Full text
Universidade do Minho Escola de Ciências Francisco Manuel de Oliveira Magalhães Metabolic engineering for the production of branched-chain fatty acids from D-xylose in Saccharomyces cerevisiae julho de 2023 Francisco Magalhães Metabolic engineering for the production of branched-chain fatty acids from D-xylose in Saccharomyces cerevisiae UMinho | 2023
Universidade do Minho Escola de Ciências Francisco Manuel de Oliveira Magalhães Metabolic engineering for the production of branched-chain fatty acids from D-xylose in Saccharomyces cerevisiae Dissertação de Mestrado Mestrado em Bioquímica Aplicada Trabalho efetuado sob a orientação de Professor Doutor Björn Fredrik Johansson Doutorando Paulo César Fernandes da Silva julho de 2023
ii DIREITOS DE AUTOR E CONDIÇÕES DE UTILIZAÇÃO DO TRABALHO POR TERCEIROS Este é um trabalho académico que pode ser utilizado por terceiros desde que respeitadas as regras e boas práticas internacionalmente aceites, no que concerne aos direitos de autor e direitos conexos. Assim, o presente trabalho pode ser utilizado nos termos previstos na licença abaixo indicada. Caso o utilizador necessite de permissão para poder fazer um uso do trabalho em condições não previstas no licenciamento indicado, deverá contactar o autor, através do RepositóriUM da Universidade do Minho. Licença concedida aos utilizadores deste trabalho Creative Commons Atribuição-NãoComercial-SemDerivações 4.0 Internacional CC BY-NC-ND 4.0 https://creativecommons.org/licenses/by-nc-nd/4.0/deed.pt
Acknowledgements First of all, I would like to thank my supervisors Professor Björn Fredrik Johansson and Paulo César Fernandes da Silva for their availability and help in carrying out this work, and also for the teachings and sharing of scientific knowledge. I would like to thank my LGM colleagues, Humberto, João, Vitor, Rosana, Alexandra, Cláudia, Inês and Faezeh for their companionship and help, and for all the moments spent. I would also like to thank all the other colleagues and technicians of the Biology Department, in particular Sr. Luís, Inês, D. Manuela and Sr. Amaro for their assistance provided in this work. And lastly, I would like to thank my family and friends for all the moral support, and for being there in the worst and best moments of my life. This work was supported by project FatVal PTDC/EAM-AMB/32506/2017 (POCI-01-0145-FEDER032506) from which I also received a three month scholarship. iii
iv STATEMENT OF INTEGRITY I hereby declare having conducted this academic work with integrity. I confirm that I have not used plagiarism or any form of undue use of information or falsification of results along the process leading to its elaboration. I further declare that I have fully acknowledged the Code of Ethical Conduct of the Universidade do Minho.
Resumo Engenharia metabólica para a produção de ácidos gordos de cadeia ramificada a partir de D-xilose em Saccharomyces cerevisiae Os ácidos gordos de cadeia ramificada (BCFAs) são um grupo específico de ácidos gordos e são produtos de grande interesse dado as recentes aplicações clínicas descobertas. Os ácidos gordos são sintetizados em vários organismos, incluindo a Saccharomyces cerevisiae. As leveduras utilizam principalmente a glucose como principal fonte de carbono. No entanto, existem outras alternativas como a xilose, que é abundante na biomassa lignocelulósica. Ainda assim, esta espécie de levedura não tem a capacidade de assimilar naturalmente a xilose. Por isso, são necessárias estratégias de engenharia metabólica para obter estirpes de levedura capazes de assimilar xilose e crescer eficientemente em meios contendo xilose. O intuito da engenharia metabólica é modificar o metabolismo celular para promover ou melhorar o consumo de substratos e a produção de metabolitos. Uma estratégia é a expressão heteróloga da via da xilose isomerase (XI) para converter a xilose em xilulose, que pode ser metabolizada pelas leveduras. Neste trabalho, estirpes de levedura foram transformadas com um plasmídeo usado como vetor de expressão contendo a cassete de expressão da XI. Além disso, integração genómica desta via foi tentada pelo método CRISPR/Cas9. Após a expressão da via XI, as leveduras foram submetidas a evolução laboratorial adaptativa para melhorar o consumo da xilose e o crescimento em meios com este açúcar. As leveduras foram também evoluídas sob depleção de nitrogénio para aumentar a acumulação de lípidos. Neste trabalho, a expressão heteróloga da via XI e a evolução adaptativa levaram ao desenvolvimento de estirpes de levedura consumidoras de xilose. A combinação de vias heterólogas para a consumo de xilose com a produção de ácidos gordos expandiria as aplicações da engenharia metabólica em leveduras, levando a um processo sustentável de produção de combustíveis e outros produtos químicos. Palavras-chave: Ácidos gordos de cadeia ramificada; D-Xilose; Engenharia metabólica; Saccharomyces cerevisiae; Xilose isomerase. v
Abstract Metabolic engineering for the production of branched-chain fatty acids from D-xylose in Saccharomyces cerevisiae Branched-chain fatty acids (BCFAs) are a specific group of fatty acids and are products of great interest since clinical applications were recently found. Fatty acids are synthesized in various organisms, including the Saccharomyces cerevisiae yeast. Yeasts uses mainly glucose as the main carbon source. Nevertheless, there are other alternatives like xylose, which is abundant in lignocellulosic biomass. However, this yeast specie does not have the ability to naturally assimilate xylose. Therefore, metabolic engineering strategies are required to obtain yeast strains capable to assimilate xylose and grow efficiently on xylose-containing media. The aim of metabolic engineering is to modify the cellular metabolism to enable or improve the substrate consumption and metabolite production. One strategy is the heterologous expression of xylose isomerase (XI) pathway to convert xylose into xylulose, which can be metabolized by yeasts. In this work, yeast strains were transformed with a plasmid used as an expression vector containing the XI expression cassette. Besides, the genomic integration of XI pathway was also attempted by the CRISPR/Cas9 method. After the expression of the XI pathway, yeasts were subjected to adaptive laboratorial evolution to improve the xylose consumption and growth on xylose-containing media. In addition, yeasts were evolved under nitrogen depletion in order to enhance the lipid accumulation. In this work, the heterologous expression of XI pathway and the adaptive evolution led to the development of xylose-consuming yeast strains. The combination of heterologous pathways for the xylose consumption with the production of fatty acids would expand the applications of metabolic engineering in yeasts, leading to an sustainable process for the production of fuels and other chemicals. Keywords: Branched-chain fatty acids; D-Xylose; Metabolic engineering; Saccharomyces cerevisiae; Xylose isomerase. vi
Table of Contents Acknowledgements iii Resumo v Abstract vi List of Abbreviations ix List of Figures xiii List of Tables xv 1 Introduction 1 1.1 Metabolic engineering of Saccharomyces cerevisiae ................. 1 1.1.1 Metabolic engineering concept . . . . . . . . . . . . . . . . . . . . . . . 1 1.1.2 Metabolic engineering in S. cerevisiae .................... 3 1.1.3 Genetic engineering strategies in yeasts . . . . . . . . . . . . . . . . . . . 4 1.2 Yeast xylose catabolism . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 6 1.2.1 Xylose catabolism . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 6 1.2.2 Xylose isomerase pathway . . . . . . . . . . . . . . . . . . . . . . . . . 8 1.3 Optimization of yeast metabolism by adaptive laboratorial evolution . . . . . . . . . . 9 1.3.1 Adaptive laboratorial evolution . . . . . . . . . . . . . . . . . . . . . . . 9 1.3.2 Adaptive evolution of yeasts for the optimization of xylose assimilation . . . . 11 1.3.3 Enhancement of lipid production by nitrogen depletion . . . . . . . . . . . 12 1.4 Fatty acid production from D-xylose in S. cerevisiae ................. 12 1.4.1 Production of acetyl-CoA from xylose . . . . . . . . . . . . . . . . . . . . 12 1.4.2 Phosphoketolase/Phosphate acetyltransferase pathway . . . . . . . . . . . 14 1.4.3 Fatty acid biosynthesis . . . . . . . . . . . . . . . . . . . . . . . . . . . 15 1.4.4 Branched-chain fatty acids . . . . . . . . . . . . . . . . . . . . . . . . . 17 1.5 Objectives ..................................... 18 vii
LIST OF FIGURES 19 Growth curves of evolved CEN.PK2-1C and IMX994 yeast strains on SX-U medium during 72hours........................................ 47 20 Overview of adaptive laboratorial evolution of two yeast strains CEN.PK2-1C and IMX994 in medium with and without drop-out . . . . . . . . . . . . . . . . . . . . . . . . . . . . 48 21 Cumulative number of generations of both evolved yeast strains CEN.PK2-1C and IMX994 cultivated with and without drop-out . . . . . . . . . . . . . . . . . . . . . . . . . . . 49 22 Growth curves of evolved CEN.PK2-1C and IMX994 yeast strains on SX-U medium during 72hours........................................ 50 23 IMX994 yeast colonies cultivated in solid YPD and SC-U media after serial passages in liquid YPD medium to induce the plasmid loss . . . . . . . . . . . . . . . . . . . . . . . . . 51 24 Spot assay analysis of parental yeast strains IMX994 and CEN.PK 2-1C, including the wildtype and the XI-expressing yeasts . . . . . . . . . . . . . . . . . . . . . . . . . . . . 53 25 Spot assay analysis of evolved IMX994 yeasts . . . . . . . . . . . . . . . . . . . . . . 53 26 Spot assay analysis of yeasts that lost the plasmid pYPK0_TDH3_805_2_ENO2 . . . . . 54 27 pYPK0_TDH3_8054_2_ENO2 plasmid map . . . . . . . . . . . . . . . . . . . . . . . 68 28 pRCC-Kplasmidmap.................................. 69 29 Schematic representation of the HXT11 locus on S. cerevisiae genome . . . . . . . . . . 70 xiv
List of Tables 1 Yeast and E. coli strains used in this experimental work . . . . . . . . . . . . . . . . . 20 2 SC-U media composition during the first ALE experiment with glucose and xylose concentrations expressed in percentage . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 23 3 PCR conditions for the xylose isomerase expression cassette amplification . . . . . . . . 25 4 Primer pairs used for pRCC-K_gDNA_HXT11 PCR amplification . . . . . . . . . . . . . 26 5 PCR conditions for the pRCC-K_gDNA_HXT11 plasmid amplification . . . . . . . . . . . 26 6 Colony PCR conditions for the xylose isomerase detection on yeasts transformed with the pYPK0_TDH3_8054_2_ENO2 plasmid . . . . . . . . . . . . . . . . . . . . . . . . . 26 7 Colony PCR conditions for the confirmation of the genomic integration of xylose isomerase expression cassette on yeasts . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 27 8 Colony PCR conditions for the detection of wild-type sequence on yeasts transformed for the XI expression cassette integration . . . . . . . . . . . . . . . . . . . . . . . . . . . . 27 9 Colony PCR conditions for the pRCC-K detection on transformant yeasts . . . . . . . . . 28 10 Time points and dilutions for the 24 h growth curves of yeasts on SX-U medium . . . . . 32 11 Time points and dilutions for the 72 h growth curves of yeasts on SX-U medium . . . . . 32 12 Number of yeast transformant colonies counted in transformation plates for yeasts transformed with the plasmid pYPK0_TDH3_8054_2_ENO2 . . . . . . . . . . . . . . . . . 34 13 Drop-out -HULT aminoacid mix composition . . . . . . . . . . . . . . . . . . . . . . . 71 14 Primers list with the nomenclature and the respective sequences . . . . . . . . . . . . . 72 xv
Chapter 1 Introduction 1.1 Metabolic engineering of Saccharomyces cerevisiae 1.1.1 Metabolic engineering concept Metabolic engineering is a practice in which the cellular metabolism is modified in order to improve the cellular activities by manipulation of enzymatic, transport, and regulatory functions of the cell (Bailey, 1991). It can be applied to various organisms including bacteria, yeast, filamentous fungi, plants, and animals. Metabolic engineering strategies are used to enable or improve the product formation, substrate consumption or to enhance cellular properties, by modification of specific metabolic pathways or introduction of new ones (Stephanopoulos et al., 1998). The metabolism is modified through genetic engineering techniques based on the use of the recombinant DNA technology. Metabolic engineering encompasses two stages of synthesis and analysis. The synthetic component involves genetic engineering strategies used to modify certain metabolic pathways in a host organism, enabling the creation of engineered strains with improved properties. These engineering strategies can include the introduction of heterologous genes, or the modification and deletion of native genes. Furthermore, the obtained engineered organisms are evaluated for their ability to consume or produce a desired metabolite. Thus, the analysis component comes with various methods to evaluate the outcome of the modifications made in the host organism. The most common analytic techniques include: DNA array technology for transcriptome analysis; two-dimensional gel electrophoresis for proteome analysis; chromatographic techniques coupled to mass spectrometry for metabolite level measurements; 13C-labelling experiments for metabolic flux analysis; advanced fermentation experiments; and bioinformatics (Ostergaard et al., 2000). Prior to the existence of genetic engineering techniques, the biotechnology relied on the natural ability of a cell to produce valuable products, and strain improvement was based on random mutagenesis and selection strategies (Wuest et al., 2011). However, the advances in genetics and molecular biology led to 1
CHAPTER 1. INTRODUCTION the emergence of genetic manipulation tools that enabled the construction of new engineered strains with improved traits. The first attempt to manipulate microbial DNA happened with the experiment done in 1973 by Stanley Cohen, Herbert Boyer and their colleagues (Cohen et al., 1973). In this experiment, they produced recombinant human insulin from bacteria through the introduction of foreign genes into bacterial cells, which allowed the transfer of genes from one organism to another. Then, it became apparent that bacteria and other microorganisms could be engineered to use genes for the overproduction of chemicals and pharmaceutical products (Woolston et al., 2013). This discovery was crucial for the appearance of the genetic engineering and it was the basis of the recombinant DNA technology. The development of that technique was essential to the beginning of metabolic engineering since it introduced a way to modify specific biochemical reactions in cells (Stephanopoulos et al., 1998). During the 1980s, researchers investigated fundamental questions of design and functioning of chemical networks. This led to the publication of the first scientific papers enumerating all possible routes connecting a substrate with a target product, the thermodynamic analysis of pathways, the distribution of kinetic control, and the design of genetic circuits to bring about a desired pattern of gene expression and product synthesis (Woolston et al., 2013). Then, the first works towards the metabolic engineering concept were published in the beginning of the 1990s by James Bailey, Gregory Stephanopoulos and Joseph Vallino (Bailey, 1991; Stephanopoulos and Vallino, 1991). These works laid the groundwork for the systematic engineering of metabolic pathways in microorganisms and established the field as an relevant area of research in biotechnology and synthetic biology. Currently, metabolic engineering has many applications, specially in bacteria and yeasts since they have historically been the easiest to study and manipulate (Wuest et al., 2011). These applications include the synthesis of new heterologous products, the increase of native product yields, and the use of less expensive feedstocks. Besides, metabolic engineering has the potential to play a significant role in promoting an environment-friendly economy. By harnessing the power of living cells and their metabolic activities, it is possible to develop more sustainable and efficient manufacturing processes for a wide range of products, including advanced biofuels and industrial chemicals (Kwak and Jin, 2017). The high selectivity and specificity of biological catalysts, including enzymes and microbial cells, is one of their main advantages. Biological catalysts are highly suited to certain chemical processes, lowering the amount of undesirable byproducts and waste that are produced by the traditional chemical synthesis, and improving the overall process efficiency (Sheldon and Woodley, 2017). Moreover, many biological reactions can be carried out at lower temperatures and pressures in comparison to the traditional chemical processes, minimizing the energy consumption required for manufacturing. This not only reduces the environmental impact of the manufacturing process, but it can also lead to cost savings and increased competitiveness. 2
CHAPTER 1. INTRODUCTION 1.1.2 Metabolic engineering in S. cerevisiae Saccharomyces cerevisiae, also known as baker’s yeast, is a eukaryotic unicellular organism belonging to the kingdom Fungi and an important model organism in biological studies. Yeasts share similarities with higher eukaryotes in cellular organization, making them a suitable model for eukaryotic organisms including humans. It has remarkable features such as rapid growth, ease of replica plating and mutant isolation, ease of genetic manipulation, and highly versatile DNA transformation system (Sherman, 2002). Besides, it is non-pathogenic and it has a great commercial availability. In addition, the S. cerevisiae genome is well-studied and it was the first eukaryotic genome to be sequenced in 1996 (Engel et al., 2014). The complete sequence of its genome is regarded as a reference to the sequences of other higher eukaryotic genes including the human ones (Meisinger et al., 2006). Yeasts has been instrumental in the production of foods and alcoholic beverages by the fermentation process for millennia (Lahue et al., 2020). However, the existence of yeasts and their role in alcoholic fermentation remained undiscovered for a long time. In the 19th century, Louis Pasteur began his work on alcoholic fermentation, in which it was established that the cause of the fermentation process is associated with vital activity exerted by yeasts (Barnett, 2003). The Pasteur’s work was a fundamental contribution to biology and it changed the understanding about fermentation. Nowadays, yeasts are still used to this process, making them a relevant object of study. Furthermore, the latest advances of genetic engineering enabled the emergence of new applications of yeasts in biotechnology (Mattanovich et al., 2014). S. cerevisiae is one of the most studied organisms and it is widely used in both fundamental research and industry. In fundamental research, yeasts are used in various fields of biology, including the study of ageing, regulation of gene expression, signal transduction, cell cycle, metabolism, apoptosis, neurodegenerative disorders, and many other biological processes (Karathia et al., 2011). Moreover, S. cerevisiae is widely used in biotechnology, specially in microbial production of recombinant proteins, chemicals, and metabolites. This is possible due to the genetic manipulation of yeasts, which is relatively easy and it has a large collection of genetic tools available (Nandy and Srivastava, 2018). Some yeast traits such as high substrate uptake rates, high metabolic rates, and resistance against various stresses, including low pH, high osmotic pressure, high alcohol concentration, and phage contamination, make this yeast specie an optimal choice for metabolite production (Kwak and Jin, 2017). Besides, due to the long history of application in the production of consumable products, S. cerevisiae has been classified as a GRAS (Generally Regarded As Safe) organism (Ostergaard et al., 2000). The improvement of yeast strains has largely been accomplished by metabolic engineering strategies. In comparison to traditional methods of genetic strain improvement such as selection, mutagenesis, mating, and hybridization, metabolic engineering is more advantageous for two reasons: the directed modification of strains without the accumulation of unfavorable mutations, and the introduction of foreign genes into S. cerevisiae that endow them with novel traits (Nevoigt, 2008). 3
CHAPTER 1. INTRODUCTION Although ethanol is the most relevant product of yeast metabolism, metabolic engineering allowed the synthesis of new products and the increase of native products yields. The most common metabolic products obtained from engineered yeasts include alcohols like butanol and isobutanol (Branduardi et al., 2013), organic acids like lactic acid and succinic acid (Porro et al., 1999; Xiberras et al., 2020), flavonoids (Wang et al., 2011), stilbenoids (Wang et al., 2011), isoprenoids (Paddon et al., 2013), polyketides (Gao et al., 2013), and penicillins (Gidijala et al., 2009). Additionally, there were attempts to develop yeasts strains for the production of fatty acids in large quantities, as well as derivatives, such as fatty alcohols (FALs), fatty acid ethyl esters (FAEEs), and alkanes (Lian and Zhao, 2015). Besides, engineered yeasts can be used for recombinant protein synthesis. For example, the human leukocyte interferon was the first recombinant protein produced by recombinant S. cerevisiae (R. A. Hitzeman et al., 1981). Other recombinant proteins, including human insulin and hepatitis B antigen, have also been produced by yeasts (Kjeldsen et al., 2001; R. Hitzeman et al., 1983). Another application of engineered yeasts is the wholecell biocatalysis. This is a process where the metabolic reactions of cells are used to carry out desired chemical reactions with the use of whole cells in bioreactors. The biochemical reactions are usually employed in intracellular medium, but secreted enzymes may also contribute to biocatalytic activity through in vivo biotransformations (Mattanovich et al., 2014). Yeasts have been used for whole-cell biocatalysts, specifically for the reduction of α-keto esters (Kratzer et al., 2008), and conversion of cephalosporins and steroids (Abad et al., 2010; Braun et al., 2012). 1.1.3 Genetic engineering strategies in yeasts The availability of tools for genetic modification is one of the key requirements of metabolic engineering (Nielsen and Keasling, 2016). The genetic modifications can include the introduction of heterologous genes encoding new metabolic pathways, deletion, mutation or overexpression of native genes in the host organism. These techniques usually involve the transformation of host organisms with recombinant DNA, or directed mutagenisis techniques. Some genetic engineering strategies in yeasts use the homologous recombination, which is a process where two similar DNA molecules exchange genetic material and it is used by cells as a repair mechanism of DNA breaks (Li and Heyer, 2008). This technique can be used to make precise changes in the genome, including the insertion and deletion of specific nucleotides or genes. Heterologous genes can be introduced through the transformation of host organisms with recombinant DNA, which is composed by the vector and the insert DNA. The insert is a heterologous gene to be expressed, and it can be isolated by fragmentation of foreign genomic DNA with restriction enzymes or amplification by the polymerase chain reaction (PCR) (Brown, 2016). Then, the heterologous gene is cloned in a host organism, using a cloning vector to replicate the recombinant DNA in the host cell. Consequently, multiple copies of the recombinant DNA, including the vector and the heterologous gene, are obtained. 4
CHAPTER 1. INTRODUCTION The cloned gene is then inserted into an expression vector and incorporated by the host organism through transformation. In S. cerevisiae, this is typically done using the PEG-LiAc-ssDNA method, where yeast cells are treated with a mixture of polyethylene glycol, lithium acetate, and a single stranded DNA carrier, in order to make them more permeable to foreign DNA (Gietz, 2014). The gene inactivation is done through insertional mutagenesis (knock-out), where a gene construction is introduced into the host organism to inhibit the expression of a specific gene (Sitnicka et al., 2010). It starts with the insertion of a DNA fragment from a vector into a targeted gene in the host DNA. This insertion causes the discontinuation of the gene and block its expression. Deletion cassettes can be used for gene inactivation, which is inserted into a vector DNA and incorporated in the host cell. Then, the cassette is integrated into the host chromosomal DNA via homologous recombination, causing the disruption of gene expression. Furthermore, strain engineering can be performed by other genome edition techniques, such as meganucleases (Paques and Duchateau, 2007), transcription activator-like effector nucleases (TALENs) (Christian et al., 2010), and zinc-finger nucleases (ZFNs) (Carroll, 2011). These technologies utilize doublestranded DNA breaks for site-directed genome edition. However, especially when multiple genetic manipulations are required, strain construction is a time-consuming and labour-intensive process (Mans et al., 2015). A recently developed method for genome editing is the CRISPR/Cas9. It offers improvements over the aforementioned methods, and it has the potential to be employed in gene therapy (Xiao-Jie et al., 2015). This method is based on a bacterial defense mechanism against viruses that consists of a DNA segment containing alternating repeating DNA sequences called CRISPR (Clustered Regularly Interspaced Palindromic Repeats). These sequences are spaced by viral DNA collected from previous phage infections (Barrangou et al., 2007). The Cas proteins cut the viral DNA at specific sequences to neutralize the virus and collect a part that is added to the CRISPR array. This mechanism enables the recognition of foreign DNA from invading viruses and gives an embedded memory of the virus infection, enabling bacteria to defend themselves against future phage invasions. The CRISPR/Cas9 system requires two components for its function, the Cas9 protein and the guide RNA (gRNA) (Mans et al., 2015). The gRNA directs the Cas9 to cut a selected region of the host genomic DNA where the guide RNA is complementary. Whereas, the Cas9 cuts the double stranded DNA at a specific location, more precisely in a region called protospacer adjacent motif (PAM). After the DNA cut, the DNA is repaired via two pathways: non-homologous end joining (NHEJ), typically leading to a random insertion or deletion of DNA; or homology directed repair (HDR), where a homologous piece of DNA is used as a repair template (Redman et al., 2016). The CRISPR/Cas9 is an efficient approach for strain construction and explores their potential for simultaneous introduction of multiple genetic modifications on yeasts. In S. cerevisiae, a plasmid expressing the Cas9 and a selected guide RNA target sequence can be introduced in yeasts through transformation (Generoso et al., 2016). This enables a simple and rapid way to introduce modifications on yeast DNA, since the Cas9 and the guide RNA are expressed on a single plasmid. 5
CHAPTER 1. INTRODUCTION 1.2 Yeast xylose catabolism 1.2.1 Xylose catabolism The traditional carbon sources used by yeasts are glucose and sucrose, which are primarily produced from cane sugar and corn starch (Mattanovich et al., 2014). Nevertheless, there are other alternative carbon sources that can be used by yeasts. The best examples are glycerol, a by-product from biodiesel production, and the main constituents of hemicellulose, xylose and arabinose (Mattanovich et al., 2014). Xylose is an aldopentose and it is the second most abundant sugar in nature after glucose, being 30-40% of the lignocellulosic biomass (Mosier et al., 2005). Since xylose is predominant in lignocellulosic materials, it is an attractive substrate for production of fuels and chemicals (Kwak and Jin, 2017). However, most microorganisms, including S. cerevisiae, are unable to metabolize xylose and use it as a carbon source. Therefore, genetic engineering approaches are required in order to enable the xylose assimilation in such organisms. Xylose assimilation requires the conversion of xylose into xylulose and subsequent phosphorylation of xylulose to xylulose-5-phosphate (Figure 1). The most widely used metabolic engineering strategies for the xylose consumption in S. cerevisiae involves the expression of heterologous genes that encode enzymes for xylose conversion. Two metabolic pathways for xylose assimilation are the xylose isomerase (XI) and the oxidoreductase (XR/XDH) pathways. In the XI pathway, xylose is directly converted into xylulose via xylose isomerase. In the oxidoreductase pathway, xylose is first reduced to xylitol via xylose reductase (XR), which is then oxidized into xylulose via xylitol dehydrogenase (XDH). Xylose reductase uses NADPH or NADH for reduction, whereas xylitol dehydrogenase only requires NAD+ for oxidation. The oxidoreductase pathway is predominant in fungi, while the xylose isomerase pathway is more common in prokaryotes (Silva et al., 2021). The enzymes XR and XDH are encoded by the genes XYL1 and XYL2, respectively, and the XI is encoded by the xylA gene (Ostergaard et al., 2000). 6
CHAPTER 1. INTRODUCTION Figure 1: Overview of glucose and xylose catabolism in S. cerevisiae. The bold lines represent the glycolytic pathway, where glucose catabolism occurs, and the xylose assimilation pathway. The remaining lines represent the PPP. Abbreviations: TCA = tricarboxylic acid cycle; Tkl1 = transketolase; Tal1 = transaldolase; Glu-6P = glucose-6-phosphate; Fru-6P = fructose-6-phosphate; Gly-3P = glyceraldehyde-3-phosphate; Ery4P = erythrose-4-phosphate; Sed-7P = sedoheptulose-7-phosphate. The XYL1,XYL2 and XKS1 genes are shown in parentheses. XR - xylose reductase; XDH - xylitol dehydrogenase; XI - xylose isomerase, XK - xylulokinase. Obtained from Ostergaard et al. (2000). Although the oxidoreductase pathway expression in S. cerevisiae provides faster xylose assimilation rates in comparison with the xylose isomerase pathway (Karhumaa et al., 2007), it is susceptible to a cofactor imbalance under anaerobic conditions (Wahlbom et al., 2001). This cofactor imbalance occurs due to the differential coenzyme preference between xylose reductase and xylitol dehydrogenase, where XR preferably uses NADPH over NADH for xylose reduction (Cunha et al., 2019). Consequently, it leads to an accumulation of xylitol that reduces the carbon assimilation and ethanol production in yeasts (Hahn-Hägerdal et al., 2007). One solution to this cofactor imbalance is to increase the activity of xylitol dehydrogenase by overexpressing the XYL2 gene (Karhumaa et al., 2007). Other strategies have been employed to solve this problem, which involve the redirection of carbon fluxes from NADPH to NADHconsuming reactions (Moysés et al., 2016). These strategies encompasses the addition of an external electron acceptor to the fermentation media (Ohgren et al., 2007), the connection of furaldehyde reduction with xylose metabolism (Almeida et al., 2009), the modification of ammonium assimilation pathway (Roca et al., 2003), the channelling of carbon fluxes through a recombinant phosphoketolase pathway in a xylose-consuming strain (Sonderegger et al., 2004), and the change of cofactor preference for the XR and XDH enzymes (Almeida et al., 2011). The development of efficient xylose-consuming yeast strains is critical to the production and commercialization of advanced biofuels and chemicals (Kwak and Jin, 2017). This has the potential to reduce the reliance on fossil fuels and to promote the production of yeast metabolic products by a sustainable and 7
CHAPTER 1. INTRODUCTION environment-friendly process. In this process, renewable feedstocks like the lignocellulosic biomass can be used, where xylose is abundant. Therefore, metabolic engineering strategies applied for the production of metabolites derived from the xylose conversion in yeasts can contribute to the implementation of a sustainable production process in a future green economy. 1.2.2 Xylose isomerase pathway The xylose isomerase is an enzyme that catalyzes the conversion of D-xylose into D-xylulose in a singlestep reaction. It belongs to the family of isomerases, specially those involved in the interconversion of aldoses and ketoses. Xylose isomerases are also referred to as glucose isomerases because of their ability to convert D-glucose into D-fructose (Singh and Kumar, 2019). Currently, this enzyme has been successfully industrialized and it has a extensive market in the food industry due its application in production of high-fructose corn syrup (Mu et al., 2018). As mentioned before, the xylose isomerase pathway is one of the metabolic routes for xylose degradation in yeasts. In S. cerevisiae, the heterologous expression of XI pathway is necessary since the xylose isomerase enzyme is not present in this yeast specie. In contrast to the oxidoreductase pathway, the XI pathway is a redox neutral reaction and does not suffer from a cofactor imbalance. For this reason, the currently most promising xylose metabolic pathways are based on the XI pathway (Silva et al., 2021). However, this metabolic pathway has been proven to be difficult to express in S. cerevisiae. Several attempts have been made, which include XIs from Escherichia coli (Briggs et al., 1984; Sarthy et al., 1987), Bacillus subtilis (Amore et al., 1989), Actinoplanes missouriensis (Amore et al., 1989), Lactobacillus pentosus (Hallborn, 1996) and Clostridium thermosulfurogenes (Moes et al., 1996). This difficulty to express the XI pathway in yeasts was attributed to several reasons, such as protein misfolding, post-translational modifications, improper disulfide bridge formation, sub-optimal internal pH, and absence of specific metal ions (Van Maris et al., 2007). The first successfully expressed XIs in S. cerevisiae were extracted from Thermus thermophilus and Piromyces sp. (Walfridsson et al., 1997; Kuyper et al., 2003). Furthermore, other XIs were expressed in yeasts, being currently fifteen which have been actively expressed (Silva et al., 2021). Among these, it is included the most recent xylose isomerase to be expressed and tested on yeasts, a novel xylose isomerase extracted from the gut of the wood feeding beetle Odontotaenius disjunctus. This new XI, denominated as 8054_2, displays higher growth rates on xylose under aerobic conditions and better kinetic properties, in comparison with its homolog from Piromyces sp.. Besides, this new XI provides 50% faster growth on xylose to yeasts, 72% higher xylose isomerization rate than the XI from Piromyces, it has 2.6 times higher specific activity, 37% higher affinity for D-xylose, and it exhibits higher activity over a broader temperature range, retaining 51% of maximal activity at 30°C, when compared with only 29% activity of the Piromyces XI (Silva et al., 2021). Therefore, this novel XI is a highly valuable addition to the yeast metabolism, enabling an efficient assimilation and conversion of xylose in S. cerevisiae. 8
CHAPTER 1. INTRODUCTION native metabolism. Whereas, in the PK/PTA pathway, the carbon is conserved and only one ATP unit is consumed. The expression of PK combined with the PTA pathway results in a enhancement of acetyl-CoA production and its derivatives. The heterologous expression of the PK pathway in a yeast strain that produce polyhydroxybutyrate (PHB), a product derived from acetyl-CoA, improved the production from 4 mg/g dry cell weight into 28 mg/g dry cell weight (Kocharin et al., 2013). The PK was also expressed in yeasts for FAEEs production, which was increased by 5.7-fold relatively to the parental yeast strain (de Jong et al., 2014). Thus, the expression of the PK/PTA pathway is an appropriate strategy to enhance the acetyl-CoA production in S. cerevisiae. Consequently, this pathway can also promote an improved production of fatty acids in yeasts, since acetyl-CoA is a precursor of the FAs biosynthesis. In addition, this pathway establishes a link between the xylose catabolism and fatty acid production, through the xylulose-5-phosphate that is obtained from the xylose conversion and it is further metabolized into acetyl-CoA by the PK/PTA pathway. 1.4.3 Fatty acid biosynthesis Fatty acids are essential macromolecules due to their roles in living organisms, acting as the building blocks of phospholipidic bilayers in cell membranes, storing energy, and signaling (Trotter, 2001). FAs can be classified in various types according to the length, bond and chain. In terms of bond type, FAs are separeted in two groups: saturated and unsaturated. Those which have solely simple bonds are saturated, while those with at least one double bond are unsaturated. Depending on the acyl-chain length, FAs have variable lengths ranging from 2 to 36 carbons (Cox and Nelson, 2021). There are four groups of FAs, including very long-chain fatty acids (VLCFAs), long-chain fatty acids (LCFAs), medium-chain fatty acids (MCFAs), and short-chain fatty acids (SCFAs). VLCFAs have an acyl-chain of 22 or more carbons and are used as food supplements (Rezanka, 1989). LCFAs have a length between 14 to 20 carbons, and are used mainly for biofuels production, specially biodiesel (Knothe, 2010). MCFAs have a chain ranging of 6 to 12 carbon molecules, whereas SCFAs have 2 to 4 carbons. Both MCFAs and SCFAs are used as precursors for biofuels and platform chemicals (Nikolau et al., 2008; Rude and Schirmer, 2009). Depending on chain type, FAs can be linear or branched, being the latter denominated as branched-chain fatty acids (BCFAs). The biosynthesis of FAs is carried out by fatty acid synthases (FAS), which can be divided into two types, FAS I and FAS II. Both FAS I and II are predominant in eukaryotes and prokaryotes, respectively (Chan and Vogel, 2010). Despite being mostly found in bacteria, FAS II can also be found in eukaryotic organelles like mitochondria and plastids (Tehlivets et al., 2007). The FAS I consists of large multifunctional polypeptides that carry all the proteins necessary for FA biosynthesis on one or two large polypeptide chains, whereas FAS II is composed by discretely expressed monofunctional proteins (Lian and Zhao, 2015). In yeasts, FA biosynthesis can occur via FAS I in the cytosol, or in mitochondria via FAS II (Hu et al., 2019). In 15
CHAPTER 1. INTRODUCTION S. cerevisiae, the FAS I comprise two subunits, α-subunit Fas2 and β-subunit Fas1. Six copies of eight independent functional domains are assembled into an α6β6 molecular complex of 2.6 MDa (Lomakin et al., 2007). FA synthesis begins with the conversion of acetyl-CoA into malonyl-CoA by acetyl-CoA carboxylase (ACC), with the cost of one ATP molecule (Figure 4). Then, malonyl-CoA:ACP transacylase transfers malonyl-CoA to the acyl carrier protein (ACP). Malonyl-ACP is generated and employed as an extender unit, combining with acyl-ACP to produce β-ketoacyl-ACP. The extended β-ketoacyl-ACP is reduced in a NADPH-dependent reaction to produce β-hydroxyacyl-ACP, which is then converted to trans-2-enoyl-ACP by the removal of a hydroxyl group. Then, the trans-2-enoyl-ACP reductase reduces the double bond in another NADPH-dependent reaction. Each elongation cycle results in the synthesis of acyl-ACP with the fatty acyl chain extended by two carbon units. The fatty acyl-CoA elongation cycle ends with the formation of palmitoyl-CoA, which is released from the FAS complex by the malonyl:palmitoyl transferase domain (MPT). The released fatty acyl-CoAs can be converted into various products, such as free fatty acids (FFAs), fatty alcohols (FALs), and fatty acid ethyl esters (FAEEs) by the enzymes thioesterase (TE), fatty acyl-CoA reductase (FAR), and wax-ester synthase (WS), respectively (Lian and Zhao, 2015). Figure 4: Overview of the fatty acid biosynthesis. Malonyl-ACP is used as the extender unit, and fatty acyl chain is extended by two carbon units after each elongation cycle including condensation, reduction, dehydration, and reduction. Obtained from Lian and Zhao (2015). 16
CHAPTER 1. INTRODUCTION Fatty acids, specifically when they are in form of free fatty acids (FFAs), are present at low concentrations, as most FAs are bound to proteins, cofactors or other functional groups (Fernandez-Moya and Silva, 2017). However, FFAs are often desired for the conversion of FAs into derivatives, which serve as biofuels and fine chemicals (Kwak and Jin, 2017). In order to produce high levels of FAs, large amounts of FA synthesis precursors, such as acetyl-CoA, ATP and NADPH, are required. This can be achieved through metabolic engineering strategies that enhance the production of these precursors. One example is the aforementioned PK/PTA pathway, which has been proven to increase the acetyl-CoA levels in S. cerevisiae, leading to an enhanced production of FAs in yeasts. 1.4.4 Branched-chain fatty acids Branched-chain fatty acids (BCFAs) are fatty acids substituted with one or more methyl branches on the linear carbon chain (Taormina et al., 2020). Usually, BCFAs have an iso structure where the FA has the branch point on the penultimate carbon atom, or an anteiso structure, in which the branch point is located on the ante-penultimate carbon atom (Figure 5). Figure 5: Structural differences between different types of FAs, including linear-chain fatty acids, and iso, anteiso, and multi-methyl branched-chain fatty acids. Obtained from Taormina et al. (2020). The biosynthesis of BCFAs initiates with the production of branched-chain α-ketoacids, including αketoisovalerate, α-keto-β-methylvalerate, and α-ketoisocaproate, which are derived from the branchedchain amino acids (BCAAs) valine, leucine and isoleucine, respectively (Figure 6). These α-ketoacid products are obtained by the removal of the BCAA amino group via transferase enzyme. Then, the α-ketoacids are subsequently decarboxylated by branched-chain-α-ketoacid dehydrogenase, producing the respective branched short-chain carboxylic acids isobutyril-CoA, isovaleryl-CoA, and 2-methylbutyril-CoA. Finally, branched short-chain carboxylic acids are elongated by the branched-chain fatty acid synthase, where malonyl-CoA acts as the chain extender in each elongation cycle. After various cycles of chain enlogation, BCFAs with iso or anteiso structures are produced. 17
CHAPTER 1. INTRODUCTION Figure 6: Biosynthetic pathways of branched-chain fatty acids. Abbreviations: BCAT, branched-chain amino acid transferase; BKD: branched-chain-α-ketoacid dehydrogenase. Obtained from Taormina et al. (2020). BCFAs are typically found in dairy products, constituting 2% of dairy fat (Taormina et al., 2020). In particular, they are abundant in ruminant animals since they are produced by the bacterial fermentation of feed in the rumen (Allison and Bryant, 1963). Besides, BCFAs are common lipidic constituents of certain groups of bacteria such as the gram-positive genera Bacillus,Streptomyces and Staphylococcus (Christie and Han, 2012). They are particularly prominent in Bacillus, constituting 95% of the FAs in many species of Bacillus and Lactobacillus (Kaneda, 1991). In addition, BCFAs are important structural lipidic constituents of bacterial cell membranes since they regulate their fluidity and permeability (Taormina et al., 2020). BCFAs are also rarely found in internal human tissues, although they are present in higher concentrations in the skin and vernix caseosa, the unique waxy white substance coating the skin of term newborns (Ran-Ressler et al., 2008). Moreover, BCFAs have potential health benefits, including improved reduced inflammation, anticarcinogenic properties, energy homeostasis, improved insulin sensitivity, and improved gut health (Taormina et al., 2020). For example, capsaicin and many related compounds, which only differ by the BCFA moiety, give to chili peppers heat and have recently found clinical applications (McCarty et al., 2015). The capsaicin biosynthesis has been engineered in S. cerevisiae, but the production of BCFAs is still to be achieved. Due to their biological effects and possible health benefits, BCFAs are a new class of FAs that have attracted the attention of scientists (Taormina et al., 2020). 1.5 Objectives The main purpose of this work is to optimize the xylose assimilation in S. cerevisiae and to rewire the metabolism towards the fatty acid biosynthesis. It is intended to establish a link between the production of fatty acids and the xylose catabolism, in which xylose is assimilated by yeasts via the xylose isomerase 18
CHAPTER 1. INTRODUCTION pathway. The ultimate goal is the improvement of the titer, rate, and yield of fatty acids, specifically branched-chain fatty acids with pharmaceutical application, through combination of additional metabolic pathways recently developed in Björn Johansson lab. In order to achieve this aim, xylose-consuming S. cerevisiae strains were constructed and characterized by performing the following tasks: • Transformation of S. cerevisiae with the xylose isomerase gene to integrate and express the XI pathway in yeasts. Two yeasts strains, CEN.PK2-1C and IMX994, were transformed with the plasmid pYPK0_TDH3_8054_2_ENO2, which is a expression vector that contains the xylose isomerase gene to be expressed. Besides, CEN.PK21-C yeasts were also transformed with the plasmid pRCCK and the xylose isomerase expression cassette, in order to integrate the xylose isomerase gene on yeasts genome by the CRISPR/Cas9 method. • Adaptive laboratorial evolution of XI-expressing yeasts to improve the xylose assimilation and growth on xylose-containing media. Yeasts were cultivated in culture media with glucose and xylose, where the concentration of xylose was gradually increased until the medium contained solely xylose and no glucose. Then, the evolved yeasts were also cultivated in two types of synthetic xylose media, one containing an aminoacid drop-out mix and another where the drop-out mix was removed to evolve yeasts under nitrogen depletion. • Cultivation of evolved yeasts in rich glucose medium for plasmid loss, in yeasts previously transformed with the plasmid pYPK0_TDH3_8054_2_ENO2. • Spot assay analysis for characterization of three groups of different types of yeasts: parental yeast strains, including wild-type and non-evolved transformed yeasts; evolved yeast strains; and yeasts without the plasmid pYPK0_TDH3_8054_2_ENO2. These yeast strains were tested in various cultures, such as glucose and xylose synthetic complete media without uracil, synthetic defined xylose medium, and rich xylose medium. 19
Chapter 2 Materials and Methods 2.1 Yeast and bacterial strains In this experimental work, three S. cerevisiae strains were used: CEN.PK113-5D, CEN.PK2-1C and IMX994. The strains CEN.PK2-1C and IMX994 were used during all experimental work, while CEN.PK1135D was used as a positive control for a colony PCR. The CEN.PK113-5D and CEN.PK2-1C strains belong to the CEN.PK family. Both CEN.PK strains are auxotrophic to uracil, and the CEN.PK2-1C strain is also auxotrophic for the aminoacids histidine, leucine and tryptophan (Entian and Kötter, 2007). IMX994 is a yeast strain that is derived from the CEN.PK113-5D yeast strain that expresses a S. pyogenes Cas9 (Mans et al., 2015). Besides, the IMX994 strain has the non-oxidative pentose phosphate pathway genes overexpressed, which are inserted in the aldose reductase locus (Papapetridis et al., 2018). In addition, the E. coli strain XL1-Blue was used specially for plasmid DNA extraction and transformation. This strain has the selective marker AmpR, which gives antibiotic resistance to ampicillin. All microbial strains used in this work and their respective relevant features are listed in table 1. Table 1: Yeast and E. coli strains used in this experimental work. Specie Strain Genotype Source S. cerevisiae CEN.PK113-5D MATa ura3-52 MAL2-8c SUC2 Entian and Kötter, 2007 S. cerevisiae CEN.PK2-1C MATa ura3-52 his3-𝛥1 leu2-3,112 Entian and Kötter, 2007 trp1-289 MAL2-8c SUC2 S. cerevisiae IMX994 MATa ura3-52 MAL2-8c SUC2 Papapetridis et al., 2018 can1::cas9-natNT2, gre3::RPE1, TKL1, TAL1, RKI1, XKS E. coli XL1-Blue recA1 endA1 gyrA96 thi-1 Stratagene hsdR17 supE44 relA1 lac [F´ proAB lacIqZ𝛥M15 Tn10 (Tetr)] 20
CHAPTER 2. MATERIALS AND METHODS 2.2 Plasmids In this work, two plasmids were used, pYPK0_TDH3_8054_2_ENO2 and pRCC-K. The plasmid maps are represented in Appendix A. The plasmid pYPK0_TDH3_8054_2_ENO2 is a pYPK0 expression vector that contains the xylose isomerase expression cassette (TDH3_8054_2_ENO2), which is composed by the promoter TDH3, the xylose isomerase gene 8054_2, and the terminator ENO2. This plasmids contains the selection marker URA3, which enables the selection of transformant cells with this plasmid in uracil auxotrophic culture media. Besides, it also contains the AmpR marker, enabling the cultivation and selection of cells with this plasmid in selective media with ampicillin. The 8054_2 is the xylose isomerase gene extracted from the gut of the wood feeding beetle Odontotaenius disjunctus (Silva et al., 2021). The plasmid pRCC-K is a CRISPR/Cas9 plamsid that expresses the Cas9 protein and has the sequence for the guide RNA scaffold, where a specific DNA target sequence with usually around 20 nucleotides in length can be inserted to determine the location of the Cas9 DNA cut (Generoso et al., 2016). The guide RNA expression cassette consists of a SNR52 promoter sequence, the gRNA scaffold, and the CYC1 terminator. The specific gRNA target sequence is chosen to be complementary to a specific DNA sequence of interest where the DNA will be cut. In this case, the gRNA was designed to specify the Cas9 break in the upstream region of the HXT11 gene (Appendix B), using the web tool ATUM (https://www.atum.bio/eCommerce/cas9/input). For the insertion of the target sequence on pRCC-K plasmid, the plasmid was amplified in three fragments by PCR to obtain the plasmid pRCCK_gDNA_HXT11. This plasmid contains the DNA sequence that encodes the specific target sequence of the gRNA (5’-CACGAACAATGCATACACTC-3’). For this, three primer pairs were used to amplify three plasmid fragments, including the primer pairs 1646/253, 473/576, and 196/1645. The primers 1645 and 1646 contain the reverse and forward nucleotide sequences of the gRNA-coding DNA target, respectively. Furthermore, the amplified plasmid fragments share homologous ends so that the plasmid parts can be assembled by homologous recombination, generating the plasmid pRCC-K_gDNA_HXT11. After the plasmid amplification, the three resulting fragments were treated with the restriction enzyme DpnI for enzymatic digestion, in order to get rid of any remaining template plasmid in the PCR samples. The pRCC-K plasmid has the selection marker KanR, which gives antibiotic resistance to geneticin. Thus, the selection of yeast transformants with this plasmid was done with rich glucose medium with geneticin. This plasmid also has the AmpR selection marker, enabling the bacterial transformation in selective media with ampicillin. 21
CHAPTER 2. MATERIALS AND METHODS 2.3 Culture media and growth conditions During this experimental work, various cultures were used for different purposes. All yeast solid cultures were prepared in Petri dishes and incubated at 30ºC. The yeast liquid cultures were also incubated at 30ºC and with agitation in a rotatory shake of 200 revolutions/minute (rpm). The pre-cultures were prepared using Falcon tubes, whereas the growth cultures were prepared in glass tubes or Erlenmeyer flasks. In the case of E. coli cultures, they were prepared using the same materials and conditions, but the incubation temperature used was 37ºC. For short-term storage, microbial solid cultures were prepared and stored in the fridge at 4ºC. Yeast cultures were maintained in solid rich glucose medium (YPD; 2% glucose, 2% peptone, 1% yeast extract, and 2% agar), while E. coli cultures were cultivated in solid lysogeny broth with ampicilin (LB-Amp; 1% NaCl, 1% yeast extract, 2% peptone, 2% agar, and 100 µg/mL Ampicilin). For long-term storage, fresh overnight cultures of each microbial culture were added to 25% glycerol in equal volume and stored in cryogenic vials at -80ºC in the deep freezer. Yeasts were cultivated in liquid rich glucose medium (YPD; 2% glucose, 2% peptone, and 1% yeast extract), whereas E. coli cultures were prepared with liquid lysogeny broth with ampicilin (LB-Amp; 1% NaCl, 1% yeast extract, 2% peptone, and 100 µg/mL Ampicilin). For plasmid DNA extraction, E. coli cells were cultivated in liquid lysogeny broth (LB-Amp; 1% NaCl, 1% yeast extract, 2% peptone, and 100 µg/mL Ampicilin). In yeasts, the cells were cultivated and grown in liquid rich glucose medium (YPD; 2% glucose, 2% peptone, and 1% yeast extract). Before yeast transformation, yeasts were cultivated in pre-cultures of liquid rich medium (YPD; 2% glucose, 2% peptone, and 1% yeast extract). For transformant selection, yeasts were cultivated in two solid media, rich medium supplemented with geneticin (YPD+G418; 2% glucose, 2% peptone, 1% yeast extract, and 2% agar + 200 µg/mL geneticin) and synthetic complete medium without uracil (SC-U; 2% glucose, 0.67% yeast nitrogen base (YNB) + 0.07% amino acid dropout mix, 50 mM potassium hydrogen phtalate, 2% agar, 80 mg/L tryptophan, 80 mg/L histidine, 80 mg/L leucine). Yeasts transformed with the pYPK0_TDH3_8054_2_ENO2 plasmid were cultivated in SC-U, while yeasts transformed with the pRCC-K_gDNA_HXT11 plasmid were cultivated in YPD+G418. Before E. coli transformation, cells were cultivated in pre-cultures of liquid LB-Amp medium (1% NaCl, 1% yeast extract, 2% peptone, and 100 µg/mL Ampicilin). For the recovery of transformed E. coli cells, super optimal broth with catabolite repression medium (SOC; 2% tryptone, 0.5% yeast extract, 10 mM NaCl, 2.5 mM KCl, 10 mM MgCl2, 10 mM MgSO4, and 20 mM glucose) was added to the transformation mix. For E. coli transformant selection, plates with solid LB-Amp (LB-Amp; 1% NaCl, 1% yeast extract, 2% peptone, 2% agar, and 100 µg/mL Ampicilin) were used. Before the ALE experiments, the transformed yeasts were cultivated in pre-cultures of liquid synthetic complete medium without uracil (SC-U; 2% glucose, 0.67% YNB + 0.07% amino acid dropout mix, 50 mM potassium hydrogen phtalate, 80 mg/L tryptophan, 80 mg/L histidine, 80 mg/L leucine), in which the 22
CHAPTER 2. MATERIALS AND METHODS pH was adjusted to 5.5 with addition of 5M and 1M NaOH drops. The pH of culture media was measured by a pH electrode at room temperature. Then, in the first ALE experiment, yeasts were cultivated in liquid synthetic complete media (SC-U; 0.67% YNB + 0.07% amino acid dropout mix, 50 mM potassium hydrogen phtalate, 80 mg/L tryptophan, 80 mg/L histidine, 80 mg/L leucine, pH = 5.5) with initial concentrations of 0.5% glucose and 1.5% xylose. The glucose/xylose ratio was changed during the ALE experiment, in accordance with the table 2. In the second evolution experiment, yeasts were cultivated in synthetic media without uracil (0.67% YNB without amino acids, 0.07% amino acid dropout mix, 50 mM potassium hydrogen phtalate, 80 mg/L tryptophan, 80 mg/L histidine, 80 mg/L leucine, pH = 5.5), with and without drop-out. The drop-out is an aminoacid mix, which its composition is presented in table 13 (Appendix C). All previously evolved yeast strains were initially cultivated in culture media with 0.25% glucose + 1.75% xylose. Then, yeast cells were transferred to culture media with 1.9 % xylose + 0.1 % glucose with and without drop-out. Afterwards, yeast cells were cultivated to cultures with solely xylose (2%) until the end of the evolution experiment. After the evolution experiment, the evolved yeasts were cultivated in solid synthetic xylose medium without uracil (SX-U; 2% xylose, 0.67% YNB + 0.07% amino acid dropout mix, 50 mM potassium hydrogen phtalate, 2% agar, 80 mg/L tryptophan, 80 mg/L histidine, 80 mg/L leucine, pH = 5.5). Table 2: SC-U media composition during the first ALE experiment with glucose and xylose concentrations expressed in percentage. Concentration (%) Glucose 0.5 0.25 0.1 0 Xylose 1.5 1.75 1.9 2 For the growth curves, yeast cultures were cultivated in liquid synthetic xylose medium without uracil (SX-U; 2% xylose, 0.67% YNB + 0.07% amino acid dropout mix, 50 mM potassium hydrogen phtalate, 80 mg/L tryptophan, 80 mg/L histidine, 80 mg/L leucine, pH = 5.5). Before the growth curves, yeasts were cultivated in pre-cultures of liquid synthetic complete medium (SC-U; 2% glucose, 0.67% YNB + 0.07% amino acid dropout mix, 50 mM potassium hydrogen phtalate, 80 mg/L tryptophan, 80 mg/L histidine, 80 mg/L leucine, pH = 5.5). For plasmid loss, previously evolved yeast cells were cultivated in liquid rich medium (YPD; 2% glucose, 2% peptone, and 1% yeast extract). In order to select the yeasts that lost the plasmid, yeast cells were transferred in solid rich medium (YPD; 2% glucose, 2% peptone, 1% yeast extract, and 2% agar). Then, yeast colonies were isolated and re-transferred to two culture media, solid rich medium (YPD; 2% glucose, 2% peptone, 1% yeast extract, and 2% agar) and synthetic xylose medium without uracil (SX-U; 2% xylose, 0.67% YNB + 0.07% amino acid dropout mix, 50 mM potassium hydrogen phtalate, 2% agar, 80 mg/L tryptophan, 80 mg/L histidine, 80 mg/L leucine, pH = 5.5). Before the spot assay experiments, yeast cells were cultivated in pre-cultures of liquid rich medium 23
CHAPTER 2. MATERIALS AND METHODS (YPD; 2% glucose, 2% peptone, and 1% yeast extract). During the spot assay analysis, four culture media were used: synthetic complete medium without uracil (SC-U; 2% glucose, 0.67% YNB + 0.07% amino acid dropout mix, 50 mM potassium hydrogen phtalate, 2% agar, 80 mg/L tryptophan, 80 mg/L histidine, 80 mg/L leucine, pH = 5.5); synthetic xylose medium without uracil (SX-U; 2% xylose, 0.67% YNB + 0.07% amino acid dropout mix, 50 mM potassium hydrogen phtalate, 2% agar, 80 mg/L tryptophan, 80 mg/L histidine, 80 mg/L leucine, pH = 5.5); synthetic defined xylose medium (SDX; 2% xylose, 0.67% YNB without amino acids, 50 mM potassium hydrogen phtalate, 40 mg/L uracil, 2% agar, pH = 5.5); and rich xylose medium (YPX; 2% xylose, 2% peptone, 1% yeast extract, and 2% agar). 2.4 Plasmid DNA extraction The plasmid DNA was extracted from E. coli cultures using the NZYTech Miniprep kit. For the plasmid extraction, fresh E. coli cells were cultivated in 10 mL of liquid culture LB-Amp in 50 mL Falcon tubes. Then, the cultures were incubated overnight at 37 ºC. In the next day, the cultures were centrifuged for 30 seconds, the supernatant was removed and discarded, and the pellet was resuspended in 500 µL of buffer A1 (resuspension buffer with RNase) by vortexing. The cells were then lysed by adding 500 µL of buffer A2 (lysis buffer) and mixing by inverting the tube 6-8 times. Following a 4-minute incubation, 600 µL of buffer A3 (neutralization buffer) was added to the lysate and mixed by inverting again the tube 6-8 times. The lysate was then centrifuged for 10 minutes, and the resulting supernatant transferred to a spin column and centrifuged for 1 minute at 11000 g. With the flow-through discarded, 500 µL of pre-warmed buffer AY (wash buffer) was then added to the spin column and centrifuged for 1 minute. The flow-through was discarded again and 600 µL of buffer A4 (wash buffer with ethanol) added to the column, before being centrifuged for 1 minute. After discarding the flow-through, the columns were dried by centrifugation for 2 minutes. The spin column was then transferred to an empty 1.5 mL microcentrifuge tube and 50 µL of buffer AE (elution buffer) was added. After 1 minute of incubation at room temperature, the tubes were centrifuged for 1 min at 12000 g. Finally, the tubes with purified plasmid DNA were stored at -20 ºC in the freezer for further utilization. The plasmid extraction in S. cerevisiae followed the same protocol used in bacterial plasmid DNA extraction. However, it was used an extra step before the extraction, where cells were subjected to disruption by mechanical lysis. For this, yeast cells were first cultivated in YPD pre-cultures of 10 mL, and glass beads were added to the culture for cell disruption. The cell lysis was carried out using a disruptor during 5 minutes and with maximum rotation (5000 rpm). After plasmid extraction, the extracted plasmid DNA was quantified and the DNA purity was measured by Nanodrop. The DNA purity was determined based on absorbance ratios at 260/280 nm and 260/230 nm (Lucena et al., 2016). 24
CHAPTER 2. MATERIALS AND METHODS collected to measure the OD value in the spectrophotometer, with a dilution of 1:20. Each batch culture was inoculated with yeast cells to a OD = 0.05, and yeast cells were successively transferred to new batches by serial passages over the evolution experiment. Yeast cells were cultivated in glass tubes with 3 mL of culture media, where the concentration of xylose was gradually increased. Initially, the first two serial batches had concentrations of 0.25% glucose and 1.75% xylose. Then, yeast cells were transferred to new batch cultures with 1.9 % xylose + 0.1 % glucose in the next two transfers. From the fifth transfer, yeast cells were cultivated in medium with 2% xylose and no glucose until the end of this evolution experiment. The evolution was performed over 33 days and ended after 11 successive transfers for CEN.PK2-1C and IMX994 yeasts cultivated in medium with drop-out, and 6 transfers for CEN.PK2-1C cells and 11 transfers for IMX994 in medium without drop-out. 100 µL samples of evolved yeast cells were plated in solid SX-U media, with dilutions of 10-3 and 10-4. The SX-U plates were incubated at 30ºC during 4 days. At the end, the evolved yeast cells were re-transferred to a new solid SX-U media and stored at 4ºC in the fridge for short-time storage, and stored at -80ºC in the deep freezer for long-therm storage. 2.11 Growth curves For the first growth curves, yeast cells were cultivated in SX-U medium to test the growth of yeasts on xylose. The first growth curves were obtained for the previous transformed yeast strains, including evolved and non-evolved yeasts. For these growth curves, three yeast colonies from each yeast strain, CEN.PK2-1C and IMX994, were used as three biological replicates. Yeasts cells were cultivated in pre-cultures of 10 mL SC-U media on Falcon tubes. Then, the pre-cultures were incubated at 30ºC overnight. In the next day, 1 mL of yeast pre-cultures were collected and transferred to a cuvette to measure the OD value at 600 nm with a spectrophotometer, with a dilution of 1:20. Each yeast growth culture was inoculated with yeast cells to a OD = 0.1. Before the inoculation of the growth cultures, 10 mL of SX-U medium was added in 100 mL Erlenmeyer flasks, and then, the culture media were pre-warmed at 30ºC. Yeast cells were cultivated in these cultures and incubated at 30ºC for growth. The OD values of yeast cultures were measured using the spectrophotometer during 24 hours, in the following time points: 0, 2, 4, 5, 6, 7, 8, and 24 h. For absorbance measurements, dilutions of 1:1 (without dilution), 1:5, 1:10, and 1:20 for each time point were made (Table 10). 31
CHAPTER 2. MATERIALS AND METHODS Table 10: Time points and dilutions for the 24 h growth curves of yeasts on SX-U medium. Time (Hour) Dilution factor 0 No dilution 2 No dilution 4 No dilution 5 1:5 6 1:5 7 1:10 8 1:10 24 1:20 Furthermore, growth curves for the evolved CEN.PK2-1C and IMX994 yeasts were obtained for 72 hours, with three technical replicates for each yeast strain. Yeast cells were first cultivated in SC-U precultures of 5 mL, in 50 mL Falcon tubes. Then, the pre-cultures were incubated overnight at 30ºC, and the OD values of each pre-culture were measured. Each growth culture was inoculated with yeast cells to a OD of 0.05. The cultures were prepared in glass tubes with 7 mL of SX-U medium, and they were then pre-warmed at 30ºC. Then, yeast cells were cultivated in SX-U culture media and incubated at 30ºC. The OD values of yeast growth cultures were measured in the time points and with the respective dilutions presented in table 11. Table 11: Time points and dilutions for the 72 h growth curves of yeasts on SX-U medium. Time (Hour) Dilution factor 0 No dilution 12 1:5 16 1:5 20 1:10 24 1:10 36 1:20 40 1:20 44 1:20 48 1:20 60 1:50 64 1:50 68 1:50 72 1:50 Additionally, another growth curves were also obtained after the second ALE experiment, where yeasts were evolved in synthetic xylose media with and without drop-out. Two isolated colonies from each evolved CEN.PK2-1C and IMX994 strains were cultivated in SX-U medium for growth. These growth curves were obtained using the same procedure previously used, as well as the same time points and the respective dilutions presented in table 11. In this case, the growth curves were obtained using two technical replicates 32
CHAPTER 2. MATERIALS AND METHODS for each isolated yeast colony, giving a total of four replicates for each yeast strain. 2.12 Plasmid loss in yeasts Yeast cells from the previously evolved IMX994 yeasts were cultivated in YPD medium for plasmid loss in yeasts previously transformed with the plasmid pYPK0_TDH3_8054_2_ENO2. Yeast cells that were previously stored in SX-U media plates at 4ºC were transferred to 5 mL of YPD media in 50 mL Falcon tubes. Then, the yeast cultures were incubated overnight at 30ºC. In the next day, the OD values of yeast cultures was measured by the spectrophotometer, with a 1:20 dilution. 10 µL of each culture was transferred to a new YPD culture and incubated overnight at 30ºC, and this process was repeated three times, making three serial passages of yeast cells in liquid YPD medium. At the end, 10 µL of yeast cultures were plated in solid YPD medium, with dilutions of 10-3 and 10-4. Then, the cultures were incubated at 30ºC overnight. After 3 days, yeast colonies were obtained, and 12 colonies from each yeast culture were transferred to solid YPD and SC-U media. Afterwards, the cultures were incubated overnight at 30ºC for 3 days. Then, the plates were visualized and photographed in the GenoView/GenoSmart UV transilluminator. Finally, the plates were stored in the fridge at 4ºC. 2.13 Spot assay analysis For spot assay analysis, three groups of different types of yeasts were used: CEN.PK2-1C and IMX994 parental strains, evolved yeast strains, and yeasts without the plasmid pYPK0_TDH3_8054_2_ENO2. Initially, yeast cells were cultivated in 5 mL of YPD pre-cultures in 50 mL Falcon tubes, and they were then incubated overnight. In the next day, all pre-cultures were grown and centrifuged at 5000 rpm during 5 minutes to obtain the pellet. Then, the supernatant was discarded and 5 mL of sterile distilled water was added for washing the cells. The cultures were centrifuged again in same conditions, the supernatant discarded, and the pellets were resuspended in sterile water. After resuspension, the OD value at 600 nm of cell suspensions was measured using the spectrophotometer, with a dilution of 1:20. The yeast cells from pre-cultures were then transferred for inoculation in YPD medium to a OD = 1. Each yeast strain culture was diluted with four serial dilutions of 10-1, 10-2, 10-3, and 10-4, using sterile Eppendorff tubes. Then, yeast cells were plated in four solid culture media: SC-U, SX-U, SDX and YPX. For each plate, four strains were tested with five spots corresponding to serial dilutions of 100to 10-4. The spot assays were carried out in sterile conditions with the use of a flux chamber. Then, the plates were incubated at 30ºC for 3 days. Finally, the plates were observed, photographed and visualized in the GenoView/GenoSmart UV transilluminator. The plates were observed 3 days after the inoculation of yeast cells in culture media. 33
Chapter 3 Results and Discussion 3.1 Expression of xylose isomerase pathway in S. cerevisiae 3.1.1 Expression of xylose isomerase in yeasts with the pYPK0_TDH3_8054_2_ENO2 plasmid The first step of this experimental work was the heterologous expression of the xylose isomerase pathway in S. cerevisiae. In order to accomplish that, two S. cerevisiae strains, CEN.PK2-1C and IMX994, were transformed with the plasmid pYPK0_TDH3_8054_2_ENO2. This plasmid contains the xylose isomerase expression cassette (TDH3_8054_2_ENO2), in which the TDH3 is the promoter, 8054_2 is the xylose isomerase gene, and ENO2 is the terminator. Before the transformation, the pYPK0_TDH3_8054_2_ENO2 plasmid was extracted from E. coli cells from the lab collection, which were previously transformed with this plasmid. After plasmid extraction, both yeast strains were tranformed with 1 µL of the extracted plasmid DNA. For the selection of transformants, yeasts were cultivated in solid synthetic complete medium without uracil (SC-U). For each transformation, dilutions of 1:1, 1:10 and 1:100 were made. In addition, negative controls were included, where yeasts were transformed with solely sterile water. Then, the transformed cells were plated in the SC-U media, and after 3 days of incubation at 30ºC, the number of colonies in each plate was counted (Table 12). The transformation resulted in 245, 24 and 2 CEN.PK2-1C colonies, and 153, 15 and 1 IMX994 colonies, for the plates with dilutions of 1:1, 1:10 and 1:100, respectively. Table 12: Number of yeast transformant colonies counted in transformation plates for yeasts transformed with the plasmid pYPK0_TDH3_8054_2_ENO2. The plates are represented according to the respective dilutions of 1:1, 1:10 and 1:100. Cis the negative control transformation plate. Plates Strain 1:1 1:10 1:100 CCEN.PK2-1C 245 24 2 0 IMX994 153 15 1 0 34
CHAPTER 3. RESULTS AND DISCUSSION After the transformation, 10 colonies from each transformant yeast strain were picked and transferred to a new plate SC-U. Then, these yeast colonies were tested by colony PCR, in order to confirm the presence of the pYPK0_TDH3_8054_2_ENO2 plasmid. For this, the primers 1287 and 1341 were used to amplify the XI expression cassette contained on the plasmid. The resulting PCR samples were loaded onto an agarose gel and an image of the gel was acquired (Figure 9). Almost all yeast colonies, including the positive controls, had a band with a size between 500 and 750 bp, which is approximately the expected size of the PCR product (685 bp). Since the xylose isomerase gene was detected in almost all transformant colonies, the transformation of yeasts with the plasmid containing the xylose isomerase expression cassette was confirmed, and then, the transformation was successful. As the pYPK0_TDH3_8054_2_ENO2 plasmid was incorporated by transformant yeasts, they can express the XI pathway. Nevertheless, although the expression of xylose isomerase gene is required for yeasts to metabolize xylose, it is not sufficient for yeasts to carry out an efficient conversion of xylose and growth on xylose-containing media (S.-M. Lee et al., 2012). Therefore, the adaptive laboratorial evolution is still necessary to improve the XI-expressing yeasts growth on xylose. For this, three transformant colonies of each yeast strain were selected for the ALE experiment. Figure 9: Image of agarose gel of colony PCR amplification for the XI expression cassette detection on yeasts transformed with the pYPK0_TDH3_8054_2_ENO2 plasmid. Each letter represent a gel lane, where M represents the molecular weight marker (Generuler 1 kb DNA Ladder [TermoFisher]), I (I1I10) represents the IMX994 colonies, C (C1-C10) represents the CEN.PK2-1C colonies, + represents the positive controls, and - is the negative control. Almost all transformant yeast colonies, except the colonies I8, I10, and C9, had a visible band with a size of approximately 685 bp. 3.1.2 Genomic integration of xylose isomerase on S. cerevisiae by CRISPR/Cas9 The heterologous expression of any gene via an expression vector like a plasmid is an optimal strategy for genetic engineering in yeasts. However, a drawback associated with the use of plasmids for heterologous gene expression is the lack of stability. The reason for this is the fact that a plasmid requires the cultivation of transformed cells in selective media, with either antibiotic or auxotrophic selection, and it can easily 35
CHAPTER 3. RESULTS AND DISCUSSION be lost if the selection factor is removed. When the transformed yeasts are cultivated in non-selective media, yeasts cells can lose the plasmid after various cell divisions, and then, the gene expression is also lost. The genomic integration of the xylose isomerase gene could led to a more stable expression of the XI pathway on yeasts, and it would allow the cultivation of engineered yeasts without the need of a selective pressure. In this way, the expression of the XI pathway in yeasts would be maintained after various cell divisions in any yeast culture media. Given that, the genomic integration of xylose isomerase gene on yeasts genome was attempted by the CRISPR/Cas9 technique. In this method, the plasmid pRCC-K was used to deliver the the Cas9 and the guide RNA (Generoso et al., 2016). In this case, it was designed a gRNA sequence that directs the Cas9 cut into the upstream region of the HXT11 gene (Figure 29 - Appendix B). However, the pRCC-K plasmid itself does not express the gRNA required to direct the DNA break to the desired location. Therefore, this plasmid was amplified in three parts by PCR using the three primer pairs 1646/253, 473/576, and 196/1645 (Figure 28 - Appendix A). Then, these three fragments were assembled to generate the plasmid pRCC-K_gDNA_HXT11. The gRNA-coding DNA was inserted in the plasmid by amplification using the primers 1645 and 1646 with the corresponding overhangs. Furthermore, the pRCC-K_gDNA_HXT11 fragments share homologous ends between them to allow the assembly of the plasmid fragments by homologous recombination. Thus, the three amplified fragments of the plasmid pRCC-K_gDNA_HXT11 were integrated in yeasts through transformation for in vivo assembly. In addition, the xylose isomerase expression cassette was also included in combination with the plasmid fragments for the transformation of yeasts, in order to integrate the XI expression cassette on yeasts genome. Before yeast transformation, the plasmid pRCC-K was extracted from E. coli cells by the Miniprep protocol. After the plasmid extraction, the three fragments of plasmid pRCC-K_gDNA_HXT11 and the xylose isomerase expression cassette were amplified by PCR. The plasmid pYPK0_TDH3_8054_2_ENO2 was used as the template for the PCR amplification of the XI expression cassette. For this PCR, the primers 1643 and 1644 were used. Each primer contained a 30 bp homologous sequences in their 5’ ends. Thus, the amplification of the XI cassette will result in a DNA segment that contains the XI expression cassette with homologous ends. This amplified DNA was used as a donor for the homologous recombination repair after the Cas9 DNA cut in the upstream region of the HXT11 gene (Figure 29 - Appendix B). The PCR samples were loaded onto an agarose gel, where a band for the amplified XI expression cassette was detected (Figure 10). This band is located just below to the 3000 bp marker band, which has approximately the expected size for the PCR product (2731 bp). This result indicates that the xylose isomerase expression cassette was amplified. However, a faint band on the negative control lane can be observed, nearly above to the marker band with 1500 bp. This band in negative control might indicate a contamination in PCR samples. Even though, if the PCR was contaminated, it would be expected to observe the negative control band for the XI expression cassette lane too. Nevertheless, this band was only detected in the negative control and did not appear in the XI expression cassette lane. Therefore, the PCR sample for the amplified 36
CHAPTER 3. RESULTS AND DISCUSSION XI expression cassette was used for the further experimental steps. Figure 10: Image of agarose gel for the PCR amplification of the XI expression cassette. Each letter represent a gel lane, where M represents the molecular weight marker (PSU marker 1 kb DNA Ladder), XI is the amplified xylose isomerase expression cassette (2731 bp), and Crepresents the negative control used for this PCR. Then, the three parts of the plasmid pRCC-K_gDNA_HXT11 were amplified. For each plasmid fragment, the plasmid DNA was diluted three times, with dilutions of 1:100, 1:1000 and 1:10000. These dilutions were made due to the high concentration of pRCC-K plasmid, since the plasmid pRCC-K has a higher plasmid copy number (Generoso et al., 2016). Thus, the template DNA was diluted so that the amount of template was appropriate for the PCR, and to get a better chance of obtaining a PCR product for each plasmid fragment. In the figure 11, an agarose gel can be observed for the PCR where the three plasmid fragments were amplified. Each fragment was denominated according to the respective primer pair used for its amplification. For each plasmid fragment, there are three lanes corresponding to DNA dilutions of 1:100, 1:1000, and 1:10000. As can be observed in the gel, only the fragments 473/576 and 196/1645 had bands, while the fragment 1646/253 had no band. For the fragment 196/1645, two bands to with the same size of approximately 3000 bp can be visualized for the dilutions of 1:1000 and 1:10000. Whereas, the fragment 473/576 had two bands with equal size and just above the 2000 bp band, for the 1:100 and 1:1000 dilutions. The detected bands had approximately the expected sizes of the PCR products, as the fragment 473/576 has a size of 3020 bp and the fragment 196/1645 has 2068 bp. The 196/1645 and 473/576 fragments were successfully amplified, although there were no bands in 37
CHAPTER 3. RESULTS AND DISCUSSION some lanes, specifically in the 1:100 dilution lane for the fragment 196/1645 and the 1:10000 dilution lane for the fragment 473/576. Figure 11: Image of agarose gel of the PCR amplification of three fragments of the plasmid pRCCK_gDNA_HXT11. The lane represented by the letter M corresponds to the molecular weight marker (PSU marker 1 kb DNA Ladder). The 1646/253 (5295 bp), 196/1645 (3020 bp) and 473/576 (2049 bp) are the pRCC-K plasmid fragments amplified by the respective primer pairs. For each plasmid fragment to be amplified, dilutions of 1:100, 1:1000 and 1:10000 were made. The lane represented by Cis the negative control. In order to amplify the remaining fragment (1646/253), the PCR conditions were optimized. The annealing temperature used for this PCR was raised from 54.5 ºC to 58ºC, and the extension time was increased to 2 minutes. Two PCR reactions were carried out with two dilutions of 1:100 and 1:1000. The PCR results were visualized in the agarose gel represented in the figure 12, where two bands can be observed with equal size and just above 5000 bp. This is approximately the expected size of the PCR product (5315 bp), indicating that the 1646/253 fragment was successfully amplified after the optimization of PCR conditions. 38
CHAPTER 3. RESULTS AND DISCUSSION Figure 12: Image of agarose gel of the PCR amplification of the 1646/253 fragment of the plasmid pRCCK_gDNA_HXT11. The lane represented by the letter M corresponds to the molecular weight marker (PSU marker 1 kb DNA Ladder). The other two lanes have the bands corresponding to the amplified 1646/253 fragment, with dilutions of 1:100 and 1:1000. Afterwards, the PCR samples with the lowest dilutions were picked for enzymatic digestion, where the samples were treated with the restriction enzyme DpnI. This digestion is necessary to degrade the remaining pRCC-K plasmid used as the template DNA for the previous PCRs. After 1 hour of digestion, the PCR samples were incubated at 80ºC during 20 minutes for enzyme deactivation. The next step was the transformation of yeasts, with the three pRCC-K_gDNA_HXT11 fragments and the XI expression cassette. The CEN.PK2-1C yeast strain was tranformed with 5 µL of each plasmid fragment and 45 µL of XI expression cassette DNA. For the selection of transformants, yeasts were cultivated in solid rich glucose medium with geneticin (YPD+G418). For each transformation, dilutions of 1:1, 1:10 and 1:100 were made. The transformant cells were plated, and after 3 days of incubation at 30ºC, the number of colonies in each plate was counted. The transformation resulted in 20 colonies in total, in which 19 were obtained from the plate without dilution (1:1), and the other one was obtained from the plate with 1:10 dilution. After the transformation, a colony PCR was carried out to confirm the integration of XI expression cassette on yeast genome. For this PCR, the primers 1354 and 1653 were used, where the primer 1354 pairs with the XI sequence, and the primer 1653 pairs with the HXT11 gene (Figure 7). The PCR samples were tested on agarose gel, but no positive yeast colonies were detected. This suggests that the XI expression 39
CHAPTER 3. RESULTS AND DISCUSSION cassette was not integrated on yeasts genome. Then, another colony PCR was carried out to detect the presence of the pRCC-K plasmid on transformant yeast colonies. For this PCR, the primers 473 and 474 were used to amplify a pRCC-K portion (Figure 28 - Appendix A). The PCR results were observed in an agarose gel, where almost all colonies had a band nearly above the 1500 bp marker band (Figure 13). This band has approximately the expected size for the PCR product (1333 bp), indicating the presence of the plasmid on transformant yeast colonies. Figure 13: Image of agarose gel of PCR for detection of pRCC-K plasmid on transformant yeast colonies. The lane represented by the letter M corresponds to the molecular weight marker (PSU marker 1 kb DNA Ladder), the lanes represented by numbers 1-20 correspond to the transformant CEN.PK2-1C colonies, and the Cis the negative control. Almost all colonies, except the colony 20, had a band with a size of approximately 1333 bp. Given the obtained results, the plasmid DNA was extracted from two transformant yeast colonies, in order to isolate the plasmid pRCC-K_gDNA_HXT11. After the plasmid extraction, two aliquotes of E. coli cells were transformed with 1 µL of the extracted plasmid DNA for plasmid rescue. The E.coli were transformed in LB-Amp medium and incubated overnight at 37ºC. This E. coli transformation resulted in one hundred transformant colonies, and one colony from each transformation was then picked for plasmid DNA extraction. After the plasmid DNA extraction, the samples were used for sequencing in order to confirm the pRCC-K_gDNA_HXT11 DNA sequence, and to verify if the gRNA-coding DNA sequence was inserted into the plasmid. The sequencing results confirmed the plasmid sequence and the insertion of the gRNA-coding DNA into the plasmid (Figure 14). Two samples of the plasmid were sequenced and aligned with the predicted sequence. The obtained sequences were similar with the pRCC-K_gDNA_HXT11 sequence, and the gRNA-coding DNA was present in both samples. 40
CHAPTER 3. RESULTS AND DISCUSSION Figure 19: Growth curves of evolved CEN.PK2-1C and IMX994 yeast strains on SX-U medium during 72 hours. The data points are the average OD at 600 nm of three technical replicates of the yeast colony with the highest growth. The error bars corresponding to the standard error of the three replicates used are also represented. 3.2.2 Evolution of yeasts under nitrogen depletion Another evolution experiment was carried out using the same yeast strains that were previously evolved. Yeast cells were initially cultivated in pre-cultures of SC-U with 2% glucose, and the pre-cultures were incubated overnight at 30ºC. In the next day, cells were transferred to two types of synthetic medium, with and without drop-out. The evolution experiment was carried out during a period of 33 days. The evolution ended after 11 transfers for both strains in medium with drop-out, and 11 transfers for the IMX994 strain and 6 transfers for the CEN.PK2-1C strain in medium without drop-out. During serial passages, the batch cultures were inoculated to an initial OD = 0.05 and the final OD reached after a few days was registered (Figure 20). In the first two serial transfers, cells were cultivated with a concentration of xylose of 1.75% and glucose at 0.25%. Then, the concentration of xylose was raised to 1.9% with 0.1% glucose in the next two transfers, where a decrease in ODs was observed for all yeast strains. From the fifth transfer, all yeast strains were cultivated in medium with solely xylose (2%). For all yeast strains except CEN.PK2-1C in medium without drop-out there was a overall increase in optical density over passages, specifically between the fifth and sixth transfers. During this time, the time between transfers was of 3 days. In yeasts evolved in medium with drop-out, the ODs were higher than those cultivated in medium without drop-out, and this OD increase was slighter. In yeasts evolved in medium without drop-out, the OD of IMX994 strain was doubled from the fifth to the sixth transfer. Whereas, in the case of CEN.PK2-1C strain, cells took too long to grow, taking up to 17 days in the fifth transfer. Then, the sixth transfer was the last transfer for the CEN.PK2-1C without dropout, and the time between transfers was 5 days. From the seventh passage, the time between transfer was increased to 4 days for all yeast strains except the CEN.PK2-1C without 47
CHAPTER 3. RESULTS AND DISCUSSION drop-out, which evolution ended in the sixth transfer. From this point, there was a gradual increase in ODs until the ninth transfer for all yeast strains. Then, in the last two transfers, the time between serial passages was reduced to 3 days, and a small increase in OD was observed from the tenth to the eleventh transfer. The IMX994 strain generally displayed higher OD values than the CEN.PK2-1C strain, having reached values between a range of 3 and 5 for the IMX994 cells with drop-out, and ODs between 2 and 3 in IMX994 yeasts in medium without drop-out. The CEN.PK2-1C cells had the lowest OD values, having OD values between 2 and 3 for cells cultivated with drop-out, and values about 0.5 for yeasts evolved in medium without drop-out. Figure 20: Overview of adaptive laboratorial evolution of two yeast strains CEN.PK2-1C and IMX994 in medium with and without drop-out. In this figure, there are four plots for each yeast strain and culture medium type, including CEN.PK2-1C with drop-out (A), CEN.PK2-1C without drop-out (B), IMX994 with drop-out (C), and IMX994 without drop-out (D). The blue bars are the average of OD values for three colonies of each yeast strain used as biological replicates, which are the OD values measured before the subsequent transfer. The black lines are the error bars that represent the standard error of the replicates used. The yellow line represents the time passed expressed in days between serial transfers. The the concentration ratio of glucose/xylose in the culture medium for the respective transfers is also represented. 48
CHAPTER 3. RESULTS AND DISCUSSION Furthermore, the total number of generations for each evolved yeast strain was calculated using the aforementioned formula. In the figure 21, the cumulative number of generations over the time is represented. At the end of the evolution experiment, the CEN.PK2-1C strain reached of about 62 in medium with drop-out, and only 26 generations in medium without drop-out. The IMX994 strain reached a number of generations of 69 when cultivated with drop-out, and 57 in medium without drop-out. The number of generations between the two strains in drop-out medium is more similar, although the IMX994 cells reached 7 more generations. Whereas, the differences between the strains are much more remarkable in medium without drop-out, being the CEN.PK2-1C strain evolved in medium without drop-out the one with a much lower number of generations in comparison to the other yeast strains. Figure 21: Cumulative number of generations of both evolved yeast strains CEN.PK2-1C and IMX994 cultivated with and without drop-out. Additionally, growth curves were obtained for both yeast strains evolved in medium with and without drop-out. The cultures were inoculated with yeast cells to an initial OD = 0.05, and the OD values were registered during 72 hours. In the figure 22, four growth curves can be observed, with two curves for each strain evolved in both types of synthetic xylose medium. As can be observed, the IMX994 strain had a higher growth in comparison to the CEN.PK2-1C strains, reaching an OD of about 3.5 after 72 hours, while CEN.PK2-1C had reached an OD of about 2. It is possible to notice a similarity for the CEN.PK2-1C and IMX994 curves between both types of synthetic xylose media with and without drop-out, although slight differences in the OD values were observed between the growth curves of the IMX994 strain, being the IMX994 strain evolved without drop-out the one with the highest optical densities. 49
CHAPTER 3. RESULTS AND DISCUSSION Figure 22: Growth curves of evolved CEN.PK2-1C and IMX994 yeast strains on SX-U medium during 72 hours. The data points are the average OD at 600 nm of two technical replicates per each two evolved yeast clones used as biological replicas, giving a total of four replicates. The error bars corresponding to the standard error are also represented. 3.3 Plasmid loss in yeasts with the pYPK0_TDH3_8054_2_ENO2 plasmid After the ALE experiments of yeasts, IMX994 cells were cultivated in liquid rich glucose medium (YPD) in order to promote the plasmid loss, specifically the pYPK0_TDH3_8054_2_ENO2 plasmid which contains the xylose isomerase expression cassette. The cultivation of yeasts transformed with a plasmid in nonselective media can lead to plasmid loss, since cells that have not retained the plasmid after several cell divisions can proliferate on the medium. In this case, as the plasmid contains the auxotrophic selective marker URA3, yeasts were cultivated in an auxotrophic medium without uracil. After 3 serial passages in liquid rich medium, yeast cells were plated in solid rich medium and incubated at 30ºC. After 3 days, yeast colonies were obtained for each yeast culture, with two yeasts colonies evolved in synthetic xylose media with and without drop-out. Then, 12 colonies from each yeast culture were picked and transferred to two culture media, rich glucose medium (YPD) and synthetic complete medium without uracil (SC-U). In this way, it is possible to know which colonies had lost the plasmid, which are those that did not grow in the selective medium SC-U. Whereas, if the colonies grew on both media, it means that colonies retained the plasmid. In the figure 23, the results obtained for the plasmid loss are represented. All yeast colonies grew on rich medium as expected, while some colonies survived and grew on selective medium SC-U. In the case of IMX994 yeasts evolved with drop-out, the colonies I5, II1, II2, II3, II10 and II12 had lost the plasmid. Whereas, in IMX994 yeasts evolved without drop-out, the colonies that lost the plasmid were I6, I10, II3, II5, II6, II10 and II11. Afterwards, 4 of these colonies were selected for spot assay analysis, 50
CHAPTER 3. RESULTS AND DISCUSSION where different groups of yeast strains were tested, including parental yeast strains, evolved strains, and yeasts that lost the plasmid. These colonies include two yeast colonies evolved in medium with drop-out and other two colonies evolved without drop-out. Figure 23: IMX994 yeast colonies cultivated in solid YPD and SC-U media after serial passages in liquid YPD medium to induce the plasmid loss. In this figure it is possible to observe four plates, two with YPD and another two with SC-U. Each plate was prepared in order to streak 12 yeast colonies from two isolated IMX994 parental clones, which were previously transformed with the pYPK0_TDH3_8054_2_ENO2 plasmid and evolved in synthetic xylose-containing media with and without, giving a total of 24 colonies per plate. The plates include: YPD medium for IMX994 cells evolved with drop-out (A); YPD medium for IMX994 cells evolved without drop-out (B); SC-U for IMX994 evolved with drop-out (C); and SC-U for IMX994 yeasts evolved without drop-out (D). The yeast colonies that lost the plasmid are indicated with the respective numbers observed in the figure. Each yeast colony was numbered by a roman numeral, which represents the evolved yeast parental clone I and II, and an arabic numeral representing each isolated yeast colony. 51
CHAPTER 3. RESULTS AND DISCUSSION 3.4 Spot assay analysis of S. cerevisiae strains The spot assay analysis allows to obtain an visual insight into the growth of different types of microorganisms on a specific medium, typically by spotting a small amount of each strain on a plate and measuring the size of the colonies. It can be used to evaluate the growth of microbial cells in certain conditions, based on the size and shape of the cell colonies. In this case, the spot assay analysis was carried out to compare and characterize the growth of different yeast strains in four culture media: synthetic complete medium without uracil (SC-U); synthetic xylose medium without uracil (SX-U); synthetic defined xylose medium (SDX); and rich xylose medium (YPX). Four groups of yeast strains were tested, including the parental yeast strains CEN.PK2-1C and IMX994, evolved IMX994 yeast strains, and IMX994 yeasts that lost the plasmid. The SC-U and SX-U media were used to test the difference between yeasts transformed with the plasmid and those without the plasmid, while the SDX and YPX cultures were used as control media. The first group of yeasts to be tested was the parental yeast strains CEN.PK2-1C and IMX994. These strains include the wild-type yeast strains and the non-evolved XI-expressing yeasts that were previously transformed with the pYPK0_TDH3_8054_2_ENO2 plasmid. In the figure 24, the plates where yeast cells were tested are presented, with five spots for serial dilutions from 100to 10-4. According to the observed results, the parental XI-expressing IMX994 and CEN.PK 2-1C strains, denominated as IMX994 XI and CEN.PK2-1C XI, grew in SC-U and SX-U, while the wild-type yeast strains (CEN.PK2-1C WT and IMX994 WT) did not grow in these media. In addition, yeast colonies had a smaller size in SX-U when compared with the SC-U. According to the observations, in SC-U and SX-U culture media only the XI-expressing yeast strains grew since these yeasts were transformed with the pYPK0_TDH3_8054_2_ENO2 plasmid, which contains the auxotrophic marker URA3 that enables the growth of transformant cells in the absence of uracil. Besides, the yeast growth on glucose is faster in comparison with the growth on xylose, which explains the different size of yeast colonies between the SC-U and SX-U. Whereas, the wild-type yeast strains did not survived and grew in both SC-U and SX-U since both CEN.PK2-1C and IMX994 strains are auxotrophic to uracil (Entian and Kötter, 2007; Papapetridis et al., 2018). In SDX medium, only the IMX994 strains displayed growth in this medium, and the colony size was smaller than in the other culture media. This happened since this medium only contains a minimal amount of ingredients, such as yeast nitrogen base without aminoacids, xylose, potassium hydrogen phtalate, and uracil. Besides, this medium does not have the aminoacids tryptophan, histidine and leucine. For this reason, the CEN.PK2-1C cells did not survived and grew in this medium since this strains has auxotrophy for these aminoacids (Entian and Kötter, 2007). Moreover, the wild-type IMX994 displayed a similar pattern with the XI-expressing IMXX94, although the colonies are slightly more visible for the IMX994 XI strain than in the wild-type in the 10-3 dilution. Finally, all yeast strains grew in YPX medium, without any significant differences between all yeast strains. These results demonstrate that the expression of XI gene through the plasmid pYPK0 gave to yeasts 52
CHAPTER 3. RESULTS AND DISCUSSION the ability to metabolize the xylose and grow on medium where the xylose is the sole carbon source. It is possible to verify that the transformation of both yeasts with the pYPK0_TDH3_8054_2_ENO2 plasmid and the expression of the XI gene worked, as the XI-expressing strains grew in synthetic xylose medium. Figure 24: Spot assay analysis of parental yeast strains IMX994 and CEN.PK 2-1C, including the wild-type and the XI-expressing yeasts. In this figure, four plates with SC-U, SX-U, SDX and YPX are represented. Each plate has four strains, including IMX994 WT, CEN.PK2-1C WT, IMX994 XI, and CEN.PK2-1C XI. The variation of cell density is also represented, which results from the serial dilutions made, including dilutions of 100to 10-4. The evolved IMX994 yeasts were also tested by spot assays (Figure 25), where two clones of the evolved IMX994 were used (IMX994 I and II). These clones were obtained after the ALE experiment, in which yeasts were evolved in synthetic xylose medium with and without drop-out. As can be observed, all evolved yeast strains grew in both SC-U and SX-U medium as expected. Based on the size of the colonies, those that are observed in SC-U are larger than in SX-U medium, as yeasts grow more rapidly on glucose than on xylose. In addition, all yeasts, either evolved with drop-out or without, do not displayed any significant differences in spot assay analysis. Furthermore, all evolved yeasts also in SDX and YPX medium in same way, being the growth slower in SDX as the colony size was smaller than the other media. Figure 25: Spot assay analysis of evolved IMX994 yeasts. In this figure, the SC-U, SX-U, SDX and YPX media are represented. Each plate has four strains, including two clones of IMX994 yeasts (IMX994 I and II) evolved with and without drop-out. The variation of cell density is represented, which results from the serial dilutions made, including dilutions of 100to 10-4. In addition, the evolved yeast strains can be compared with the parental ones. The IMX994 evolved yeasts in comparison to the IMX994 parental yeasts did not have any significant difference in growth on SC-U and YPX media. However, the differences were clear in SX-U and SDX media. As can be observed, the evolved IMX994 cells displayed more colonies with a size larger than the parental IMX994 strains, indicating that the adaptive evolution of yeasts improved the growth of yeasts on xylose. 53
CHAPTER 3. RESULTS AND DISCUSSION Finally, the same yeast strains used before but without plasmid were also tested. According to the figure 26, these yeast strains did not grow in SC-U and SX-U as expected. Nonetheless, these yeasts grew in SDX and YPX media, although the growth in SDX medium had been more reduced. Since these yeast strains lost the plasmid, they also lose the ability to survive and grow in uracil-auxotrophic media like SC-U and SX-U. Regarding to the SDX medium, it is possible to visualize some yeast colonies with a reduced size. Figure 26: Spot assay analysis of yeasts that lost the plasmid pYPK0_TDH3_805_2_ENO2. In this figure, the SC-U, SX-U, SDX and YPX media are represented. Each plate has four strains, including the same yeast strains used before but without plasmid. The variation of cell density is represented, which results from the serial dilutions made, including dilutions of 100to 10-4. Interestingly, the yeasts that lost the plasmid displayed results that were similar to those of the parental wild-type IMX994 strain, showing similarities between the yeasts that lost the plasmid and the parental strains. Regarding to the evolved yeasts, the differences between these and the yeasts without plasmid were obvious. These results demonstrate that the loss of the pYPK0_TDH3_8054_2_ENO2 plasmid interferes with the ability of yeasts to grow in media where xylose is the sole carbon source. Consequently, yeasts without the plasmid are incapable to metabolize xylose as they cannot to express the xylose isomerase, and then, they lose the ability to grow efficiently on xylose. 54
Chapter 4 Conclusion and Future Perspectives In this work, two yeast strains with the ability to metabolize xylose and grow efficiently on xylosecontaining media were developed. The CEN.PK2-1C and IMX994 strains were first transformed with the expression vector pYPK0_TDH3_8054_2_ENO2 that contains the XI expression cassette. The transformation was successfully, giving the capability to yeasts to express the XI pathway. The genomic integration of XI gene by CRISPR/Cas9 was also attempted in the CEN.PK2-1C strain. Unfortunately, the CRISPR/- Cas9 technique did not work since the XI expression cassette integrated in yeast genome was not detected by PCR for any transformant colony. Giving that, the yeasts transformed with the pYPK0 expression vector with the XI gene were subsequently subjected to adaptive laboratorial evolution in order to optimize yeasts growth on xylose. After the ALE experiment, the analysis of yeast growth through growth curves and spot assay analysis indicate that the evolved yeast strains had a higher growth on xylose-containing media in comparison with the non-evolved parental strains. Therefore, the combination of the heterologous expression of XI pathway with the adaptive evolution led to the improvement of yeasts growth on xylose. Besides, in this work it was possible to verify the effect of plasmid loss, specially the pYPK0_TDH3_8054_2_ENO2 plasmid used for the XI pathway expression. The loss of the plasmid caused the inability for yeasts to assimilate xylose and grow properly on xylose media, demonstrating the relevance of the XI pathway expression. In conclusion, the heterologous expression of XI pathway in S. cerevisiae strains and the development of xylose-consuming yeasts was accomplished, although the ultimate goal of this work was not yet achieved. Thus, a link between the xylose catabolism and fatty acid production remains to be established. This experimental work had successfully led to the development of new yeast strains capable to assimilate xylose and grow efficiently on xylose-containing media. However, there is still the possibility for future work that can be done to achieve the ultimate goal of this work, which is the production of fatty acids, specially branched-chain fatty acids. The FAs production will be connected to the xylose catabolism through some metabolic engineering strategies, including the integration of heterologous pathways in yeasts, such as the phosphoketolase pathway (PK) and the phosphate acetyltransferase (PTA). The introduction of these two metabolic pathways would enable the conversion of xylose until the production of acetyl-CoA, and then, 55
CHAPTER 4. CONCLUSION AND FUTURE PERSPECTIVES the FAs biosynthesis. Until the present moment, yeasts have the ability to convert xylose into xylulose via xylose isomerase. In turn, xylulose is phosphorylated into xylulose-5-phosphate by a native yeast metabolic pathway. From this point, the PK and PTA pathways would establish a link between the xylose catabolism and the FAs biosynthesis, as xylulose-5-phosphate is converted to glyceraldehyde-3-phosphate and acetyl phosphate that is then converted into acetyl-CoA. Since acetyl-CoA is a fundamental precursor of FAs biosynthesis, by directing the metabolism towards acetyl-CoA production it would lead to an enhancement of fatty acid production. Thus, the heterologous expression of PK and PTA pathways can be used to achieve the main objective of this work. In this case, candidate genes of PK and PTA from source organisms available in the Department of Biology of the University of Minho will be expressed in XI-expressing S. cerevisiae strains that were already developed in this work. The source organisms for the extraction of the PK gene may include yeast species, such as Schizosaccharomyces pombe,Schizosaccharomyces octosporus,Leuconostoc mesenteroides, and Rhodotorula glutinis. Whereas, bacterial species such as E. coli and Bacillus subtilis can be used for the PTA gene extraction. Then, these genes should be first cloned using the pYPKa cloning vector and E. coli as the host organism. After gene cloning, the PK and PTA genes would be extracted, and then expressed in S. cerevisiae through the expression vector pYPK0. For this, there is a method that can be used for metabolic pathway assembly denominated as Yeast Pathway Kit (YPK) (F. Pereira et al., 2016). This method consist of a protocol where genetic elements for the expression of metabolic pathways, including genes and regulatory sequences, are assembled by making a set of single gene expression vectors that are further combined through homologous recombination. Then, the promoter-gene-terminator fragments, also denominated as transcriptional units, are generated and can be stitched together by a second round of homologous recombination. This is a method that enables the combination and expression of any desired metabolic pathways in S. cerevisiae in an efficient way. Furthermore, the next step would be the characterization of yeast strains after the integration of PK and PTA pathways. In this task, the yeasts growth on xylose would be tested, with yeast strains expressing the PK/PTA pathway and with the deletion of acetyl-CoA syntethase pathway (ACS). In this screening task, the PK and PTA genes from the candidate source organisms that work best will be selected for characterization. Yeast strains with PK/PTA pathway, with and without the ACS pathway (acs2𝛥), will be cultivated in culture media with glucose, ethanol or xylose. In order to characterize the PK and PTA enzymes with best performance, the growth of yeast strains expressing these enzymes will be evaluated in liquid cultures by the determination of the specific growth rates, and also in solid cultures by spot assay analysis. Then, the substrate consumption and metabolite production would be measured by HPLC. Besides, the lipid accumulation would be quantified by fluorescence, using nile red as a fluorescent marker. In addition, the lipid production could be quantified for yeasts evolved under nitrogen depletion. Each yeast strain evolved in synthetic xylose medium with or without drop-out would be tested for lipid accumulation, which can be analysed and quantified by fluorescence microscopy using the BODIPY dye (Dan 56
BIBLIOGRAPHY Mans, R., van Rossum, H., Wijsman, M., Backx, A., Kuijpers, N., Broek, M., Daran-Lapujade, P., Pronk, J., Van Maris, A., & Daran, J.-M. (2015). CRISPR/Cas9: A molecular Swiss army knife for simultaneous introduction of multiple genetic modifications in Saccharomyces cerevisiae.FEMS Yeast Research,15(2), 1–15. https://doi.org/10.1093/femsyr/fov004 Mattanovich, D., Sauer, M., & Gasser, B. (2014). Yeast Biotechnology: Teaching the Old Dog New Tricks. Microbial Cell Factories,13, 34. https://doi.org/10.1186/1475-2859-13-34 Mavrommati, M., Daskalaki, A., Papanikolaou, S., & Aggelis, G. (2021). Adaptive laboratory evolution principles and applications in industrial biotechnology. Biotechnology Advances,54, 1–31. https: //doi.org/10.1016/j.biotechadv.2021.107795 McCarty, M., Dinicolantonio, J., & O’Keefe, J. (2015). Capsaicin may have important potential for promoting vascular and metabolic health. Open Heart,2, 1–7. https://doi.org/https://doi.org/10. 1136/openhrt-2015-000262 Meisinger, C., Pfanner, N., & Truscott, K. (2006). Isolation of Yeast Mitochondria. Methods in Molecular Biology,313, 33–39. https://doi.org/10.1385/1-59259-958-3:033 Mizushima, N., & Komatsu, M. (2011). Autophagy: Renovation of Cells and Tissues. Cell,147(4), 728– 741. https://doi.org/10.1016/j.cell.2011.10.026 Moes, C. J., Pretorius, I. S., & van Zyl, W. H. (1996). Cloning and expression of the Clostridium thermosulfurogenes D-xylose isomerase gene (xylA) in Saccharomyces cerevisiae.Biotechnology Letters, 18, 269–274. https://doi.org/10.1128/aem.56.9.2638-2643.1990 Mosier, N., Wyman, C., Dale, B., Elander, R., Lee, Y., Holtzapple, M., & Ladisch, M. (2005). Features of promising technologies for pretreatment of lignocellulosic biomass. Bioresource Technology,96, 673–686. https://doi.org/10.1016/j.biortech.2004.06.025 Moysés, D. N., Reis, V. C. B., Almeida, J. R. M. d., Moraes, L. M. P. d., & Torres, F. A. G. (2016). Xylose Fermentation by Saccharomyces cerevisiae: Challenges and Prospects. International Journal of Molecular Sciences,17(3), 1–18. https://doi.org/10.3390/ijms17030207 Mu, W., Hassanin, H., Zhou, L., & Jiang, B. (2018). Chemistry Behind Rare Sugars and Bioprocessing. Journal of Agricultural and Food Chemistry,66, 13343–13345. https://doi.org/10.1021/acs. jafc.8b06293 Nandy, S. K., & Srivastava, R. K. (2018). A review on sustainable yeast biotechnological processes and applications. Microbiological Research,207, 83–90. https://doi.org/10.1016/j.micres.2017. 11.013 Nevoigt, E. (2008). Progress in Metabolic Engineering of Saccharomyces cerevisiae.Microbiology and Molecular Biology Reviews,72, 379–412. https://doi.org/10.1128/MMBR.00025-07 Nielsen, J., & Keasling, J. (2016). Engineering Cellular Metabolism. Cell,164, 1185–1197. https://doi. org/10.1016/j.cell.2016.02.004 63
BIBLIOGRAPHY Nikolau, B., Perera, A., Brachova, L., & Shanks, B. (2008). Platform chemicals for a biorenewable chemical industry. The Plant Journal : For Cell and Molecular Biology,54, 536–545. https://doi.org/10. 1111/j.1365-313X.2008.03484.x Ohgren, K., Bengtsson, O., Gorwa-Grauslund, M., Galbe, M., Hahn-Hägerdal, B., & Zacchi, G. (2007). Simultaneous saccharification and co-fermentation of glucose and xylose in steam-pretreated corn stover at high fiber content with Saccharomyces cerevisiae tmb3400. Journal of Biotechnology, 126, 488–498. https://doi.org/10.1016/j.jbiotec.2006.05.001 Ostergaard, S., Olsson, L., & Nielsen, J. (2000). Metabolic Engineering of Saccharomyces cerevisiae. Microbiology and Molecular Biology Reviews,64(1), 34–50. https://doi.org/10.1128/MMBR. 64.1.34-50.2000 Paddon, C., Westfall, P., Pitera, D., Benjamin, K., Fisher, K., McPhee, D., Leavell, M., Tai, A., Main, A., Eng, D., Polichuk, D., Teoh, K., Reed, D., Treynor, T., Lenihan, J., Fleck, M., Bajad, S., Dang, G., Diola, D., & Newman, J. (2013). High-level semi-synthetic production of the potent antimalarial artemisinin. Nature,496, 528–532. https://doi.org/10.1038/nature12051 Papapetridis, I., van Dijk, M., Dobbe, A., Metz, B., Pronk, J., & Van Maris, A. (2016). Improving ethanol yield in acetate-reducing Saccharomyces cerevisiae by cofactor engineering of 6-phosphogluconate dehydrogenase and deletion of ALD6.Microbial Cell Factories,15, 1–16. https://doi.org/10.1186/ s12934-016-0465-z Papapetridis, I., Verhoeven, M., Wiersma, S., Goudriaan, M., Van Maris, A., & Pronk, J. (2018). Laboratory evolution for forced glucose-xylose co-consumption enables identification of mutations that improve mixed-sugar fermentation by xylosefermenting Saccharomyces cerevisiae.FEMS Yeast Research,18, 1–47. https://doi.org/10.1093/femsyr/foy056 Paques, F., & Duchateau, P. (2007). Meganucleases and DNA Double-Strand Break-Induced Recombination: Perspectives for Gene Therapy. Current Gene Therapy,7, 49–66. https://doi.org/10. 2174/156652307779940216 Pereira, F., Azevedo, F., Skorupa Parachin, N., Hahn-Hägerdal, B., Gorwa-Grauslund, M., & Johansson, B. (2016). The Yeast Pathway Kit: A method for metabolic pathway assembly with automatically simulated executable documentation. ACS Synthetic Biology,5, 386–394. https://doi.org/10. 1021/acssynbio.5b00250 Pereira, H., Azevedo, F., Domingues, L., & Johansson, B. (2022). Expression of Yarrowia lipolytica acetylcoa carboxylase in Saccharomyces cerevisiae and its effect on in-vivo accumulation of malonylcoa. Computational and Structural Biotechnology Journal,20, 779–787. https://doi.org/10. 1016/j.csbj.2022.01.020 Porro, D., Bianchi, M., Brambilla, L., Menghini, R., Bolzani, D., Carrera, V., Lievense, J., Liu, C.-L., Ranzi, B., Frontali, L., & Alberghina, L. (1999). Replacement of a Metabolic Pathway for Large-Scale 64
BIBLIOGRAPHY Production of Lactic Acid from Engineered Yeasts. Applied and Environmental Microbiology,65(9), 4211–4215. https://doi.org/10.1128/AEM.65.9.4211-4215.1999 Portnoy, V., Bezdan, D., & Zengler, K. (2011). Adaptive laboratory evolution—harnessing the power of biology for metabolic engineering. Current Opinion in Biotechnology,22, 590–594. https://doi. org/10.1016/j.copbio.2011.03.007 Portnoy, V., Herrgård, M., & Palsson, B. (2008). Aerobic Fermentation of D-Glucose by an Evolved Cytochrome Oxidase-Deficient Escherichia coli Strain. Applied and Environmental Microbiology,74, 7561–7569. https://doi.org/10.1128/AEM.00880-08 Ran-Ressler, R., Devapatla, S., Lawrence, P., & Brenna, T. (2008). Branched Chain Fatty Acids Are Constituents of the Normal Healthy Newborn Gastrointestinal Tract. Pediatric Research,64, 605–609. https://doi.org/10.1203/PDR.0b013e318184d2e6 Redman, M., King, A., Watson, C., & King, D. (2016). What is CRISPR/Cas9? Archives of Disease in Childhood,101, 1–3. https://doi.org/10.1136/archdischild-2016-310459 Rezanka, T. (1989). Very-long-chain fatty acids from the animal and plant kingdoms. Progress in Lipid Research,28(3), 147–187. https://doi.org/10.1016/0163-7827(89)90011-8 Roca, C., Nielsen, J., & Olsson, L. (2003). Metabolic Engineering of Ammonium Assimilation in XyloseFermenting Saccharomyces cerevisiae Improves Ethanol Production. Applied and Environmental Microbiology,69, 4732–6. https://doi.org/10.1128/AEM.69.8.4732-4736.2003 Rude, M. A., & Schirmer, A. (2009). New microbial fuels: A biotech perspective. Current Opinion in Microbiology,12(3), 274–281. https://doi.org/10.1016/j.mib.2009.04.004 Sandberg, T., Salazar, M., Weng, L., Palsson, B., & Feist, A. (2019). The emergence of adaptive laboratory evolution as an efficient tool for biological discovery and industrial biotechnology. Metabolic Engineering,56, 1–16. https://doi.org/10.1016/j.ymben.2019.08.004 Sarthy, A., McConaughy, B., Lobo, Z., Sundstrom, J., Furlong, C., & Hall, B. (1987). Expression of the Escherichia coli xylose isomerase gene in Saccharomyces cerevisiae.Applied and Environmental Microbiology,53(9), 1996–2000. https://doi.org/10.1128/aem.53.9.1996-2000.1987 Sato, G., & Kuroda, K. (2023). Overcoming the Limitations of CRISPR-Cas9 Systems in Saccharomyces cerevisiae: Off-Target Effects, Epigenome, and Mitochondrial Editing. Microorganisms,11(4), 1– 19. https://doi.org/10.3390/microorganisms11041040 Satomura, A., Nishioka, R., Mori, H., Sato, K., Kuroda, K., & Ueda, M. (2017). Precise genome-wide base editing by the CRISPR nickase system in yeast. Scientific Reports,7(1), 1–10. https://doi.org/ 10.1038/s41598-017-02013-7 Sheldon, R., & Woodley, J. (2017). Role of Biocatalysis in Sustainable Chemistry. Chemical Reviews,118, 801–838. https://doi.org/10.1021/acs.chemrev.7b00203 Sherman, F. (2002). Getting Started With Yeast. Methods in Enzymology,350, 3–41. https://doi.org/10. 1016/s0076-6879(02)50954-x 65
BIBLIOGRAPHY Silva, P., Ceja-Navarro, J., Azevedo, F., Karaoz, U., Brodie, E., & Johansson, B. (2021). A novel D-xylose isomerase from the gut of the wood feeding beetle Odontotaenius disjunctus efficiently expressed in Saccharomyces cerevisiae.Scientific Reports,11, 1–12. https://doi.org/10.1038/s41598021-83937-z Singh, P., & Kumar, S. (2019). Microbial Enzyme in Food Biotechnology (M. Kuddus, Ed.). In M. Kuddus (Ed.), Enzymes in food biotechnology. Academic Press. https://doi.org/10.1016/B978-0-12813280-7.00002-5 Sitnicka, D., Figurska, K., & Orzechowski, S. (2010). Functional Analysis of Genes. Advances in Cell Biology, 2, 1–16. https://doi.org/10.2478/v10052-010-0001-y Sonderegger, M., Schümperli, M., & Sauer, U. (2004). Metabolic Engineering of a Phosphoketolase Pathway for Pentose Catabolism in Saccharomyces cerevisiae.Applied and Environmental Microbiology,70, 2892–2897. https://doi.org/10.1128/AEM.70.5.2892-2897.2004 Stephanopoulos, G., & Vallino, J. (1991). Network Rigidity And Metabolic Engineering In Metabolite Overproduction. Science,252, 1675–1681. https://doi.org/10.1126/science.1904627 Stephanopoulos, G., Aristidou, A. A., & Nielsen, J. (1998). Metabolic Engineering: Principles and Methodologies. Academic Press. Taormina, V., Unger, A., Schiksnis, M., Torres-Gonzalez, M., & Kraft, J. (2020). Branched-Chain Fatty AcidsAn Underexplored Class of Dairy-Derived Fatty Acids. Nutrients,12, 1–16. https://doi.org/https: //doi.org/10.3390/nu12092875 Tehlivets, O., Scheuringer, K., & Kohlwein, S. (2007). Fatty acid synthesis and elongation in yeast. Biochimica et Biophysica Acta,1771, 255–270. https://doi.org/10.1016/j.bbalip.2006.07.004 Trotter, P. (2001). The genetics of fatty acid metabolism in Saccharomyces cerevisiae.Annual Review of Nutrition,21, 97–119. https://doi.org/10.1146/annurev.nutr.21.1.97 Van Maris, A., Winkler, A., Kuyper, M., de laat, W., Dijken, J., & Pronk, J. (2007). Development of Efficient Xylose Fermentation in Saccharomyces cerevisiae: Xylose Isomerase as a Key Component. Advances in Biochemical Engineering/Biotechnology,108, 179–204. https://doi.org/10.1007/ 10_2007_057 Wahlbom, C., Eliasson, A., & Hahn-Hägerdal, B. (2001). Intracellular fluxes in a recombinant xyloseutilizing Saccharomyces cerevisiae cultivated anaerobically at different dilution rates and feed concentrations. Biotechnology and Bioengineering,72, 289–296. https://doi.org/10.1002/ 1097-0290(20010205)72:3<289::aid-bit5>3.0.co;2-9 Walfridsson, M., Bao, X., Anderlund, M., Lilius, G., Bülow, L., & Hahn-Hägerdal, B. (1997). Ethanolic fermentation of xylose with Saccharomyces cerevisiae harboring the Thermus thermophilus xylA gene, which expresses an active xylose (glucose) isomerase. Applied and Environmental Microbiology,62, 4648–4651. https://doi.org/10.1128/AEM.62.12.4648-4651.1996 66
BIBLIOGRAPHY Wang, Y., Halls, C., Zhang, J., Matsuno, M., Zhang, Y., & Yu, O. (2011). Stepwise increase of resveratrol biosynthesis in yeast Saccharomyces cerevisiae by metabolic engineering. Metabolic Engineering, 13(5), 455–463. https://doi.org/10.1016/j.ymben.2011.04.005 Winkler, J., Reyes, L., & Kao, K. (2013). Adaptive Laboratory Evolution for Strain Engineering. Methods in Molecular Biology,985, 211–22. https://doi.org/10.1007/978-1-62703-299-5_11 Wisselink, H., Toirkens, M., Berriel, M., Winkler, A., Dijken, J., Pronk, J., & Van Maris, A. (2007). Engineering of Saccharomyces cerevisiae for Efficient Anaerobic Alcoholic Fermentation of L-Arabinose. Applied and Environmental Microbiology,73, 4881–4891. https://doi.org/10.1128/AEM.0017707 Woolston, B., Edgar, S., & Stephanopoulos, G. (2013). Metabolic Engineering: Past and Future. Annual Review of Chemical and Biomolecular Engineering,4, 259–288. https://doi.org/10.1146/ annurev-chembioeng-061312-103312 Wuest, D., Hou, S., & Lee, K. (2011). Metabolic Engineering (M. Moo-Young, Ed.; Second Edition). In M. Moo-Young (Ed.), Comprehensive biotechnology (second edition) (Second Edition). Burlington, Academic Press. https://doi.org/10.1016/B978-0-08-088504-9.00229-4 Xiao-Jie, L., Hui-Ying, X., Zun-Ping, K., Jin-Lian, C., & Li-Juan, J. (2015). CRISPR-Cas9: A new and promising player in gene therapy. Journal of Medical Genetics,52, 289–296. https://doi.org/10.1136/ jmedgenet-2014-102968 Xiberras, J., Klein, M., Hulster, E., Mans, R., & Nevoigt, E. (2020). Engineering Saccharomyces cerevisiae for Succinic Acid Production from Glycerol and Carbon Dioxide. Frontiers in Bioengineering and Biotechnology,8, 11–13. https://doi.org/10.3389/fbioe.2020.00566 Ziv, N., Brandt, N., & Gresham, D. (2013). The Use of Chemostats in Microbial Systems Biology. Journal of Visualized Experiments,80, 1–10. https://doi.org/10.3791/50168 67
Appendix A Appendix 1 - Plasmid maps Figure 27: pYPK0_TDH3_8054_2_ENO2 plasmid map. This plasmid contains the xylose isomerase expression cassette (TDH3_8054_2_ENO2), with the promoter TDH3, the xylose isomerase gene 8054_2 extracted from the gut of the wood feeding beetle Odontotaenius disjunctus (Silva et al., 2021), and the terminator ENO2. In addition, this plasmid also have other important features, such as the selection marker URA3 that confers the ability to produce uracil and survive in uracil auxotrophic media, the AmpR marker that gives ampicillin resistance, and the sequences for the origins of replication, including the 2µ ori (2 micron origin) and ColE1 origin. The primers used for PCRs where this plasmid was used are also represented. The plasmid map was designed using the software SnapGene®. 68
APPENDIX A. APPENDIX 1 - PLASMID MAPS Figure 28: pRCC-K plasmid map. This plasmid is a CRISPR-Cas9 vector that contains a sequence for the expression of Cas9 protein, and the guide RNA expression cassette, which is composed by the SNR52 promoter, the gRNA scaffold, and the terminators SUP4 and CYC1. The pRCC-K also have other relevant sequences, including: the AmpR selection marker that gives ampicillin resistance; the KanMX expression cassette, composed by the KanR selection marker, which confers antibiotic resistance to geneticin, and the promoter and terminator TEF sequences; and origins of replication ori and 2µ ori (2 micron origin). The primers used for PCRs where this plasmid was used are also represented. The plasmid map was designed using the software SnapGene®. 69
Appendix B Appendix 2 - Genomic integration of the XI expression cassette on HXT11 locus Figure 29: Schematic representation of the HXT11 locus on S. cerevisiae genome. The relevant features include the HXT11 gene, gDNA target, the PAM sequence (green arrow adjacent to the gDNA target), and the upstream and downstream homologous recombination sites used to integrate the xylose isomerase cassette expression by homologous recombination after the Cas9 cut. This image was generated using the web platform software Benchling (https://www.benchling.com). 70
Appendix C Appendix 3 - Drop-out -HULT aminoacid mix Table 13: Drop-out -HULT aminoacid mix composition. Aminoacid Concentration (mg/L) L-Adenine 19.74 L-Arginine 78.96 L-Asparagine 78.96 L-Aspartic acid 78.96 L-Cysteine 78.96 L-Glutamic acid 78.96 L-Glutamine 78.96 L-Glycine 78.96 L-Isoleucine 78.96 L-Lysine 78.96 L-Methionine 78.96 L-Phenylalanine 78.96 L-Proline 78.96 L-Serine 78.96 L-Threonine 78.96 L-Tyrosine 78.96 L-Valine 78.96 Myo-inositol 78.96 Para-aminobenzidine 7.896 71
Appendix D Appendix 4 - Primers list Table 14: Primers list with the nomenclature and the respective sequences. Name Sequence (5’ →3’) 196_pMEC_MX4_fwd ACTTTTCGGGGAAATGTGC 253_kanC3 CCTCGACATCATCTGCCCAGAT 473_MSW_rev GTATAGCGACCAGCATTC 474_MSW_fwd TCCTTGACAGTCTTGACG 576_pBR322_2 GAAAAATAAACAAATAGGGGTTCCG 1287_Rv_Conf_8054_2 GAAAGTTGCCCTTAAAGCCTTTACT 1341_8454_fw ATGACATACTTTCCCACAGTGG 1354_fw_seq_8454 CTTGCGACCATCTTAACC 1356_sgDNA_seq_pRCC-K_v2 CACACCCTACAATGTTCTG 1643_rv_integ_HXT11 TGCGGATGTATTATTAACACCTGACATGATTGATTCAGGTAAATCCGGAT 1644_fw_integ_HXT11 CGCCTCCTCCACAATAAATGCTGACCACACTGCGGCCGCTGACTTAAATA 1645_rv_HXT11_gDNA CACGAACAATGCATACACTCGATCATTTATCTTTCACTGCGGAG 1646_fw_HXT11_gDNA GAGTGTATGCATTGTTCGTGGTTTTAGAGCTAGAAATAGCAAGTTAAAAT 1653_rv_HXT11_conf TAGAGTCACCGTGTTCAGTC 1654_fw_upstream_HXT11 CTGCAAGCAGACCCCATTATTG 72