Figure 1.2) that are absorbed by the intestinal mucosal cells (Henderson and Tocher, 1987; Sargent et al., 1989; Izquierdo and Henderson, 1998). There are two isoforms of phospholipase A2 that have been purified in red seabream hepatopancreas (Ono and Iijima, 1998). The activity of phospholipase A2 was detected in marine fish larvae several days after first feeding (Izquierdo et al., 2000). Lipolytic enzymes of pancreas, lipase and phospholipase A2, increase with development of marine fish larvae (Izquierdo et al., 2000) and are stimulated by the increase of their respective substrates, triglycerides and phospholipids in the diet. Phospholipase A2 activity increases with the level of its corresponding mRNA in sea bass larvae (Zambonino-Infante and Cahu, 1999) suggesting a transcriptional regulation of this enzyme that has been elevated when diets incorporated more than 4.5% phospholipids. 1.3.3.2 Phospholipid absorption and transport The dietary lipid absorption in fish is simillar to that of mammals (Sire et al., 1981; Tocher et al., 2008). After intraluminal hydrolysis, dietary lipid is incorporated into intestinal epithelial cells by diffusion in a form of micelles of monoglycerides and free fatty acids (Izquierdo et al., 2000; Tocher et al., 2008). Products of hydrolysis of dietary lipids, free fatty acids, monoacylglycerols, diacylglycerols and lysophospholipids, are grouped with bile salts to form small micelles that are transported into the enterocyte (Figure 1.2), and the content of these micelles, which also includes other lipids such as cholesterol and liposoluble vitamins, crosses the cell membrane by diffusion and is poured inside the enterocyte (Smith et al., 1983). Reacylation occurs in the endoplasmic reticulum and its products are released into the submucosal as lipoproteins of very low density (chylomicrons). The activity of the
Introduction ………………………………………………………………………………………… 13 enterocytes during the absorption of lipids is the packaging of lipids together with proteins to constitute stable molecules to transport them through the blood to sites of metabolism and storage (Gurr and Harwood, 1991). Inside the intestinal cells, as the short chain fatty acids (less than 12 atoms carbon) are sufficiently soluble in the plasma, they are released directly from the enterocyte to the portal circulation and metabolized in the liver (Green and Selivonchick, 1987). The absorbed long-chain fatty acids and monoacylglycerols migrate to the endoplasmic reticulum vesicles, where they are resynthesized into triglycerides or other lipids by a multienzyme complex (Gurr and Harwood, 1991). These fatty acids diffuse to the endoplasmic reticulum associated with the binding protein FABP (Fatty Acid Binding Protein), which plays an important role in intracellular transport of the absorbed fatty acids. In fish, this protein has a preference for unsaturated fatty acids in the same manner as it occurs in mammals (Gangl et al., 1980). Sire and Vernier (1981), reported that this protein is more abundant in fish fed high dietary lipids, which could indirectly affect the activation and reacylation of fatty acids. Figure 1.2 Absorption and metabolism of triacylglycerides (Adapted from Smith et al., 1983).
Introduction ………………………………………………………………………………………… 14 The two main pathways of reacylation of fatty acids in the enterocytes are the monoacylglycerol and glycerol-3-phosphate pathway, both routes finally producing triacylglycerol and phospholipids (Iijima et al.,1983; Caballero et al., 2006a) (Figure 3). Most enzymes involved in these pathways have been identified and studied in rats, but there are very few studies in fish that refer to them (Sire et al.,1981; Iijima et al.,1983; Caballero et al., 2006a). Thus, Iijima et al., (1983) showed that the intestine of carp (Cyprinus carpio) is able to esterify the palmitic acid in triglycerides and phospholipids. On the other hand, Sire et al., (1981) found that linoleic acid is esterified more rapidly to triacylglycerols than palmitic acid in enterocytes of rainbow trout. Furthermore, these authors propose that while monoacylglycerol pathway in mammals is predominant due to the luminal hydrolysis products are the 2monoacylglycerols, but in fish, the pathway glycerol-3-phosphate is the main due to free fatty acids and glycerol are the main products of hydrolysis intraluminal, so that the synthesis of glycerophospholipids in fish is more important than in mammals. Caballero et al., (2006 a) isolating enterocytes microsomes demonstrated that in gilthead seabream phospholipid synthesis occurs mainly through the glycerol-3phosphate pathway, whose activity is modulated through dietary lipids. In the case of phospholipids, the mechanisms of absorption of their digestion products have not been studied deeply in fish, but are assumed to be generally similar to those in mammals. Thus, the hydrolysis products, 1-acyl-lysosome phospholipids and fatty acids free are associated with all other products of lipid digestion with bile salts in mixed micelles, which uptake in the intestinal mucosa, whose penetration occurs in the enterocytes by passive diffusion. Lyso-phospholipids concentration is very low in the intestinal mucosa, most of the 1-acyl lyso-phospholipids are reesterified with free fatty acids activated in microsomes prior to export from enterocytes to the circulatory system (Sargent et al., 1989).
Introduction ………………………………………………………………………………………… 21 Figure 1.7 A simplified diagram of the differentiation of (A) osteoclast precursors into osteoclasts and (B) osteoblast precursors into osteoblasts. PU.1, Transcription factor PU.1; M-CSF, macrophage-colony stimulating factor; c-fms, c-fms genes; MITF, microphthalmia-associated transcription factor; c-fos, c-fos gene; NF!", nuclear factor !"; NFATc1, nuclear factor of activated T cells 1; TRAF6, tumor necrosis factor receptor-associated factor-6; c-src, cellular-sarcoma gene; !v"3, !v"3-integrin; RANKL, receptor activator of nuclear factor !" ligand; OPG, osteoprotegerin; Osx, osterix; PPAR#2, peroxisome proliferator activated receptor #2 (Adapted from Kruger et al., 2010). Bone is a specialized vascularized connective tissue consisting of cells and a mineralized extracellular collagen matrix that then mineralizes by deposition of hydroxyapatite (Hall and Witten, 2007; Nordvick, 2007). During first feeding several dietary nutrients play a central role in bone development and the posterior appearance of skeletal malformations (Izquierdo et al., 2010, 2012). Several studies dealing with the impact of first feeding on fish development showed that the dietary incorporation of total phospholipid reduced malformation, especially twist of jaw and scoliosis, in
Introduction ………………………………………………………………………………………… 22 ayu larvae, (Plecoglossus altivelis) (Kanazawa et al., 1981). Geurden et al., (1998a) suggested that in carp larvae dietary PL, specially PI, reduces skeletal deformity. These findings were reinforced by Cahu et al., (2003a) who found that dietary PC/PI ratio of 2.18 prevented deformities during larval development in European sea bass. Moreover, ossification of the vertebral column in cod larvae, first observed at 21dph in neural arches, occurred significantly earlier in groups fed diets containing PL than in those fed neutral lipids (NL), when measured both by larval size and larval age (Kjørsvik et al., 2009). The PL has a role as a precursor of second messenger regulating calcium entry into the cells, and it is involved in a signaling system controlling biological processes in the early development of vertebrates (Berridge and Irvine, 1989). Sandel et al., (2010) found a very high correlation between developmental age of gilthead seabream fed high PI and gene expression for osteocalcin, a protein used as a marker for bone and cartilage growth, and has been correlated with bone mineralization (Simes et al., 2008). PI, as the second messenger inositol-3-phosphate (IP3), mobilizes calcium by regulating the entry of this ion into the cell from the endoplasmic reticulum (Cahu et al., 2003a; Tocher et al., 2008). These authors argued that dietary PI may be increasing the availability of calcium for bone mineralization, which stimulates osteocalcin production and normal bone development. In support of this, Nishimoto et al., (2003) found in carp that bone hydroxyapatite binding of bone Gla protein (BGP) is enhanced in the presence of calcium ions. Changes in dietary PUFAs are reflected in the composition of various tissues, including bone cells such as the osteoblasts (Atkinson et al., 1997; Moyad, 2005). Several of the long chain poly-unsturated fatty acids (LCPUFAs) have been shown to affect bone cells, i.e. osteoclasts and osteoblasts, via various cellular signaling pathways or growth factors, thereby affecting bone formation, resorption and bone density in animals or humans (Salari et al., 2008). Changing the balance of PUFAs present in the membranes towards the n-3 fatty acids rather than n-6 fatty acids, shifts the ratio of n-6/n-3 in the membranes and affects production of several cytokines, which could affect bone resorption and formation. LCPUFAs have been shown to affect cellular proteins and the receptor activator of nuclear factor k! (RANK), a receptor found on the osteoclast, which controls osteoclastogenesis (Sun et al., 2003; Coetzee et al., 2007). A large number of studies have been done on animals that show that in growing
Introduction ………………………………………………………………………………………… 23 animals PUFAs affect bone mineral content, bone mass, femoral thickness and bone area, seemingly affecting bone formation and growth. n-3 PUFAs also increase alkaline phosphatase (ALP) activity in growing male rats as well as insulin-like growth factor I (IGF-1) and insulin-like growth factor binding protein (IGFBP) levels (Coetzee et al., 2007; Li et al., 1999). Insulin-like growth factors (IGFs), especially IGF-I, are major bone-derived growth factors and are believed to function as both systemic and local growth factors for bone tissue. Once secreted and deposited in bone matrix, IGFs are released during osteoclastic bone resorptive activity, acting in an autocrine or paracrine fashion to stimulate new bone cell formation and matrix production (Watkins and Seifert, 2000). IGF-I acts as a regulator of bone cell function as it stimulates the proliferation of preosteoblasts, thereby increasing the number of cells capable of producing bone matrix. In addition, IGF-I increases collagen expression while decreasing collagen degradation, causing an anabolic effect in bone tissue (Schmid et al., 1992; Delany et al., 1994). Dietary PUFAs may up-regulate or down-regulate IGF-I production in bone via their ability to modulate local concentrations of the arachidonic acid (AA) metabolite prostaglandin E2 (PGE2) (Li et al., 1999; McCarthy et al., 1991; Delany et al., 1994). PGE2 is derived from the AA and is the major prostaglandin in bone. It has been shown to be a potent modulator of bone remodeling, affecting both bone resorption (Collins and Chambers, 1991) and formation (Jee and Ma, et al., 1997; McCarthy et al., 1991). PGE2 also promotes the expression of various IGF-binding proteins (Schmid et al., 1992; McCarthy et al., 1994; DiBattista et al. 1996) suggesting that PGE2 could keep IGF-1 available for stimulation of osteoblasts at a later phase of bone remodeling (Schmid et al., 1992). McCarthy et al. (1991) suggested that the ability of PGE2 to enhance osteoblastic IGF-I synthesis could explain its anabolic potential, and furthermore suggests a role for PGE2 in coupled bone remodeling. The anabolic effects of PGE2 may occur through stimulation of endogenous IGF-I production by osteoblasts (Raisz et al., 1993) or by increased bone cell responsiveness to IGF-I (Hakeda et al., 1993) In conclusion, enriching diets with n-3 LCPUFA-rich may elevate or preserve bone mass through increasing mesenchymal stem cell (MSC) number, through enhancing
Introduction ………………………………………………………………………………………… 24 expression of key transcription of factors required for bone formation such as core binding factor !-1 (Cbf!1) and osterix (Watkins et al., 2003; Zhang et al., 2002) that enhance differentiation of pre-osteoblasts into mature osteoblasts. Expression of both Cbf!1 and osterix is enhanced by IGF-1, transforming growth factor-"1 (TGF- " 1), bone morphogenic protein (BMP) and moderate amounts of PGE2 (Zhang et al., 2002), all of which result from diets rich in n-3 LCPUFA. 1.4 Oxidative stress: Antioxidant defense mechanism Lipid peroxidation products such as hydroxyperoxides, fatty acid hydroxides, aldehydes and hydrocarbons which are implicated in several pathological conditions damage cellular bio-membranes (Kanazawa, 1991, 1993) and subcellular membranes, such as those of mitochondria, causing several pathological conditions in fish (Kawatsu, 1969; Watanabe et al., 1970; Murai and Andrews, 1974; Sakai et al., 1989). Fish have an endogenous antioxidant defense system (Filho et al., 1993) with a wide range of antioxidant mechanisms to maintain an adequate oxidative balance. When this balance tilts in favor of the oxidant agents, oxidative stress arises with detrimental effects in molecules of great biological importance. Reactive oxygen species (ROS) are free radicals and/or oxygen derivatives produced during all aerobic biological systems and in normal cellular functions (Mates, 2000). The biological handicap associated with oxidative stress could be estimated by a physicochemical condition in which an increase in the steady-state levels of oxidative species e.g. H2O2, HO-, O-2, ONNO-, Ry ROO- (Ansaldo et al., 2000) increase in ROS leads to random cellular damages on the different cellular components. If continued along time will cause disease or even cell death. 1.4.1 Enzymatic defenses The antioxidant defense system mostly formed by radical scavenging enzymes, play an important role in physiological antioxidant protection (Blazer, 1982). These antioxidants defense mechanisms to detoxify reactive oxygen species have evolved to counteract the potentially deleterious effects of activated oxygen (Yu, 1994). Among antioxidant enzymes, superoxide dismutase (SOD) catalyzes the superoxide anion dismutation to molecular oxygen and hydrogen peroxide; catalase (CAT) breaks
Introduction ………………………………………………………………………………………… 25 down hydrogen peroxide to molecular oxygen and water; glutathione peroxidase (GPX) detoxifies hydrogen peroxide into water, or organic peroxides into their corresponding stable alcohols, by oxidizing the reduced glutathione (GSH) into its oxidized form (GSSG); finally, glutathione reductase (GR) catalyzes the reduction of GSSG into GSH (Halliwell and Gutteridge, 2007). The SOD plays a crucial role since it is the first enzyme to respond to oxygen radicals, preventing initialization of the radical chain reaction that the superoxide anion produces (McCord and Fridovich, 1969; Winston and Di Giulio, 1991). All these enzymes, which are very important in antioxidant defense mechanisms, have been detected in most fish species (Rudneva, 1997). The activities of antioxidant defense enzymes showed variations in different organs of fish (Wdzieczak et al., 1982; Lemaire et al., 1993), depending upon feeding behavior (Radi and Markovics, 1988), feeding period (Mourente et al., 2002), ecological conditions (Winston and Di Giulio, 1991) and dietary antioxidant content. All these antioxidant mechanisms are responsible for maintaining an adequate “oxidative balance”. When this balance tilts in favor of the oxidant agents, due to excessive generation of these compounds, or a weakening of antioxidant defenses, or both occurring simultaneously, “oxidative stress” arises (Sies, 1985; Tocher et al., 2002). Antioxidants may be found in the cell plasma, mitochondria or cell membranes (Figure 1.8) and can act at different stages in the oxidation process and some may have more than one mechanism of action. They can exert their action by different mechanisms such as breaking the chain of an initiated sequence, scavenging singlet oxygen or decreasing local O2 concentrations.
Introduction ………………………………………………………………………………………… 26 Figure 1.8 Antioxidants mechanisms within the cell. Adapted from Machlin and Bendich (1987). Catalase (CAT); Superoxide dismutase (SOD); Glutathione peroxidase; (GPX); Reduced glutathione (GSH). 1.4.2 Non enzymatic defenses An antioxidant is a substance that, when present at low concentrations compared to those of a prone to oxidation substrate, is able to interact with free radicals to terminate the reaction (Halliwell and Gutteridge, 1990). Adequate levels of antioxidant compounds can be provided by nutritional supplements, including vitamins such as vitamin E and C or minerals such as selenium, that establish a second line of defense (Sen, 1995). These supplements will promote maximum benefits from these nutrients and avoid lipid oxidation problems that can cause pathologies (Sakai et al. 1989) including cellular damages (Halliwell and Gutteridge, 1996), muscles injuries (Betancor et al., 2011; 2012a), negative growth, bad feed intake and poor development, increased incidence of deformities (Lewis-McCrea and Lall, 2007), and, in general, oxidative damage to molecules of great biological importance such as lipids, proteins, carbohydrates and DNA causing alterations that can lead to cell death (Winston and Di Giulio, 1991; Halliwell and Gutteridge, 2007).
Introduction ………………………………………………………………………………………… 27 1.4.2.1 Vitamin E (!-tocopherol) The vitamin E has a great importance as exogenous component in the diet of aquaculture fish acting as an antioxidant defense in reduction of lipid peroxidation products and free radicals scavengers (Machlin, 1984; Betancor et al., 2011). Mourente et al. (2002) showed a reduction of peroxidation products in liver of gilthead seabream fed oxidized oil fed diets supplement with vitamin E in comparison with those fed diets lacking this vitamin. Vitamin E is a lipid soluble vitamin that is absorbed from the digestive tract in association with fat molecules. Putnam and Comben (1987) showed that vitamin E is a structural component of cell membranes, where it acts as an antioxidant factor for phospholipids by chain-breaking antioxidant process (Sargent et al., 1997). Also, it has role in maintaining flesh quality in rainbow trout (Frigg et al., 1990; Chaiyapechara et al., 2003; Yildiz, 2004), Atlantic salmon (Salmo salar) (Hamre et al., 1998; Scaife et al., 2000), turbot (Psetta maxima) (Ruff et al., 2003, 2004) and sea bass (Gatta et al., 2000; Pirini et al., 2000), improving immunity, increasing the resistance of red blood corpuscles to haemolysis, and permeability of capillaries and heart muscle (Halver, 2002). Besides, it has been proposed to be the most important factor in maintaining the post-mortem membrane stability of fish fillet (Baker, 1997). Dietary requirement of vitamin E has been studied in different fish species (NRC, 1993) and recommendations include 120 mg kg-1 diet (Hamre and Lie, 1995) for Atlantic salmon, 30 to 50 mg kg-1 diet for channel catfish (Ictalurus punctatus) (Murai and Andrews, 1974; Wilson et al., 1984), 200 to 300 mg kg-1 diet for common carp (Cyprinus carpio) (Watanabe et al., 1977), 1200 mg kg-1 for gilthead seabream juveniles (Ortuño et al., 2000) and 99 mg kg-1 for mrigal fry (Cirrhinus mrigala) (Paul et al., 2004). The level of 250 mg !-tocopherol kg-1 diet is sufficient to meet the requirements for successful reproduction in gilthead seabream (Fernández-Palacios et al., 1998). Little is known about the precise vitamin E requirements in marine fish larvae, but Atalah et al. (2008) used 1.5 and 3.0 g kg-1 dry diet of vitamin E for gilthead seabream and sea bass larvae, and suggested an optimal level of 3 g kg-1 because this high level reduced mortality after stress. In the same study, the high vitamin E level also alleviated muscular lesions caused by excessive dietary DHA (Betancor et al., 2011). The results of these studies are therefore in line with the general opinion that
Introduction ………………………………………………………………………………………… 28 vitamin E in larval diets should be above 1 g kg-1, while the requirement given by NRC (1993) for juvenile fish is 50 mg kg-1. However, when stress and immune responses are used to measure requirements of these vitamins, higher estimations of dietary optima are most often found, also in juvenile and adult fish (Hamre, 2011). Figure 1.9 Proposed mechanism for the reaction of a-tocopherol with oxidizing lipids. The peroxyl radical group formed during lipid oxidation is polar and floats to the surface of the membrane where it can react with atocopherol, rendering a lipid hydroperoxyde and the tocopheroxyl radical (Buettner, 1993). The effect of !-tocopherol in skeletal development has been studied extensively in terrestrial mammals but not in fish. Vitamin E is important for proper skeletal development (Xu et al., 1995; Jilka et al., 1996) where it associates with the lipid bilayer of bone cells allowing it to be the first line of defense against free radicals (Arjmandi et al., 2002). The studies on the effect of ROS on fish bone development
Introduction ………………………………………………………………………………………… 29 are scarce. Lewis-McCrea and Lall (2007) found an increase in the incidence of scoliosis in Atlantic halibut juveniles feed increasing levels of oxidized oils. This may be a result of lipid peroxidation products effect, which stimulate osteoclastic differentiation and inhibit osteoblastic activity that may cause bone resorption and lead to improper bone formation/abnormalities (Tintut et al., 2002; Parhami, 2003; Kruger et al., 2010). The antioxidant mechanism of !-tocopherol intercepts the peroxyl radical (ROO-) more rapidly than PUFA by donating its phenolic hydrogen atom to the radical and converting it to a hydroperoxide product (Figure 1.9), thereby breaking the chain of reactions involved in lipid auto-oxidation. Result of this reaction is the tocopheroxyl radical that is sufficiently stable to be unable to continue the oxidation chain and, instead, is removed from the cycle by reaction with another peroxyl radical to form inactive non-radical products. 1.4.2.2 Selenium Research on mineral requirements in fish larvae only started after 2005 and the number of publications is quite small. Selenium (Se) is a trace mineral and an essential micronutrient for vertebrates (Johansson et al., 2005). In fish, Se is also involved in thyroid hormone and insulin function, maintenance of fertility as well as regulation of cell growth (Lall, 2002; Kohlmeier, 2003). One of the major Se function is as a component of the selenoproteins GPX, isoenzymes that protect lipid components and membranes at both the cellular and subcellular level from oxidative damage (Arteel and Sies, 2001). Se deficiency can lead to oxidative stress in organs (Gatlin et al., 1986; Bell et al., 1986, 1987), reduced growth (Wang and Lovell, 1997) and increased mortality (Gatlin et al., 1986; Bell et al., 1987) in several fish species Penglase et al., (2010) fed rotifers enriched with up to 3 mg selenium kg-1 dry weight diet to cod larvae. They found only minor effects on growth and survival, but gene expression and activity of the glutathione peroxidases were enhanced by the enrichment, indicating a requirement of selenium above the control level. The importance of Se to oxidative stress is due to its role in active sites of the antioxidant enzymes glutathione peroxidase and phospholipid hydroperoxide glutathione peroxidase (Felton et al., 1996), which catalyze the reduction of hydroperoxides and peroxides to less reactive alcohols and water (Felton et al., 1996). It must be taken into account that Se requirements of fish vary with the form of
Introduction ………………………………………………………………………………………… 30 selenium ingested, PUFA and vitamin E content of the diet (Lall, 2002). As illustrated above, direct measurements of vitamin and mineral requirements in fish larvae are fragmented and scarce, as each nutrient is measured only in a few species or not at all. More work is therefore needed to conclude on whether micronutrient requirements in fish larvae are different from those in juvenile and adult fish 1.8 Objectives Since good quality fry is essential for the further development of marine fish culture and the success of fry high production is greatly affected by the nutritional quality of the initial larval diets (Kolkovski et al., 2009; Izquierdo et al., 2000), a main objective in fish larval nutrition is to formulate an effective compound diet able to substitute live preys (Watanabe and Kiron, 1994). Dietary phospholipids are fundamental components of these weaning diets (Koven et al., 1995; Izquierdo, 1996; Fontagné et al., 2000; Izquierdo and Koven, 2010) due to their essential roles in larval development (Izquierdo and Koven, 2010). However, despite there are many studies denoting the importance of dietary PL, few of them have aimed to specifically determine the quantitative PL requirements testing at least 5 different levels. Moreover, the type of phospholipid used is determinant of its nutritional value, but few studies have been able to compare different sources at several levels. Finally, although increase of n-3 HUFA rich PL may increase the oxidative risk, these aspects have not been yet studied and no information is neither published about the potential interaction of PL with antioxidant nutrients. Therefore, the main objective of this thesis was to define the phospholipid requirements of gilthead seabream larvae and to improve the current knowledge on the effects of this nutrients on growth, survival, stress resistance, digestive enzymes activity, skeleton formation and mineralization and oxidative metabolism. To achieve this goal the following objectives were formulated: 1To determine the optimum dietary levels of krill phospholipids (KPL) for seabream (Sparus aurata) larvae, and its influence on larval development and digestive enzymes activity. 2To define the optimum dietary levels of soybean lecithin (SBL) for seabream (Sparus aurata) larvae, and its influence on larval development and digestive enzymes activity.
Materials and methods ………………………………………………………………………………………….. 37 Official Methods of Analysis (A.O.A.C., 1995), using the following equation: Where: A = Weight of empty flask B = Weight of wet sample + flask C = Weight of dry sample + flask 2.5.1.2 Ash Ash content was determined in 200 mg samples by complete combustion in an oven at a temperature of 450ºC (A.O.A.C., 1995). 2.5.1.3. Proteins Proteins were estimated from the total nitrogen present in the sample, using the Kjeldhal method (A.O.A.C, 1995). After digestion of the sample (!250 mg) with concentrated sulphuric acid at a temperature of 420ºC, nitrogen was distillate and determined by colorimetric methods. Then total nitrogen content was converted to total crude protein value by multiplying by the empirical factor 6.25. 2.5.1.4 Total lipids Lipids were extracted following the method of Folch et al. (1957). The method starts taking a sample amount between 50-200 mg and homogenising it in an Ultra Turrax (IKA-Werke, T25 BASIC, Staufen Germany,) during 5 min in a solution of 5 ml of chloroform: methanol (2:1) with 0.01% of butylated hydroxytoluene (BHT). The resulting solution was filtered by gravimetric pressure through glass wool and 0.88% KCl added to increase the water phase polarity. After decantation and centrifugation at 2000 rpm during 5 min the watery and organic phases were separated. Once the watery phase was eliminated, the solvent was dried under nitrogen atmosphere and subsequently total lipids weighed. AB ACAB Moisture ! !!!! =)()(100 (%)
Materials and methods ………………………………………………………………………………………….. 38 2.5.1.4.1 Lipid classes Separation of lipid classes was performed by double development high-performance thin layer chromatography (HPTLC) using the method described elsewhere (Olsen and Henderson, 1989). The lipid classes were visualized by charring at 160oC for 15 min after spraying with 3% (w/v) aqueous cupric acetate containing 8% (v/v) phosphoric acid and quantified by densitometry using a CAMAG-3 TLC scanner (Version Firmware 1.14.16; CAMAG, Muttenz, Switzerland) with winCATS Planar Chromatography Manager. The identities of individual lipid classes were confirmed by comparison with reference to the Rf values of authentic standards run alongside samples on HPTLC plates and developed in the same conditions. Total glycerophospholipids, including lysophosphatidylcholine (LPC), phosphatidylcholine (PC), phosphatidylethanolamine (PE), phosphatidylinositol (PI) and phosphatidylserine (PS), were collectively isolated from HPTLC plates and subjected to acid-catalysed transesterification according to the method of Christie (1982). Extraction and purification was performed as described by Tocher and Harvie (1988). 2.5.1.4.2 Fatty acid methyl esters preparation and quantification Fatty acid methyl esters (FAME) were obtained by acid transmethylation of total lipid with 1% sulphuric acid in methanol following the method of Christie (1982). The reaction was conducted in dark conditions under nitrogen atmosphere for 16 h at 50ºC. Afterwards, fatty acid methyl esters were extracted with hexane:diethyl ether (1:1, v/v) and purified by adsorption chromatography on NH2 Sep-pack cartridges (Waters S.A., Massachussets, USA) as described by Christie (1982). Fatty acid methyl esters were separated by GLC (GC-14A, Shimadzu, Tokyo, Japan) in a Supercolvax-10-fused silica capillary column (length:30 mm, internal diameter: 0.32 mm; Supelco, Bellefonte, USA) using helium as a carrier gas. Column temperature was 180ºC for the first 10 min, increasing to 215ºC at a rate of 2.5ºC min-1 and then held at 215ºC for 10 min, following the conditions described in Izquierdo et al. (1992). Fatty acid methyl esters were quantified by FIED and identified by comparison with external standards and well-characterized fish oils (EPA 28, Nippai, Ltd. Tokyo, Japan).
Materials and methods ………………………………………………………………………………………….. 39 2.5.2 Digestive enzymes activity Enzymes activity was determined at the department of Applied Biology (Escuela Politécnica Superior, Universidad de Almería, España). The alkaline phosphatase, trypsine and lipase activities were expressed as relative fluorescence units (RFU) and PLA2 was expressed as units (U); one unit will hydrolyze 1.0 µmole of soybean L-!- phosphatidylcholine to L-!-lysophosphatidylcholine and a fatty acid per minute. The larvae were homogenized by a sonicator ultrasound (Misonix Microson XL2007 Ultrasonic Homogenizer) on ice in 110"l of high-purified water, centrifuged and the supernatant used as the sample stock solution. Alkaline phosphatase activities were quantified by fluorometric assay using a spectrofluorometer (Thermolab Systems; Helsinki, Finland) at excitation wavelengths of 358 nm and emission wavelengths of 455nm. After preparation of 140 "l of reaction buffer at pH 10.4 (100 mM Glycine, 1 mM MgCl2, 1mM ZnCl2), and 50 "l of substrate stock solution (200 "M of 6,8 Difluoro-4 methyllumbelliferyl phosphate (DiFMUP) solution in DMSO, the reaction was started by adding 10 "l of the sample stock solution and the kinetic curves were recorded for 20 min (Gee et al., 1999). Trypsine activities were quantified by a fluorometric assay using spectrofluorometer at excitation wavelengths of 380 nm and emission wavelengths of 440nm. After preparation of 195 "l of reaction buffer pH 8.0 (50mM Tris-HCl, 10 mM CaCl2), and 5 "l of of substrate stock solution (20 "M of Boc-Gln-Ala-Arg-7 amido-4 methylcoumarin hydrochloride in DMSO), the reaction was initiated by adding 10 "l of the sample stock solution and the kinetic curves were recorded for 5 min (Rotllant et al., 2008). Neutral lipase activities were quantified by a fluorometric assay using spectrofluorometer at excitation wavelengths of 355 nm and emission wavelengths of 460nm. Firstly, 247.4 "l of 0.1 M phosphate reaction buffer pH 7.0 (19.5 ml of 0.2M phosphate monobasic (NaH2PO4 1 H2O) solution and 30.5ml of 0.2M phosphate dibasic (NaH2PO4 7 H2O) solution were mixed and completed up to 100 ml by adding 50 ml high-purified water), then 2.6"l of substrate stock solution (40 mM of 4Methylumbelliferol butyrate (MUB) in N,N Dimethyl formamide (DMSO) was added and then reaction was started by adding10 "l of the sample stock solution. Kinetics curves were recorded for 5 min (Rotllant et al., 2008).
Materials and methods ………………………………………………………………………………………….. 40 The PLA2 activities were quantified by fluorometric assay using spectrofluorometer at excitation wavelengths of 377 nm and emission wavelengths of 450nm. First 160 !l of reaction buffer pH 8 (50mM Tris-HCl,100 mM NaCl, 2mM NaN3, 5!g/ml bovine serum albumin, and 10 !m 1-anilinonaphthalene-8-sulfonate, and 20 !l of substrate stock solution (50 !l of 1,2-dimyristoyl-sn-glycero-3-phosphocholine solution in 40 mM, methanol mixed with 15 !l deoxycholic acid solution in 40 mM, methanol and quickly injected into 1ml high purified water, stirred for 1 min and sonicated for 2 min) and 10 !l of 100 mM CaCl2 solution were incubated at 25 °C for 10 min. The reaction was started by adding 20 !l of the sample stock solution and the kinetic curves were recorded for 40 min (Huang et al., 2006). 2.6 Measurement of thiobarbituric reactive substances (TBARS): The thiobarbituric reactive substances (TBARS) were determined in triplicated samples using a method adapted from Burk et al. (1980). Approximately 20-30 mg of larval tissue per sample was homogenized in 1.5 ml of 20% trichloroacetic acid (w/v) containing 0.05 ml of 1% BHT in methanol using a rotating probe homogeniser (Ultra-Turrax; IKA-Werke, T25 BASIC, Staufen, Germany). To this homogenate 2.95 ml of freshly prepared 50mM thiobarbituric acid solution were added before mixing and heating for 10 min at 100ºC. After cooling and removing protein precipitates by centrifugation (Sigma 4K15, Osterode and Harmz, Germany) at 2000 X g, the supernatant was read in a spectrophotometer (Evolution 300, Thermo Scientific, Cheshire, UK) at 532 nm. The absorbance was recorded against a blank at the same wavelength. The concentration of TBA-malondialdehyde (MDA) expressed as nmol MDA per g of tissue was calculated using the extinction coefficient 0.156 µM-1 cm-1 applying the following formula: nmol MDA g tissue-1 = A 0.156 !50 Sample weight 2.7 Selenium determination Total selenium concentration was measured in total larvae and feeds. Samples were acidified in a microwave digestor (MarsXpress, CEM, Kamp-Lintfort, Germany) with 5 ml of 69% pure nitric acid. The resultant solution was poured after digestion into a
Materials and methods ………………………………………………………………………………………….. 41 10 ml volumetric flask and made up to volume with distilled water. A total of 0.4 ml of this solution was then added to a 10 ml sample tube, 10 µl of the internal standard (Ga and Sc, 10 ppm) included and 0.3 ml of methanol added. The tubes were made up to volume with distilled water and total selenium measured in a collision/reaction cell ICP-MS (Thermo Scientific, Cheshire, UK) using argon and hydrogen as carrier gas. Collision/reaction cell ICP-MS is a technique that uses ion-molecule chemistry to eliminate polyatomic interferences from the mass spectrum of an ICP-MS. In this way, this technique has enabled ICP-MS to become virtually free of polyatomic interferences. Selenium determination was performed in the Institute of Aquaculture, University of Stirling (Scotland, UK). 2.8 Whole mount staining for skeleton studies Staining procedures with alizarin red (Table 2.2) were conducted to evaluate the skeletal anomalies and vertebral mineralization (Vandewalle et al.1998). Table 2.2 Staining protocol according to Vandewalle et al. (1998) STEP DURATION Significance of the step Solutions Alcian Blue (8GX) 2 hours Proteoglycan (cartilage) Staining For 100 mL: 80 mL alchol 95% 20 mL glacial acetic acid 10 mg Alcian blue Ethanol 95% 1 hour Hydratation For 100 mL: 95 mL absolute ethanol 5 mL distilled water Ethanol 95% 1 hour Ethanol 95% 1 hour Ethanol 75% 1 hour For 100 mL: 75 mL absolute ethanol 15 mL distilled water Ethanol 40% 1 hour For 100 mL: 40 mL absolute ethanol 60 mL distilled water Ethanol 15% 1 hour For 100 mL: 15 mL absolute ethanol 75 mL distilled water Distilled water 1 hour or all night Trypsine solution 1 hour Tissue digestion 90 mg pancreas porcine trypsine; 70 mL distilled water 30 mL saturated solution of Na2B4O7
Materials and methods ………………………………………………………………………………………….. 42 2.9 Molecular biology studies Molecular biology analysis was carried out at the GIA laboratories in Instituto Universitario de Sanidad Animal y Seguridad Alimentaria (IUSA, ULPGC, Las Palmas, Spain). Total RNA from larvae samples (average weight per sample 60mg) was extracted using the Rneasy Mini Kit (Qiagen). Total body tissue was homogenised using the TissueLyzer-II (Qiagen, Hilden, Germany) with QIAzol lysis reagent (Qiagen). Samples were centrifuged with chloroform for phase separation (12000g, 15min, 4ºC). The upper aqueous phase containing RNA was mixed with 75% ethanol and transferred into an RNeasy spin column where total RNA bonded to a membrane and contaminants were washed away by RW1 and RPE buffers (Qiagen). Purified RNA was eluted with 30ml of RNase-free water. The quality and quantity of RNA were analysed using the NanoDrop 1000 Spectrophotometer (Thermo Scientific, Wilmington, DE, USA). Synthesis of complementary desoxiribonucleic acid (cDNA) was conducted using the iScript cDNA Synthesis Kit (Bio-Rad) according to manufacturer’s instructions in an iCycler thermal cycler (Bio-Rad, Hercules, CA, USA). Primer efficiency was tested with serial dilutions of a cDNA pool (1, 1:5, 1:10, 1:15,1:20 and 1:25). The product size of the real-time q PCR amplification was checked by electrophoresis Alizarine red 1 hour and a half Calcium (bone) staining 1g L-1 alizarine red In a 0.5% KOH solution Glycerin KOH 1:3 12 to 24 hours For 100 mL: 25 mL Glycerin 75 % KOH (0.5%) Glycerin KOH 1:1 12 to 24 hours Clearing For 100 mL: 50 mL Glycerin 50 mL KOH (0.5%) Glycerin KOH 3:1 12 to 24 hours For 100 mL: 75 mL Glycerin 25 mL KOH (0.5%) Pure glycerine and some grains of thymol Storage
Materials and methods ………………………………………………………………………………………….. 43 analyses using PB322 cut with HAEIII as a standard. Real-time quantitative PCR was performed in an iQ5 Multicolor Real-Time PCR detection system (Bio-Rad, Hercules, CA, USA) using !-actin as the house-keeping gene in a final volume of 20ml per reaction well, and 100ng of total RNA reverse transcribed to complementary cDNA. Each gene sample was analysed once per gene. The PCR conditions were the following: 95ºC for 3min 30sec followed by 40 cycles of 95ºC for 15sec, 61ºC for 30sec, and 72ºC for 30sec; 95ºC for 1min, and a final denaturing step from 61ºC to 95ºC for 10sec. Data obtained were normalised and the Livak method (2–""Ct) used to determine relative mRNA expression levels. Gilthead seabream specific gene primers were designed after searching the NCBI nucleotide database and using the Oligo 7 Primer Analysis software (Molecular Biology Insights, Cascade, CO, USA). Detailed information on primer sequences and accession numbers is presented in table 2.3. Table 2.3 Sequences of forward and reverse primers (5´-3´) for real-time quantitativePCR of seabream genes Gene Primers Accession no Catalase(CAT) Forward primer: 5´-ATGGTGTGGGACTTCTGGAG-3´ Reverse primer: 3´-AGTGGAACTTGCAGTAGAAAC-5´ FJ860003 Superoxide dismutase (SOD) Forward primer: 5´- AAGAATCATGGCGGTCCTACTGA-3´ Reverse primer: 3´- TGAGCATCTTGTCCGTGATGTCT -5´ AJ937872 Glutathione peroxidase (GPX) Forward primer: 5´- TCCATTCCCCAGCGATGATGCC-3´ Reverse primer: 3´- TCGCCATCAGGACCAACAAGGA-5´ DQ524992 Osteocalcin Forward primer: 5´-AGCCCAAAGCACGTAAGCAAGCTA-3´ Reverse primer: 3´- TTTCATCACGCTACTCTACGGGTT-5´ AF048703 Osteopontin Forward primer: 5´- AAGATGGCCTACGACATGACAGAC3´ Reverse primer: 3´- CCTGAAGAGCCTTGTACACCTGC-5´ AY651247 Osteonectin Forward primer: 5´- AAAATGATCGAGCCCTGCATGGAC-3´ Reverse primer: 3´- TACAGAGTCACCAGGACGTT-5´ AY239014 aRUNX2 Forward primer: 5´- GCCTGTCGCCTTTAAGGTGGTTGC-3´ Reverse primer: 3´- TCGTCGTTGCCCGCCATAGCTG-5´ AJ619023 Alkaline phosphatase Forward primer: 5´- AGAACGCCCTGACGCTGCAA-3´ Reverse primer: 3´- TTCAGTATACGAGCAGCCGTCAC-5´ AY266359 Matrix Gla protein Forward primer: 5´- GTGCCCTCCTTCATTCCAC-3´ Reverse primer: 3´- TATGACCACGTTGGATGCCT-5´ AY065652 bBMP4 Forward primer: 5´- CCACCAGGGCAGACACGTCC-3´ Reverse primer: 3´- GCGTAGCTGCTCCCAGTCCTC-5´ FJ436409 !-actin Forward primer: 5´- TCTGTCTGG ATC GGAGGCTC-3´ Reverse primer: 3´- AAGCATTTG CGGTGGACG -5´ X89920 a RUNX2 (Runt-related transcription factor 2). b BMP4 (Bone morphogenetic protein 4).
Materials and methods ………………………………………………………………………………………….. 44 2.10 Statistical analysis All data were tested for normality and homogeneity of variances with Levene´s test, not requiring any transformation and were treated using one-way ANOVA. Means compared by Duncan’s test (P < 0.05) using a SPSS software (SPSS for Windows 11.5; SPSS Inc., Chicago, IL, USA).
Optimum krill phospholipids for seabream larvae ………………………………………………………………………………………...... 45 Chapter 3 ----------------------------------------------------------------------------- Optimum krill phospholipids content in microdiets for gilthead seabream (Sparus aurata) larvae This work was published in Saleh et al. (2012a) Aquaculture Nutrition, Doi: 10.1111/j.1365-2095.2012.00976.x Abstract The aim of the present study was to determine the optimum dietary levels of krill phospholipids (KPL) for seabream (Sparus aurata) larvae, and its influence on larval development and digestive enzymes activity. Larvae were fed five formulated microdiets with five different levels of KPL. Complete replacement of live preys with the experimental microdiets for seabream larvae produced high survival and growth rates, particularly in larvae fed the highest levels of KPL. In the present study, increase in dietary KPL up to 12% (10% total PL) significantly improved larval survival and growth, whereas further increase did not improved those parameters. An increase in alkaline phosphatase, trypsin and lipase activity with the elevation of KPL up to 12% was also found denoting a better functioning of digestive system. Besides, there was a linear substrate stimulatory effect of dietary KPL on phospholipase A2 activity. Finally, increasing dietary KPL lead to better assimilation of n-3 HUFA especially EPA, reflected in the higher content of these fatty acids in both neutral and polar lipids of the larvae. In summary, KPL were found to be an excellent source of lipids for seabream larvae. Optimum inclusion levels of this ingredient in microdiets to completely substitute live preys at this larval age were found to be 12% KPL.
Optimum krill phospholipids for seabream larvae ………………………………………………………………………………………...... 46 Introduction Dietary phospholipids (PL) improve culture performance of various freshwater and marine fish species (Izquierdo and Koven, 2011), enhancing growth and survival, reducing morphological alterations in larvae (Kanazawa 1993; Salhi et al., 1999; Izquierdo et al., 2001; Kjørsvik, 2009) and early juveniles (Coutteau et al., 1997), and increasing fish resistance to stress (Takeuchi et al., 1992; Kanazawa, 1993). Despite PL metabolic pathways, including those of de novo PL biosynthesis, are essentially the same in fish as in mammals (Caballero et al., 2006b), the fish larvae and early juvenile have a limited capacity to synthesise de novo (Salhi et al., 1999; Coutteau et al., 1997). Thus, addition of PL to diets for fish larvae contributes to assimilation of dietary lipid by increasing the enteric lipoprotein synthesis (Liu et al., 2002; Hadas et al., 2003) and release in lamina propria, significantly reducing lipoprotein size by promoting VLDL synthesis (higher in PL), rather than chylomicron production (higher in NL) (Liu et al., 2002; Caballero et al., 2003, 2006b). Indeed, young fish receive abundant of PL during embryo and larval development either from yolk sac lipids or from wild preys (Rainuzzo et al., 1997; van der Meeren et al., 2008). Therefore, PL seems to be essential for the adequate growth and development of fish larvae. Described phospholipid requirements are around 2–4% DW of diet for juvenile fish and they may be higher in larval fish. Frequently those requirements have used plant PL such as soybean lecithin, or egg yolk lecithin, whereas marine PL, rich in docosahexaenoic acid (DHA) and eicosapentaenoic acid (EPA), have been more scarcely studied (Salhi et al., 1999; Cahu et al., 2003a). DHA and EPA present in the PL fraction of larval diets seem to be more beneficial than in the nuetral lipid (NL) fraction (Salhi et al., 1999; Cahu et al., 2003a; Gisbert et al., 2005; Wold et al., 2007). Cahu et al. (2003a) ran a dose response study with sea bass larvae, using five levels of phospholipids at a constant dietary lipid level (PL, 27-116 g kg-1 dw). They found that the diet with the highest dietary PL gave the best larval performance and lower skeletal malformation rates. A similar result was found by Hamza et al. (2008) for pikeperch larvae, which also showed best growth with the diet highest in PL (9% of dry matter ). The digestive system of larvae is not fully developed at first feeding. The digestion of ingested food occurs in the larval intestine, where the pH remains alkaline and trypsin-like enzyme activity accounts for the proteolytic activity (Walford and Lam,
Optimum krill phospholipids for seabream larvae ………………………………………………………………………………………...... 53 Larval growth was also improved by dietary PL and after 15 days of feeding, growth of larvae fed 17.5 KPL(11% dietary PL content) diet had significantly higher total length than those fed 0 KPL, 3 KPL, and 6 KPL, but did not differed from those fed 12 KPL(10% dietary PL content) (Figure 3.3). In terms of body weight, larvae fed 17.5 KPL were bigger than larvae fed 0 KPL and 3 KPL but did not differed significantly from larvae fed 6 KPL or 12 KPL diets (Figure 3.4). Figure 3.3 Total length of larvae (31 dph) fed five dietary KPL levels. Values (mean ± standard deviation) with the same letters are not significantly different (P>0.05). Figure 3.4 Dry weight of larvae (31 dph) fed five dietary KPL levels. Values (mean ± standard deviation) with the same letters are not significantly different (P>0.05). y = 0.217x + 7.4878 R2 = 0.9253 6 7 8 9 10 6 7 8 9 10 11 12 Total Length (mm) Polar Lipids (% of dry diet) c c b ab a c y = 48.304x + 403.08 R2 = 0.8738 200 300 400 500 600 700 800 6 7 8 9 10 11 12 Dry Weight (!g) Polar Lipids (% of dry diet) c bc ab ab a
Optimum krill phospholipids for seabream larvae ………………………………………………………………………………………...... 54 In general digestive enzyme activity was increased by the elevation of dietary marine PL. Thus, alkaline phosphatase was lowest in 0 KPL larvae and significantly increased with the elevation of dietary PL up to 9 % (diet 6 KPL), whereas trypsine activity was significantly lowest in both 0 KPL and 3 KPL larvae (Figure 3.5 and 3.6). Neutral lipase activity was lowest in 0 KPL and 3 KPL larvae and significantly higher in 12 KPL and 17.5 KPL larvae (Figure 3.7). PLA2 activity was significantly higher in larvae fed 17.5 KPL than in larvae fed 0 KPL, 3 KPL or 6 KPL, but did not differed from that of 12 KPL larvae (Figure 3.8). Figure 3.5 Alkaline phosphatase activity in seabream larvae (31 dph) fed five dietary KPL. Values (mean ± standard deviation) with the same letters are not significantly different (P>0.05). y = -3.0666x! + 67.183x - 67026 R2 = 0.9982 150 200 250 300 350 6 7 8 9 10 11 12 Alkaline Phosphatase (RFU/Larvae) Polar Lipids (% of dry diet) "#" $#" %$#" %$" %"
Optimum krill phospholipids for seabream larvae ………………………………………………………………………………………...... 55 Figure 3.6 Trypsin activity in seabream larvae (31 dph) fed five dietary KPL. Values (mean ± standard deviation) with the same letters are not significantly different (P>0.05). Figure 3.7 Lipase activity in seabream larvae (31 dph) fed five dietary KPL. Values (mean ± standard deviation) with the same letters are not significantly different (P>0.05). y = -3.8295x2 + 87.92x - 338.91 R2 = 09227 0 50 100 150 200 250 300 6 7 8 9 10 11 12 Trypsin (RFU/Larvae) Polar Lipids (% of dry diet) !" !" !" #" #" y = 0.1445x$ + 16.894x + 79.325 R2 = 0.9249 140 160 180 200 220 240 260 280 300 320 340 6 7 8 9 10 11 12 Lipase (RFU/Larvae) Polar Lipids (% of dry diet) ""%" "%" "#%" "!#" "!"
Optimum krill phospholipids for seabream larvae ………………………………………………………………………………………...... 56 Figure 3.8 Phospholipase A2 activity in seabream larvae (31 dph) fed five dietary KPL. Values (mean ± standard deviation) with the same letters are not significantly different (P>0.05). Fatty acid composition of total lipids of the microdiets showed that gradual inclusion of PL lead to an increase in n-3 fatty acids, particularly due to the increase in EPA and DHA, together with 14:0. On the contrary, oleic acid and n-6 fatty acids, particularly 18:2n-6, were reduced by the inclusion of dietary PL (Table 3.2). However, fatty acid composition of PL from microdiets was much more stable and only showed a slight reduction in 20:1n-9+n-7 and increase in EPA (Tables 3.3 and 3.4). Table 3.2 Fatty acids (% dry weight) composition in total lipids of diets containing five KPL levels 0 KPL 3 KPL 6 KPL 12 KPL 17.5 KPL 14:0 0.54 0.77 0.86 1.45 2.00 14:1n-7 0.01 0.01 0.01 0.03 0.07 14:1n-5 0.01 0.01 0.01 0.04 0.11 15:0 0.09 0.09 0.08 0.10 0.19 15:1n-5 0.00 0.00 0.00 0.01 0.06 16:0ISO 0.01 0.01 0.01 0.02 0.07 16:0 4.78 4.72 4.16 4.98 5.73 16:1n-7 0.52 0.58 0.58 1.05 1.38 Me 16:0 0.03 0.04 0.04 0.07 0.11 16:1n-5 0.04 0.05 0.05 0.07 0.12 16:2n-6 0.06 0.04 0.04 0.07 0.13 16:2n-4 0.12 0.12 0.11 0.14 0.19 17:0 0.06 0.04 0.03 0.05 0.08 y = 0.7022x2 - 6.2453x + 60.837 R2 = 0.8976 30 40 50 60 70 80 90 100 6 7 8 9 10 11 12 Phospholipase A2 (U*100/ Larvae) Polar Lipids (% of dry diet) !!!"! !#"! !#"! !$#! !$!
Optimum krill phospholipids for seabream larvae ………………………………………………………………………………………...... 57 16:3n-4 0.01 0.00 0.01 0.01 0.03 16:3n-3 0.03 0.04 0.04 0.06 0.10 16:3n-1 0.07 0.07 0.06 0.06 0.07 16:4n-3 0.02 0.02 0.04 0.08 0.12 16:4n-1 0.00 0.00 0.01 0.01 0.02 18:0 0.99 0.80 0.55 0.50 0.53 18:1n-9 4.12 5.83 3.93 1.59 2.01 18:1n-7 0.46 0.47 0.55 1.01 1.31 18:1n-5 0.05 0.05 0.04 0.05 0.06 18:2n-9 0.00 0.00 0.01 0.01 0.02 18:2n-6 4.07 2.23 0.70 0.31 0.41 18:2n-4 0.02 0.01 0.00 0.01 0.01 18:3n-6 0.01 0.01 0.01 0.04 0.05 18:3n-4 0.03 0.01 0.01 0.01 0.01 18:3n-3 0.52 0.24 0.08 0.13 0.16 18:4n-3 0.05 0.06 0.13 0.27 0.36 18:4n-1 0.01 0.00 0.00 0.01 0.02 20:0 0.04 0.03 0.01 0.01 0.01 20:1n-9 1.06 0.77 0.50 0.53 0.52 20:1n-5 0.04 0.04 0.03 0.05 0.06 20:2n-9 0.01 0.00 0.00 0.00 0.00 20:2n-6 0.09 0.06 0.04 0.04 0.04 20:3n-6 0.02 0.01 0.01 0.01 0.02 20:4n-6 0.13 0.14 0.18 0.21 0.22 20:3n-3 0.09 0.08 0.08 0.08 0.07 20:4n-3 0.06 0.04 0.04 0.08 0.10 20:5n-3 0.83 1.12 2.52 3.72 4.53 22:1n-11 0.45 0.17 0.08 0.14 0.19 22:1n-9 0.06 0.06 0.00 0.02 0.03 22:4n-6 0.02 0.02 0.05 0.08 0.10 22:5n-6 0.02 0.02 0.03 0.03 0.03 22:5n-3 0.11 0.07 0.08 0.11 0.13 22:6n-3 1.56 1.82 4.25 4.66 4.76 Total Saturated 6.51 6.45 5.70 7.08 8.54 Total Monounsaturated 14.08 14.57 5.82 4.62 5.79 Total n-3 3.28 3.50 7.27 9.19 10.34 Total n-6 4.42 2.54 1.05 0.79 1.00 Total n-9 4.15 5.85 3.98 1.67 2.11 Total n-3HUFA 2.57 3.06 6.90 8.57 9.52 EPA/ARA 6.35 8.09 14.1 18.08 20.87 DHA/EPA 1.87 1.64 1.69 1.25 1.05 DHA/ARA 11.88 13.23 23.78 22.62 21.94 n-3/n-6 0.74 1.38 6.91 11.55 10.39
Optimum krill phospholipids for seabream larvae ………………………………………………………………………………………...... 58 Table 3.3 Fatty acids (% dry weight) composition in neutral lipids of diets containing five KPL levels 0 KPL 3 KPL 6 KPL 12 KPL 17.5 KPL 14:0 0.46 0.83 1.48 2.81 3.66 14:1n-7 0.01 0.02 0.03 0.06 0.08 14:1n-5 0.01 0.01 0.01 0.03 0.04 15:0 0.06 0.07 0.10 0.15 0.12 15:1n-5 0.00 0.00 0.01 0.02 0.02 16:0ISO 0.01 0.01 0.01 0.02 0.02 16:0 2.49 2.51 2.92 4.02 4.74 16:1n-7 0.59 0.70 1.05 2.22 2.72 Me 16:0 0.03 0.04 0.05 0.10 0.14 16:1n-5 0.02 0.02 0.04 0.07 0.08 16:2n-6 0.07 0.06 0.07 0.15 0.20 16:2n-4 0.06 0.10 0.18 0.33 0.38 17:0 0.07 0.05 0.04 0.08 0.09 16:3n-4 0.01 0.00 0.01 0.01 0.02 16:3n-3 0.01 0.01 0.03 0.06 0.06 16:4n3 0.03 0.04 0.07 0.16 0.23 18:0 0.69 0.54 0.51 0.48 0.41 18:1n-9 4.93 7.57 7.46 2.93 3.54 18:1n-7 0.36 0.34 0.47 1.13 1.53 18:1n-5 0.04 0.03 0.04 0.05 0.06 18:2n-6 5.73 3.49 1.38 0.73 0.47 18:2n-4 0.02 0.01 0.00 0.01 0.01 18:3n-6 0.01 0.01 0.02 0.02 0.06 18:3n-4 0.03 0.02 0.01 0.01 0.01 18:3n-3 0.87 0.43 0.09 0.16 0.18 18:4n-3 0.11 0.13 0.17 0.41 0.57 18:4n-1 0.03 0.02 0.00 0.01 0.01 20:0 0.07 0.05 0.04 0.04 0.03 20:1n9+n7 0.75 0.50 0.35 0.38 0.40 20:1n-5 0.03 0.03 0.03 0.06 0.08 20:2n-9 0.01 0.00 0.02 0.01 0.00 20:2n-6 0.08 0.05 0.02 0.03 0.03 20:3n-6 0.02 0.01 0.01 0.02 0.02 20:4n-6 0.07 0.06 0.06 0.09 0.11 20:3n-3 0.05 0.04 0.04 0.05 0.04 20:4n-3 0.13 0.07 0.04 0.06 0.09 20:5n-3 0.84 0.91 1.24 2.33 3.03 22:1n-11 0.54 0.28 0.09 0.16 0.14 22:1n-9 0.09 0.07 0.08 0.02 0.02 22:4n-6 0.04 0.03 0.03 0.05 0.07 22:5n-6 0.02 0.01 0.01 0.02 0.02 22:5n-3 0.29 0.15 0.04 0.06 0.08 22:6n-3 1.58 1.49 1.72 2.37 2.70 Total Saturated 3.82 4.05 5.10 7.57 9.04
Optimum krill phospholipids for seabream larvae ………………………………………………………………………………………...... 59 Total Monounsaturated 7.36 9.57 9.63 7.12 8.69 Total n-3 3.90 3.28 3.43 5.66 6.96 Total n-6 6.04 3.72 1.60 1.12 0.98 Total n-9 5.03 7.65 7.57 2.97 3.57 Total n-3HUFA 2.88 2.66 3.07 4.87 5.94 EPA/ARA 12.19 15.84 20.95 24.52 26.66 DHA/EPA 1.88 1.63 1.39 1.02 0.89 DHA/ARA 22.91 25.89 29.18 24.89 23.75 n-3/n-6 0.65 0.88 2.14 5.04 7.11 Table 3.4 Fatty acids (% dry weight) composition in polar lipids of diets containing five KPL levels 0 KPL 3 KPL 6 KPL 12 KPL 17.5 KPL 14:0 0.33 0.34 0.35 0.43 0.51 14:1n-7 0.01 0.01 0.01 0.01 0.01 14:1n-5 0.01 0.01 0.01 0.00 0.00 15:0 0.14 0.13 0.12 0.12 0.12 15:1n-5 0.00 0.00 0.00 0.00 0.00 16:0ISO 0.01 0.01 0.01 0.01 0.02 16:0 5.78 5.61 5.23 5.86 6.52 16:1n-7 0.10 0.20 0.23 0.32 0.41 Me 16:0 0.04 0.04 0.04 0.05 0.06 16:1n-5 0.05 0.05 0.05 0.07 0.08 16:2n-6 0.01 0.01 0.01 0.02 0.02 16:2n-4 0.16 0.14 0.12 0.11 0.10 17:0 0.03 0.03 0.03 0.03 0.03 16:3n-4 0.00 0.00 0.00 0.00 0.01 16:3n-3 0.05 0.05 0.05 0.06 0.07 16:3n-1 0.11 0.10 0.08 0.07 0.06 16:4n-3 0.02 0.02 0.01 0.01 0.02 16:4n-1 0.03 0.02 0.00 0.00 0.01 18:0 0.94 0.81 0.67 0.61 0.57 18:1n-9 0.63 0.65 0.66 0.82 1.02 18:1n-7 0.27 0.43 0.51 0.77 1.04 18:1n-5 0.05 0.05 0.04 0.05 0.06 18:2n-9 0.00 0.01 0.00 0.01 0.01 18:2n-6 0.47 0.33 0.29 0.33 0.35 18:2n-4 0.01 0.01 0.01 0.01 0.01 18:3n-6 0.01 0.01 0.01 0.01 0.03 18:3n-4 0.01 0.01 0.01 0.01 0.01 18:3n-3 0.05 0.06 0.08 0.12 0.17 18:4n-3 0.02 0.06 0.10 0.16 0.26 18:4n-1 0.03 0.02 0.02 0.01 0.01 20:0 0.04 0.03 0.02 0.02 0.01 20:1n-9+n7 0.86 0.75 0.63 0.58 0.55 20:1n-5 0.03 0.03 0.03 0.05 0.05
Optimum krill phospholipids for seabream larvae ………………………………………………………………………………………...... 60 20:2n-9 0.01 0.01 0.01 0.01 0.00 20:2n-6 0.07 0.06 0.05 0.05 0.04 20:3n-6 0.00 0.00 0.01 0.01 0.02 20:4n-6 0.30 0.28 0.25 0.25 0.28 20:3n-3 0.13 0.12 0.10 0.09 0.09 20:4n-3 0.02 0.04 0.05 0.08 0.11 20:5n-3 2.54 3.06 3.42 4.31 5.99 22:1n-11 0.07 0.14 0.17 0.23 0.31 22:1n-9 0.02 0.00 0.00 0.04 0.05 22:4n-6 0.03 0.05 0.07 0.09 0.14 22:5n-6 0.07 0.06 0.05 0.05 0.05 22:5n-3 0.10 0.10 0.11 0.13 0.17 22:6n-3 7.68 6.89 6.35 5.96 6.88 Total Saturated 7.26 6.95 6.41 7.06 7.76 Total Monounsaturated 2.09 2.31 2.35 2.94 3.59 Total n-3 10.60 10.39 10.27 10.91 13.76 Total n-6 0.96 0.80 0.73 0.80 0.91 Total n-9 0.66 0.67 0.68 0.87 1.08 Total n-3HUFA 10.47 10.21 10.03 10.56 13.24 EPA/ARA 8.6 11.1 13.5 17.0 21.5 DHA/EPA 3.0 2.3 1.9 1.4 1.1 DHA/ARA 26.0 25.0 25.0 23.5 24.7 n-3/n-6 11.0 12.9 13.9 13.4 14.8 Analysis of fatty acids composition of larvae showed significant differences between the five dietary PL treatments in both neutral and polar lipids (Tables 3.5 and 3.6). Neutral lipids were more markedly affected by dietary lipids and showed increased myrisitc acid (14:0), 18:1n-7, 18:4n-3, n-3 fatty acids, particularly EPA, and reduced stearic (18:0), oleic (18:1n-9), 20:1n-9 and linoleic (18:2n-6) acids with increased dietary PL. Thus, 17.5 KPL larvae were significantly highest in EPA while the 0 KPL has the lowest. Larvae fed diets 12 KPL and 17.5 KPL diets showed higher n-3/n-6 and EPA/ARA ratios than 0 KPL, 3 KPL and 6 KPL larvae. Larval polar lipids were more conservative than the neutral lipids and only showed a marked increased in n-3 fatty acids and EPA, together with a reduction in n-6 fatty acids due to the lower linoleic acid contents. On the contrary, regardless dietary levels, ARA and DHA contents were not significantly different among larvae fed different levels of dietary PL. Larvae fed 12 KPL and 17.5 KPL diets showed the highest total n-3, n-3HUFA, and EPA content of polar lipids.
Optimum krill phospholipids for seabream larvae ………………………………………………………………………………………...... 61 Table 3.5 Fatty acids (% total identified fatty acids) composition in neutral lipids of larvae fed diets containing five KPL levels. Values (mean ± standard deviation) with the same letters in the same row are not significantly different (P>0.05) 0 KPL 3 KPL 6 KPL 12 KPL 17.5 KPL 14:0 1.42 1.62 2.84 5.62 5.21 14:1n-5 0.02 0.02 0.02 0.03 0.03 14:1n-7 0.13 0.13 0.12 0.15 0.14 15:0 0.35 0.31 0.39 0.62 0.41 15:1n-5 0.02 0.02 0.03 0.03 0.05 16:0iso 0.07 0.06 0.07 0.09 0.08 16:0 14.81 15.12 17.73 29.54 18.44 16:1n-7 2.28 2.16 3.11 4.31 5.19 Met 16:0 0.17 0.18 0.22 0.30 0.31 16:1n-5 0.29 0.31 0.33 0.39 0.37 16:2n-6 0.70 0.63 0.69 0.69 0.63 16:2n-4 0.71 0.97 1.51 2.17 2.08 17:0 0.31 0.30 0.28 0.24 0.25 16:3n-4 0.03 0.03 0.04 0.04 0.04 16:3n-3 0.12 0.13 0.21 0.29 0.27 16:3n-1 0.10 0.12 0.08 0.05 0.04 16:4n-3 0.09 0.09 0.13 0.16 0.20 16:4 n-1 0.00 0.00 0.00 0.00 0.00 18:0 7.26 7.22 6.28 6.37 4.78 18:1n-9 14.55 17.25 16.88 8.06 9.07 18:1n-7 2.77 2.74 3.47 4.61 5.43 18:1n-5 0.37 0.40 0.37 0.41 0.34 18:2n-9 0.08 0.17 0.10 0.08 0.10 18:2n-6 13.41 7.17 2.65 1.33 1.52 18:2n-4 0.06 0.06 0.06 0.07 0.07 18: 3n-6 0.18 0.23 0.19 0.22 0.29 18:3n-4 0.12 0.12 0.19 0.10 0.08 18:3n-3 1.54 0.71 0.30 0.40 0.52 18:4n-3 0.24 0.24 0.44 0.85 1.13 18:4n-1 0.04 0.02 0.01 0.02 0.01 20:0 0.47 0.32 0.25 0.34 0.19 20:1n-9 3.46 2.53 2.58 2.42 1.96 20: 1n-5 0.32 0.30 0.34 0.36 0.36 20: 2n-9 0.06 0.08 0.03 0.03 0.02 20:2n-6 0.72 0.50 0.31 0.21 0.20 20:3n-9+n0.02 0.02 0.00 0.00 0.00 20:3n-6 0.08 0.09 0.06 0.06 0.09 20:4n-6 1.79 2.13 1.48 1.06 1.10 20: 3n-3 0.38 0.33 0.37 0.33 0.29 20:4n-3 0.32 0.24 0.25 0.35 0.44 20:5n-3 5.7 6.84 8.63 10.32 12.8 22:1n-11 1.33 0.95 1.42 1.47 1.34 22:1n-9 0.80 0.63 0.21 0.23 0.23 22:4n-6 0.12 0.13 0.20 0.30 0.37
Optimum krill phospholipids for seabream larvae ………………………………………………………………………………………...... 62 22:5n-6 0.26 0.29 0.22 0.17 0.17 22:5n-3 1.59 1.47 1.33 1.48 1.71 22:6n-3 20.35 24.64 23.61 20.16 21.69 Total Saturated 24.62±0.85bc 24.9±0.17bc 27.77±0.51bc 32.73±4.83a 29.28±0.28b Total Monounsaturated 32.06+3.05a 32.38+2.05a 34.1+2.65 a 27.93+2.05 b 29.21+2.01b Total n-3 30.34±1.76c 34.7±2.15b 35.27±1.82b 34.34±3.08b 39.05±0.82a Total n-6 17.26±0.07a 11.17±0.16b 5.8±0.05c 4.03±0.56d 4.36±0.02d Total n-9 18.98±1.13a 20.68±0.82a 19.81±1.13a 11.31±0.9b 11.38±0.27b Total n-3HUFA 28.35±1.84b 33.52±2.19a 34.18±1.84a 34.64±2.87a 36.93±1.04a ARA 1.79±0.06b 2.13±0.31a 1.48±0.15b 1.06±0.14c 1.1±0.12c EPA 5.71±0.26 e 6.84±0.21d 8.63±0.54c 10.32±0.94b 12.8±0.16a DHA 20.35±1.44c 24.64±1.97a 23.61±1.32ab 20.16±1.78c 21.69±0.97bc EPA/ARA 3.2±0.03d 3.26±0.37d 5.85±0.24c 9.78±0.41b 11.79±1.37a DHA/EPA 3.56±0.09a 3.6±0.18a 2.74±0.02b 1.95±0.07c 1.69±0.08d DHA/ARA 11.38±0.42c 11.65±0.75c 15.94±0.76b 19.11±1.01a 19.91±1.4a n-3/n-6 1.76±0.11d 3.11±0.24c 6.08±0.37b 8.57±0.46a 8.96±0.15a Table 3.6 Fatty acids (% total identified fatty acids) composition in polar lipids of larvae fed diets containing five KPL levels. Values (mean ± standard deviation) with the same letters in the same row are not significantly different (P>0.05) 0 KPL 3 KPL 6 KPL 12 KPL 17.5 KPL 14:0 0.57 0.69 0.86 1.05 1.15 14:1n-5 0.01 0.01 0.01 0.01 0.00 14:1n-7 0.05 0.06 0.04 0.04 0.04 15:0 0.32 0.33 0.35 0.31 0.30 15:1n-5 0.01 0.02 0.01 0.00 0.00 16:0iso 0.05 0.05 0.04 0.05 0.05 16:0 23.76 24.82 27.00 26.45 28.13 16:1n-7 1.19 1.32 1.38 2.10 2.16 Met 16:0 0.13 0.15 0.17 0.22 0.25 16:1n-5 0.26 0.29 0.26 0.25 0.28 16:2n-6 0.55 0.52 0.53 0.47 0.34 16:2n-4 0.64 0.70 0.74 0.70 0.72 17:0 0.29 0.32 0.27 0.24 0.22 16:3n-4 0.06 0.01 0.01 0.01 0.02 16:3n-3 0.36 0.11 0.13 0.16 0.19 16:3n-1 0.45 0.67 0.62 0.55 0.49 16:4n-3 0.21 0.38 0.36 0.19 0.19 16:4n-1 0.13 0.12 0.11 0.13 0.13 18:0 9.30 7.09 7.49 6.32 5.52 18:1n-9 6.80 13.22 11.65 7.69 7.66 18:1n-7 1.19 2.29 2.34 3.08 3.58
Optimum soybean lecithin for seabream larvae ………………………………………………………………………………………….. 69 Introduction Phospholipids (PL) are particularly important in fish larvae production for their essential function as necessary components for cellular bio-membranes and organelles formation, as well as for being an endogenous energy source during early development (Izquierdo and Koven, 2011). Indeed, young fish contain abundant PL received during embryo and larval development either from endogenous yolk sac or exogenous live preys lipids (Rainuzzo et al., 1997; van der Meeren et al., 2008). Studies on dietary PL were initiated by Kanazawa et al. (1981, 1983a, b), who showed that despite their significant roles in fish metabolism, developing fish possess a limited ability for phospholipids synthesis (Kanazawa, 1985) and, consequently, they must be included in young fish diets. Thus, PL inclusion in young fish diets has been found to enhance growth, survival and stress resistance, and reduce the incidence of morphological alterations in fish larvae (Takeuchi et al., 1992; Kanazawa, 1993; Salhi et al., 1999; Izquierdo et al., 2001; Cahu et al., 2003a; Kjørsvik et al., 2009). PL are necessary as emulsifiers in the formation of mixed micelles in the digestive tract (Olsen and Ringø, 1997) and appear to be crucial for lipid transport (Fontagné et al., 1998; Salhi et al., 1999; Caballero et al., 2006a). At hatching, the larval digestive system is not completely developed, lacks a functional stomach and main digestion of ingested food occurs in the intestine, where the pH remains alkaline and trypsin-like enzyme activity accounts for the proteolytic activity (Walford and Lam, 1993; Morais et al., 2005). Lipolytic activity in fish larvae is leaded by a nonspecific neutral lipase dependent on the presence of bile salts (bile salt activated lipase, BAL) (Iijima et al., 1998; Izquierdo and Henderson, 1998), whereas PL are specifically digested by the intestinal phospholipase A2 (PLA2) secreted by the pancreas (Sargent et al., 1989). The activity of all these luminal enzymes tends to increase with gut development (Moyano et al., 1996; Izquierdo et al., 2000; Zambonino-Infante and Cahu, 2001; Lazo et al., 2007). Intestinal brush border membrane enzymes such as alkaline phosphatases are lowest at first feeding and subsequently increase with gut development (Cahu and Zambonino-Infante, 1995b; Lazo et al., 2007). Nevertheless, during early development certain dietary ingredients, such as PL may promote digestive enzymes activities and induce
Optimum soybean lecithin for seabream larvae ………………………………………………………………………………………….. 70 digestive system maturation (Zambonino-Infante and Cahu, 2001), playing an important role on larval digestive physiology and the metabolic pathways of the assimilated nutrients (Kolkovski et al., 2009; Morais et al., 2006). PL have been also found to be required for the formation of very low-density lipoproteins during the intestinal absorption of lipids (Salhi et al., 1999; Liu et al., 2002; Caballero et al., 2006b). Feeding high lipid diets low in PL causes the accumulation of lipidic vacuoles in the basal zone of the enterocyte and esteatosis in the hepatic tissue, both of them being markedly reduced by a 2 % addition of soybean lecithin, denoting an enhancement in the lipid transport activity in gut and liver (Liu et al., 2002) and emphasizing the limited ability of fish larvae to synthesize PL. Moreover, this fact may reduce the absorption of different ingested nutrients from the lumen (Morais et al., 2006). Therefore, dietary PL are required for the appropriate development and biological performance of young fish (Kanazawa, 1993). The quantitative requirements of PL for larval fish range from about 2–12% of diet, being lower in the larvae of common carp (Cyprinus carpio) (2% chicken egg) (Geurden et al., 1995a) and in red seabream (Pagrus major) larvae was 5% SBL and knife jaw (Oplegnathus fasciatus) larvae (7.4 % SBL) (Kanazawa et al. 1983a) and Japanese flounder (Paralichthys olivaceus) larvae (7 % SBL) (Kanazawa 1993), with the highest reported value being for Gilthead seabream (Sparus aurata) (15 % SBL) (Seiliez et al., 2006). However, for the later species, our recent studies have found an optimum inclusion of about 4% using krill PL as a PL source (Saleh et al., 2012a). Being gilthead seabream one of the most important species for Mediterranean aquaculture, it is necessary to quantify its optimum dietary PL requirements to optimize weaning diets, particularly since this species does not develop a functional stomach until 35-40 dah (Moyano et al., 1996). As soybean lecithin is a readily available and cost effective PL source in fish diets, the objective of the present study was to determine the optimum quantity of soybean lecithin required in weaning diets to support better growth, survival and development of gilthead seabream larvae.
Optimum soybean lecithin for seabream larvae ………………………………………………………………………………………….. 71 Materials and methods Gilthead seabream larvae were obtained from natural spawnings from Instituto Canario de Ciencias Marinas (Grupo de Investigación en Acuicultura (GIA), Las Palmas de Gran Canaria, Spain). Larvae (initial total length 5.4±0.6 mm, mean±SD; dry body weight 120±37 !g) previously fed rotifers (Brachinous plicatilis) enriched with DHA Protein Selco® (INVE, Dendermond, Belgium) until they reached 15 day old, were randomly distributed in 15 experimental tanks at a density of 2100 larvae tank-1 and fed one of the experimental diets tested in triplicate for 15 days. All tanks (200 L fibreglass cylinder tanks with conical bottom and painted a light grey colour) were supplied with filtered seawater (37 mg L-1 salinity) at an increasing rate of 0.41.0 L min-1 to assure good water quality during the entire trial. Water entered from the tank bottom and exited from the top to ensure water renewal and maintain high water quality, which was tested daily and no deterioration was observed. Water was continuously aerated (125 ml min-1) attaining 6.0±1 ppm dissolved O2. Average water temperature and pH along the trial were 21.0±1°C and 7.85±0.1, respectively. Photoperiod was kept at 12h light: 12h dark, by fluorescent daylights and the light intensity was 1700 lux (digital Lux Tester YF-1065, Powertech Rentals, Osborne Park City, Australia) at the water surface. Five experimental microdiets (pellet size < 250 !m) with increasing phospholipid contents were formulated using sardine oil (Agramar S.A., Spain) and soybean lecithin oil (Acofarma, Barcelona, Spain) as sources of triglycerides and PL, respectively. Their formulation and proximate analysis are showed in Table 1. The fatty acids profiles are shown in Tables 2, 3 and 4. The desired lipid content (about 180 g kg-1) was completed if necessary with a non-essential fatty acid source, oleic acid (Oleic acid vegeTable, Merck, Darmstadt, Germany). The microdiets were prepared by mixing squid meal and water-soluble components, and then the lipids and fat-soluble vitamins and, finally, gelatine dissolved in warm water. The paste was compressed pelleted (Severin, Suderm, Germany) and dried in an oven at 38 ºC for 24 h (Ako, Barcelona, Spain). Pellets were ground (Braun, Kronberg, Germany) and sieved (Filtra, Barcelona, Spain) to obtain a particle size below 250 !m. Diets were prepared and analyzed for proximate and fatty acid composition (Tables 4.1, 4.2, 4.3 and 4.4) at GIA laboratories.
Optimum soybean lecithin for seabream larvae ………………………………………………………………………………………….. 72 Table 4.1 Formulation and proximate composition of the experimental microdiets containing several levels of SBL Ingredients (g kg-1 diet) 0 SBL 2 SBL 4 SBL 8 SBL 12 SBL Squid meala 756 755 755 755 715 Soybean lecithinb 0.0 20 40 80 120 Sardine oilc 79 40 20 0.0 0.0 Oleic acidd 0.0 20 20 0.0 0.0 Basal premix 165 165 165 165 165 Proximate analysis (g kg-1 diet) Lipid 180.2 175 179.2 183.4 200.2 Polar Lipids 49.4 56.5 65.4 88.1 95.9 Protein 712.2 710.3 714.3 720.4 671.3 Ash 68.2 68.8 68.7 70.3 70.5 Moisture 81.0 80.0 78.8 80.3 78.7 a Rieber and Son, Bergen, Norway. b Acofarma, Barcelona, Spain. c Agramar S.A., Las Palmas, Spain. d Merck KGaA, Darmstadi, Germany. Diets were manually supplied fourteen times per day each 45 min from 9:00 to 19:00 for 16 days. Non-enriched rotifers were co-fed only during days 16th and 17th (1 rotifer ml-1). To assure feed availability, daily feed supplied was maintained at 1.5 and 2.5 g L-1 tank-1 during the first and second week of feeding, respectively. Larvae were observed under the binocular microscope to determine feed acceptance. Before the end of the experiment an activity test was conducted by handling 20 larvae tank-1 out of the water in a blotted scoop net for 1 min and subsequently allocating them in another tank supplied with clean seawater and aeration, to determine survival after 24 hours. Final survival was calculated by individually counting all the living larvae at the beginning and at the end of the experiment. Growth was determined by measuring dry body weight (105ºC 24 h) and total length (Profile Projector V-12A Nikon, Tokyo, Japan) of 30 fish tank-1 at the beginning, in the middle and at the end of the trial. In addition, at the end of the trial and after 12 h of starvation, the all larvae in each tank were washed with distilled water, sampled and kept at -80 ºC for biochemical composition. Moisture (A.O.A.C., 1995), protein (A.O.A.C., 1995) and crude lipid (Folch, 1957) contents of larvae and diets were analyzed. Fatty acid methyl esters were obtained by transmethylation of crude lipids as described by Christie (1982). Fatty acid methyl esters were separated by GLC (GC -14A, Shimadzu, Tokyo, Japan) in a Supercolvax10-fused silica capillary column (length: 30 m; internal diameter: 0.32 mm; Supelco, Bellefonte, USA) using helium as a carrier gas. Column temperature was 180 ºC for
Optimum soybean lecithin for seabream larvae ………………………………………………………………………………………….. 73 the first 10 min, increasing to 215 ºC at a rate of 2.5 ºC min-1 and then held at 215 ºC for 10 min. Fatty acid methyl esters were quantified by FID (GC -14A, Shimadzu, Tokyo, Japan) following the conditions described in Izquierdo et al. (1990) and identified by comparison to previously characterized standards and GLC-MS. For enzymes activity determination, the alkaline phosphatase, trypsine and lipase activities are expressed as relative fluorescence units (RFU) and PLA2 is expressed as units (U). The larvae were homogenized by a sonicator ultrasound (Misonix Microson XL2007 Ultrasonic Homogenizer) on ice in 110!l of high-purified water, centrifuged and the supernatant used as the sample stock solution. The alkaline phosphatase activities were quantified by fluorometric assay using a spectrofluorometer (Thermolab Systems; Helsinki, Finland) at excitation wavelengths of 358 nm and emission wavelengths of 455nm. After preparation of 140 !l of reaction buffer at pH 10.4 (100 mM Glycine, 1 mM MgCl2, 1mM ZnCl2), and 50 !l of substrate stock solution (200 !M of 6,8 Difluoro-4 methyllumbelliferyl phosphate (DiFMUP) solution in DMSO., the reaction was started by adding 10 !l of the sample stock solution and the kinetic curves were recorded for 20 min (Gee et al.,1999). Trypsine activities were quantified by fluorometric assay using spectrofluorometer at excitation wavelengths of 380 nm and emission wavelengths of 440nm. After preparation of 195 !l of reaction buffer pH 8.0 (50mM Tris-HCl, 10 mM CaCl2), and 5 !l of of substrate stock solution (20 !M of Boc-Gln-Ala-Arg-7 amido-4 methylcoumarin hydrochloride in DMSO), the reaction was started by adding 10 !l of the sample stock solution and the kinetic curves were recorded for 5 min (Rotllant et al., 2008). Neutral lipase activities were quantified by fluorometric assay using spectrofluorometer at excitation wavelengths of 355 nm and emission wavelengths of 460nm. Firstly, 247.4 !l of 0,1 M phosphate reaction buffer pH 7.0 (19.5 ml of 0.2M phosphate monobasic (NaH2PO4 1 H2O) solution and 30.5ml of 0.2M Phosphate dibasic (NaH2PO4 7 H2O) solution were mixed and completed up to 100 ml by adding 50 ml high-purified water), then 2.6!l of substrate stock solution (40 mM of 4Methylumbelliferol butyrate (MUB) in N,N Dimethyl formamide (DMSO) was added and then reaction was started by adding 10 !l of the sample stock solution. . Kinetics curves were recorded for 5 min (Rotllant et al., 2008).
Optimum soybean lecithin for seabream larvae ………………………………………………………………………………………….. 74 The PLA2 activities were quantified by fluorometric assay using spectrofluorometer at excitation wavelengths of 377 nm and emission wavelengths of 450nm. First 160 !l of reaction buffer pH 8 (50mM Tris-HCl,100mM NaCl, 2mM NaN3, 5!g ml-1 bovine serum albumin, and 10 !m 1-anilinonaphthalene-8-sulfonate, and 20 !l of substrate stock solution (50 !l of 1,2-dimyristoyl-sn-glycero-3-phosphocholine solution in 40 mM, methanol mixed with 15 !l deoxycholic acid solution in 40 mM, methanol and quickly injected into 1ml high purified water, stirred for 1 min and sonicated for 2 min) and 10 !l of 100 mM CaCl2 solution were incubated at 25 °C for 10 min. The reaction was started by adding 20 !l of the sample stock solution and the kinetic curves were recorded for 40 min (Huang et al., 2006). All data were tested for normality and homogeneity of variances with Levene´s test, not requiring any transformation and were treated using one-way ANOVA. Means compared by Duncan’s test (P < 0.05) using a SPSS software (SPSS for Windows 11.5; SPSS Inc., Chicago, IL, USA). Results All the experimental diets were well accepted by the larvae as early as 16 days post hatching (dph) as observed in the microphotography. Regardless the diet fed survival was high 52-58 % (Figure 4.1) and did not significantly differed (P>0.05) among larvae fed different diets. Dietary treatments did neither affected survival 24 h after the handling test, being always over 88 % (Figure 4.2). Larval growth in terms of total length significantly (P>0.05) increased by the elevation of dietary SBL up to 80 g kg1, whereas further elevation of SBL dietary levels to 120 g kg-1 did not further improved larval growth (Figure 4.3). Similarly, elevation of SBL dietary contents up to 40-80 g kg-1 significantly (P>0.05) raised dry body weight, whereas elevation to 120 g kg-1 did not further increased weight (Figure 4.4). In general digestive enzymes activity was increased by the elevation of dietary marine phospholipids. Thus, alkaline phosphatase was lowest in 0 SBL larvae and significantly increased with the elevation of dietary SBL up to 8 SBL and 12 SBL larvae, whereas trypsine activity was significantly lowest in both 0 SBL and 2 SBL larvae (Figure 4.5 and 4.6). Neutral lipase activity was lowest in 0 SBL 2 SBL larvae and significantly increased in 8 SBL and 12 SBL larvae (Figure 4.7). PLA2 activity
Optimum soybean lecithin for seabream larvae ………………………………………………………………………………………….. 75 was significantly higher in larvae fed 12 SBL than in larvae fed 0 SBL, 2 SBL or 4 SBL, but did not differed from that of 8 SBL larvae (Figure 4.8). Figure 4.1. Survival rate (% of population) of larvae reared from 16 to 31 dph on five levels of SBL. Values (mean ± standard deviation) with the same letters are not significantly different (P>0.05). Figure 4.2 Survival 24 h after activity test of larvae (30 dph) fed increased levels of SBL for 15 days. Values (mean ± standard deviation) with the same letters are not significantly different (P>0.05). y = -0.2888x2 + 4.452x + 39.029 R! = 0.15736 45 49 53 57 61 65 5 6 7 8 9 10 11 Survival % Diet (% Polar Lipids) a a a a a y = -0.0961x2 + 1.6898x + 87.063 R2 = 0.8473 80 85 90 95 100 105 5 6 7 8 9 10 11 Survival % Diet (% Polar Lipids) a a a a a
Optimum soybean lecithin for seabream larvae ………………………………………………………………………………………….. 76 Figure 4.3 Total length of larvae (30 dph) fed increased levels of SBL for 15 days. Values (mean ± standard deviation) with the same letters are not significantly different (P>0.05). Figure 4.4 Dry body weight of larvae (30 dph) fed increased levels of SBL for 15 days. Values (mean ± standard deviation) with the same letters are not significantly different (P>0.05). y = -0.0026x2 + 0.1545x + 7.9085 R2 = 0.7883 7 8 9 10 5 6 7 8 9 10 11 Total Length (mm) Diet (% Polar Lipids) b b b a a y = -0.0664x2 + 33.989x + 538.62 R2 = 0.8343 300 400 500 600 700 800 900 1000 1100 5 6 7 8 9 10 11 Dry Weight (!g) Diet (% Polar Lipids) b b ab a a
Optimum soybean lecithin for seabream larvae ………………………………………………………………………………………….. 77 Figure 4.5 Alkaline phosphatase activity in seabream larvae (30 dph) fed increased levels of SBL for 15 days. Values (mean ± standard deviation) with the same letters are not significantly different (P>0.05). Figure 4.6 Trypsin activity in seabream larvae (30 dph) fed increased levels of SBL for 15 days. (mean ± standard deviation) with the same letters are not significantly different (P>0.05). y = -4.6463x!"#"$%&'()*"+",-!&$)" .!"/"-&$-%0" 150 180 210 240 270 300 330 360 390 5 6 7 8 9 10 11 Alkaline Phosphatase (RFU/Larvae) Diet (% Polar Lipids) b ab ab a a y = -0.6293x! + 22.829x - 36.133 R! = 0.6821 0 20 40 60 80 100 120 140 160 180 200 5 6 7 8 9 10 11 Trypsin (RFU/Larvae) Diet (% Polar Lipids) bc c bc a ab
Optimum soybean lecithin for seabream larvae ………………………………………………………………………………………….. 78 Figure 4.7 Lipase activity in seabream larvae (30 dph) fed increased levels of SBL for 15 days. (mean ± standard deviation) with the same letters are not significantly different (P>0.05). Figure 4.8 Phospholipase A2 activity in seabream larvae (30 dph) fed increased levels of SBL for 15 days. Values (mean ± standard deviation) with the same letters are not significantly different (P>0.05). Fatty acid composition of total lipids, neutral lipids and polar lipids from the experimental microdiets showed that gradual inclusion of SBL lead to an increase in n-6 fatty acids, particularly 18:2n-6 fatty acid (Tables 4.2 and 4.3). The 12 SBL diet has the highest content of saturated fatty acids of total lipids and neutral lipids particularly 16:0 and 18:0 fatty acids, and has the lowest monounsaturated fatty acids particularly 18:1n-9 fatty acid. The diets 0 SBL, 2 SBL and 4 SBL have higher n-9 fatty acids of total lipids and neutral lipids compared to 8 SBL and 12 SBL. Fatty acid y = -1.1067x2 + 31.765x + 148.31 R2 = 0.5741 180 220 260 300 340 380 420 5 6 7 8 9 10 11 Lipase (RFU/Larvae) Diet (% Polar Lipids) b b ab ab a y = 9.7508x2 - 73.783x + 880.18 R2 = 0.9525 500 600 700 800 900 1000 1100 1200 1300 1400 5 6 7 8 9 10 11 Phospholipase A2 (U*100/Larvae) Diet (% Polar Lipids) b b b ab a
Optimum soybean lecithin for seabream larvae ………………………………………………………………………………………….. 85 16:0 22.87 23.09 22.70 23.13 23.63 16:1n-9 0.00 0.00 0.00 0.00 0.00 16:1n-7 0.90 0.79 0.73 0.70 0.55 Met 16:0 0.11 0.10 0.09 0.08 0.08 16:1n-5 0.23 0.23 0.22 0.20 0.17 16:2n-6 0.57 0.52 0.54 0.48 0.37 16:2n-4 0.61 0.62 0.61 0.60 0.54 16:2n-3 0.00 0.00 0.00 0.00 0.00 17:0 0.27 0.27 0.25 0.25 0.19 16:3n-4 0.01 0.00 0.00 0.00 0.00 16:3n-3 0.09 0.09 0.09 0.09 0.08 16:3n-1 0.67 0.63 0.66 0.66 0.58 16:4n-3 0.39 0.40 0.46 0.30 0.24 16:4n-1 0.10 0.09 0.09 0.09 0.06 18:0 7.82 7.74 7.87 7.79 7.88 18:1n-9 11.79 11.97 12.93 9.82 8.61 18:1n-7 1.77 1.74 1.59 1.65 1.53 18:1n-5 0.18 0.16 0.16 0.15 0.12 18:2n-9 0.10 0.08 0.08 0.07 0.02 18:2 n-6 8.22 9.15 9.28 11.80 16.65 18:2n-4 0.03 0.02 0.02 0.01 0.00 18:3n-9 0.00 0.00 0.00 0.00 0.00 18:3n-6 0.08 0.10 0.10 0.10 0.10 18:4 n-6 0.00 0.00 0.00 0.00 0.00 18:3n-4 0.08 0.06 0.08 0.10 0.06 18:3n-3 0.42 0.38 0.33 0.46 0.60 18:3n-1 0.00 0.00 0.00 0.00 0.00 18:4n-3 0.02 0.01 0.01 0.01 0.00 18:4n-1 0.01 0.01 0.00 0.00 0.00 20:0 0.15 0.14 0.15 0.13 0.12 20:1n-9 1.10 0.94 0.95 0.84 0.69 20:1n-7 0.00 0.00 0.00 0.00 0.00 20:1n-5 0.12 0.10 0.10 0.09 0.08 20:2n-9 0.02 0.04 0.01 0.04 0.03 20:2n-6 0.52 0.54 0.53 0.63 0.68 20:3n-9+n0.01 0.01 0.00 0.00 0.00 20:3n-6 0.08 0.07 0.07 0.06 0.05 20:4n-6 1.82 1.79 1.76 1.65 1.48 20:3n-3 0.20 0.19 0.19 0.21 0.19 20:4n-3 0.14 0.10 0.09 0.06 0.04 20:5n-3 5.72 5.96 5.57 6.03 5.62 22:1n-11 0.13 0.06 0.05 0.03 0.03 22:1n-9 0.08 0.03 0.07 0.03 0.02 22:4n-6 0.07 0.06 0.06 0.05 0.04 22:5n-6 0.36 0.35 0.34 0.33 0.29 22:5n-3 1.34 1.16 1.09 0.98 0.79
Optimum soybean lecithin for seabream larvae ………………………………………………………………………………………….. 86 22:5n-6 0.36 0.35 0.34 0.33 0.29 22:5n-3 1.34 1.16 1.09 0.98 0.79 22:6n-3 29.47 29.41 29.32 29.62 27.18 Total Saturated 32.24±0.12a 31.90±1.22a 31.64±0.04 a 31.88±0.49 a 32.32±0.07 a Total Monounsaturated 16.35±1.10a 16.09±1.17a 16.85±1.19a 13.57±1.04b 11.84±1.02c Total n-3 37.65±1.47a 37.71±1.43a 37.14±0.36a 37.77±0.54a 34.76±0.40b Total n-6 11.86±0.83c 12.60±1.50bc 12.67±0.02bc 15.09±1.57b 19.66±0.07a Total n-9 13.40±1.12ab 13.06±1.11ab 14.04±0.26a 10.79±1.54bc 9.37±0.19c Total n-3HUFA 36.76±1.45a 36.84±1.34a 36.25±0.37a 36.91±0.51a 33.83±0.39b ARA 1.82±0.11a 1.79±0.20a 1.76±0.02ab 1.65±0.05ab 1.48±0.054b EPA 5.72±0.49a 5.96±0.01a 5.57±0.24a 6.03±0.11a 5.62±0.01a DHA 29.47±0.62a 29.41±1.15a 29.32±0.12a 29.62±0.50a 27.18±0.38b EPA/ARA 3.12±0.06b 3.35±0.38ab 3.15±0.09b 3.65±0.20ab 3.80±0.14a DHA/EPA 5.16±0.33a 4.93±0.19a 5.26±0.20a 4.91±0.01a 4.83±0.08a DHA/ARA 16.16±0.72b 16.50±1.22ab 16.60±0.14ab 17.95±0.95ab 18.38±0.42a n-3/n-6 3.18±0.34a 3.02±0.47a 2.93±0.03a 2.51±0.22a 1.767±0.02b Discussion Regardless the dietary PL levels tested in the present study, the larvae were early weand at 16 dph on the experimental microdiets without rotifers or Artemia and produced very strong larvae (over 90% survival rate after a handling test) and high survival rates (52-57 %). Indeed, survival rates were higher than those previously obtained for marine fish larvae of this or other species fed only microdiets (Zambonino-Infante and Cahu, 1999; Roo et al., 2005; Seiliez et al., 2006). Under this conditions, increase of PL (49.4-95.9 g kg-1 in dry weight of diet) by the inclusion of SBL from 0 to 120 g kg-1 did not affected larval survival or stress resistance, suggesting that about 50 g kg-1 PL in the form of SBL is enough to maintain good larval survival. In agreement, the increase from 100 to 120 g kg-1 PL in the form of marine PL did neither improved larval survival in Atlantic cod (Gadus morhua) (Wold et al., 2007) or pikerperch (Sander lucioperca) (Hamza et al., 2008) fed ranged levels of SBL (up to 12%). Nevertheless, increased dietary PL up to 88.1 g kg-1 PL (80 g SBL kg-1 diet) significantly improved gilthead seabream larvae growth both in terms of total length and dry body weight. Dietary polar lipids have been found to improve microdiet ingestion (Izquierdo and Koven, 2010), that resulted in significant enhancement of digestive enzymes activities, particularly, PLA2 and alkaline phosphatase, was found by the elevation of
Optimum soybean lecithin for seabream larvae ………………………………………………………………………………………….. 87 dietary PL up to 88.1 g kg-1. Although marine fish larvae may have a wide range of digestive enzymes for an efficient digestion (Kolkovski et al., 2009), the presence of certain nutrients such as protein hydrolysates or short peptides can markedly contribute to enhance digestive enzymes activity as well as intestine maturation (Zambonino-Infante et al., 1999). Indeed, nutritional changes in the intestinal lumen are well known to affect directly or indirectly (via hormones, growth factors and cytokines) the epithelial cell function and differentiation in other vertebrates (Sanderson and Naik, 2000). Intestinal PLA2 activity has been determined in several fish species and catalyses the hydrolysis of dietary PL, producing free fatty acids and lysoPL (Izquierdo and Henderson, 1998). Despite dietary PL can be also hydrolysed by other lipolytic enzymes such as bile salt activated non specific lipase, PLA2 has been found to be more effective hydrolysing these type of lipids (Izquierdo and Henderson, 1998). Indeed, in the present study, increase in dietary PL only slightly increased lipase activity, whereas a linear substrate stimulatory effect of dietary SBL was found on PLA2 activity. These results are in agreement with those obtained in larval seabass, where PLA2 rather than lipase activity was increased in larvae fed increased PL levels, regulation occurring mainly at the transcriptional level (Cahu et al., 2003a). Lipase activity was markedly increased by dietary PL of marine origin in our previous studies (Saleh et al., 2012a), denoting the high affinity of this enzyme for n-3 HUFA esterified lipids (Izquierdo et al., 2000). Increased PLA2 activity in the present study would imply a better digestion of dietary PL, both from SBL and from the marine ingredients (squid meal and sardine oil), suggesting a better digestive utilization of ARA, EPA and DHA, high in the later lipid sources. Trypsin activity was only slightly affected by dietary SBL, being significantly higher only in larvae fed 88.1 g PL kg-1 diet, in agreement with previous studies feeding marine PL in this (Saleh et al. 2012a) or other species (Wold et al., 2007). This moderated effect on trypsin activity could be expected in these diets with similar protein contents, since this enzyme is the most important proteolytic enzyme in the early life stage of marine fish larvae (Ueberschär, 1993). Thus, the increase in trypsin could be more related to a general improvement in gut maturation or the stimulation of nervous or hormonal control of pancreatic secretion. The intestinal alkaline phosphatase is an intestinal specific isozyme, localized in the
Optimum soybean lecithin for seabream larvae ………………………………………………………………………………………….. 88 apical brush border of the enterocyte and enriched in surfactant-like particles, which is involved in nutrition processes, intestinal transport and intestinal inflammation in vertebrates, including fish (Bates et al., 2007). Since, this enzyme is intimately associated with the hydrophobic core of the intestinal microvillus membrane, its functioning is directly dependant on the development of this structure and it shows a sharp increase in activity during the post-embryonic development of mammals and fish (Bates et al. 2007). Consequently, the intestinal alkaline phosphatase has been used as a marker for enterocyte maturation in vertebrates (Zambonino-Infante and Cahu, 2001; Cahu et al., 2003; Bates et al., 2007; Saleh et al., 2012a). Nutritional factors, such as dietary lipids, have been found to affect alkaline phosphatase activity in mammals, as a result of the increase in the number of enterocytes that can express these enzymes (Sanderson and Naik, 2000). Indeed, increase in dietary PL improved the activity of this enzyme and enterocyte maturation in larvae fed increased PL (MacQueen Leifson et al., 2003; Wold et al., 2007; Saleh et al., 2012a). However, the phospholipid source used in these three studies was of marine origin, rich in n3HUFA, known to markedly affect cell differentiation and proliferation in several tissues (Izquierdo and Koven, 2010) and particularly in intestine (Sanderson and Naik, 2000). The present study shows that n-3 HUFA free source of PL, the SBL rich in linoleic acid (LA), also increases alkaline phosphatase activity in gilthead seabream larvae reflecting an improvement in enterocyte maturation. Dietary PL are hydrolysed mainly to free fatty acids and 1-acyl lyso-glyceroPL that are absorbed by the intestinal mucosal cells (Izquierdo and Henderson, 1998), where they are re-acylated to form PL mainly by the glycerol-3-phosphate pathway as demonstrated by Caballero et al. (2006a). In gilthead seabream, phospholipid synthesis is mainly regulated by two enzymes of this pathway diacylglycerol choline phosphotransferase and diacylglycerol ethanolamine phosphotransferase, whose activity can be modulated through dietary lipids (Caballero et al., 2006a). Thus, elevation of dietary soybean oil, rich in linoleic acid, increases PL synthesis, particularly PC, in gilthead seabream enterocytes (Caballero et al., 2006a). In agreement, in the present study, elevation of dietary SBL and, consequently, in PLA2 activity, would have increased the presence of substrates for these reacilation enzymes promoting PL synthesis in the enterocyte, which in turn would have stimulated membrane formation for both cell organelles and cell membrane
Optimum soybean lecithin for seabream larvae ………………………………………………………………………………………….. 89 promoting enterocyte and brush border maturation. Indeed, larvae of this study (15-30 dph) were in the most critical phase of digestive tract development (phase IV) in gilthead seabream, when connective tissue starts to develop and the first mucosal folds appear (Elbal et al., 2004). The improved gut maturation caused by the increased dietary SBL contents would improve digestive and absorptive utilization of dietary nutrients from the experimental microdiets, what could contribute to the improved growth rates. Besides, nutrient transport could have been also improved contributing to dietary nutrients utilization. For instance, dietary linoleic acid, high in SBL, has been found to increase lipoprotein, particularly VLDL, synthesis and composition, (Caballero et al., 2003, 2006b) in gilthead seabream juveniles. Moreover, in gilthead seabream larvae dietary SBL markedly increases lipoproteins synthesis in larval gut (Liu et al., 2002), promoting dietary lipids and proteins transport. In agreement, addition of SBL in microdiets for gilthead seabream improves enterocytes morphology and reduces lipid droplets accumulation (Salhi et al., 1999; Izquierdo et al., 2000). Indeed, lipid transport may be a more important limiting factor for utilization of dietary lipids in marine fish larvae than lipid digestion according to the results of Morais et al. (2006). Improved lipid digestion, absorption and transport can be also responsible for the high incorporation of ARA, EPA and DHA into polar lipids of larvae fed increased levels of SBL in the present study. Thus, despite the levels of this fatty acids were lower in both total and polar lipids of the experimental diets containing increased levels of SBL, the contents of these fatty acids in the larvae fed up to 88.1 g PL kg-1 diet remained unchanged in larval PL, and almost constant in larval NL. However, further increase in dietary PL up to 95.9 g kg-1 diet (120 g SBL kg-1 diet) markedly reduced the contents of these three essential fatty acids in both larval NL and PL. This reduction can be related to the high content in linoleic acid in SBL, since this fatty acid not only promotes PL synthesis, particularly PC (Caballero et al., 2006a), but is also specifically incorporated into gilthead seabream PL (Izquierdo et al., 2003; Ganga et al., 2005) and it is highly retained in this fraction even after months of being removed from the diet (Izquierdo et al., 2005). Therefore, the high linoleic acid content (52.1 g kg-1 in dry weight basis) of diets containing 95.9 g PL kg-1 diet (120 g SBL kg-1) could have compete for incorporation of ARA, EPA and DHA into larval lipids, in turn reducing the increase in larval growth caused by dietary SBL addition.
Optimum soybean lecithin for seabream larvae ………………………………………………………………………………………….. 90 From these results, an 80 g kg-1 SBL inclusion in microdiets for gilthead seabream larvae could be recommended, since further increase does not improve larval growth and survival and could reduce the DHA incorporation into the different larval tissues. Thus, a 50 % increase in final dry weight was obtained by the increase in SBL from 0 to 80 g kg-1 SBL, as it occurs in pikerperch larvae when SBL is increased from 15 to 95 g kg-1 (Hamza et al., 2008), being the requirements similar for both fish species. However, higher SBL levels (120 g kg-1) are required in microdiets for European sea bass (Cahu et al., 2003a). Our former studies in larval gilthead seabream fed microdiets with a similar formulation to those used in the present study, showed a higher requirement for PL (100 g kg-1) when a marine PL source was used (Saleh et al., 2012a). Finally, Further studies are being conducted to compare the effectiveness of the different sources of dietary PL. Acknowledgements This study was partially supported by a grant from the Spanish Agency of International Cooperation and Development (AECID) to Reda Saleh Mohamed Ibrahim. The present study was partly funded by the Spanish Ministry of Sciences and Education (AGL2009-14661). Also, this work has been partly funded under the EU seventh Framework Program by the ARRAINA project No 288925: Advanced Research Initiatives for Nutrition and Aquaculture.
Krill phospholipids vs soybean lecithin for seabream larvae ………………………………………………………………………………………….. 91 Chapter 5 ----------------------------------------------------------------------------- Effect of krill phospholipids vs soybean lecithin in microdiets for gilthead seabream (Sparus aurata) larvae on molecular markers of antioxidative metabolism and bone development This work has been submitted to Aquaculture Nutrition Abstract The objective of the present study was to compare the effectiveness of dietary marine phospholipids (MPL) obtained from krill and soybean lecithin (SBL) on the rearing performance and development of seabream (Sparus aurata) larvae. Larvae were fed from 16 to 44 day post hatching (dph) five formulated microdiets with three different levels (5, 7 or 9 %) of phospholipids (PL) obtained either from a MPL or a SBL source. Larvae fed MPL showest a higher survival, stress resistance and growth than those fed SBL, regardless the dietary PL level. Overall, the increase in MPL up to 7% total PL in diet was enough to improve larval gilthead seabream performance, whereas even the highest SBL inclusion level (9% PL) was not able to provide a similar success in larval growth or survival. Inclusion of SBL markedly increased the proxidation risk as denoted by the higher TBARs in larvae, as well as a higher expression of CAT, GPX and SOD genes. Moreover, SBL tend to produce larvae with a lower number of mineralized vertebrae and a lower expression of OC, OP and BMP4 genes.Finally, increasing dietary MPL or SBL lead to a better assimilation of polyunsaturated fatty acids in the larvae, n-3HUFA (especially 20:5n-3) or n-6 fatty acids (especially 18:2n-6), respectively. In conclusion, MPL had a higher effectiveness in promoting survival, growth and skeletal mineralization of gilthead seabream larvae in comparison to SBL.
Krill phospholipids vs soybean lecithin for seabream larvae ………………………………………………………………………………………….. 92 Introduction A main objective in fish larval nutrition is to formulate an effective compound diet able to substitute live preys as early as possible during larval development (Watanabe and Kiron, 1994). Such inert diet must be attractive, adequated to fit larval mouth size and should be able to fulfil the nutritional requirements of the larvae (Kolkovski et al., 2009). Among the different nutrients, phospholipids (PL) have been found to play essential roles in larval development (Izquierdo and Koven, 2010), their contents in larval inert diets markedly affecting larval performance (Kanazawa et al., 1981, 1983a, b; Sargent et al., 2002).Thus, various studies have demonstrated that the inclusion of dietary phospholipids leads to better growth and survival rates, a higher fish resistance to stress, and a reduced incidence of skeletal deformities in larvae (Kanazawa, 1993; Takeuchi et al., 1992; Salhi et al., 1999; Izquierdo et al., 2001; Kjørsvik et al., 2009; Izquierdo and Koven, 2010; Saleh et al., 2012a, b) and early juveniles (Coutteau et al., 1997). Marine fish larvae have a high capacity to utilize phospholipids (Geurden et al., 1998b; Salhi et al., 1999; Izquierdo et al., 2001) and inert diets containing marine phospholipids rather than marine triacylglycerides (TAG) resulted in better larval growth (Izquierdo et al., 2001; Cahu et al., 2003a; Gisbert et al., 2005). PL are the main structural components of cell membranes bilayers (Kagan et al., 1984), but also play an important structural role in digestion, promoting the utilization of dietary neutral lipids (Olsen and Ringø, 1997). For instance, elevation of dietary PL levels significantly increases both neutral lipase and phospholipase A2 activity in gilthead seabream larvae (Saleh et al., 2012a, b). Several authors had also suggested a significant role of PL in the intestinal absorption of lipids in marine fish larvae and early juveniles (Coutteau et al., 1997; Fontagne et al., 1998; Salhi et al., 1999). More recently, it has been demonstrated that dietary PL contribute to the assimilation of dietary lipids by enhancing the enteric lipoprotein synthesis required for the extra-cellular transport of lipids (Liu et al., 2002; Hadas et. al., 2003). Moreover, inclusion of PL in early weaning diets markedly increases alkaline phosphatase activity denoting a better development of fish digestive system (Saleh et al., 2012a,b). Besides, they seem to affect inert diets palatability and could contribute to supply essential components such as choline and inositol (Tocher et al., 2008).
Krill phospholipids vs soybean lecithin for seabream larvae ………………………………………………………………………………………….. 93 Early studies also showed a positive effect of dietary PL inclusion on skeletal development of fish larvae, chicken egg lecithin reducing the incidence of certain bone malformations such as twisted jaw and scoliosis (Kanazawa et al., 1981). Inclusion of PL rich in n-3 polyunsaturated fatty acids in early weanning diets for cod induced a faster ossification and a higher number of fin rays in comparison to the control group (Kjørsvik et al., 2009). However, little is known on the phisiological mechanisms implied in this effect. Transcription factors, growth factors, cell surface receptors, cell adhesion molecules and extracellular matrix molecules are all involved in the four basic processes of skeletal cell and tissue differentiation, which include: migration of skeletogenic cells to the site of future skeletogenesis, epithelialmesenchymal interactions, cell condensation and cell differentiation. For instance, a very high correlation between developmental age and gene expression for osteocalcin, a matrix mineralization protein and a marker for late bone cell differentiation, was found in fish fed high PI dietary levels (Sandel et al., 2010). Therefore, these effects could be also related to the different PL classes composition of each PL source (Geurden et al., 1998a, b). Indeed certain membrane PL, such as phosphatidyl inositols (PI), are precursors of second messengers regulating calcium entry into the cells and are involved in a signaling system controlling biological processes in the early development of vertebrates (Berridge and Irvine, 1989). Thus, PL include a large group of compounds and their function in larval development could be related to their specific composition, both in type of lipid classes and fatty acids contents. For instance, inclusion of PL from marine origin (bonito eggs), rich in n-3 highly unsaturated fatty acids, improve growth and survival of larval ayu (Plecoglossus altivelis) more effectively than PL from a vegetal source (Kanazawa et al., 1981). Similarly, higher length and weight are obtained in gilthead seabream larvae fed marine PL (squid) than soybean lecithin (Salhi et al., 1999). Recently, seabream growth, hepatic utilization of dietary lipids and gut health were all improved when 2.5% dietary soybean lecithin was substituted by krill PL (Betancor et al., 2012b). However, there are no studies comparing both PL sources at several dietary contents, which are close to the optimum levels for each PL source as determined in previous studies (Saleh et al., 2012a, b). Different fatty acid profiles in the dietary PL could differently affect the susceptibility of larval tissue lipids to peroxidative damage. Lipid peroxidation is recognized as being highly deleterious, resulting in damage to cellular biomembranes (Kanazawa,
Krill phospholipids vs soybean lecithin for seabream larvae ………………………………………………………………………………………….. 94 1993) and subcellular membranes, such as those of mitochondria, causing several pathological conditions in fish (Sakai et al., 1989). The detrimental effects of peroxidative risk include the oxidative damage to molecules of high biological importance – lipids, proteins, carbohydrates and/or DNA causing alterations that can lead to cell death (Halliwell and Gutteridge, 2007). To be protected from this peroxidation risk, fish have an endogenous antioxidant defence system, including radical scavenging enzymes such as catalase (CAT), superoxide dismutase, (SOD) and glutathione peroxidase (GPX) (Halliwell and Gutteridge, 1996). Peroxidative risk seems to be even higher in marine fish larvae than in juveniles, due to the large surface area to volume ratio of microdiets, the very high larval tissue content in polyunsaturated fatty acids and the higher water contents, and, hence, a functional defence against oxidised fat is more important than at later stages of fish life cycle (Betancor, 2012). However, few studies have been aimed to determine the effect of dietary nutrients, and particularly PL on the oxidative status of marine fish larvae. PL requirements for marine fish larvae range between 5 and 10% in microdiets. For instance, the optimum PL dietary levels determined for red seabream (Pagrus major) larvae are 5% SBL (Kanazawa et al., 1983a), 7% SBL for Japanese flounder (Paralichthys olivaceus) (Kanazawa, 1993) and 12% SBL for European sea bass (Dicentrarchus labrax) (Cahu et al., 2003a). For gilthead seabream (Sparus aurata) our previous studies feeding 5 different dietary levels have shown an optimum dietary level of 8 % PL when SBL (Saleh et al., 2012b) was used as a dietary PL source and a 10% PL when krill PL were used (Saleh et al., 2012a). Although a lower amount of SBL seems to be sufficient to fulfil the PL requirements of gilthead seabream larvae, the value of SBL in promoting fish larvae growth and survival could be lower. Thus, the aim of the present study was to compare the effectiveness of both PL sources, krill phospholipids and SBL, to promote gilthead seabream (Sparus aurata) larvae development, when they are included at optimum levels in early weanning diets. For that porpuse, PL from either SBL or krill PL were included at three different dietary levels that were either deficient or optimum, and their effects on survival, stress resistance, growth, skeleton malformation, bone mineralization, biochemical composition, oxidative status and selected genes expression in gilthead seabream larvae were studied.
Krill phospholipids vs soybean lecithin for seabream larvae ………………………………………………………………………………………….. 101 Figure 5.1 Survival rate of larvae (44 dph) fed three dietary PL levels using two different PL sources. Values (mean ± standard deviation) with the same letters were not significantly different (P>0.05). Figure 5.2 Survival rate (24 hours after activity test) of larvae (44 dph) fed three dietary PL levels using two different PL sources. Values (mean ± standard deviation) with the same letters were not significantly different (P>0.05). y = -0.8125x2!"!#$%&&'(!"!%)$&&'! *+!,!%! y = 0.0069x2 + 1.5556x + 16 R2 = 1 10 15 20 25 30 35 40 45 5 6 7 8 9 10 Survival % Polar Lipids (% of dry diet) MPL SBL d b c a a d y = -0.8646x2 + 9.9583x + 74 R2 = 1 y = 0.2188x2 + 1.125x + 74 R2!,!%! 70 75 80 85 90 95 100 105 5 6 7 8 9 10 Survival % Polar Lipids (% of dry diet) MPL SBL c b a a d
Krill phospholipids vs soybean lecithin for seabream larvae ………………………………………………………………………………………….. 102 Figure 5.3 Total length of larvae (44 dph) fed three dietary PL levels using two different PL sources. Values (mean ± standard deviation) with the same letters were not significantly different (P>0.05). Figure 5.4 Correlation between total length of larvae (44 dph) fed three dietary PL levels using two different PL sources and dietary n-3 HUFA. Values (mean ± standard deviation) with the same letters were not significantly different (P>0.05). y = -0.1791x! + 1.6962x + 8.6 R2 = 1 y = 0.0059x2 + 0.0737x + 8.6 R2 = 1 7 8 9 10 11 12 13 14 5 6 7 8 9 10 Total Length (mm) Polar Lipids (% dry diet) MPL SBL d cd c b a y = 0.5096x + 7.0074 R! = 0.92768 7 8 9 10 11 12 13 14 0 2 4 6 8 10 12 Total Length (mm) Dietary n-3 HUFA (% dry diet) Control SBL MPL d cd c b a
Krill phospholipids vs soybean lecithin for seabream larvae ………………………………………………………………………………………….. 103 Figure 5.5 Dry whole body weight of larvae (44 dph) fed three dietary PL levels using two different PL sources. Values (mean ± standard deviation) with the same letters were not significantly different (P>0.05). The effects the different dietary PL levels on skeletal mineralization were analyzed considering the average number of mineralized vertebrae for a given larval size. In general, there was a promoting effect of dietary MPL on the skeletal mineralization. For instance, in the size group 12.40-13.40 mm, when most of the larvae started mineralization of vertebrae, the average number of mineralized vertebrae was 10, 16, 18, 12 and 14 for fish fed diets Control, 7 MPL, 9MPL, 7 SBL and 9 SBL, respectively (Figures 5.6 and 5.7, Table 5.3). The skeletal anomalies study showed that larvae fed 9 MPL had the lowest percentage of total skeletal anomalies incidence en comparison with the other treatments, the larvae fed Control, 7SBL and 9SBL diet had the highest incidence of lordosis (10 %), and larvae fed 9 SBL had higher incidence of kyphosis (13 %). The larva fed 7MPL diets had lowest mandibula and maxilla anomalies (Figure 5.8). y = -72.531x2 + 649.87x + 876 R2 = 1 y = 8.8646x2 - 25.292x + 876 R2 = 1 500 1000 1500 2000 2500 3000 5 6 7 8 9 10 Dry Weight (ug)/Larvae Polar Lipids (% dry diet) MPL SBL d c b d a
Krill phospholipids vs soybean lecithin for seabream larvae ………………………………………………………………………………………….. 104 ! " C D E Figure 5.6 Representative pictures of mineralized vertebrae of larvae (44 dah) fed three dietary PL levels using two different PL sources, (A: Control; B: 7 MPL; C: 9 MPL; D: 7 SBL; E: 9 SBL.
Krill phospholipids vs soybean lecithin for seabream larvae ………………………………………………………………………………………….. 105 Table 5.3 Average numbers of mineralized vertebrae of larvae (44 dah) fed three dietary PL levels using two different PL sources Average number of mineralized vertebrae Size class Length (mm) Control 7 MPL 9 MPL 7 SBL 9 SBL 1 8.409-8.909 0 n.a. n.a. n.a. n.a. 2 8.909-9.409 0 n.a. n.a. n.a. n.a. 3 9.409-9.909 0 n.a. n.a. n.a. n.a. 4 9.909-10.409 1 0 n.a. 0 2 5 10.409-10.909 2 2 n.a. 2 0 6 10.909-11.409 3 2 n.a. 1 4 7 11.409-11.909 6 3 n.a. 2 2 8 11.909-12.409 0 5 n.a. 5 10 9 12.409-12.909 8 12 15 9 12 10 12.909-13.409 13 20 21 15 17 11 13.409-13.909 n.a. n.a. 20 n.a. n.a. 12 13.909-14.409 n.a. n.a. 22 n.a. n.a. 13 14.409-14.909 n.a. n.a. 23 n.a. n.a. % Normal larvae 8.409-14.909 71 84 80 73 71 *n.a. : not available. Figure 5.7 Graphical representation of the average number of mineralized vertebrae for each size class of larvae (44 dah) fed three dietary PL levels using two different PL sources. !" #" $!" $#" %!" %#" !" $" %" &" '" #" (" )" *" +" $!" $$" $%" $&" $'" !"#$%&'()'#*+%&,-*.%/'0%&1%$&,%' 2*.%'3-,44'5##6' ,-./0-1" )234" +234" )564" +564"
Krill phospholipids vs soybean lecithin for seabream larvae ………………………………………………………………………………………….. 106 Figure 5.8 Incidence of skeleton anomalies of larvae (44 dah) fed three dietary PL levels using two different PL sources. (P>0.05). Values (mean ± standard deviation) with the same letters were not significantly different (P>0.05). Table 5.4 Fatty acids (% dry weight) composition in total lipids of diets three dietary PL levels using two different PL sources Control 7 MPL 9 MPL 7 SBL 9 SBL 14:0 0.86 1.69 0.58 0.86 2.29 14:1n-5 0.31 0.05 0.03 0.01 0.04 14:1n-7 0.23 0.04 0.06 0.01 0.03 15:0 0.31 0.09 0.08 0.10 0.09 15:1n-5 0.12 0.01 0.01 0.01 0.02 16:0iso 0.06 0.07 0.07 0.01 0.01 16:0 4.90 4.85 5.39 4.65 4.11 16:1n-7 0.47 1.04 0.92 0.75 0.27 16:1n-5 0.14 0.05 0.04 0.04 0.05 16:2n-6 0.04 0.09 0.04 0.02 0.15 16:2n-4 0.04 0.01 0.01 0.12 0.01 17:0 0.02 0.04 0.04 0.04 0.08 16:3n-4 0.09 0.08 0.21 0.02 0.06 16:3n-3 0.10 0.06 0.03 0.03 0.06 16:3n-1 0.04 0.07 0.06 0.00 0.01 16:4n-3 0.68 0.16 0.05 0.00 0.22 18:0 2.90 0.59 0.73 1.13 0.20 18:1n-9 2.04 3.26 3.57 6.66 2.91 18:1n-7 0.50 1.22 0.76 0.00 0.07 18:1n-5 0.05 0.09 0.10 0.04 0.06 18:2n-9 0.00 0.03 0.07 0.24 0.02 18:2n-6 0.97 0.38 0.68 4.76 6.82 18:2n-4 0.02 0.02 0.07 0.00 0.02 18:3n-6 0.07 0.01 0.01 0.01 0.01 !" #" $" %" &" '!" '#" '$" '%" ()*+,)-" ."/01" 2"/01" ."341" 2"341" !"#$%&'()*+* ,'(-)** 1),5)676" 89:;)676" /<*57=>-<? /<@7--<" b b c a c a d b c b b b c a c a a a d b a a
Krill phospholipids vs soybean lecithin for seabream larvae ………………………………………………………………………………………….. 107 18:3n-4 0.05 0.02 0.05 0.03 0.01 18:3n-3 0.12 0.15 0.24 0.20 0.42 18:4n-3 0.13 0.40 0.39 0.03 0.04 18:4n-1 0.45 0.01 0.04 0.04 0.03 20:0 0.13 0.02 0.03 0.05 0.02 20:1n-9 0.06 0.04 0.06 0.07 0.03 20:1n-7 0.66 0.47 0.48 0.00 0.07 20:1n-5 0.00 0.06 0.03 0.00 0.07 20:2n-6 0.35 0.03 0.09 0.06 0.07 20:3n-6 0.01 0.01 0.02 0.01 0.02 20:4n-6 0.38 0.16 0.14 0.18 0.11 20:3n-3 0.20 0.07 0.06 0.09 0.03 20:4n-3 0.07 0.06 0.07 0.03 0.10 20:5n-3 1.72 3.67 3.63 0.99 2.55 22:1n-11 0.11 0.01 0.04 0.13 0.02 22:1n-9 0.60 0.15 0.05 0.02 0.15 22:4n-6 0.01 0.09 0.05 0.04 0.10 22:5n-6 0.03 0.03 0.03 0.03 0.01 22:5n-3 0.26 0.10 0.26 0.07 0.18 22:6n-3 1.99 4.42 6.33 1.99 2.74 Total Saturated 9.12 7.27 6.85 6.83 6.78 Total n-3 5.28 9.14 11.03 3.42 6.33 Total n-6 1.86 0.81 1.07 5.12 7.29 Total n-9 2.71 3.47 3.77 7.00 3.11 n-3HUFA 4.24 8.33 10.34 3.16 5.60 ARA 0.38 0.16 0.14 0.18 0.11 EPA 1.72 3.67 3.63 0.99 2.55 DHA 1.99 4.42 6.33 1.99 2.74 EPA/ARA 4.57 22.41 26.63 5.41 22.32 DHA/EPA 1.16 1.20 1.74 2.01 1.08 DHA/ARA 5.30 26.98 45.21 10.89 24.05 n-3/n-6 2.84 11.30 10.23 0.64 0.88 Table 5.5 Fatty acids (% dry weight) composition in lipid classes of diets containing three dietary PL levels using two different PL sources Control 7 MPL 9 MPL 7 SBL 9 SBL Phosphatidylcholine Saturated 37.07 36.96 32.14 36.14 35.5 Monounsaturated 6.10 11.78 15.95 7.20 11.35 Total n-3 55.58 48.97 48.12 47.77 62.53 ARA 0.38 0.53 0.78 0.35 0.42 EPA 6.76 18.30 29.50 6.08 7.51 DHA 47.86 27.92 14.11 40.14 52.29 Phosphatidylinositol Saturated 36.23 45.85 44.78 35.71 47.06 Monounsaturated 19.69 16.24 18.09 19.91 8.85
Krill phospholipids vs soybean lecithin for seabream larvae ………………………………………………………………………………………….. 108 Total n-3 20.95 34.20 33.50 21.08 11.27 ARA 0.69 1.42 1.77 0.70 0.32 EPA 8.69 17.03 17.61 8.79 3.48 DHA 7.81 15.81 14.46 7.87 3.84 Phosphatidylserine Saturated 30.22 34.34 31.01 42.00 34.20 Monounsaturated 18.40 20.72 21.70 17.52 18.53 Total n-3 42.13 41.72 42.69 31.57 32.71 ARA 1.33 1.44 2.21 1.23 1.21 EPA 9.42 12.75 19.61 7.96 7.55 DHA 27.12 26.51 20.73 20.99 22.61 Phosphatidylethanolamine Saturated 25.34 23.42 22.23 28.61 24.73 Monounsaturated 13.93 12.89 17.26 11.77 13.84 Total n-3 37.35 56.59 54.71 45.58 38.21 ARA 2.27 3.41 2.28 2.86 2.25 EPA 20.01 30.09 26.08 25.18 19.45 DHA 16.42 24.74 26.99 18.36 15.96 The fatty acid profile of neutral lipids of the larvae (Table 5.6) showed significantly higher contents of saturated and n-3 fatty acids, particularly n-3 HUFA and EPA in fish fed MPL diets in comparison with the control or SBL fed larvae. On the contrary, total n-6 and n-9 fatty acids were higher in larvae fed SBL and control diets than those fed MPL diets. Fatty acid composition of neutral lipids from larvae fed 7 SBL diet was very similar to the Control, being only significantly higher in saturated fatty acids and DHA and lower in ARA. Larvae fed diet 9 SBL were also significantly higher than the control in DHA, n-6 and n-9 fatty acids. Regarding the larval polar lipids, the fatty acids profiles were more similar among larvae fed the different diets than their respective neutral lipids (Table 5.7). In general, the main n-3 polyunsaturated fatty acids EPA and DHA presented a higher concentration in the PL fraction than in the NL, whereas 18:2n-6 content was higher in the NL than in the PL fraction. PL fractions of larvae fed MPL diets were 15% higher in saturated and n-3 fatty acids than fish fed Control or SBL diets. Besides, they were 50% higher in EPA, whereas DHA levels in polar lipids were more similar among the different larvae, being highest in larvae fed 9MPL followed by SBL and, then, 7 MPL and Control larvae. Thus, increasing dietary MPL and SBL lead to better assimilation of n3HUFA (especially EPA) and n-6 fatty acids (especially 18:2n-6) respectively, denoted by the higher content of these fatty acids in both neutral and polar lipids of
Krill phospholipids vs soybean lecithin for seabream larvae ………………………………………………………………………………………….. 109 the larvae in comparison to Control fish, regardless their respective dietary fatty acid profiles. Table 5.6 Fatty acids (% total identified fatty acids) composition of neutral lipids from larvae fed diets containing five phospholipids levels. Values (mean ± standard deviation) with the same letters in the same row are not significantly different (P>0.05) Control 7 MPL 9 MPL 7 SBL 9 SBL 14:0 0.81 4.20 5.08 1.91 1.43 14:1n-5 0.10 0.05 0.03 0.21 0.06 14:1n-7 0.12 0.12 0.12 0.21 0.08 15:0 0.32 0.33 0.41 0.38 0.32 15:1n-5 0.04 0.05 0.04 0.06 0.04 16:0iso 0.10 0.08 0.08 0.10 0.08 16:0 11.10 18.42 20.69 12.53 14.40 16:1n-7 3.89 5.48 4.86 3.28 2.42 16:1n-5 0.19 0.31 0.37 0.26 0.21 16:2n-6 0.38 0.31 0.68 0.37 0.36 16:2n-4 0.48 3.15 2.26 0.58 0.54 17:0 0.97 0.32 0.27 1.04 0.71 16:3n-4 0.03 0.02 0.03 0.00 0.00 16:3n-3 0.09 0.15 0.27 0.09 0.08 16:3n-1 0.00 0.02 0.03 0.00 0.00 16:4n-3 0.09 0.14 0.15 0.06 0.05 16:4n-1 0.04 0.00 0.00 0.00 0.00 18:0 4.48 5.93 6.03 4.82 5.33 18:1n-9 40.19 15.21 11.02 41.20 33.30 18:1n-7 3.47 6.44 5.43 2.31 1.87 18:1n-5 0.81 0.45 0.55 0.65 0.50 18:2n-9 0.15 0.10 0.12 0.09 0.00 18:2n-6 9.87 7.54 2.62 10.29 18.31 18:2n-4 0.16 0.21 0.25 0.15 0.13 18:3n-6 0.24 0.11 0.09 0.09 0.12 18:3n-4 0.10 0.01 0.06 0.06 0.10 18:3n-3 0.99 0.98 0.56 0.91 1.69 18:4n-3 0.19 1.02 0.89 0.19 0.15 18:4n-1 0.02 0.03 0.00 0.00 0.00 20:0 0.19 0.22 0.18 0.15 0.15 20:1n-9 2.88 1.63 2.52 2.06 1.99 20:1n-5 0.18 0.30 0.38 0.14 0.13 20:2n-9 0.00 0.01 0.01 0.01 0.01
Krill phospholipids vs soybean lecithin for seabream larvae ………………………………………………………………………………………….. 110 20:2n-6 0.28 0.22 0.19 0.21 0.27 20:3n-6 0.05 0.14 0.07 0.03 0.02 20:4n-6 0.90 1.19 0.86 0.73 0.61 20:3n-3 0.19 0.13 0.32 0.18 0.21 20:4n-3 0.17 0.41 0.33 0.05 0.04 20:5n-3 3.20 10.57 10.68 3.00 2.82 22:1n-11 0.75 0.90 0.73 0.50 0.49 22:1n-9 0.43 0.69 0.84 0.03 0.03 22:4n-6 0.04 0.06 0.05 0.03 0.01 22:5n-6 0.12 0.09 0.15 0.10 0.09 22:5n-3 0.63 1.34 1.06 0.31 0.28 22:6n-3 10.55 10.92 18.63 10.64 10.56 Total Saturated 17.86±1.11d 29.41±2.28a 32.66±1.79a 20.83±1.56c 22.33±1.84c Total n-3 16.12±1.45c 25.66±1.73b 32.89±1.98a 15.43±1.33c 15.88±1.26c Total n-6 11.87±0.78b 9.67±067c 4.72±0.46d 11.84±0.71b 19.80±0.91a Total n-9 43.66±1.98a 17.64±1.34c 14.51±1.05d 43.38±2.01a 35.33±1.94b Total n-3HUFA 14.75±0.67c 23.37±1.34b 31.03±1.58a 14.18±0.78c 13.91±0.87c ARA 0.90±0.05b 1.19±0.08a 0.86±0.03b 0.73±0.08c 0.61±0.03d EPA 3.20±0.17b 10.57±0.51a 10.68±0.44a 3.00±0.28b 2.82±0.14b DHA 10.55±0.79b 10.92±0.95b 18.63±0.96a 10.64±0.88b 10.56±0.79b EPA/ARA 3.55±0.11d 9.13±0.69b 12.47±0.76a 4.13±0.28d 4.65±0.19c DHA/EPA 3.25±0.13b 1.03±0. 07d 1.74±0.08c 3.54±0.16a 3.73±0.21a DHA/ARA 11.65±0.88d 9.43±0.79e 21.76±1.02a 14.62±0.91c 17.36±1.00b n-3/n-6 1.38±0.04c 2.65±0.09b 7.25±0.54a 1.30±0.03c 0.80±0.01d Table 5.7 Fatty acids (% total identified fatty acids) composition in polar lipids of larvae fed diets containing five phospholipids levels. Values (mean ± standard deviation) with the same letters in the same row are not significantly different (P>0.05) Control 7 MPL 9 MPL 7 SBL 9 SBL 14:0 0.62 1.12 1.07 1.11 0.38 14:1n-5 0.03 0.02 0.02 0.35 0.02 14:1n-7 0.05 0.04 0.03 0.29 0.03 15:0 0.30 0.23 0.27 0.62 0.23 15:1n-5 0.01 0.01 0.01 0.42 0.00 16:0ISO 0.06 0.04 0.04 0.24 0.04 16:0 22.88 25.63 28.03 22.11 23.12 16:1n-7 0.88 2.25 2.07 1.00 0.72 16:1n-5 0.21 0.24 0.26 0.35 0.17 16:2n-6 0.39 0.15 0.43 0.52 0.36 16:2n-4 0.55 0.97 0.70 0.66 0.48
Krill phospholipids vs soybean lecithin for seabream larvae ………………………………………………………………………………………….. 117 Figure 5.17 Osteocalcin gene expression level measured by real-time PCR in seabream larvae fed five dietary phospholipid levels. Values (mean ± standard deviation) with the same letters were not significantly different (P>0.05). Figure 5.18 Osteopontin gene expression level measured by real-time PCR in seabream larvae fed five dietary phospholipid levels. Values (mean ± standard deviation) with the same letters were not significantly different (P>0.05). !" #" $" %" &" '" (" )" *" +" #!" ##" ,-./0-1" )"234" +"234" )"564" +"564" !"#$%&'(&)*+,$*$++ -$.$(+/012$"")%*+ 3)$#+ a a c b d !" #" $" %" &" ,-./0-1" )"234" +"234" )"564" +"564" !"#$%1%*#)*+,$*$+++ -$.$(+/"12$"")%*+ 3)$#+ bc d c b a
Krill phospholipids vs soybean lecithin for seabream larvae ………………………………………………………………………………………….. 118 Figure 5.19 Osteonectin gene expression level measured by real-time PCR in seabream larvae fed five dietary phospholipid levels. Values (mean ± standard deviation) with the same letters were not significantly different (P>0.05). Figure 5.20 Matrix Gla Protein gene expression level measured by real-time PCR in seabream larvae fed five dietary phospholipid levels. Values (mean ± standard deviation) with the same letters were not significantly different (P>0.05). !" #" $" %" &'()*'+" ,"-./" 0"-./" ,"12/" 0"12/" !"#$%&$'#(&)*$&$)+$,$-))./01$"(%&) 2($#) c a a b b !" #" $" %" 3" &'()*'+" ,"-./" 0"-./" ,"12/" 0"12/" 345678)*+4)*$&$)) +$,$-)./01$""(%&) 2($#) c a a bc ab
Krill phospholipids vs soybean lecithin for seabream larvae ………………………………………………………………………………………….. 119 Discussion Addition of SBL to the early weanning diets for gilthead seabream raised the dietary contents of PL, particularly PI, PC and PE, and improved seabream survival and stress resistance, promoting the incorporation of dietary DHA into larval polar lipids. These results could be due to the enhancement of digestive enzymes activities, particularly, PLA2 and alkaline phosphatase (Saleh et al., 2012b) and gut and liver lipid transport activity (Liu et al., 2002) obtained by the inclusion of SBL in previous studies,which would improve the absorption of several nutrients from the lumen (Morais et al., 2006). Thus, improved lipid digestion, absorption and transport would be responsible for the high incorporation of n-3 HUFA, particularly DHA into polar lipids of larvae fed increased levels of SBL. Cahu, et al. (2003a) found that soybean lecithin incorporation (12% PL dietary dry weight), supported high survival to European sea bass Dicentrarchus labrax. However, only the elevation of dietary SBL up to 9% PL improved larval growth. This is in agreement with previous studies, where elevation of dietary PL over 9% with SBL did not further improved seabream larval growth (Saleh et al., 2012b). However, improvement in either larval growth or survival was significantly lower than that obtained by MPL in the present study. Dietary inclusion of SBL, rich in linoleic acid and PI, markedly increased the oxidative risk of gilthead seabream larvae as denoted not only by the higher MAD values obtained, but also by the increase in the gene expression of enzymes involved in the oxidative metabolism such as SOD, CAT and GPX. Despite inclusion of the highest MPL level (9% PL) also raised the MAD values, the expression of CAT, SOD or GPX genes was significantly lower than for SBL fed larvae, and only slightly higher than in the control larvae, suggesting the presence of antioxidant factors in the MPL source used, such as carotenoids. The krill oil is rich in antioxidants factors such as carotenoids (astaxanthin) (Tou et al., 2007). In agreement with the improved growth obtained by increased levels of marine phospholipids in other species such as Atlantic cod (Gadus morhua) and European sea bass (Dicentrarchus labrax), in the present study, the MPL seemed to be superior to enhance larval growth and development when incorporated into microdiets than SBL. Thus, even the inclusion of only 7 % PL as MPL improved survival, stress
Krill phospholipids vs soybean lecithin for seabream larvae ………………………………………………………………………………………….. 120 resistance and growth of gilthead seabream in a larger extend than SBL, what could be related to their higher content in PC and LPC rich in DHA and EPA, in comparison to SBL diets. Indeed growth improvement obtained by dietary PL increase has been previously associated to an enhancement in feed intake associated to the estimulation of gustatory response by the trimethyl group of the choline base of PC (Izquierdo and Koven, 2010). Despite it is well known the potent effect of these fatty acids in promoting larval growth and survival, the higher performance of fish fed MPL seems to be due not only to a higher dietary content on these fatty acids. For instance, feeding seabream larvae with two weaning diets containing the same PL (2.5%) and n-3 HUFA (1.6%) levels, the diet containing these fatty acids in the PL fraction caused a significantly higher growth than those fed these fatty acids in the NL (Salhi et al., 1999; Izquierdo et al., 2001). Moreover, a better utilization of dietary n-3 HUFA is obtained as denoted by the higher incorporation of these fatty acids in the larval PL (Izquierdo et al., 2001). These authors found that dietary n-3 HUFA rich PL markedly improves the incorporation of free EPA, but not of free oleic acid, into larval polar lipids (Izquierdo et al., 2001), in relation to improved lipid transport, mobilization and deposition in the peripheral tissues by n-3 HUFA rich dietary PL. More specifically, the higher LPC rich in DHA, could specifically promote the higher incorporation of HUFA into larval polar lipids, as it has been found in mammal models. For instance, DHA incorporation into PC of rat brain cells was higher when LPC-DHA was used instead of unesterified DHA and LPC-16:0 (Bernoud et al., 1999), suggesting an intact and specific uptake of DHA-PC that was directly reacilated into PC. The improvement in larval growth could be also related to a faster maturation of the gut suggested by the significant increase in alkaline phosphatase activity in previous studies (Wold et al., 2007; Saleh et al., 2012a, b) and a better digestive efficiency due to the stimulatory effect of dietary MPL on PLA2 and neutral lipase activity (Saleh et al., 2012a). Thus, marine PL rich in HUFA may increase the microdiet intake, promote gut development and nutrient digestion, facilitate direct incorporation of HUFA into polar lipids, and thus, enhance growth, survival and stress resistance in marine fish larvae. Inclusion of PL in the seabream weaning diets significantly reduced the lordosis incidence, regardless the type of PL or the dietary PI level, despite in carp this PL class was proposed to reduce skeletal deformities (Guerden et al., 1998a). In the present study, the elevation of PI in SBL diets in comparison to control or MPL diets
Krill phospholipids vs soybean lecithin for seabream larvae ………………………………………………………………………………………….. 121 did not reduced the incidence of deformities. On the contrary, lordosis incidence seemed to be lower in larvae fed higher PE, rich in DHA, and with high DHA incorporation into larval PL. Lordosis incidence was neither related to the dietary PC/PI ratios, which were either larger in control and MPL diets than the 2.18 reccommended by Cahu et al. (2003b) for European sea bass, or lower in diet with 9% SBL in the present study. Regarding kyphosis the lowest incidence was found in larvae fed 9% PL as MPL, the diet with the highest DHA content, and also showed the highest ARA contents in the larval PL fraction. In addition there was not any incidence of cranial deformities in this fish. The lowest incidence of skeleton deformities found in fish fed 9% PL as MPL could be related to a higher resistance to vertebral deformities by a stronger mineralization as suggested by the highest expression in this fish of the skeletal extracellular matrix proteins, significantly osteopontine, in relation to the higher dietary DHA content. Indeed, larvae fed MPL showed higher expression of BMP-4 gene, a member of the transforming growth factor b superfamily considered as important regulators of the differentiation of uncommitted mesenchymal cells into osteoblasts during both embryonic development and bone repair. These genes are up-regulated by dietary n-3 HUFA being beneficial for other vertebrates (Kruger et al., 2010). In agreement in the present study no maxilar or mandibular deformities were registered in fish fed 9% PL as MPL. Similarly, Runx2, the earliest and most specific marker of osteogenesis, is regulated by dietary DHA and possibly also other n-3 HUFA (Kruger et al., 2010). In turn, Runx2 regulates the expression of ALP and OC, both being up-regulated in larvae fed MPL. Thus, n-3 HUFA increase ALP activity in growing male rats as well as insulin-like growth factor I (IGF-1) (Kruger et al., 2010). In gilthead seabream, increased in dietary DHA up-regulated IGF-1, enhanced bone mineralization and significantly reduced the incidence of vertebral anomalies such as lordosis and kyphosis (Izquierdo et al., 2012). The n-3 HUFA has a role in promoting bone formation in mammals as well as in fish (Lall and Lewis-McCrea, 2007), but these mechanisms are poorly studied in fish. Feeding dietary n-3 HUFA to growing male rats increased rates of bone formation (Watkins et al., 2000). Increasing dietary DHA also increased the ratio of n-3/n-6 in bone compartments, which favored bone formation in rats (Watkins et al., 2003, 2006). Larvae fed 9 MPL and 7 MPL diets contained relatively more n-3 HUFA than
Krill phospholipids vs soybean lecithin for seabream larvae ………………………………………………………………………………………….. 122 the 7 SBL and 9 SBL larvae, thus increasing the ratio of n-3/n-6 to 8.19% and 11.3% respectively. In summary, despite increased on dietary SBL up to 9% improve larval survival, stress resistance, growth and skeletal development, dietary MPL was more effective in promoting all these parameters. Their higher content in PC, LPC, ARA, EPA and, particularly, DHA, not only promotes digestion, transport and deposition of dietary lipids, but also contributes to reduce skeleton anomalies by up-regulating BMP-4, Runx2, ALP and the skeletal extracellular matrix proteins, inducing early mineralization and resistance of vertebral bodies to reduce anomalies such as lordosis and kyphosis. Inclusion of SBL markedly increased the proxidation risk as denoted by the higher TBARs in larvae, as well as a higher expression of CAT, GPX and SOD genes. Acknowledgement This study was partially supported by a grant from the Spanish Agency of International Cooperation and Development (AECID) to Reda Saleh Mohamed Ibrahim. The present study was partly funded by the Spanish Ministry of Sciences and Education (AGL2009-14661). This work has been partly funded under the EU seventh Framework Program by the ARRAINA project No 288925: Advanced Research Initiatives for Nutrition and Aquaculture.
Biomarkers of bone development and oxidative stress in seabream larvae ………………………………………………………………………………………….. 123 Chapter 6 ----------------------------------------------------------------------------- Biomarkers of bone development and oxidative stress in gilthead seabream larvae fed microdiets with several levels of polar lipids and !–tocopherol Abstract Although dietary marine phospholipids are able to improve culture performance of marine fish larvae in a further extend than soybean lecithin, both types of phospholipids (PL) markedly increase oxidative risk. The inclusion of a fat-soluble antioxidant such as the vitamin E !-tocopherol could allow a better control of oxidative stress. The objective of the present study was to determine the combined effect of graded levels of !-tocopherol with different levels and sources of krill phospholipids (KPL) and soybean lecithin (SBL) on growth, survival, resistance to stress, oxidative status, bone metabolism related genes expresion and biochemical composition of seabream larvae. Seabream larvae were completely weanned at 16 dph and fed for 30 days seven microdiets with three different levels of PL (0, 4 and 8%) and two of !-tocopherol 1500 and 3000 mg kg-1 diet. Seabream larvae fed diets without PL supplementation showed the lowest survival, growth and stress resistance, whereas increase in PL, particularly KPL, markedly promoted larval survival and growth. However, feeding SBL markedly increased TBARs and GPX gene expression increasing the peroxidation risk in the larvae. Besides, KPL inclusion improved incorporation of n-3 HUFA and, particularly, EPA into larval tissues, these fatty acids being positively correlated to the expression of BMP-4, RUNX 2, ALP, OC and OP genes and to bone mineralization for a given larval size class. The increase in dietary !-tocopherol tend to improve growth in relation to the n-3 HUFA levels in the diet, denoting the protective role of this vitamin against oxidation. Indeed, dietary !- tocopherol decreased the oxidative stress in the larvae as denoted by the reduction in
Biomarkers of bone development and oxidative stress in seabream larvae ………………………………………………………………………………………….. 124 larval TBARs contents and gene expression of SOD and CAT, but not GPX. Thus, increase in dietary !-tocopherol effectively prevented the formation of free radicals from HUFA, particularly EPA, but did not affected the incidence of bone anomalies or the expression of genes related to osteogenetic processes. Introduction Good quality fry is essential for the further development of marine fish culture, but the success of fry high production is greatly affected by the nutritional quality of the initial larval diets (Kolkovski et al., 2009; Izquierdo et al., 2000). Dietary phospholipids are fundamental components of early weaning diets (Izquierdo, 1996; Fontagné et al., 2000; Izquierdo and Koven, 2010). Not only they are and essential constituents for cell membranes and tissues and organ development but also play an important role as energy sources (Kanazawa, 1993; Izquierdo et al., 2001). Thus, phospholipid addition to larval diets promote growth and survival and increase fish resistance to stress (Kanazawa 1993; Salhi et al., 1999; Izquierdo et al., 2001; Kjørsvik et al., 2009). In gilthead seabream (Sparus aurata), the increase in dietary soybean lecithin up to 8 % improves larval growth, promotes gut development as suggested by higher alkaline phosphatase activity, and improves dietary lipid utilization enhancing lipase and phospholipase activities (Saleh et al., 2012b). However, in their natural preys, phospholipids are rich in n-3 highly unsaturated fatty acids (n-3 HUFA) (Sargent et al., 1997) and accordingly, inclusion of phospholipids of marine origin, rich in these essential fatty acids, further improves larval performance in comparison to soybean lecithin (Betancor et al., 2012b; Saleh et al., submitted). Therefore, the dietary inclusion of 7% marine phospholipids improves seabream performance further than soybean lecithin (Saleh et al., submitted). Moreover, soybean lecithin increases the peroxidation risk causing higher larval TBARs and expression of antioxidant enzymes genes (Saleh et al., submitted). Nevertheless, increase in dietary marine phospholipids up to 9% also increased larval TBARs (Saleh et al., submitted). Lipid peroxidation, is recognized as being highly deleterious, producing toxic compounds such as fatty acid hydroxyperoxides, fatty acid hydroxides, aldehydes and hydrocarbons, resulting in damage to cellular biomembranes (Kanazawa, 1991, 1993)
Biomarkers of bone development and oxidative stress in seabream larvae ………………………………………………………………………………………….. 125 and subcellular membranes, such as those of mitochondria, causing several pathological conditions (Watanabe et al., 1970; Murai and Andrews, 1974; Sakai et al., 1989). To counteract this oxidative risk, fish have an endogenous antioxidant defence system (Filho et al., 1993), namely radical scavenging enzymes that play an important role in physiological antioxidant protection (Blazer, 1982) such as catalase (CAT) and superoxide dismutase (SOD), acting on hydrogen peroxide and superoxide, respectively, and glutathione peroxidase (GPX), which scavenges lipid hydroperoxides (Winston and Di Giulio, 1991; Halliwell and Gutteridge, 1996). Besides, !-tocopherol acts as well as an antioxidant defence factor, reducing lipid peroxidation products and free radicals (Machlin, 1984). !-tocopherol is one of the lipid soluble vitamins that are absorbed from the digestive tract in association with fat molecules and can be stored in body fat reserves. !-tocopherol is a structural component of cell membranes (Putnam and Comben, 1987), and improves the stability of tissue lipids to oxidation (Stéphan et al., 1995). Several studies have demonstrated that !-tocopherol is an essential nutrient for different fish species (Watanabe et al., 1970; Murai and Andrews, 1974; González et al., 1995). Dietary !- tocopherol and n-3 HUFA had a synergistic effect on the non-specific immune responses and disease resistance (Wang et al., 2006, Hamre et al., 1994). In marine fish larvae, feeding a high level of docosahexaenoic acid (DHA), an essential polyunsaturated fatty acid that are very susceptible to oxidation, together with a low level of !-tocopherol led to muscular lesions in sea bass larvae (Betancor et al., 20111). However, an increase in !-tocopherol or decrease in DHA level reduced the rate of muscular damage (Betancor et al., 2011). Dietary vitamin requirements of fish decrease as the age and weight of the animal increases and as the growth rate decreases (Amezaga and Knox 1990). A dietary requirement of !-tocopherol has been demonstrated as 120 mg/kg diet for Atlantic salmon (Hamre and Lie, 1995), 200 to 300 mg/kg diet for common carp (Cyprinus carpio) (Watanabe et al., 1977), 1200 mg/kg diet for gilthead seabream and 3000 mg/kg diet for gilthead seabream larvae (Ortuño et al., 2000, Atalah et al., 2011). Therefore, high levels of dietary HUFA, specially when the antioxidants compounds are not well balanced, may lead to several changes in fish, including increased intracellular reactive oxygen species (ROS) production that may ultimately damage DNA, proteins and lipids (Halliwell and Gutteridge, 1999). Also, ROS can affect the
Biomarkers of bone development and oxidative stress in seabream larvae ………………………………………………………………………………………….. 126 transcription of many genes, either acting via various transcription factors or directly as a result of oxidative damage (Di Giulio and Meyer, 2008). For instance, an excessive amount of PUFA accelerated osteoblasts differentiation when dietary vitamin A levels were low, causing supranumerary vertebrae in sea bass larvae (Villeneuve et al., 2006). Also, dietary HUFA affect the expression of numerous genes involved in cellular growth and differentiation such as Insulin Growth Factor-I (IGF-I), and some genes involved in early development of vertebrates and in osteoblast differentiation such as Bone Morphogenetic Protein (BMP4) (Cahu et al., 2009). Thus, to avoid adverse effects and improve high dietary HUFA performance, supplementation of antioxidants, such as !-tocopherol are necessary to larval diets (Betancor et al., 2011). For instance, beluga larvae fed with high LC-PUFA enriched Artemia showed a better performance in terms of growth and tolerance to salinity stress when a 20% of !-tocopherol was included in the enrichment media (Jalali et al., 2008). Similarly, Stéphan et al. (1995) reported that in vivo and in vitro oxidation of lipids in turbot larvae is reduced when dietary !-tocopherol was supplemented in the diet. The aim of the present study was to investigate the combined effect of graded levels of !-tocopherol with marine phospholipids derived from krill (KPL) or soybean lecithin (SBL) in early weaning microdiets on culture performance, resistance to stress, oxidative status and bone formation and mineralization of gilthead seabream larvae. Materials and methods Gilthead seabream larvae were obtained from natural spawnings from Instituto Canario de Ciencias Marinas (Grupo de Investigación en Acuicultura (GIA), Las Palmas de Gran Canaria, Spain). Larvae, previously fed rotifers (Brachinous plicatilis) enriched with DHA Protein Selco® (INVE, Dendermond, Belgium) until 16 dph (5.46±0.31 mm total length, 113±7 "g dry body weight), were randomly distributed in 21 experimental tanks at a density of 2100 larvae tank-1 and fed one of the diets tested in triplicate. All tanks (200 L fibreglass cylinder tanks with conical bottom and painted a light grey colour) were supplied with filtered seawater (37 ppm salinity) at an increasing rate of 0.4 - 1.0 L min-1 to assure good water quality during the entire trial. Water entered from the tank bottom and exited from the top to ensure
References …………………………………………………………………………………….......... 229 Barnabé G and Guissi A (1994) Adaptation of the feeding behavior of larvae of the sea bass, Dicentrarchus labrax L. to an altering live food/compound-food regime. Aquatic Fisheries Management 25, 537-546. Baskerville-Bridges B and Kling LJ (2000) Development and evaluation of microparticulate diets for early weaning of Atlantic cod, Gadus morhua larvae. Aquaculture Nutrition 6, 171-182. Bates JM, Akerlund J, Mittge E, and Guillemin K (2007) Intestinal alkaline phosphatase detoxifies lipopolysaccharide and prevents inflammation in zebrafish in response to the gut microbiota. Cell Host and Microbe 2, 371–382. Bell JG, Pirie BJS, Adron JW and Cowey CB (1986) Some effects of selenium deficiency on glutathione peroxidase (EC 1.11.19) activity and tissue pathology in rainbow trout, Salmo gairdneri. British Journal of Nutrition 55, 305-311. Bell JG, Cowey CB, Adron JW and Pirie BJS (1987) Some effects of selenium deficiency on enzyme activities and indices of tissue peroxidation in Atlantic salmon parr, Salmo salar. Aquaculture 65, 43-54. Bernoud N, Fenart L, Molie`re P, Dehouck MP, Lagarde M, Cecchelli R and Lecerf J (1999) Preferential transfer of 2-docosahexaenoyl-1lysophosphatidylcholine through an in vitro blood–brain barrier over unesterified docosahexaenoic acid. Journal of Neurochemistry 72, 338 – 345. Berridge MJ and Irvine RF (1989) Inositol phosphates and cell signalling. Nature 341, 197205. Betancor MB, Atalah E, Caballero MJ, Benítez-Santana T, Roo J, Montero D and Izquierdo MS (2011) !- tocopherol in weaning diets for European sea bass, Dicentrarchus labrax L. improves survival and reduces tissue damage caused by excess dietary DHA contents. Aquaculture Nutrition 17, 112-122. Betancor MB, Caballero MJ, Benítez-Santana T, Saleh R, Roo J, Atalah E and Izquierdo MS (2012a) Oxidative status and histological changes in sea bass larvae muscle in response to high dietary content of DHA. Journal of Fish Diseases, doi: 10.1111j.1365-2761.2012.01447.x. Betancor MB, Nordrum S, Atalah E, Caballero MJ, Benítez-Santana T, Roo J, Robaina L and Izquierdo MS (2012b) Potential of three new krill products for seabream larval production. Aquaculture Research 43, 395-406. Betancor MB, Caballero MJ, Terova G, Saleh R, Atalah E, Benítez -Santana, T, Gordon Bell J and Izquierdo M (2012c) Selenium inclusion decreases oxidative stress indicators and muscle injuries in sea bass larvae fed high-DHA microdiets. British Journal of Nutrition 13, 1-14. Betancor MB, Caballero MJ, Terova G, Cora S, Saleh R, Bell JG, Benítez-Santana T, Hernandez-Cruz CM and Izquierdo MS (2012d) Vitamin C enhances vitamin E status and reduces oxidative stress indicators in sea bass larvae fed high DHA microdiets. Lipids, doi: 10.1007/s11745-012-3730-x. Betancor MB (2012) Oxidative stress in sea bass, Dicentrarchus labrax L. larvae fed high DHA microdiets and its relation with several antioxidant nutrients. Ph.D., University of Las Palmas of Gran Canary, Spain.
References …………………………………………………………………………………….......... 230 Blazer VS (1982) The effect of marginal deficiencies of ascorbic acid and !-tocopherol on the natural resistance and immune response of rainbow trout Salmo gairdneri. Ph.D., University of Rhode Island. Brown KM and Arthur JR (2001) Selenium, selenoproteins and human health: a review. Public Health Nutrition 4, 593–599. Buettner GR (1993) The pecking order of free radicals and antioxidants: lipid peroxidation, ! ! tocopherol, and ascorbate. Archives of Biochemistry and Biophysics 300, 535–543. Burk RF, Trumble MJ and Lawrence RA (1980) Rat hepatic cytosolic GSH-dependent enzyme protection against lipid peroxidation in the NADPH microsomal lipid peroxidation system. Biochimica et Biophysica Acta 618, 35-41. Caballero MJ, Obach A, Rosenlund G, Montero D, Gisvold M and Izquierdo MS (2002) Impact of different dietary lipid sources on growth, lipid digestibility, tissue fatty acid composition and histology of rainbow trout, Oncorhynchus mykiss. Aquaculture 214, 253-271. Caballero MJ, Izquierdo MS, Kjørsvik E, Montero D, Socorro J, Fernández, AJ and Rosenlund G (2003) Morphological aspects of intestinal cells from gilthead seabream, Sparus aurata fed diets containing different lipid sources. Aquaculture 225, 325–340. Caballero MJ, Gallardo G, Robaina L, Montero D, Fernandez A and Izquierdo MS (2006a) Vegetable lipid sources affect in vitro biosynthesis of triacylblycerols and phospholipids in the intestine of seabream, Sparus aurata. British Journal of Nutrition 95, 448-454. Caballero MJ, Torstensen BE, Robaina L, Montero D and Izquierdo MS (2006b) Vegetable oils affect the composition of lipoproteins in seabream, Sparus aurata. British Journal of Nutrition 96, 830–839. Cahu CL and Zambonino-Infante JL (1995a) Effect of molecular form of dietary nitrogen supply in sea bass larvae: response of pancreatic enzymes and intestinal peptidases. Fish Physiology and Biochemistry 14, 209–214. Cahu CL and Zambonino-Infante JL (1995b) Maturation of the pancreatic and intestinal digestive functions in sea bass, Dicentrarchus labrax L. effect of weaning with different protein sources. Fish Physiology and Biochemistry 14, 431–437. Cahu CL, Zambonino-Infante JL, Escaffre AM, Bergot P and Kaushik S (1998) Preliminary results on sea bass, Dicentrarchus labrax L. larvae rearing with compound diet from first feeding, comparison with carp Cyprinus carpio larvae. Aquaculture 169, 1-7. Cahu CL and Zambonino-Infante J (2001) Substitution of live food by formulated diets in marine fish larvae. Aquaculture 200, 161–180. Cahu CL, Zambonino-Infante JL and Barbosa V (2003a). Effect of dietary phospholipid level and phospholipid:neutral lipid value on the development of sea bass, Dicentrarchus labrax L. larvae fed a compound diet. British Journal of Nutrition 90, 21–28. Cahu CL, Zambonino-Infante J and Takeushi T (2003b). Nutritional components affecting skeletal development in fish larvae. Aquaculture 227, 245–258.
References …………………………………………………………………………………….......... 231 Cahu C.L., Gisbert E, Villeneuve L, Morais S, Hamza N, Wold P, Zambonino-Infante JL (2009). Influence of dietary phospholipids on early ontogenesis of fish. Aquaculture Research 40, 989 – 999. Chaiyapechara S, Casten MT, Hardy RW and Dong FM (2003) Fish performance, fillet characteristics and health assessment index of rainbow trout, Oncorhynchus mykiss fed diets containing adequate and high concentrations of lipid and vitamin E. Aquaculture 219, 715-738. Chang RSL, Raymond SL, Lotti VJ, Victor J and Chen TB (1984) Cholecystokinin receptor mediated hydrolysis of inositol phospholipids in guinea pig gastric glands. Life Sciences 36, 965-971. Chen XS, Yang GQ, Chen XC, Wen ZM and Ge KY (1980). Studies on the relations of selenium and Keshan Disease. Biological Trace Elements Research 2, 91-107. Christie WW (1982) Lipid analysis. Pergamon, Oxoford. Coetzee M, Haag M, Joubert AM and Kruger MC (2007) Effects of arachidonic acid, docosahexaenoic acid and prostaglandin E2 on cell proliferation and morphology of MG-63 and MC3T3-E1 osteoblast-like cells. Prostaglandins, Leukotrienes and Essential Fatty Acids 76,35–45. Collins DA, Chambers TJ (1991). Effect of prostaglandins E1, E2, and F2a on osteoclast formation in mouse bone marrow cultures. J. Bone. Miner. Res. 6, 157–64. Cornwell DG and Parganamala RV (1993) Vitamin E in health and disease. Lester Packer and Jurgen Fuchs; eds. 1024 pages. New York: Marcel Cousin JCB, Baudin-Laurencin F and Gabaudan J (1987) Ontogeny of enzymatic activities in fed and fasting turbot, Scophtalmus maximus L. Journal of Fish Biology 30, 15–33. Coutteau P, Geurden I, Camara MR, Bergot P and Sorgeloos P (1997) Review on the dietary effects of phospholipids in fish and crustacean larviculture. Aquaculture 155, 149– 164. Cross PC and Mercer KL (1993) Blood. In: Cell and Tissue Ultrastructure: A Functional Perspective. WH Freeman and Company, New York 163–188. Curnow J, King J, Bosmans J and Kolkovski S (2006a) The effect of reduced Artemia and rotifer use facilitated by a new microdiet in the rearing of barramundi Lates calcarifer (Bloch) larvae. Aquaculture 257, 204-213. Curnow J, King J, Bosmans Partrige G and Kolkovski S (2006b) Effects of two commercial microdiets on growh and survival of barramundi (Lates calcarifer Bloch) larvae within various early weaning protocols. Aquaculture Nutrition 12, 247-255. Dabrowski K and Guderley H (2002) Intermediary metabolism. In: Halver JE and Hardy R (Eds). Fish Nutrition. Academic Press New York 309-365. Delany AM, Pash JM and Canalis E (1994) Cellular and clinical perspectives on skeletal insulin-like growth factor I. Journal of Cellular Biochemistry 55, 328–33.
References …………………………………………………………………………………….......... 232 Deplano M, Díaz JP, Connes R, Kentouri-Divanach M and Cavalier F (1991) Appearance of lipidabsorption capacities in larvae of the sea bass, Dicentrarchus labrax L. during transition to the exotrophic phase. Marine Biology 108, 361-371. Di Battista JA, Dore S, Morin N and Abribat T (1996) Prostaglandin E2 up-regulates insulinlike growth factor binding protein-3 expression and synthesis in human articular chondrocytes by a c-AMP-independent pathway: role of calcium and protein kinase A and C. Journal of Cellular Biochemistry 63, 320–33. Di Giulio RT and Meyer JN (2008) Reactive oxygen species and oxidative stress. In: Di Giulio RT and Hinton DE (Eds). The Toxicology of Fishes CRC Press Boca Raton FL USA. 273–324. Díaz ME, Furné M, Trenzado CE, García-Gallego M, Domezain A and Sanz A (2010) Antioxidant defences in the first life phases of the sturgeon Acipenser naccarii. Aquaculture 307, 123-129. Elbal MT, García-Hernández MP, Lozano MT and Agulleiro B (2004) Development of the digestive tract of gilthead seabream, Sparus aurata L. Light and electron microscopic studies. Aquaculture 234, 215-238. Evjemo JO, Reitan KL and Olsen Y (2003) Copepods and live food organisms in the larval rearing of halibut larvae, Hippoglossus hippoglossus L. with special emphasis on the nutritional value. Aquaculture 227, 191-210. FAO (1998) Planing for Aquaculture Development. ACDP/REP/89/33 Roma Italia, pp 68. FAO (1999) Manual on hatchery production of sea bass and gilthead sea bream. pp 5. FAO (2011) World aquaculture 2010. FAO Fisheries and Aquaculture Technical Paper. pp 120 FEAP (2008) Production and price reports of the member association of the F.E.A.P. 20012008. pp 17. Felton SP, Landolt ML and Grace R (1996) Effects of selenium dietary enhancement on hatchery-reared coho salmon, Oncorhynchus kisutch (Walbaum), when compared with wild coho: hepatic enzymes and seawater adaptation evaluated. Aquaculture Research 27, 135-142. Fernández-Díaz C and Yúfera M (1997) Detecting growth in Sparus aurata larvae fed microcapsules. Aquaculture 153, 93-102. Fernández-Palacios H, Izquierdo MS, Gonzalez M, Robaina L and Valencia A (1998). Combined effect of dietary a-tocopherol and n-3 HUFA on egg quality of gilthead seabream broodstock, Sparus aurata. Aquaculture 161, 475–476. Field FJ, Born E, Chen H, Murthy S and Mathur SN (1994) Regulation of Apolipoprotein A secretion by biliary lipids in CaCo-2 cells. Journal of Lipid Research 35, 749-762. Field FJ and Mathur SN (1995) Intestinal lipoprotein synthesis and secretion. Progress in Lipids Research 34,185-198. Filho DW, Giulivi C and Boveris A (1993) Antioxidative defences in marine fish:
References …………………………………………………………………………………….......... 233 Teleosts. Comparative Biochemistry and Physiology 106, 409– 413. Folch J, Lees M and Stanley GHS. (1957) A simple method for the isolation and purification of total lipids from animal tissues. The Journal of Biological Chemistry 226, 497-509. Fontagné S (1996) Effet des phospholipides alimentaires sur la structure histologique du fole et de I'Intestin de larves de carpe. Ph.D., Univ. Bordeaux (France). Fontagné S, Geurden I, Escaffre AM and Bergot P (1998) Histological changes induced by dietary phospholipids in intestine and liver of common carp, Cyprinus carpio L. larvae. Aquaculture, 161, 213–223. Fontagné S, Burtaire L, Corraze G and Bergot P (2000) Effects of dietary medium-chain triacylglycerols (tricaprylin and tricaproin) and phospholipid supply on survival, growth and lipid metabolism in common carp, Cyprinus carpio L. larvae. Aquaculture 190, 289-303. Foscarini R (1988) A review: intensive farming for red sea bream Pagrus major in Japan. Aquaculture 72, 191–246. Frankel EN (1998) Lipid oxidation. The Oily Press, Dundee, Scotland, 303 pp. Frigg M, Prabucki AL and Ruhdel EU (1990) Effect of dietary vitamin E levels on oxidative stability of trout fillets. Aquaculture 84, 145-158. Ganga R, Bell JG, Montero D, Robaina L, Caballero MJ, and Izquierdo MS (2005) Effect of dietary lipids on plasma fatty acid profiles and prostaglandin and leptin production in gilthead seabream, Sparus aurata. Comparative Biochemistry and Physiology 142, 410-418. Gangl A, Korauth W, Mlczoch J, Sulm O and Klose B (1980) Different metabolism of saturated and unsaturated long chain plasma free fatty acids by intestinal mucosa of rats. Lipids 15, 75-79. Gatlin DM, Poe WE and Wilson RP (1986) Effects of singular and combined dietary deficiencies of selenium and vitamin E on fingerling channel catfish, Ictalurus punctatus. Journal of Nutrition 116, 1061-1067. Gatta PP, Pirini M, Testi S, Vignola G and Monetti PG (2000) The influence of different levels of dietary vitamin E on sea bass, Dicentrarchus labrax L. flesh quality. Aquaculture Nutrition 6, 47-52. Gee KR, Sun WC, Bhalgat MK, Upson RH, Klaubert DH, Latham KA and Haugland RP (1999) Fluorogenic Substrates Based on Fluorinated Umbelliferones for Continuous Assays of Phosphatases and b-Galactosidases. Analytical Biochemistry 273, 41–48 . Geurden I, Coutteau P, Sorgeloos P, (1995a). Dietary phospholipids for European sea bass (Dicentrarchus labrax L.) during first ongrowing. In: Lavens P, Jaspers E and Roelants I (Eds). Larvi '95 – Fish and Shellfish symposium, Gent, Belgium. European Aquaculture Society, 24, 175–178. Geurden I, Radunz-Neto J and Bergot P (1995b) Essentiality of dietary phospholipids for carp, Cyprinus carpio larvae. Aquaculture 131, 303-314.
References …………………………………………………………………………………….......... 234 Geurden I, Charlon N, Marion D and Bergot P (1997a). Influence of purified soybean phospholipids on early development of common carp. Aquaculture International 5, 137–149. Geurden I, Coutteau P and Sorgeloos P (1997b). Effect of dietary phospholipid supplementation on growth and fatty acid composition of European sea bass, Dicentrarchus labrax L. and turbot, Scophthalmus maximus L. juveniles from weaning onwards. Fish Physiology and Biochemistry 16, 259–272. Geurden I, Marion D, Charlon N, Coutteau P and Bergot P (1998a) Comparison of different phospholipidic fractions as dietary supplements for common carp, Cyprinus carpio larvae. Aquaculture 161, 225-235. Geurden I, Bergot P, Schwarz L and Sorgeloos P (1998b). Relationship between dietary phospholipids class composition and neutral lipid absorption in postlarval turbot. Fish Physiology and Biochemistry 19, 217–228. Gisbert E, Villeneuve L, ZamboninoInfante JL, Quazuguel P and Cahu CL (2005) Dietary phospholipids are more efficient than neutral lipids for long chain polyunsaturated fatty acid supply in European sea bass Dicentrarchus labrax L. development. Lipids 40, 1–10. González MM, Izquierdo MS, Salhi M, Hernández-Cruz CM and Fernández-Palacios H (1995) Dietary vitamin E for Sparus aurata larvae. European Aquaculture Society Special Publication 24 , 239-242. Govoni JJ, Boehlert GW and Watanabe Y (1986) The physiology of digestion in fish larvae. Environmental Biology of Fishes 16, 59–77. Greene DHS and Selivonchick DP (1987) Lipid metabolism in fish. Progress in Lipid Research 26, 53-85. Gurr MI and Harwood JL (1991). Lipid Biochemistry. An introduction. 4th edition. Chapman and Hall, Londres. pp 407. Hadas E (1998) The influence of dietary phospholipids on feeding rate and absorption of fatty acids in the larvae of the gilthead seabream (Sparus aurata). MSc Thesis, Hebrew University of Jerusalem, Rehovot, Israel. Hadas E, Koven WM, Sklan D and Tandler A (2003) The effect of dietary phosphatidylcholine on the assimilation and distribution of ingested free oleic acid (18:1n-9) in gilthead seabream, Sparus aurata larvae. Aquaculture 217, 577-588. Hakeda Y, Kawaguchi H, Hand A, Pilbeam C, Hurley M, Abreu C, Kumegawa M and Raisz LG (1993) Insulin-like growth factor binding protein-5 accumulates in bone matrix and is released by parathyroid hormone and prostaglandin E. Journal of Bone and Mineral Research 8, 5237. Hall BK and Witten PE (2007) Plasticity of and transitions between skeletal tissues in vertebrate evolution and development. In: Anderson JS and Sues DH (Eds). Major transactions in vertebrate evolution. Bloominghton Indiana University Press. 56. Halliwell B and Gutteridge JM (1990) Role of free radicals and catalytic metal ions in human disease: an overview. Methods in Enzymology 186, 1-85.
References …………………………………………………………………………………….......... 235 Halliwell B and Chirico S (1993) Lipid-peroxidation-its mechanism, measurement and significance. The American Journal of Clinical Nutrition 57, S715-S725. Halliwell B and Gutteridge JMC (1996) Lipid peroxidation: a radical chain reaction. In: Halliwell B and Gutteridge JMC. Free Radicals in Biology and Medicine. Clarendon Press Oxford. 188-266. Halliwell B and Gutteridge JMC (1999) Free Radicals in Biology and Medicine. 3rd edn. Oxford Science Publication, Oxford, NY USA. 1-936. Halliwell B and Gutteridge JMC (2007) Free Radicals in Biology and Medicine, 4th Ed. Oxford University Press, New York. Halver JE (2002a) The vitamins. In: JE Halver, R Hardy (Eds) Fish Nutrition, 2nd edn. Academic Press New York NY. 62-132. Halver JE (2002b) The minerals. In: Halver JE and Hardy RW (Eds). Fish Nutrition, 3rd edition. Academic Press San Diego. 61-141. Hamre K and Lie O (1995) Minimum requirement of vitamin E for Atlantic salmon, Salmo salar L. at first feeding. Aquaculture Research 26, 175-184. Hamre K, Hjeltnes B, Kryvi H, Sandberg S, Lorentzen M and Lie Ø (1994) Decreased concentration of hemoglobin, accumulation of lipid oxidation products and unchanged skeletal muscle in Atlantic Salmon (Salmo salar ) fed low dietary vitamin E. Fish Physiology and Biochemistry 12 , 421-429. Hamre K, Berge RK and Lie O (1998) Oxidative stability of Atlantic salmon (Salmo salar L) fillet enriched in alpha-, gammaand delta-tocopherol through dietary supplementation. Food Chemistry 72, 173-178. Hamre K, Mollan TA, Sæle Ø and Erstad B (2008) Rotifers enriched with iodine and selenium increase survival in Atlantic cod, Gadus morhua larvae. Aquaculture 284, 190-195. Hamre K (2011) Metabolism, interactions, requirements and functions of vitamin E in fish. Aquaculture Nutrition 17, 98-115. Hamre K, Krossoy C, Lock EJ and Moren M (2010) Roles of lipid – soluble vitamins during ontogeny of marine fish larvae. Aquaculture Research 41, 745-750. Hamza N, Mhetli M, Ben Khemis I, Cahu C and Kestemont P (2008) Effect of dietary phospholipd levels on performance, enzyme activities and fatty acid composition of pikeperch, Sander lucioperca larvae. Aquaculture, 275, 274-282. Hardy RW (1989) Diet preparation. In Halver JE (Ed). Fish Nutrition, 2nd edn, Academic Press, San Diego CA. 476–544. Henderson RJ (1996) Fatty acid metabolism in freshwater fish with particular reference to polyunsaturated fatty acids. Arch Tierernahr 49, 5-22. Henning SJ (1987) Functional development of the gastrointestinal tract. In Johnson LR. Physiology of the Gastrointestinal Tract, New York: Raven Press. 285–300.
References …………………………………………………………………………………….......... 236 Hilton JW, Hodson PV and Slinger SJ (1980) The requirement and toxicity of selenium in rainbow trout, Salmo gairdneri. Journal of Nutrition 110, 2527–2535. Hoehne-Reitan K and Kjørsvik E (2004) Functional development of the liver and exocrine pancreas. In: J.J. Govoni (Ed). The development of form and function in fishes and the question of larval adaptation. American Fisheries Society. Symposium 40, Bethesda, Maryland. 9-36. Huang C, Lu Z, Ying L and Luhua L (2006) A continuous fluorescence assay for phospholipase A2 with nontagged lipid. Analytical Biochemistry 351, 11–17. Hung S and Lutes P (1988) A preliminary study on the non-essentiality of lecithin for hatchery-produced juvenile white sturgeon (Acipenser transmontanus). Aquaculture 68, 353-360. Iijima N, Zama K and Kayama M (1983) Effect of the oxidized lipids on the metabolic pathway of lipid biosynthesis in the intestine of carp, Ciprinus carpio. Nippon Suisan Gakkaishi 49,1465-1470. Iijima N, Nakamura M, Uematsu K and Kayama M (1990) Partial purification and characterization of Phospholipase A2 from the hepatopancreas of red sea bream. Nippon Suisan Gakkaishi 56, 1331-1339. lijima N, Tanaka S and Ota Y (1998) Purification and characterization of bile salt-activated lipase from the hepatopancreas of red seabream, Pagrus major. Fish Physiology and Biochemistry 18, 59-69. Ito T (1960). On the culture of the mixohaline rotifer, Brachionus plicatilis O.F. Muller, in sea water Rep. Fac. Fish prefect. Mie University 3, 708-740. Izquierdo MS, Watanabe T, Takeuchi T, Arakawa T and Kitajima C (1990) Optimum EFA levels in Artemia to meet the EFA requirements of red sea bream, Pagrus major. In: Takeda M and Watanabe T (Eds). The Current Status of Fish Nutrition in Aquaculture. Tokyo University of Fisheries, Tokyo. 221-232. Izquierdo MS, Arakawa T, Takeuchi T, Haroun R and Watanabe T (1992) Effect of n-3 HUFA levels in Artemia on growth of larval japanese flounder (Paralichthys olivaceous). Aquaculture 105, 73-82. Izquierdo MS (1996) Essential fatty acid requirements of cultured marine fish species. Aquaculture Nutrition 2 , 183-191. Izquierdo MS and Fernández-Palacios H (1997) Nutritional requirements of marine fish larvae and broodstock. Cahiers Options Mediterraneénnes 22, 243–264. Izquierdo MS and Henderson RJ (1998) The determination of lipase and phospholipase activities in gut contents of turbot, Scophthalmus maximus by fluorescence-based assays. Fish Physiology and Biochemstry 19, 153-162. Izquierdo MS, Socorro J, Arantzamendi L and Hernández-Cruz L (2000) Recent advances in lipid nutrition in fish larvae. Fish Physiology and Biochemistry 22, 97-107. Izquierdo MS, Tandler A, Salhi M and Kolkovski S (2001) Influence of dietary polar lipids quantity and quality on ingestion and assimilation of labelled fatty acids by larval
References …………………………………………………………………………………….......... 237 gilthead seabream. Aquaculture Nutrition 7, 153-160. Izquierdo MS, Obach A, Arantzamendi L, Montero D, Robaina L and Rosenlund G (2003) Dietary lipid sources for seabream and seabass: growth performance, tissue composition and flesh quality. Aquaculture Nutrition 9, 397-407. Izquierdo MS and Lall S (2004) Experimental design for lipid research. Workshop on Methodologies in Fish Nutrition Research. Phuket, Thailand. Izquierdo MS, Montero D, Robaina L, Caballero MJ, Rosenlund G and Ginés R (2005) Alterations in fillet fatty acid profile and flesh quality in gilthead seabrem, Sparus aurata fed vegetable oils for a long term period. Recovery of fatty acid profiles by fish oil feeding. Aquaculture 250, 431-444. Izquierdo MS (2005) Essential fatty acid requirements in Mediterranean fish species. Cahiers Options Mediterraneénnes 63, 91–102. Izquierdo MS and Koven WM (2010) Lipids. In: Holt J. (Ed). Larval Fish Nutrition. WileyBlackwell, John Wiley and Sons Publisher. 47-82 Izquierdo MS, Socorro J and Roo J (2010) Studies on the appearance of skeletal anomalies in red porgy: effect of culture intensiveness, feeding habits and nutritional quality of live preys. Journal of Applied Icthyology 26, 320-326. Izquierdo MS, Scolamachia M, Betancor MB, Roo J, Caballero MJ, Terova G and Witten PE (2012) Effects of dietary DHA and !-tocopherol on bone development, early mineralisation and oxidative stress in Sparus aurata (Linnaeus, 1758) larvae. British Journal of Nutrition doi: 10.1017/S0007114512003935. Jalali MA, Hosseini SA and Imanpour MR (2008) Effect of vitamin E and highly unsaturated fatty acid-enriched Artemia urmiana on growth performance, survival and stress resistance of Beluga (Huso huso) larvae. Aquaculture Research 39, 1286-1291. Jee WSS and Ma YF (1997) The in vivo anabolic actions of prostaglandins in bone. Bone 21, 297–304. Jilka RL, Winstein RS, Takahashi K, Parffit AM and Manologas SC (1996) Linkage of decreased bone mass with impaired osteoblastogenesis in a murine model of accelerated senescence. Journal of Clinic Investigation 97, 1732-1740. Johansson L, Gafvelin G and Arnér ESJ (2005) Selenocysteine in proteins – properties and biotechnological use. Biochimica et Biophysica Acta 1726, 1-13. Jones DA, Kamurudin MS and Levay L (1993) The potential for replacement of live feeds in larvae culture. Journal of the World Aquaculture Society 24, 191-210. Kagan VE, Tyurin VA, Gorbunov NV, Prilipko LL and Chelomin VP (1984) Are changes in the microviscosity and an asymmetrical distribution of phospholipids in the membrane necessary conditions for signal transmission? A comparison of the mechanisms of signal transmission in plasma membranes of brain synaptosomes and photoreceptor membranes of the retina. Journal of Evolutionary Biochemistry and Physiology 20, 6–11. Kanazawa A, Teshima S, Inamori S, Iwashita T and Nagao A (1981) Effect of phospholipids
References …………………………………………………………………………………….......... 238 on growth, survival rate, and incidence of malformation in larval ayu. Memoirs of the Faculty of Fisheries Kagoshima University, 30, 301–309. Kanazawa A, Teshima S, Inamori S and Matsubara H (1983a) Effect of dietary phospholipids on growth of the larval red sea bream and knife jaw. Memoirs of the Faculty of Fisheries Kagoshima University 32, 109-114. Kanazawa A, Teshima S, Kobayashi T, Takae M, Iwashita T and Uehara R (1983b) Necessity of dietary phospholipids for growth of the larval ayu. Memoirs of the Faculty of Fisheries Kagoshima University 32, 115-120. Kanazawa A (1983) Effect of phospholipids on aquatic animals. Feed Oil Abstracts 18, 1–5. Kanazawa A, Teshima S and Sakamoto M (1985) Effects of dietary bonito-egg phospholipids and some phospholipids on growth and survival of the larval ayu, Plecoglossus altivelis. Journal of Applied Ichthyology 4, 165–170. Kanazawa A (1985). Essential fatty acid and lipid requirements of fish. In: Cowey, CB, Mackie, AM, Bell, JG (Eds). Nutrition and feeding in fish. Academic Press, London. 281-289 Kanazawa A, Koshio S and Teshima S (1989) Growth and survival of larval red sea bream Pagrus major and Japanese flounder Paralichthys olivaceus fed microbound diets. Journal of the World Aquaculture Society 20, 31–7. Kanazawa A (1993) Essential phospholipids of fish and crustaceans. In: Kaushik SJ and Luquet P (Eds). Fish Nutrition in Practice. IV International Symposium on Fish Nutrition and Feeding, INRA, France. National Institute for Agricultural Research. 519–530. Kanazawa K (1991) Hepatotoxicity caused by dietary secondary products originating from lipid peroxidation. In: Friedman M (Ed). Nutritional and Toxicology Consequences of Food Processing. Plenum New York. 237–253. Kanazawa K (1993) Tissue injury induced by dietary products of lipid peroxidation. In: Corongiu F (Ed.), Free Radicals and Antioxidants in Nutrition. Richelieu Press, London. 383– 399. Kawatsu H (1969) Studies on the anemia of fish-III. An example of macrocytic anemia found in brook trout, Salvelinus fontinalis. Bulletin of the Freshwater Fish Research Laboratory 19, 161–167. Kjørsvik E, van der Meeren T, Kryvi H, Arnfinnson J and Kvenseth PG (1991) Early development of the digestive tract of cod larvae, Gadus morhua L. during startfeeding and starvation. Journal of Fish Biology 38, 1-15. Kjørsvik E (2009) Phospholipids vs. neutral lipids: effects on digestive enzymes in Atlantic cod, Gadus morhua larvae. Aquaculture 272, 502–513. Kjørsvik E, Olsen C, Wold PA, Hoehne-Reitan K, Cahu CL, Rainuzzo J, Olsen AI, Øie G and Olsen Y (2009) Comparison of dietary phospholipids and neutral lipids on skeletal development and fatty acid composition in Atlantic cod, Gadus morhua. Aquaculture 294, 246–255.
References …………………………………………………………………………………….......... 245 krill phospholipids vs soybean lecithin in microdiets for gilthead seabream (Sparus aurata) larvae on molecular markers of antioxidative metabolism and bone development. Aquaculture Nutrition submitted. Salhi M, Izquierdo MS, Hernández-Cruz CM, Socorro J and Fernández-Palacios H (1997) The improved incorporation of polyunsaturated fatty acids and changes in liver structure in larval gilthead seabream fed on microdiets. Journal of Fish Biology 51, 869 – 879. Salhi M, Hernández-Cruz CM, Bessonart M, Izquierdo MS and Fernández-Palacios H (1999) Effect of different dietary polar lipid levels and different n-3 HUFA content in polar lipids on gut and liver histological structure of gilthead sea bream, Sparus aurata larvae. Aquaculture, 179, 253–263. Sandel E, Nixon O, Lutzky S, Ginsbourg B, Tandler A, Uni Z and Koven W (2010) The effect of dietary phosphatidylcholine/phosphatidylinositol ratio on malformation in larvae and juvenile gilthead sea bream, Sparus aurata. Aquaculture 304, 42–48. Sanderson IR and Naik S (2000) Dietary regulation of intestinal gene expression. Annual Reviews Nutrition 20, 311–338. Sargent JR, Henderson RJ and Tocher DR (1989) Lipids. In: Halver JE(ed). Fish Nutrition 2nd ed, Academic Press, New York.153-218. Sargent JR, McEvoy LA and Bell JG (1997) Requirements, presentation and sources of polyunsaturated fatty acids in marine fish larval feeds. Aquaculture 155, 117-127. Sargent JR, Bell JG, McEvoy L, Tocher DR and Estevez A (1999) Recent developments in the essential fatty acid nutrition of fish. Aquaculture 177, 191–200. Sargent JR, Tocher DR and Bell JG (2002) The lipids. In: Halver JE and Hardy RW (Eds). Fish Nutrition, 3rd ed. Academic Press, San Diego. 181–257. Scaife JR, Onibi GE, Murray I, Fletcher TC and Houlihan DF (2000) Influence of ! tocopherol acetate on the shortand long-term storage properties of fillets from Atlantic salmon, Salmo salar fed a high lipid diet. Aquaculture Nutrition 6, 65-71. Schmid C, Schläpfer I, Waldvogel M, Zapf J and Froesch ER (1992) Prostaglandin E2 stimulates synthesis of insulin-like growth factor binding protein-3 in rat bone cells in vitro. Bone and Mineral Research 7,1157–63. Schwarz K and Foltz CM (1957) Selenium as an integral part of factor 3 against dietary necrotic liver degeneration. Journal of the American Chemical Society 79, 32923293. Seiliez I, Bruant JS, Zambonino-Infante JL, Kaushik S and Bergot P (2006) Effect of dietary phospholipid levels on the development of gilthead sea bream, Sparus aurata larvae fed a compound diet. Aquaculture Nutrition 12, 372-378. Sen CK (1995) Oxygen toxicity and antioxidants: state of the art. Indian Journal of Physiology and Pharmacology 39, 177-196. Simes DC, Viegas CB, Williamson MK, Price PA, Cancela L (2008) Purification of matrix Gla protein and osteocalcin from the adriatic sturgeon (Acipencer naccarii), an
References …………………………………………………………………………………….......... 246 ancient bony fish with a cartilaginous endoskeleton. Bone 42, S65. Sheridan MA (1988) Lipid dynamics in fish: aspects of absorption, transportation, deposition and mobilization. Comparative Biochemistry Physiology 4, 679-690. Sies H (1985) Oxidative stress: introductory remarks. In: Sies H (Ed). Oxidative stress. Academic Press, London 1–8. Sire MF and Vernier JM (1981) Étude ultrastructurale de la synthese de chylomicrons au cours de I'absorption intestinale des lipids chez la Truite. Influence de la nature des acides gras ingérés. Biology of the Cell 40, 47-62. Smith EL, Hill R, Lehman IR, Lefkowitz RJ, Handler P and White A (1983) Principles of Biochemistry: General Aspects. McGraw and Hill, Singapore 886. Sun D, Krishnan A, Zaman K, Lawrence R, Bhattacharya A and Fernandes G (2003) Dietary n-3 fatty acids decrease osteoclastogenesis and loss of bone mass in ovariectomized mice. Bone and Mineral Research 18, 1206–1216. Sutton J, Balfry S, Higgs D, Huang CH and Skura B (2006) Impact of iron-catalyzed dietary lipidperoxidation on growth performance, general health and flesh proximate and fatty acid composition of Atlantic salmon, Salmo salar L. reared in seawater. Aquaculture 257, 534-557. Stéphan G, Guillaume J and Lamour F (1995) Lipid peroxidation in turbot Scophtalmus maximus tissue: effect of dietary vitamin E and dietary n-6 or n-3 polyunsaturated fatty acids. Aquaculture 130 , 251-268. Tacon AGJ (1991) Standard Methods for the Nutrition and Feeding of Farmed Fish and Shrimp. The Essential Nutrients, Vol. 1. Argent Laboratories Press, Washington. Takeuchi T (1997) Essential fatty acid requirements of aquatic animals with emphasis on fish larvae and fingerlings. Review in Fisheries Science 5, 1-25. Takeuchi T, Arakawa T, Satoh S and Watanabe T (1992) Supplemental effect of phospholipids and requirement of eicosapentaenoic acid and docosahexaenoic acid of juvenile striped jack. Nippon Suisan Gakkaishi 58, 707–713. Tinggi U (2003) Essentiality and toxicity of selenium and its status in Australia: a review. Toxicology Letters 137, 103–110. Tocher DR and Harvie DG (1988) Fatty acid compositions of the major phosphoacylglycerols from fish neural tissues; n-3 and n-6 polyunsaturated fatty acids in rainbow trout (Salmo gairdneri) and cod (Gadus morhua) brains and retinas. Fish Physiology and Biochemistry 5, 229-239. Tocher DR (1995) Glycerophospholipid metabolism. In: Hochachka PW and Mommsen TP (Eds). Biochemistry and Molecular Biology of Fishes. Metabolic and Adaptational Biochemistry, vol. 4. Elsevier Press, Amsterdam 119–157. Tocher DR, Mourente G, Van der Eecken A, Evjemo JO, Díaz E, Bell JG, Geurden I, Lavens P and Olsen Y (2002) Effects of dietary vitamin E on antioxidant defence mechanisms of juvenile turbot, Scophtalmus maximus, halibut, Hippoglossus hippoglossus L. and sea bream, Sparus aurata. Aquaculture Nutrition 8, 195-207.
References …………………………………………………………………………………….......... 247 Tocher DR (2003) Metabolism and functions of lipids and fatty acids in teleost fish. Reviews in Fisheries Science 11, 107-184. Tocher DR, Bendiksen E, Campbell PJ and Bell JG (2008) The role of phospholipids in nutrition and metabolism of teleost fish. Aquaculture 280, 21–34. Tou JC, Jaczynski J and Chen YC (2007) Krill for human consumption: nutritional value and potential health benefits. Nutrition Reviews 65, 63-77. Traber MG and Parker L (1995) Vitamin E: beyond antioxidant function. The American Journal of Clinical Nutrition 62, 1505-1509. Ueberschär B (1993) Measurement of proteolytic enzyme activity: significance and application in larval fish research. In: Walther BT and Fyhn HJ (Eds). Physiological and Biochemical Aspects of Fish Development. University of Bergen, Norway 233237. UNEP/MAP/MED POL (2004) Mariculture in the Mediterranean. MAP Technical reports series n° 140, UNEP/MAP, Athens. Van Der Meeren T, Olsen RE, Hamre K and Fyhn HJ (2008) Biochemical composition of copepods for evaluation of feed quality in production of juvenile marine fish. Aquaculture 274, 375–397. Vandewalle P, Gluckmann I and Wagemans F (1998) A critical assessment of the alcian blue/alizarin double staining in fish larvae and fry. Belgian Journal of Zoology 128, 93-95. Verreth J (1994) Nutrition and related ontogenetic aspects in larvae of the african catfish, Clarias gariepinus. PhD Thesis, Wageningen Agricultural University, The Netherlands, 205 pp. In: Planas M and Cunha I (1999) Larviculture of marine fish: problems and perspectives. Aquaculture 177, 171–190. Villeneuve L, Gisbert E, Le Delliou H, Cahu CL and Zambonino-Infante J (2006) Intake of highlevels of vitamin A and polyunsaturated fatty acids during different developmental periods modifies the expression of morphogenesis genes in European sea bass (Dicentrarchus labrax ). British Journal of Nutrition 95, 677-687. Walford J, Lim TM and Lam TJ (1991) Replacing live finds with microencapsulated dietsin the rearing of seabass (Lates calcarifer) larvae: do the larvae ingest and digest protein-membrane microcapsules? Aquaculture 92, 225-235. Walford J and Lam TJ (1993) Development of digestive tract and proteolytic enzyme activity in sea bass, Lates calcarifer larvae and juveniles. Aquaculture 109, 187–205. Wang C and Lovell RT (1997) Organic selenium sources, selenomethionine and selenoyeast, have higher bioavailability than an inorganic selenium source, 246 sodium selenite, in diets for channel catfish, Ictalurus punctatus. Aquaculture 152, 223-234. Wang Z, Mai K, Liufu Z, Ma H, Xu W, Ai Q, Zhang W, Tan B and Wang X (2006) Effect of high dietary intakes of vitamin E and n-3 HUFA on immune responses and resistance to Edwarsiella tarda in Japanese flounder (Paralichthys olivaceous). Aquaculture Research 37, 681-692.
References …………………………………………………………………………………….......... 248 Watanabe T, Takashima F, Ogino C and Hibiya T (1970) Effect of !-tocopherol on carp. Nippon Suisan Gakkaishi 36, 623–630. Watanabe T, Takeuchi T, Matsui M, Ogino C and Kawabata T (1977) Effect of atocopherol deficiency on carp: VII. The relationship between dietary levels of linoleate and atocopherol requirement. Bulletin of the Japanese Society for the Science of Fish. 43, 935– 946. Watanabe T (1982) Lipid nutrition in fish. Comparative Biochemistry and Physiology 73 , 315. Watanabe T, Kitajima C and Fujita S (1983) Nutritional value of live organisms used in Japan for mass propagation of fish: a review. Aquaculture 34, 115–143. Watanabe T, Takeuchi T, Saito M and Nishimura K (1984) Effect of low protein-high caloric or essential fatty acids deficiency in diet on reproduction of rainbow trout. Bulletin of the Japanese Society of Science in Fisheries 50, 1207-1215. Watanabe T and Kiron V (1994). Prospects in larval fish dietetics, Aquaculture 124, 223–251. Watkins BA and Seifert MF (2000) Conjugated linoleic acid and bone biology. Journal of the American College of Nutrition 19, 478S–486S. Watkins BA, Li Y, Lippman HE and Feng S (2003) Modulatory effect of omega-3 polyunsaturated fatty acids on osteoblast function and bone metabolism. Prostaglandins Leukot Essent Fatty Acids 68, 387–398. Watkins BA, Li Y and Seifert MF (2006) Dietary ratio of n"6/n"3 PUFAs and docosahexaenoic acid: actions on bone mineral and serum biomarkers in ovariectomized rats. Journal of Nutritional Biochemistry 17, 282–289. Wdzieczak J, Zalesna G, Wujec E and Peres G (1982) Comparative studies on superoxide dismutase, catalase and peroxidase levels in erythrocytes and livers of different freshwater and marine fish species. Comparative Biochemistry and Physiology 73B, 361– 365. Wilson RP, Bowser PR and Poe WE (1984) Dietary vitamin E requirement of fingerling channel catfish. Journal of Nutrition 114, 2053-2058. Winston GW and Di Giulio RT (1991) Prooxidant and antioxidant mechanisms in aquatic organisms. Aquatic Toxicology 19, 137–161. Wold PA, Hoehne-Reitan K, Cahu CL, Zambonino Infante JL, Rainuzzo J and Kjørsvik E (2007) Phospholipids vs. neutral lipids: effects on digestive enzymes in Atlantic cod, Gadus morhua larvae. Aquaculture 272, 502–513. Xu H, Watkins BA and Seifert MF (1995) Vitamin E stimulates trabecular bone formation and alters epiphyseal cartilage morphometry. Calcified Tissue International 57, 293300. Yildiz M (2004) The study of fillet quality and the growth performance of rainbow trout, Oncorhynchus mykiss fed with diets containing different amounts of vitamin E. Turkish Journal of fisheries and Aquatic Sciences 4, 81-86.
References …………………………………………………………………………………….......... 249 Yu BP (1994) Cellular defenses against damage from reactive oxygen species. Physiological Reviews 74, 139-162. Yúfera M and Pascual E (1984) Influencia de la dieta sobre la puesta del rotifero Brachionus plicatilis en cultivo. Investigación Pesquera 48, 549-556. Yúfera M, Parra G, Santiago R and Carrascosa M (1999) Growth, carbon, nitrogen and caloric content of Solea senegalensis Kaup (Pisces, Soleidae) from egg fertilization to metamorphosis. Marine Biology 134, 43-49. Zambonino-Infante JL and Cahu CL (1999) High dietary lipid levels enhance digestive tract maturation and improve Dicentrarchus labrax larval development. Journal of Nutrition 129, 1195–1200. Zambonino-Infante JL and Cahu CL (2001) Ontogeny of the gastrointestinal tract of marine fish larvae. Comparative Biochemistry and Physiology 130, 477–487. Zambonino-Infante JL and Cahu CL (2007) Dietary modulation of some digestive enzymes and metabolic processes in developing marine fish: applications to diet formulation. Aquaculture 268, 98–105. Zhang H, Mu Z, Xu L, Xu G, Liu M and Shan A (2009) Dietary lipid level induced antioxidant response in Manchurian trout, Brachymystax lenok (Pallas) larvae. Lipids 44, 643–654. Zhang X, Schwartz EM, Young DA, Puzas JE, Rosier RN and O’Keefe RJ (2002) Cyclooxygenase-2 regulates mesenchymal cell differentiation into the osteoblast lineage and is critically involved in bone repair. Journal of Clinical Investigation 109, 1405–15.
University of Las Palmas of Gran Canaria, Spain 2013