ChIP analysis unravels an exceptionally wide distribution of DNA binding sites for the NtcA transcription factor in a heterocyst-forming cyanobacterium

RESEARCH ARTICLE Open Access ChIP analysis unravels an exceptionally wide distribution of DNA binding sites for the NtcA transcription factor in a heterocyst-forming cyanobacterium Silvia Picossi * , Enrique Flores and Antonia Herrero Abstract Background: The CRP-family transcription factor NtcA, universally found in cyanobacteria, was initially discovered as a regulator operating N control. It responds to the N regime signaled by the internal 2-oxoglutarate levels, an indicator of the C to N balance of the cells. Canonical NtcA-activated promoters bear an NtcA-consensus binding site (GTAN 8 TAC) centered at about 41.5 nucleotides upstream from the transcription start point. In strains of the Anabaena/Nostoc genera NtcA is pivotal for the differentiation of heterocysts in response to N stress. Results: In this study, we have used chromatin immunoprecipitation followed by high-throughput sequencing to identify the whole catalog of NtcA-binding sites in cells of the filamentous, heterocyst-forming cyanobacterium Anabaena sp. PCC 7120 three hours after the withdrawal of combined N. NtcA has been found to bind to 2,424 DNA regions in the genome of Anabaena, which have been ascribed to 2,153 genes. Interestingly, only a small proportion of those genes are involved in N assimilation and metabolism, and 65% of the binding regions were located intragenically. Conclusions: The distribution of NtcA-binding sites identified here reveals the largest bacterial regulon described to date. Our results show that NtcA has a much wider role in the physiology of the cell than it has been previously thought, acting both as a global transcriptional regulator and possibly also as a factor influencing the superstructure of the chromosome (and plasmids). Background Cyanobacteria are prokaryotic organisms that perform an oxygenic photosynthesis similar to that of higher plants, constituting the evolutionary ancestors of the chloroplast [1]. Cyanobacteria are generally photoautotrophs fixing CO 2 , and they preferentially use ammonium as the nitrogen source, although they can also use nitrate, urea, and some amino acids. Some filamentous cyanobacteria, such as the model strain Anabaena sp. PCC 7120, are also able to fix N 2 in specialized cells called heterocysts [2]. The CRP-family transcriptional regulator NtcA, which is highly conserved in cyanobacteria, controls the response of the cell to N availability by binding to the promoter region of its target genes, activating or repressing their expression [3]. NtcA binds as a dimer to target sites with the consensus sequence GTAN 8 TAC [4]. In a number of sites found in NtcA-activated promoters binding of NtcA in vitro increases in the presence of 2-oxoglutarate (2-OG), although binding in the absence of this effector could also take place (e.g. [5]). The crystal structure of the Anabaena NtcA dimer has been solved in complex or not with 2-OG [6]. Similarly to CRP, each NtcA monomer comprises an N-terminal effector-binding domain and a C-terminal helix-turn-helix DNA binding domain, both connected by a long helix [6,7]. 2-OG binds at a pocket in the effector-binding domain and this binding induces changes that are transmitted to the DNA-binding domain resulting in a tighter coiled-coil conformation of the two C-helices, which is better suited for DNA binding [6]. However, whereas the apo- * Correspondence: [email protected] Instituto de Bioquímica Vegetal y Fotosíntesis, Consejo Superior de Investigaciones Científicas and Universidad de Sevilla, Américo Vespucio 49, Seville E-41092, Spain © 2014 Picossi et al.; licensee BioMed Central Ltd. This is an open access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Picossi et al. BMC Genomics 2014, 15:22 http://www.biomedcentral.com/1471-2164/15/22 CRP is unable of DNA binding in the absence of cAMP, in the apo-NtcA, the conformation of the helices is permissive for DNA binding [6], consistent with in vitro DNA-binding results [7]. As the first response of the cyanobacterial cell to N starvation, NtcA activates the expression of genes involved in the scavenging of traces of combined N, such as the nir operon (nitrate assimilation proteins) or the amt genes (ammonia translocators) [8]. In filamentous, heterocyst-forming cyanobacteria, NtcA is also needed for the differentiation and function of the N 2 - fixing heterocysts in response to persistent N deprivation. The process of heterocyst differentiation is tightly regulated and involves a cascade of transcriptional regulators that is initiated by NtcA and the heterocystspecific regulator HetR [9]. Some heterocyst-related genes activated by NtcA are nrrA and hetC (early induced), xisA and devBCA (intermediate steps), and pipX and the cox2,cox3 and nifHDK operons (maturation and function) [10]. Canonical NtcA-activated promoters have a consensus NtcA-binding site, centered at about 41.5 nucleotides upstream from the transcription start point (TSP) of the regulated genes, and a −10 box with the consensus sequence TAN 3 T, thus matching the bacterial Class II activator-dependent promoters [4,11]. Genes involved in the scavenging of traces of combined N, such as urtA,nirA,ntcB,andglnA, bear canonical NtcA-dependent promoters [8]. In complex promoter regions, often found in heterocystdifferentiation genes, NtcA-dependent promoters showing a non-canonical structure have been found, such as in cphB1 or ntcA [10]. Other genes such as rbcL or gor,are repressed by NtcA and have a GTAN 8 TAC box downstream of the −35 box of the promoter [4]. A prediction of new putative binding sites of NtcA in different cyanobacteria, based on computational analyses, has been published [12], but no in vivo confirmation of these sites has been done. On the other hand, two transcriptomic studies of the response of Anabaena sp. PCC 7120 to N deprivation have been recently published. Flaherty et al. [13] mapped transcripts produced in the whole genome, and Mitschke et al. [14] focused on possible TSPs. In order to determine the whole NtcA regulon, we attempted to find out all the NtcA targets present in the genome of Anabaena sp. PCC 7120 using immunoprecipitation of chromatin followed by massive sequencing (ChIP-Seq). This is a powerful technique that allows the identification of the in vivo binding sites of a transcription factor (TF) [15]. We have focused on an early time of induction after N step-down, when NtcA regulates genes involved in the scavenging of traces of combined N, but also genes required for the early stages of heterocyst differentiation. Results Immunoprecipitation of NtcA-bound DNA Wild-type Anabaena sp. PCC 7120 cells growing in bubbled cultures with ammonium as the N source were subjected to incubation in a combined N-depleted medium for 3 hours, after which the cultures were treated with formaldehyde to fix the proteins bound to DNA. After cell lysis and DNA fragmentation, the extracts were treated with an anti-NtcA antibody to specifically immunoprecipitate the NtcA-bound DNA (see Methods). The immunoprecipitated material was then incubated at 65ºC to reverse the crosslinking, and the DNA was isolated. A sample of total DNA was also isolated prior to anti-NtcA treatment of the extracts to serve as the control input sample. Quantitative PCR was performed to check the quality of the immunoprecipitated DNA, and to confirm that known NtcA target regions were enriched. Primers that amplified the promoter region of nrrA (all4312),asa positive control, and the promoter region of ORF all0770, as a negative control, were used. The result of the Q-PCR analysis (Additional file 1: Figure S1), confirmed a substantial enrichment in the NtcA-dependent promoter. Immunoprecipitated and input DNA samples were subjected to high-throughput sequencing and the results were analyzed using the Triform algorithm [16] and mapped onto the genome of Anabaena sp. PCC 7120 [17] (Additional file 2: Table S1). Distribution of the NtcA-bound DNA throughout the genome of Anabaena sp. PCC 7120 The analysis of immunoprecipitated DNA showed 2,424 binding regions, all of them statistically significant, located in the Anabaena genome, and distributed throughout the chromosome and five of the six plasmids (Table 1; Additional file 3: Figure S2). We have analyzed the location of these binding regions on the Anabaena genomic sequence and assigned them to one gene, two genes (when it was not possible to decide between flanking genes), or sRNAs (Additional file 2: Table S1). The Integrative Genome Viewer program (Broad Institute) [18] was used to map the sequences of the binding regions obtained by the ChIP-Seq experiment onto the Anabaena genome (the data are available for its visualization at GEO accession # GSE51865). The information of the 2,424 binding regions obtained is shown in Additional file 2: Table S1, including the location in the chromosome or plasmids, the gene(s) to which the binding region has been ascribed, and the statistical significance of the peak identifying the binding region (Q value, NLQ value) (see Methods). The binding regions are about 200–250 bp long, being its midpoint the most likely position for NtcA binding. Since cyanobacterial 5′-UTRs are frequently very long [13,14], some binding regions have been assigned to Picossi et al. BMC Genomics 2014, 15:22 Page 2 of 15 http://www.biomedcentral.com/1471-2164/15/22 genes that are relatively far, even if the binding regions were located inside the coding region of an adjacent gene. For these cases, we have taken into account the information about the differential expression of the genes after combined-N deprivation [13,14,19] (Additional file 2: Table S1). In order to estimate the role of NtcA binding at the binding regions, the programs CLC Sequence Viewer (CLC Bio) and Artemis Genome Browser (Wellcome Trust Sanger Institute) [20] were used to integrate the transcriptomic data from Flaherty et al. [13] and from Mischke et al. [14] with the location of the NtcA binding region sequences obtained in our ChIP-Seq experiment. To this end, the location of a certain binding region (midpoint of the range of the detected target region) (Additional file 2: Table S1) was determined using the above-mentioned programs, and its genomic context was analyzed in relation to the transcripts/transcription start sites that have been described. In addition, putative NtcA consensus binding sites were identified (if possible) within the sequence of the binding region (Table 2; Additional file 2: Table S1). The relative location of the binding region with respect to the gene was also analyzed, and the binding regions were classified into three categories: upstream from the gene (distinguishing between far upstream and close upstream), internal to the gene (close to the 5′or the 3′end of the gene), and downstream from the gene (Table 1 and Additional file 2: Table S1). Interestingly, about 65% of the identified binding regions were found within coding regions. Among those located in intergenic regions, most of them (865) were present upstream of the assigned genes and some (79) downstream of coding regions. Functional categories of genes with NtcA-binding sites The genes identified as NtcA targets 3 h after N stepdown have been classified into eight functional categories (Table 3). About half of the assigned genes (1,074) encode proteins with unknown function. Within the genes encoding proteins involved in cellular processes (234 genes), 90 were translation-related genes, including several ribosomal proteins, and 22 were related to transcription. Among the genes encoding proteins involved in N metabolism and N fixation, 33 genes were involved in N scavenging and metabolism, including well-known NtcA-dependent genes such as ntcB,nirA,amt4,cphB, etc. [4,8,21]. A total of 179 genes encoding regulatory proteins were found, some of which were already known NtcA-targets, including genes encoding the iron-responsive transcriptional repressor FurA [22], the regulatory factor PipX [23], the two-component response regulator NrrA [24], and the pkn41 and pkn42 genes encoding Ser/Thr kinases with two-component sensor domains [25]. Some of the newly identified regulatory genes with NtcA binding regions were those encoding the transcriptional repressor SmtB (present in the beta plasmid), the two-component response regulator RpaA, or the Ser/Thr phosphatase Alr3732. Interestingly, the proportion of internal NtcA binding regions within the genes encoding regulatory proteins was higher than in other categories of genes. Regarding metabolism-related genes, there were 55 from the central metabolism, including carbon-assimilation genes, and genes activated (e.g. zwf), or repressed (e.g. rbcL), in the heterocysts [10]. Analysis of binding regions with highest NLQ value All the binding regions identified by ChIP-Seq analysis had extremely low Q values due to the exceptional quality of the deep sequencing of the immunoprecipitated DNA. We have used the NLQ value to analyze the binding regions, which allowed us to sort those regions with Q value close to zero. A list of the 40 most represented binding regions (corresponding to highest NLQ values) is shown in Table 2. Within these target regions, we localized putative NtcA-binding sequences, which in most cases were found around the midpoint of the target region and, whenever possible, they were correlated with previously described TSPs (all of which were differentially expressed in N-depleted conditions) by comparison Table 1 Results of the ChIP-Seq of NtcA in Anabaena sp. PCC 7120 after N step-down DNA Size (kb) Binding regions found Genes ascribed Position of the binding region with respect to the gene* Upstream Internal Downstream Chromosome 6413 2143 1939 802 1548 74 Alpha 408 145 103 37 103 5 Beta 187 86 66 16 71 0 Delta 55.4 12 10 2 10 0 Epsilon 40.3 10 9 3 7 0 Gamma 102 28 26 5 23 0 Zeta 5.6 0 Total 7212 2424 2153 865 1762 79 *Total number of entries in Additional file 2: Table S1 (2706) was used (some binding regions have been ascribed to more than one gene). Picossi et al. BMC Genomics 2014, 15:22 Page 3 of 15 http://www.biomedcentral.com/1471-2164/15/22 Table 2 Top-scoring target regions ID NLQ a Start End Gene Description NtcA bs b Putative NtcA binding site and promoter sequences c 1203 8186.60 3561438 3561710 alr2921* tRNA modif. prot. 3561528 GTGTGTCTTGATACAATACTTTTAAGATGACTGTTATATGCTTTCTAAG 1856 7861.39 5515960 5516178 all4613 IlvG 5516125 GAATTACTGACTACAGAATTCCCGCATTAACTTAGCTATCATCTGAGGTT 5516125 GAATTACTGACTAC 1152 7152.53 3427339 3427611 alr2817 HetC [26] 3427445 GTAACATGAGATACACAATAGCATTTATATTTGCTTTAGTATCTCTCTC 390 6288.90 1156154 1156424 alr0990 Amt4 [21] 1156258 GTATTAACTAATACAGAATTAATGTTTAGGTAAATAGACAATCAATC 798 5358.67 2400656 2400888 all2006 Unknown protein 2400815 GTATATTTCAACACGAATTTGATCATTTAGATGGTGTACTGTTTATAGA 931 4728.32 2807226 2807511 alr2328 GlnA (RNA I )[27] 2807342 GTAACAAAGACTACAAAACTGTCTAATGTTTAGAATCTACGATATTTCA GlnA (RNA II )[27] 2807342 GTAACAAAGACTACAATCCAGACGTTCT 1612 4089.39 4795414 4795682 asl3981 Unknown protein 4795535 GGATTTTGTAGCTATCACTAC 4795535 GTAGCTATCACTACAATCTATAGCTTGAAAGAGGAGGAAAATAGGTTGG 293 3663.48 815417 815662 alr0709 Fe-responsive RR [25] 815545 GTATAAATTTTTAC 364 3580.62 1070920 1071178 all0926 § PilL 1071039 GTAGCCCCTGCTAC 1764 3570.57 5243203 5243472 all4376 SpsB [28] 5243396 GTATTGAAAATTACAAAAATCTTATTTACTTATTAGTAACATTGGTGAC 1165 3408.52 3463447 3463731 all2842 § Unknown protein 3463590 GTTACACCTGCTAC 1125 3369.20 3341106 3341375 alr2743 Processing protease 3341205 GTATAACTTGATGCGAATTTGGCGATCGTTCAGAGTTAAGATCACAAACA 1530 3353.43 4573161 4573410 asl3784 hypothetical protein 4573340 GTTAAATAGATTACAAAACTCTGGATGGACTTTGAGTATCATTTAGATA 932 3292.44 2809205 2809466 asl2329 GifA [29] 2809350 GTAGCATAAGATACAGAATTCTTGCTATATTAAATGTG 2098 3220.20 6294152 6294404 alr5275 Gnd 6294223 GTTGATTTGGATACAAATTAAAACTATTTATCTGTGTTACTAGTGAGCTTTTA all5274 Hypothetical protein 6294223 GTATCCAAATCAACAATTAACTTGTAAAATTTGCGA 319 3192.18 902825 903070 all0778 Ser protease inhibitor 902941 GTAGCCATGAATAC 1150 3126.82 3420486 3420738 alr2811 AvtA 3420576 GCTGAGATTGGTAC 2232 2974.32 264949 † 265189 † alr7243 § Similar to ankyrin 265067 † GTAGCCTGTGATAC 898 2824.47 2729431 2729698 all2267 Hypothetical protein 2729550 GTATTGCTGGCTAC 1858 2807.34 5523157 5523405 all4620 a Na + /H + -exch. prot. 5523288 GTATAAGCTGTAAC 1255 2798.00 3732951 3733219 all3084 Hypothetical protein 3733071 GTTAAAATGACGACATTTTAATAAAAAGAAGCATATACTCGATGTA 260 2698.90 701137 701391 all0602 NtcB [30] 701297 GTAACAAAATCTACCAAATTGGGGAGCAAAATCAGCTAACTTAATTGAA 377 2641.34 1111093 1111337 all0956 Unknown protein 1111206 GTAGCATAGACAAC alr0957 FurC [31] 1111206 GTAGCATAGACAAC 519 2592.23 1576957 1577227 asr1328 Hypothetical protein 1577115 GTAACATACACTACGAAACTTATGCTATGTTAGGAAGAA 2149 2572.01 23295 † 23563 † all7026 § DNA binding protein 23435 † GTATTCGCTGATAC 554 2517.34 1669629 1669873 alr1404 Ser acetyltransferase 1669702 GTGACTGGGGATACAGAAAATTTATTTATAGTCCTGTCTACTGTATATTC 1784 2362.05 5312632 5312908 all4432 § EPS biosynthesis 5312767 GTATCAACTGCTAC 1660 2280.02 4946500 4946770 alr4105 § 2-comp. sensor HK 4946621 GTAGCAGGTTATAC Picossi et al. BMC Genomics 2014, 15:22 Page 4 of 15 http://www.biomedcentral.com/1471-2164/15/22 Table 2 Top-scoring target regions (Continued) 2345 2253.01 105303 ‡ 105553 ‡ all7614 Putative porin, OprB-II 81139 ‡ GTATGAAATAGTACAGTTTAAAATTAGTGTTTGCGTCATCATTACGAGA 38 2141.66 69752 69991 asr0064 Hypothetical protein 69882 AGTTCCGTATAGCAAAATAC 1118 2134.47 3325955 3326229 alr2729*cox3 operon 3326057 GTTACTAAAGATACAGTATTTTCTAGCTTTTAAATTTTGAATACAAAGA 1283 2115.10 3807024 3807271 all3144 Hypothetical protein 3807189 GTATCGACCATTAC 94 2063.99 210284 210541 alr0194 Hypothetical protein 210417 GTATTACCTAATAC all0193 Haloalkane dehalogenase 210417 GTATTACCTAATAC 1316 1948.08 3903915 3904189 all3232 2-comp. RR 3904009 GTAACCAAATATAC alr3233 TrpE 3904009 GTAACCAAATATAC 262 1927.75 704040 704304 alr0607 NirA [32] 704169 GTAGCTACTTATACTATTTTACCTGAGATCCCGACATAACCTTAGAA 729 1908.73 2158958 2159198 all1797 Unknown protein 2159129 GTATCCTCTGCTGCTGCACTAGAAGTTTGTTCAAGGTTTAATTGTAATA 1923 1885.93 5718871 5719130 alr4800 Anti-σantagonist 5718952 GATACGATTGATACCGAAATCCTTAGGCGTTTGTGCCTATATTGAGAAAA 2111 1840.96 6328022 6328296 alr5307 Glycosyl transferase 6328115 GTAGTTTTCGCTAC all5306 Exodeoxyribonuclease III 6328115 GTAGTTTTCGCTAC 695 1791.79 2058723 2059007 alr1713* Hypothetical protein 2058829 GTAACCTATAAGACATTTTATTTGATACCTCATACTCTAAAATCAAGTA 776 1744.65 2304064 2304320 alr1921 § Biotin synthase 2304193 GAAGTGTGCTGTAC †Genomic positions within the alpha plasmid. ‡Genomic positions within the beta plasmid. § Target regions located in internal positions of the ascribed genes. All the other target regions are upstream of the ascribed genes. The genes marked with * could be ascribed to sRNAs located in the upstream region of the indicated genes. a NLQ: Indication of the statistical significance of the peak identifying the binding region. b Position in the chromosome/plasmids of the first nucleotide of the putative NtcA binding sites. c The putative NtcA binding sites, -10 boxes and TSPs are in italics. Those that have been previously described are indicated in bold. In some cases, the detected NtcA-binding site could be associated to two TSPs, either of the same gene or of two divergent genes. Picossi et al. BMC Genomics 2014, 15:22 Page 5 of 15 http://www.biomedcentral.com/1471-2164/15/22 with the data from Flaherty et al. [13] and Mitschke et al. [14], as well as from individual analyses [21,25-32]. Some target regions were included in DNA sequences that conform Class-II NtcA-dependent promoters. Among these is the target region with highest NLQ value (#1203), which was located upstream of the ORF alr2921,witha GTGN 8 TAC sequence separated 35 nucleotides from a bulk of 5′-transcript ends activated in combined-N free medium [13], which could represent a putative TSP, preceded by a −10 box (Figure 1). In others, the target region was included in DNA sequences showing a repressor-like position. Finally, in other target regions only a putative binding site could be found with no correlation with any known TSP. In some cases one binding site could be affecting the expression of two TSPs (both of the same gene or of two divergent ones), and in others the putative binding site could be ascribed to two genes (with no apparent relation with any TSP). The target region with second highest NLQ value (region #1856) was located upstream of the ilvG gene encoding an enzyme of the biosynthesis of the branched chain amino acids, which is slightly repressed in combined N-free medium [13,19]. The NtcA binding site identified in this target region, GAAN 8 TAC, overlaps a TSP that is repressed under N depleted Table 3 Functional categories of the assigned genes Category* Number of genes Cellular processes 234 Translation 90 Transcription 22 DNA replication, recombination, and repair 39 Cell killing 5 Cell envelope 44 Others 34 Metabolism 151 Purines, pyrimidines, nucleosides, and nucleotides 25 Fatty acid, phospholipid and sterol metabolism 16 Central metabolism 55 Biosynthesis of cofactors, prosthetic groups, and carriers 55 Nitrogen metabolism and nitrogen fixation-related 121 Amino acid biosynthesis 44 Nitrogen metabolism 33 Heterocyst differentiation and function 44 Regulatory functions 179 Transcriptional regulators 28 Serine/threonine kinases 18 Two-component hybrid sensor and regulators 29 Two-component response regulators 22 WD-proteins 15 Two-component sensor histidine kinases 32 Serine/threonine kinases with two-component sensor domains 11 Phosphatases 3 Others 21 Photosynthesis and respiration 57 Transport and binding proteins 124 Iron-related genes 30 Other categories 213 Hydrogenases 7 Hypothetical proteins 1074 *The eight main categories in which the assigned genes have been classified are indicated in bold. Picossi et al. BMC Genomics 2014, 15:22 Page 6 of 15 http://www.biomedcentral.com/1471-2164/15/22 conditions (Table 2 and [14]). In addition to the repressor effect described above, the NtcA binding sequence upstream of ilvG is separated by 22 nucleotides from the −10 box of an N-dependent activated TSP, thus representing a putative Class II promoter activator site. This is similar to what we have found for the target region located upstream of glnA, which has already been described (Table 2 and [27]). Figure 2 shows two examples of target regions whose sequences contained a Class-II NtcA-dependent promoter structure. One is the well-known NtcA-dependent gene ntcB, whose promoter determinants have already been described [30] (Figure 2A and Table 2). The other example is a high-NLQ target region mapped inside the ORF alr2482 (target region #1165), whose sequence also showed a Class-II NtcA-activated promoter structure that could be regulating an internal TSP activated under N deprivation [14]. In vitro binding of NtcA In order to corroborate our results, we first checked whether our ChIP-Seq analysis identified already known NtcA binding sites located in promoter regions of genes regulated by this transcription factor. Indeed, Additional file 4: Table S2 shows eighteen target regions indentified in this work which include NtcA binding sites identified previously by different means, such as those corresponding to the nitrate assimilation genes nirA and ntcB, the ammonium assimilation gene glnA, and the heterocystrelated genes hetC,xisA and devB, among others. A B alr2921 Figure 1 Nucleotide analysis of the top-scoring target region in the ChIP-Seq experiment showing the presence of an NtcA-binding site. A) Location of the target region (in black) with respect to the adjacent ORFs and in the context of the transcriptomic data from Flaherty et al. [13]. B) Zoomed image of the midpoint of the target region (circled A), the putative TSP (G), and the putative NtcA-binding sequence (GTGTGTCTTGATAC) located 22 nucleotides from a putative -10 box (TATGCT) (CLC Sequence Viewer). Horizontal gray lines indicate transcription [13]. Picossi et al. BMC Genomics 2014, 15:22 Page 7 of 15 http://www.biomedcentral.com/1471-2164/15/22 Additionally, electrophoretic mobility shift assays (EMSA) were performed to check the capability of NtcA to bind in vitro to DNA fragments included in different binding regions (Figure 3) identified in this study. Target regions #605 and #931 (which include the NtcA binding sites located upstream of rbcL and glnA, respectively [Additional file 2: Table S1]) were used as positive controls. As negative controls, we used a DNA fragment upstream of all2096,aninternal region of nrrA,andthepromoterregionofthe Amaranthus hybridus psbA gene, which have not been described as NtcA targets. A selection of twelve binding regions with different features were tested. We included binding regions with low NLQ (#204, 259, 602, 1128 and 1570), and with high NLQ (#364, 996, 1135, 1137, 1203 and 1756). The analyzed binding regions were located intragenically (#204, 259, 364, 602, 1135 and 1570), upstream (#892, 996, 1128, 1203 and 1756), or downstream (#1137) of genes. A putative consensus NtcA binding site was identified in binding regions #204, 364, 602, 892, 996, 1128, 1137, 1203 and 1570, while binding regions #602, 996, 1128 and 1203 were found close to a TSP (Class II-dependent activation compatible sites) (Figure 3). Several concentrations of NtcA were used in the EMSA assays and, in general, there was a correlation between NLQ and the affinity of NtcA for the binding region, which indicated the quality of the results. NtcA showed a Figure 2 Nucleotide analysis of two high-score target regions. A) Promoter sequence of ntcB (all0602), including the NtcA binding site, the −10 box and the TSP (or TSS) (already described) [30], and the midpoint of the target region found in the ChIP-Seq experiment (circled G). B) Analysis of the sequence of the target region found inside ORF alr2482 (midpoint of the target region represented by the circled C), which includes a putative NtcA binding site separated 22 nucleotides from a putative −10 box of an internal regulated TSP [14]. Transcriptomic data was obtained from [13] (12 h after N withdrawal). Picossi et al. BMC Genomics 2014, 15:22 Page 8 of 15 http://www.biomedcentral.com/1471-2164/15/22 higher affinity for binding regions with high NLQ than for those with low NLQ, regardless of the position of the binding regions with respect to the genes. Consensus NtcA-binding site An initial CisFinder analysis of the whole data resulting from the deep-sequencing of the immunoprecipitated DNA, using randomly located subsequences as control, showed a predominant target region-specific motif: GTAN 8 TAC. We have done additional analyses of the NtcA binding sequences identified using the Weblogo application [33] (Figure 4). The consensus sequence of three different groups of NtcA binding sites have been analyzed. The first included the putative NtcA sequences identified in the 40 target regions with highest NLQ (Figure 4A). The well-known NtcA-binding site sequence [4] was obtained, having somewhat conserved T and C nucleotides in positions 4 and 5, and A in positions 10 and 11. When the 508 putative NtcA sequences identified (mainly located in the target regions with highest NLQ values; Additional file 2: Table S1) were analyzed, the NtcA consensus binding site shown in Figure 4B was Figure 3 Electrophoretic mobility shift assay of several binding regions. Results of the EMSA carried out using DNA fragments from the indicated binding regions tested, using the indicated NtcA concentrations. The NLQ value, position with respect to the gene, the ascribed gene, the NtcA binding site identified, and the presence of a TSP are indicated. Picossi et al. BMC Genomics 2014, 15:22 Page 9 of 15 http://www.biomedcentral.com/1471-2164/15/22