Transcriptional regulation in Salmonella enterica by the Lysr-type factor LeuO

Transcriptional regulation in Salmonella enterica by the LysR-type factor LeuO TESIS DOCTORAL ELENA ESPINOSA ALFARO Departamento de Genética Universidad de Sevilla Transcriptional regulation in Salmonella enterica by the LysR-type factor LeuO Memoria elaborada por Elena Espinosa Alfaro para optar al grado de Doctora en Biología Tesis realizada bajo la dirección del Dr. Josep Casadesús Pursals, en el Departamento de Genética de la Facultad de Biología de la Universidad de Sevilla Josep Casadesús Pursals Elena Espinosa Alfaro CONTENTS RESUMEN .................................................................................................................................. 1 INTRODUCTION......................................................................................................................... 5 I.1. The genus Salmonella ............................................................................................. 7 I.1.1. Evolution of Salmonella pathogenicity ................................................... 8 I.1.2. Virulence of S. Typhimurium .................................................................. 9 I.2. Salmonella pathogenicity island 1 (SPI-1) .............................................................. 10 I.2.1. TTSS structure ......................................................................................... 11 I.2.2. SPI-1 main regulators ............................................................................. 12 I.2.3. Other regulators of SPI-1 ........................................................................ 14 I.3. The Salmonella enterica virulence plasmid ........................................................... 19 I.3.1. The transfer region of the Salmonella enterica virulence plasmid ........ 20 I.3.2. Regulation of the tra operon .................................................................. 21 Appendix: Transcriptional silencing and anti-silencing in Salmonella by nucleoidassociated proteins and LysR-type transcriptional regulators ..................................... 29 A.1. Nucleoid associated proteins ................................................................... 29 A.2. H-NS .......................................................................................................... 29 A.3. LTTR transcriptional regulators ................................................................ 31 A.4. LeuO ......................................................................................................... 32 OBJECTIVES ............................................................................................................................... 37 MATERIALS AND METHODS ..................................................................................................... 41 M.1. Bacterial strains .................................................................................................... 43 M.2. Bacteriophages..................................................................................................... 45 M.3. Culture media, solutions and growth conditions ................................................. 45 M.3.1. Bacterial media and growth conditions ............................................... 45 M.3.2. Epithelial cells ....................................................................................... 47 M.3.3. Solutions ............................................................................................... 47 M.4. Bacterial transduction .......................................................................................... 48 M.4.1. P22 lysates ............................................................................................ 48 M.4.2. Transduction in liquid medium ............................................................ 49 M.4.3. Detection of lysogenic transductants .................................................. 49 M.4.4. P22 sensitivity assay ............................................................................. 49 M.5. Conjugation .......................................................................................................... 50 M.6. DNA manipulation and transfer ........................................................................... 50 M.6.1. Plasmids ............................................................................................... 50 M.6.2. Extraction of plasmid DNA ................................................................... 51 M.6.3. Extraction of genomic DNA .................................................................. 51 M.6.4. Digestion, modification and ligation of DNA fragments ...................... 52 M.6.5. Agarose DNA gel electrophoresis ......................................................... 52 M.6.6. Acrylamide DNA gel electrophoresis .................................................... 52 M.6.7. Isolation of DNA fragments from agarose gels .................................... 53 M.7. Bacterial transformation ...................................................................................... 53 M.7.1. High efficiency E. coli transformation .................................................. 53 M.7.2. E. coli and Salmonella electroporation ................................................ 54 M.8. Preparation of a pool of Tn10d::Cm insertions .................................................... 54 M.9. Construction of bacterial strains .......................................................................... 55 M.9.1. Oligonucleotides .................................................................................. 55 M.9.2. Polymerase chain reaction (PCR) ......................................................... 58 M.10. Semi-random, two step PCR (ST-PCR) ................................................................ 58 M.11. Chromosomal gene disruption using PCR products ........................................... 59 M.11.1. Preparation of DNA for substitution .................................................. 60 M.11.2. Cell transformation ............................................................................ 61 M.11.3. Excision of the resistance marker ...................................................... 61 M.11.4. Strain construction by transductional transfer of genetic markers ... 61 M.12. Construction of lac fusions................................................................................. 62 M.12.1. Chromosomal fusions......................................................................... 62 M.12.2. Plasmid fusions................................................................................... 63 M.13. Contruction of 3xFLAG fusions ........................................................................... 63 M.15. DNA sequencing ................................................................................................. 64 M.16. DNA sequence analysis ...................................................................................... 64 M.17. ChIP-on-CHIP ...................................................................................................... 65 M.17.1. Chromatin inmunoprecipitation ........................................................ 65 M.17.2. Labelling for array hybridization ........................................................ 65 M.17.3. Purification of labeled DNA samples .................................................. 68 M.17.4. Microarray hybridization .................................................................... 69 M.17.5. Microarray data acquisition, analysis and data access ...................... 70 M.18. RNA manipulation .............................................................................................. 71 M.18.1. RNA extraction ................................................................................... 71 M.19. Quantitative RT-PCR (qRT-PCR) .......................................................................... 72 M.19.1. Quantification of qRT-PCR results ...................................................... 73 M.20. Protein analysis .................................................................................................. 73 M.20.1. Preparation of proteins extracts for polyacrylamide gels analysis .... 73 M.20.2. Polyacrylamide gel electrophoresis ................................................... 73 M.20.3. Molecular weight markers ................................................................. 74 M.20.4. Coomasie blue staining ...................................................................... 75 M.21. Inmunodetection of proteins by Western-blot .................................................. 75 M.21.1. Nitrocellulose membrane transfer ..................................................... 75 M.21.2. Ponceau staining ................................................................................ 76 M.21.3. Nitrocellulose membrane blocking .................................................... 76 M.21.4. Incubation with primary antibody ..................................................... 76 M.21.5. Incubation with secondary antibody ................................................. 77 M.25.6. Signal detection .................................................................................. 77 M.22. LeuO6His protein purification .............................................................................. 77 M.22.1. Cloning of leuO in pET21a .................................................................. 77 M.22.2. Expression of LeuO6His protein ........................................................... 78 M.22.3. Purification of LeuO6His protein .......................................................... 78 M.22.4. Protein quantification ........................................................................ 79 M.23. Interaction DNA-protein .................................................................................... 80 M.23.1. Electrophoretic mobility shift assay (EMSA) ...................................... 80 M.23.2. Slot blot assays ................................................................................... 80 M.23.3. Footprinting........................................................................................ 81 M.24. β-galactosidase assays ....................................................................................... 81 M.25. Flow cytometry .................................................................................................. 82 M.27. Infection of HeLa cells ........................................................................................ 82 M.28. DNA sequence analysis ...................................................................................... 83 M.29. Statistical analysis .............................................................................................. 83 RESULTS .................................................................................................................................... 85 Chapter 1: LeuO is a global regulator of gene expression in Salmonella enterica serovar Typhimurium ................................................................................................................ 87 C.1.1. Identification of LeuO target genes in Salmonella enterica using a ChIP approach .......................................................................................................... 89 C.1.2. Extension of the LeuO regulon .............................................................. 91 C.1.3. LeuO binding in close proximity to H-NS ............................................... 92 C.1.4. RNA polymerase recruitment to LeuO targets genes ........................... 97 C.1.5. Identification of an A-T rich LeuO binding motif ................................... 98 C.1.6. Genome-wide prediction and validation of LeuO binding sites ............ 99 Chapter 2: Regulation of Salmonella enterica pathogenicity island 1 (SPI-1) by the LysR- type regulator LeuO ..................................................................................................... 105 C.2.1. Activation of LeuO transcription represses SPI-1 .................................. 107 C.2.2. LeuO downregulates SPI-1 expression via HilE and HilD ....................... 109 C.2.3. LeuO activates hilE transcription ........................................................... 113 C.2.4. Binding of LeuO to the hilE promoter ................................................... 114 C.2.5. Activation of leuO transcription inhibits epithelial cell invasion ........... 116 Chapter 3: Regulation of conjugal transfer of pSLT by LeuO ....................................... 119 C.3.1. identification of the LeuO targets in the Salmonella virulence plasmid using a ChIP-CHIP approach ............................................................................ 121 C.3.2. Regulation of the tra operon by LeuO ................................................... 122 C.3.3. LeuO binds upstream finP promoter ..................................................... 122 C.3.4. LeuO positively regulates finP expression ............................................. 123 C.3.5. LeuO downregulates tra expression ..................................................... 124 C.3.6. LeuO represses conjugal transfer of pSLT ............................................. 124 DISCUSSION .............................................................................................................................. 127 D.1. LeuO acts as a global regulator in S. Typhimurium ............................................... 129 D.2. Regulation of SPI-1 by LeuO .................................................................................. 133 D.3. Regulation of pSLT transfer by LeuO ..................................................................... 136 CONCLUSIONS ........................................................................................................................... 139 REFERENCES .............................................................................................................................. 143 TABLE S1 .................................................................................................................................... 169 RESUMEN Introduction 9 I.1.3. Virulence of S. Typhimurium Infection by S. Typhimurium begins with the ingestion of contaminated food or water by the host. In a first step, Salmonella has to overcome the acid pH of the stomach which serves as a barrier to bacterial pathogens. Activation of the acid tolerance response (ATR), which maintains an intracellular pH higher than the extracellular pH, permits Salmonella survival in the stomach (Foster & Hall, 1991). In turn, acivation of bile resistance responses permits Salmonella survival in the duodenum (Ref.). Salmonella interaction with the mammalian intestine occurs at the ileum. Salmonella adheres to the intestinal epithelium, and invades either M cells of the Peyer’s patches or enterocytes (Jones et al., 1994, Takeuchi, 1967) (Fig I.1.2). During invasion there is a profound rearrangement of the eukaryotic cytoskeleton, and these modifications disrupt the epithelial brush border inducing the formation of membrane ruffles that introduce the bacteria inside vesicles called Salmonella-containing vacuoles (SCVs) (Finlay et al., 1991, Francis et al., 1993) (Fig I.1.2). SCVs are integrated in the endocytic pathway, but Salmonella induces changes in this pathway avoiding the fusion with the secondary lysosomes (Garcia-del Portillo & Finlay, 1995, Rathman et al., 1997). A process called vacuole-actin polymerization is produced when an F- actin meshwork that is necessary for the maintenance of the integrity of the vacuole membrane is formed around the SVC (Meresse et al., 2001). SVCs migrate to a perinuclear position in the cell, near the Golgi apparatus (Deiwick et al., 2006, Salcedo & Holden, 2003). Furthermore, long filamentous membrane structures called Salmonella-induced filaments (SIFs) are formed. These structures are tubular aggregates along a scaffold of microtubules that are originated from the SVC and extend throughout the cell (Garcia-del Portillo et al., 1993, Rajashekar et al., 2008, Knodler et al., 2003). Some SVCs migrate to the basolateral membrane and transcytose to the intestinal epithelium where Salmonella is engulfed by three kinds of phagocytes (neutrophils, macrophages and dendritic cells) that transport bacterial cells to the mesenteric lymph nodes through the intestinal lymph (Fabrega & Vila) (Figure I.1.2). Dendritic cells can also open the tight junction of the epithelial cells, develop dendrites, send them to the lumen and take up bacteria directly from the intestinal lumen (Rescigno, 2006) (Figure I.1.2). Macrophages and neutrophils are recruited in response to inflammatory signals, and phagocytate bacteria integrating them within SVCs following a mechanism similar to that described above (Fabrega Introduction 10 & Vila) (Figure I.1.2). Migration of bacteria inside phagocytes favours the dissemination of Salmonella in the host and the development of a systemic infection. Figure I.1.2. Pathogenesis model of S. Typhimurium. Bacterial cells attach to the intestinal epithelium and the invasion process takes place. Alternatively, bacterial cells can be taken up directly by dendritic cells of the submucosa. Once in the cytoplasm, Salmonella localizes and replicates inside the SCV. The SCV transcytoses to the basolateral membrane and releases the bacterial cells to the submucosa. Bacteria are internalized within phagocytes and localized again in a SCV and these infected phagocytes can disseminate trough the lymph and the bloodstream. Figure adapted from Fabrega and Vila (Fabrega & Vila). I.2. Salmonella pathogenicity island 1 (SPI-1) As described above, the first step in Salmonella pathogenesis is the colonization of the intestine and the accession to lymph tissue. This process starts with the invasion of the epithelium, and is mediated by the type three secretion system (TTSS) encoded by Salmonella pathogenicity island 1 (SPI-1). SPI-1 is a 40 kb island of Salmonella-specific DNA, localized at centisome 63 on the chromosome (Darwin & Miller, 1999b). SPI1 contains all the genes necessary to produce a functional TTSS apparatus, several secreted effectors and transcriptional regulators like hilA, hilC, hilD and invF (Figure I.2.1). TTSS have been often described as nanosyringes, and are used to inject bacterial effectors into the host cells (Van Engelenburg & Palmer, Marlovits & Stebbins). The secreted effector proteins SipB-A, AvrA and SptP are encoded in SPI-1 (Lostroh & Lee, 2001). Other Introduction 11 effectors like SopB or SopE are encoded outside of SPI-1 on bacteriophages or pathogenicity islets (Wallis & Galyov, 2000). Figure I.2.1. Diagram of TTSS components encoded on SPI-1. The region encoding the operon sitBCDA is not shown in the figure. Adapted from Lostroh and Lee (Lostroh & Lee, 2001). I.3.1. TTSS structure TTSS is a macromolecular structure composed of a basal body (called inner rod), a needle, and a translocon (Moest & Meresse) (Figure I.3.2). The basal body is composed by three different structures: an inner ring made of 24 subunits of PrgK and PrgH, a neck that spans the periplasmic space and an outer ring. The neck and outer ring are composed of 15 units of InvG (Moest & Meresse) (Figure I.3.2). Linked to the basal body there is a cytosolic complex necessary to make the structure functional. The needle is composed of PrgI protein units that assemble spontaneously on the basal body and grow to the distal end as a flagellar filament. The needle is linked to the inner rod through PrgJ protein that, in turn, controls the length of the needle. The tip of the needle, formed by 5 molecules of SipD, interacts with PrgI (Moest & Meresse) (Figure I.3.2). Translocation of effector proteins is a multistep process. Effectors are delivered form the bacterial cytosol through the TTSS to the eukaryotic host cell, and this secretion is promoted by an ATPase. Introduction 12 Fig I.3.2. TTSS-1 structure. A. Electron microscopy picture of the needle complex. B. Picture of a classaverage from cyro-electron microscopy of a Salmonella TTSS-1. Scale bar: 10 nm Photo: Thomas C. Marlovits (Moest & Meresse) C. Diagram of a TTSS (Burkinshaw & Strynadka). I.3.2 SPI-1 main regulators Salmonella pathogenicity island 1 is essential to inject effector proteins inside the host cell by forming the needle-like structure described above. SPI-1 expression is tightly regulated by five main regulators that form a feed-forward regulatory loop, and by additional regulators encoded outside of SPI-1. HilA HilA is transcriptional regulator belonging to the OmpR/ToxR family (Bajaj et al., 1995). It is encoded inside SPI-1 and activates directly or indirectly most SPI-1 genes. HilA binds prgH and invF promoters, and activates the transcription of these operons and the sic/sip operon as well (Figure I.3.4.). HilA has a revelant role in SPI-1 expression, as indicated by the fact that mutations in hilA cause a drastic decrease in the invasion of M cells and in mouse virulence (Bajaj et al., 1995, Penheiter et al., 1997). Due to this relevant role in infection, hilA is subjected to a strict regulation by many different regulators. It is positively activated by the SPI-1 regulators HilD, HilC and RtsA, and it is negatively regulated by H-NS, Hha, PhoPQ and Fnr (Queiroz et al., Fahlen et al., 2001, Bajaj et al., 1996, Fink et al., 2007) (Figure I.3.4.). Introduction 13 InvF InvF is an AraC/XylS-like transcriptional activator that is required for efficient invasion of cultured epithelial cells (Kaniga et al., 1994, Darwin & Miller, 1999a). InvF is the first???? open reading frame of SPI-1 gene cluster (Kaniga et al., 1994), and it is required, in conjunction with the chaperone SicA (Darwin & Miller, 1999a, Darwin & Miller, 2001), for the expression of sic/sip operons by directly binding to sicA promoter. InvF also activates the expression of effectors encoded outside of SPI-1 such as SopB, SopE and the effector SptP (Darwin & Miller, 1999a, Darwin & Miller, 2001, Eichelberg & Galan, 1999) (Figure I.3.4.). Expression of invF is activated by HilA (Lostroh et al., 2000) and by HilD and HilC (Akbar et al., 2003). HilD HilD is as an AraC/XylS-like protein, is encoded in SPI-1, and it has been described as one of the most important regulators of SPI-1. HilD positively regulates SPI-1 expression at different levels. HilD is able to regulate expression of the SPI- 1 regulators hilA, hilC, invF and rtsA by binding upstream their promoters (Schechter & Lee, 2001, Olekhnovich & Kadner, 2002, Akbar et al., 2003) (Figure I.3.4.) Synthesis of HilD is subjected to tight regulation at transcriptional and posttranscriptional levels. At the transcriptional level, hilD is regulated by the SPI-1 regulators RtsA and HilC- However, HilD is able to bind to its own promoter and to induce transcription independently of the presence of other regulators (Ellermeier et al., 2005, Olekhnovich & Kadner, 2002) (Figure I.3.3). At the postranscriptional level, the 3’ UTR of hilD mRNA, which is unusually long, has a critical role in hilD mRNA stability. It has been proposed that the hilD 3’ UTR is a target for the Hfq chaperone and the degradosome (Lopez-Garrido et al.). HilD translation is regulated by FliZ, SirA, StdEF and by an unknown mechanism under Dam methylation control (Lopez- Garrido & Casadesus, Lopez-Garrido & Casadesus, Chubiz et al., Teplitski et al., 2003). HilD activity is negatively regulated by HilE, a protein that interferes with HilD, and by the Lon protease that degrades HilD (Takaya et al., 2005, Baxter et al., 2003) (Figure I.3.4.). HilD activity is not restricted to SPI-1 regulation; in addition, crosstalk between SPI-1 and SPI-2 connects both islands. HilD controls transcription of ssrAB, the two-regulatory component system of SPI-2 (Bustamante et al., 2008). HilD activates also transcription flhDC, the flagellar master operon, which is essential for Salmonella motility (Singer et al.). Recently, novel HilD targets have been described, many of them outside SPI-1 (Petrone et al.). Introduction 14 HilC HilC is an AraC/XylS-like transcriptional regulator encoded in SPI-1. HilC binds upstream the promoters of hilD, hilA, invF and its own promoter, activating SPI-1 expression. HilC and HilD may recognize the same DNA binding regions (Olekhnovich & Kadner, 2002). HilC is also positively regulated by HilD and RtsA (Ellermeier et al., 2005, Ellermeier & Slauch, 2003). At the protein level is known that Lon protease degrades HilC (Takaya et al., 2005) (Figure I.3.4.). RtsA RtsA belongs to the AraC/XylS family transcriptional regulators and is homologous to HilC and HilD. The rtsA gene forms part of an operon with two transcriptional regulators, rtsAB, localized in a 15 Kb island near the tRNAPheU (Ellermeier & Slauch, 2003). RtsA regulates SPI-1 by activating the hilA and invF promoters, whereas RtsB represses flhDC promoter expression (Ellermeier & Slauch, 2003) (Figure I.3.4.). Like the other SPI-1 transcriptional regulators described above, RtsA is part of the SPI-1 feed-forward loop. RtsA activates its own transcription as well as transcription of hilC and hilD, and is regulated by HilC and HilD, sharing with these proteins the binding site in the rtsA promoter (Olekhnovich & Kadner, 2007). I.3.3 Other regulators of SPI-1 Transcriptional regulators: -H-NS and Hha H-NS is a global regulator that binds A+T regions (Lucchini et al., 2006, Dorman, 2007, Navarre et al., 2006). HhA is a low molecular weight protein that plays a role in bacterial gene regulation acting together with H-NS in a protein complex (Madrid et al., 2007). H-NS and Hha are negative regulators of SPI-1. H-NS and Hha downregulate SPI-1 expression by binding the hilA and rtsA promoters (Fahlen et al., 2001, Olekhnovich & Kadner, 2006, Olekhnovich & Kadner, 2007, Queiroz et al.) (Figure I.3.4.). Introduction 15 - Fur The iron-responsive regulator Fur is required for systemic infection in mice (Troxell et al.). Fur binds to a divalent cation (mainly Fe2+) and then binds to DNA to directly repress downstream genes (Kadner, 2005). In SPI-1, Fur-mediated regulation is carried out through H- NS. Fur binds the H-NS promoter, inhibiting its expression and thereby activating SPI-1 expression (Troxell et al.). - Fis Fis is a nucleoid-associated protein involved in DNA replication, recombination, and transcription. Fis modulates DNA topology in a growth phase-dependent manner (Finkel & Johnson, 1993). Fis activates SPI-1 expression, and a fis mutant is attenuated upon mouse infection (Wilson et al., 2001) (Figure I.3.4.). - PhoPQ The PhoPQ two-component system regulates SPI-1 expression (Figure I.3.4.). Low extracellular cation concentrations and acid pH activates the sensor kinase PhoQ, which activates the regulator PhoP (Garcia Vescovi et al., 1996). Activated PhoP represses SPI-1 through hilA (Golubeva et al.), and activates the transcription of pag genes which, in turn down-regulate hilA expression (Lucas & Lee, 2001, Boddicker et al., 2003). - Fnr In E. coli, transition from aerobic to anaerobic environments and vice versa involve changes in the expression of a large number of genes. The global anaerobic regulator Fnr is a DNA-binding protein that senses O2 concentrations and controls the expression of multiple genes (Fink et al., 2007). In S. Typhimurium, Fnr activates SPI-1 transcription, and is essential for invasion in the mouse model (Fink et al., 2007). Post-transcriptional regulators: - Dam and StdEF Deoxyadenosil methyltransferases are common in bacteria (Cheng, 1995). DNA adenine methylase (Dam) methylates adenine at 5’-GATC-3’ sites by postreplicative modification (Marinus & Morris, 1973). Dam provides signals to initiate chromosome replication (Messer et al., 1985), to direct chromosome segregation (Ogden et al., 1988) and to Introduction 16 target the daughter strand for mismatch repair (Glickman et al., 1978). Due to its multiple roles, Dam methylation is an important factor in cellular welfare, and its loss causes pleiotropic defects (McGraw & Marinus, 1980, Peterson & Mount, 1987, Torreblanca & Casadesus, 1996, Pucciarelli et al., 2002, Prieto et al., 2004) and impairs virulence in mouse model (Heithoff et al., 1999, Garcia-Del Portillo et al., 1999). Dam is also involved in the regulation of gene expression (Balbontin et al., 2006). Dam-regulated genes can be classified into two classes: genes whose expression is coupled to the cell cycle and genes whose expression is controlled by Dam methylation patterns (combinations of methylated and nonmethylated GATC sites). Dam activates SPI-1 expression by upregulating hilD at the posttrancriptional level (Lopez-Garrido & Casadesus). Dam-mediated regulation of SPI-1 turns out to be indirect: Dam methylation represses the std fimbrial operon, and two products of this operon (StdE and StdF) repress SPI-1 (Lopez-Garrido & Casadesus) (Figure I.3.4.). - FliZ FliZ is a posttranscriptional regulator that positively regulates SPI-1 expression at the level of HilD protein. A fliZ mutant is attenuated in the mouse model of Salmonella infection (Chubiz et al.). - SirA SirA/BarA is a two-component system that activates SPI-1 expression by both direct and indirect mechanisms. SirA directly activates SPI-1 expression binding to hilA and hilC promoters and activating transcription of these genes (Altier et al., 2000, Johnston et al., 1996, Teplitski et al., 2003). Indirectly, SirA regulates SPI-1 through CsrA (Teplitski et al., 2003). CsrA is a posttranscriptional regulator that alters the stability of its target mRNAs, and it has been described as a positive or a negative regulator depending upon its target (Liu & Romeo, 1997, Liu et al., 1995, Baker et al., 2002, Teplitski et al., 2003, Wei et al., 2001, Romeo et al., 1993). The Csr system comprises two additional untranslated regulatory RNA molecules, CsrB and CsrC. It has been proposed that CsrB and CsrC bind to CsrA titrating it from its targets (Liu et al., 1997, Weilbacher et al., 2003). Otherwise, it has been proposed that CsrA itself regulates csrB and csrC expression (Fortune et al., 2006). SirA can bind the csrB promoter, and SirA/BarA can activate csrB and csrC expression (Teplitski et al., 2003, Fortune et al., 2006). CsrB and CsrC bind and titrate CsrA (Fortune et al., 2006). The reduction in free CsrA leads to the induction of SPI-1 genes, although the direct Introduction 17 target, or targets, of CsrA in the invasion pathways are not known (Altier et al., 2000, Fortune et al., 2006) (Figure I.3.4.). - Lon and DnaK The ATP-protease Lon and the DnaK chaperone have been described to regulate SPI-1 expression. Lon protease reduces SPI-1 expression by degrading HilC and HilD, whereas DnaK negatively regulates lon expression increasing invasion (Takaya et al., 2005, Takaya et al., 2004)(Fifure I.3.4.). - HilE HilE negatively regulates SPI-1 activity, and repression requires HilD. A hilE strain has invasion rates higher than the wild type (Boddicker et al., 2003, Fahlen et al., 2000). The hilE gene maps at centisome 98, and the region has characteristics of a pathogenicity island: it is located near a tRNALeu and has a low G+C content, 48.1% (Baxter et al., 2003). HilE downregulates SPI-1 at the posttranscriptional level. Two-hybrid analysis indicates that HilE interacts with the HilD protein (Baxter et al., 2003) (Figure I.3.4.). HilE is regulated at the transcriptional and posttranscriptional level. At the transcriptional level, hilE transcription is regulated by FimZ and MIc (Baxter & Jones, 2005, Lim et al., 2007). FimZ is a transcriptional regulator encoded in the fim gene cluster that contains all the components of the type I fimbriae involved in invasion of intestinal epithelial cells (Tavendale et al., 1983). MIc is a global regulator of carbohydrate metabolism that controls genes involved in sugar utilization (Lee et al., 2000, Nam et al., 2001). Expression of hilE is driven by three different promoters: P1, whose transcriptional start site is located at position - 55; P2, located at -160 position; and P3, located at -335 position from the ATG. To activate hilE expression, FimZ binds the P2 promoter, whereas MIc binds the P3 promoter and represses transcription (Baxter & Jones, 2005, Lim et al., 2007) (Figure I.3.3). At the posttranscriptional level, hilE is regulated by IsrM, a pathogenicity islandspecific sRNA which binds to hilE mRNA and downregulates its expression (Gong et al.). An additional target of this sRNA is sopA mRNA (Gong et al.). Introduction 18 Fig I.3.3. Diagram of the locations of hilE promoters and binding sites of FimZ and MIc. The numbers are relative to hilE translational start site. The arrows indicate the transcriptional start sites of P1 (-55), P2 (- 160) and P3 (-335). Binding sites for FimZ and MIc are shown by yellow and blue boxes, respectively. Numbers below boxes indicate the center of the binding sites. Modified from Lim et al. (Lim et al., 2007). Figure I.3.4. Diagram of the regulatory network of SPI-1. Positive effects are indicated by lines ending in arrowheads, whereas blunt lines indicate negative regulatory effects. Introduction 25 - ArcA ArcA is the response regulator of a system involved in sensing the redox state of a bacterial cell and allows adaptation to changes in O2 concentration. The sensor kinase of this two-component system is AcrB, which phosphorylates AcrA in response to microaerobiosis (Lynch & Lin, 1996). Approximately 120 operons are regulated directly or indirectly by AcrAB (Liu & De Wulf, 2004). AcrA was previously described as a gene required for expression of F- like plasmids (Beutin & Achtman, 1979). In the F sex factor, ArcA and TraJ are required for PtraY activation (Silverman et al., 1991) (Figure I.4.5.). In pSLT, ArcA regulates conjugation by two different mechanisms. In aerobiosis, ArcA seems to activate PtraY expression in an AcrB independent manner, whereas in microaerobiosis the sensor kinase AcrB is necessary for activation (Serna et al.). ArcA binds upstream the PtraY promoter, and the binding site is conserved among F-like plasmids (Serna et al., Strohmaier et al., 1998, Silverman et al., 1991). - IHF Integration host factor (IHF) is a nucleoid-associated protein (NAP) that binds multiple DNA targets, acting as a transcription factor for many genes in E. coli (Grainger et al., 2006). IHF bends DNA sharply, and often regulates transcription in conjunction with other NAPs and transcription factors (Browning et al.). In F, IHF forms part of the relaxosome with the TraY and TraI proteins (Howard et al., 1995) and these three components of the relaxosome are required for the nicking reaction in vitro (Nelson et al., 1995). IHF binds to two different sites in F oriT (Tsai et al., 1990) and enhances the cleaving activity of TraI in vitro (Inamoto et al., 1994, Nelson et al., 1995)(Figure I.4.5.). - H-NS Regulation of conjugation carried by H-NS was first described in the F-like plasmid pRK100 in which H-NS acts as an activator of traJ expression (Starcic-Erjavec et al., 2003). However, H-NS acts as a strong repressor of traJ and traM expression in F (Will et al., 2004) by binding to PtraJ and PtraM promoters (Will et al., 2004). H-NS also binds to intrinsically curved DNA at PtraY downregulating transcription from this promoter (Will & Frost, 2006a, Will & Frost, 2006b, Wagner et al.)(Figure I.4.5.). In pSLT, it has been reported that H-NS represses transcription of both traJ and finP (Camacho et al., 2005, Will & Frost, 2006a). Introduction 26 - Lrp The leucine-responsive regulatory protein (LRP) is a bacterial global regulator that can act as an activator and as a repressor. In pSLT, Lrp positively regulates conjugation by activating traJ transcription (Camacho & Casadesus, 2002). The traJ upstream activating sequence (UAS) contains two Lrp binding sites, LRP-1 and LRP-2, and Lrp binding two both sites is necessary for traJ transcription. LRP-2 contains a GATC site whose methylation state influences Lrp binding (Camacho & Casadesus, 2002, Torreblanca et al., 1999). If the GATC is methylated in both strands, Lrp is unable to bind to LRP-2 with an appropriate pattern, and traJ expression is prevented. When the plasmid replicates and the traJ UAS becomes hemimethylated, Lrp can bind to both LRP-1 and LPR-2, and activates traJ expression (Camacho & Casadesus, 2005)(Figure I.4.5.). Activation may occur in one of the plasmid daughter molecules only (Camacho & Casadesus, 2005). - Hfq Hfq (host factor required for phage Qβ RNA replication) is a chaperone that has a role in stability, translation, and RNA bacteriophage replication, often by interacting with small RNAs (Valentin-Hansen et al., 2004, Gottesman, 2004). Hfq preferentially binds regions of AU- rich RNA, flanked by structured regions (Moller et al., 2002, Zhang et al., 2002). In F, Hfq binds to the intergenic UTR, 3’ to traM and 5’ to traJ, decreasing the stability of transcripts containing this region (Will & Frost, 2006b)(Figure I.4.5.). However, Hfq does not appear to be involved in fertility inhibition and has no role in FinOP-mediated repression. Hfq appears to act as a repressor of TraJ and TraM synthesis by desestabilizing the corresponding transcripts (Will & Frost, 2006b). - Cpx The CpxAR two-component system senses envelope stress and responds to this signal via a phosphotransfer reaction. The stress signal is transferred from the CpxA sensor kinase to CpxR. Once phosphorylated, CpxR binds to its target promoters at a consensus sequence (Pogliano et al., 1997, Weber & Silverman, 1988, De Wulf et al., 1999)(Hoch 1995). The cpx (conjugative plasmid expression) regulon was firstly identified by the effects of cpx mutations on conjugation. Namely, cpxA* gain-of-function mutations caused a decrease in conjugation due to the absence of pili in the cell surface (McEwen & Silverman, 1980b, McEwen & Silverman, 1980a). Regulation is indirect: Under stress conditions, the CpxAR Introduction 27 system promote degradation of the transcriptional activator TraJ via the HslVU protease (Lau- Wong et al., 2008)(Figure I.4.5.). - Sdh Succinate dehydrogenase catalyses the oxidation of succinate to fumarate in the tricarboxylic acid cycle (Hederstedt & Rutberg, 1981) (ackrell 1992). Expression of sdhCDAB is regulated in response to oxygen availability and by the composition of the growth medium (Iuchi et al., 1994, Park & Gunsalus, 1995). ArcA binds to the sdhCDAB promoter and represses its expression especially under anaerobic conditions (Shen & Gunsalus, 1997). In rich medium sdhCDAB inhibits pSLT conjugation, probably by an indirect manner. It has been proposed that ArcAB may regulate conjugation by activating tra operon expression and by repressing sdhCDBA (Serna et al.)(Figure I.4.5.). - Dam methylation Dam methylation represses the pSLT tra operon (Torreblanca et al., 1999), a phenomenon also observed in other F-like plasmids such as F and R100 (Torreblanca et al., 1999, Camacho & Casadesus, 2005). As described above, Dam regulation downregulates traJ expression by inhibiting Lrp binding to the UAS in the absence of plasmid replication. In addition, Dam methylation relieves H-NS-mediated repression of the finP promoter by an unknown mechanism (Camacho et al., 2005). - GroEL and CRP Other host-components that have been described as regulators of F-like plasmids conjugation are the cAMP receptor protein, which positively regulates traJ expression (Starcic et al., 2003)m and the heat shock chaperone GroEL, which downregulates R1 conjugation by degrading TraJ upon heat shock (Zahrl et al., 2007)(Figure I.4.5.). Introduction 28 Figure I.4.5. Schematic representation of the plasmid regulatory circuit of F tra region. Positive effects are indicated by lines ending in arrowheads, whereas blunt lines indicate negative regulatory effects. Introduction 29 Appendix 1 Transcriptional silencing and anti-silencing in Salmonella by nucleoidassociated proteins and LysR-type transcriptional regulators A.1. Nucleoid-associated proteins In prokaryotes, the genome is not surrounded by a nuclear membrane; it is located in the cytoplasm in a region called nucleoid. In the nucleoid, the bacterial chromosome is subjected to compaction by a combination of factors including molecular crowding, DNA polymer dynamics, supercoiling and interaction of the DNA with other molecules such as nucleoid-associated protein (NAPs) (Pelletier et al., Dillon & Dorman, de Vries). In addition to participate in conferring structure to the DNA, supercoiling and NAPs regulate gene expression. NAPs are proteins with low-molecular mass whose monomeric subunits can dimerize or oligomerize. NAPs bind to the DNA, altering the DNA structure by bending, wrapping or bridging it, helping to maintain the appropriate level of chromosome supercoiling depending on the different environmental conditions (Tupper et al., 1994, Zhang et al., 1996, Dame, 2005, Travers & Muskhelishvili, 2005). NAPs have also an important role regulating transcription in a positive and negative manner (Dillon & Dorman). A.2. H-NS H-NS is a protein of 15 KDa that is present in approximately 20,000 copies per genome equivalent, is widely represented in Gram-negative bacteria (Dorman, 2007) and has a key role in bacterial gene regulation due to ability to bind DNA and RNA (Brescia et al., 2004). H-NS silences the expression of target genes and plays also a role in DNA compaction. H-NS is highly expressed and is detectable at a constant level throughout the growth cycle. Horizontal gene transfer is a mechanism that increases bacterial genetic variability. In enteric bacteria, regions that have been acquired recently in evolution have the common characteristic of a low G+C content, and H-NS represses preferentially these regions (Lucchini et al., 2006, Dorman, 2007, Navarre et al., 2007). In S. Typhimurium, H-NS binds preferentially to A+T rich regions preventing gene expression (Lucchini et al., 2006, Navarre et al., 2006). In E. Introduction 30 coli, H-NS regulates almost the 5% of the genome, repressing more than 80% of horizontallyacquired genes (Hommais et al., 2001). The mechanisms by which H-NS represses transcription have been extensively studied. First, H-NS binds to intrinsically curved DNA at the promoter to be regulated (Dame et al., 2001, Rimsky et al., 2001). Second, repression is carried out by the formation of a loop closed by two patches of H-NS, inside which RNA polymerase is trapped, or by blocking binding of RNA polymerase to the promoter inhibiting transcription elongation (Schroder & Wagner, 2000, Dame et al., 2002, Prosseda et al., 2004). A nucleic acid-binding domain in the H-NS carboxyl-terminal region is responsible for the recognition of intrinsically curved DNA. In turn, the N-terminal domain is a dimerization domain that has the capacity to form oligomers, possibly through the flexible linker domain that connects the DNA binding domain with the dimerization domain (Dorman, 2004, Rimsky, 2004). At low concentrations, H-NS exists as a dimer, but at higher concentrations or when bound at promoters, H-NS can multimerize into tetramers or oligomers, and this multimerization seems to be a requisite for its silencing function (Navarre et al., 2007). H-NS binds forming bridges between adjacents helices of DNA and also can polymerize along the DNA (Dame, 2005, Dame et al., 2001, Dame et al., 2000, Dame et al., 2002, Dame & Wuite, 2003) (Figure I.2.1). H-NS-like proteins share a domain structure organization and are able to form heterodimers and oligomers (Dorman et al., 1999). A relevant H-NS homologue of enteric bacteria that can interact with H-NS is HhA (Paytubi et al., 2004, Nieto et al., 2002, Johansson & Uhlin, 1999). Hha is generally belived to modulate the DNA-binding and nucleoid-organizing properties of H-NS by forming heteromeric complexes H-NS-Hha-DNA (Madrid et al., 2007, Madrid et al., 2002, Nieto et al., 2000). StpA is an H-NS paralogue that partially compensates hns inactivation and is able to form heterodimeric complexes with H-NS (Deighan et al., 2000, Shi & Bennett, 1994, Williams et al., 1996, Leonard et al., 2009). Although the silencing of horizontally-acquired genes by H-NS may have selective value by avoiding inappropriate expression thereby reducing concomitant fitness costs, H-NS- repressed genes are expressed under specific conditions. Hence, the bacterial cell must possess mechanisms to counteract transcriptional silencing by H-NS. One such mechanism involves the LysR-like protein LeuO (Navarre et al., 2007, Stoebel et al., 2008, Stratmann et al., 2008, De la Cruz et al., 2007, Shimada et al.). Introduction 31 Fig I.2.1. DNA binding modes of nucleoid-associated proteins. H-NS binds to DNA and influences its structure. This binding can result in DNA bridging (left), in which protein binds to two sites that are further apart and causes the DNA between them to form a loop or in DNA coating (right), in which the protein binds to two sites that are close together or the same strand. Picture adapted from Dillon and Dorman (Dillon & Dorman). A.3. LTTR transcriptional regulators LysR-type transcriptional regulators (LTTRs) are the most abundant family protein in the prokaryotic kingdom. LTTRs are highly conserved and ubiquitous among bacteria. Genes that encode LTTRs have a characteristically high G+C content due to a distinct Lys/Arg ratio (Maddocks & Oyston, 2008). Members of this family have been described as global transcriptional regulators acting either as activators or as repressors. The presence of a co-inducer is often necessary to carry out their function; the co-inducer can be a product or an intermediate of a metabolic/synthesis pathway (Heroven & Dersch, 2006, Hernandez-Lucas et al., 2008). A typical LTTR is made of approximately 330 aminoacids. The C-terminus domain is a co-factor binding domain and the N-terminus is a helix-turn-helix motif that binds DNA. LTTRs proteins are usually tetramers (dimers of dimers). Each dimer comprises two subunits a DNA- binding domain and a regulatory domain joined by a linker region each one (Maddocks & Oyston, 2008). The LTTR-binding DNA sequence, called LTTR box, is a palindromic sequence, and often forms part of an imperfect, dyadic region. The sequence presents the consensus T-N11-A, but can vary in both base pair composition and length. LTTRs can cause DNA bending between 50° to 100°, and this bending is often determined by the presence of the co-inducer (Maddocks & Oyston, 2008). LTTR expression is often subjected to autoregulation, and the regulatory DNA bridging DNA coating Introduction 32 binding site of the genes contains an LTTR-box, suggesting that this is the recognition sequence for autoregulation. A.4. LeuO LeuO is a LysR-type transcriptional regulator. The leuO gene is located at the intergenic region between the ilvIH and leuABCD operons, and is divergently transcribed with respect to the leuABDC operon (Figure I.2.2). This region is highly conserved among Enterobacteriaceae and it has been studied in E. coli, Salmonella, Yersinia enterocolitica and Vibrio cholerae. LeuO was firstly described as a regulator implicated in DNA supercoiling, and later as an H-NS antagonist (Fang & Wu, 1998a, Hernandez-Lucas et al., 2008, Shimada et al., Stratmann et al.). Figure I.2.2. Chromosomal location of leuO gene. Diagram adapted from Stratmann et al.(Stratmann et al.). LeuO expression Natural conditions that permit leuO expression remain unclear. In E. coli it was proposed to be expressed under stress conditions in stationary phase, and this expression was supposed to be guanosine 3’,5’-bispyrophosphate (ppGpp) dependent (Fang et al., 2000). Activation of leuO expression has been also described under phosphorous restriction in E. coli (VanBogelen et al., 1996). In turn, Shimada et al., reported that leuO expression in E. coli increases after one week of incubation at 37° C, whereas hns expression decreases as days pass by (Shimada et al.). In vivo, evidence exists that Salmonella may express leuO during infection of C. elegans and of mice (Tenor et al., 2004, Lawley et al., 2006). LeuO self-regulation The gene cluster ilvIH-leuO-leuABCD has a complex regulation, in which H-NS and LeuO pkay an important role (Fang & Wu, 1998a, Chen et al., 2003, Chen & Wu, 2005, Stratmann et al.). The interest of the scientific community in this gene cluster is mainly due to the role carried out by supercoiling in transcription of the promoters in the region. Initially, it was Introduction 33 found that in S. Typhimurium a point mutation in the leu promoter (leu-500) rendered the promoter inactive, but this effect was suppressed in a topA (topoisomerase I) mutant, suggesting that the leu-500 promoter was supercoiling sensitive (Margolin et al., 1985, Pruss & Drlica, 1985, Richardson et al., 1988, Lilley & Higgins, 1991, Chen et al., 1992, Chen et al., 1994, Tan et al., 1994). Later, it was shown that leu-500 promoter activation depends on transcription of the ilvIH operon and of the leuO gene, suggesting that topoisomerase acts over the 1.9 kb region in the chromosome, and that a supercoiling relay mechanism that activates ilvIH results in an activation of leuO and finally of leuABCD (Wu et al., 1995, Fang & Wu, 1998a, Fang & Wu, 1998b, Wu & Fang, 2003). Two additional models of regulation have been proposed, one based in H-NS repression and LeuO derepression and another based in H- NS silencing and RcsB-BglJ activation (Chen et al., 2005, Chen et al., 2003, Chen & Wu, 2005, Stratmann et al.). The model proposed by Chen et al., is based in H-NS silencing and LeuO derepression, in which regulation by LeuO and H-NS is dependent on the presence of two regions called locus control regions (LCRs) with a high A+T content. LCR-I is located between the leuABCD and leuO promoters, and comprises three different regions called AT3, AT8 and AT7 (Figure I.2.3). The AT3 and AT7 regions contain a LeuO binding site, whereas AT8 is called a silencer and is a target for H-NS protein. LCR-II is located upstream the ilvIH promoter and harbours a weak LeuO binding site (Figure I.2.3). In this model of regulation, AT8 is a silencer region to which H- NS binds forming a filament avoiding gene transcription. Under de-repressing conditions, LeuO binds to AT7 and to the LeuO binding site in LCR-II forming a DNA loop which blocks H-NS filament spreading and permits leuO transcription (Figure I.2.3.A.). This model also proposes that LeuO binds with lower affinity to AT3 forming a DNA small loop, avoiding H-NS binding to the silencer region and leading to leuO transcription (Figure I.2.3.C.). On the other hand, if LeuO binds the AT3 and LCR-II regions, H-NS can bind to the AT8 spread along leuO promoter avoiding leuO transcription (Chen & Wu, 2005) (Figure I.2.3.B.). Introduction 34 Figure I.2.3 Model of Chen et al. of leuO regulation by DNA looping-mediated LeuO-LeuO interaction. A. LeuO interacts with AT7 and LCR-II avoiding H-NS spreading and leading leuO transcription. B. LeuO interacts with AT3 and LCR-II leading H-NS spreading and avoiding leuO transcription. C. LeuO interacts with AT3 and AT7 avoiding H-NS binding to the silencer region and its repression, leading leuO transcription. Adapted from Chen and Wu (Chen & Wu, 2005). The model proposed by Stratmann et al., is based upon H-NS silencing of the ilvIH- leuO-leuABCD gene cluster in conjuction with StpA, activation by the RcsB-BglJ heterodimer, and autorepression by LeuO. RcsB is a transcription factor that is the response regulator of the Rcs two-component phosphorelay system that senses perturbations of the outer membrane and the peptidoglycan layer (Majdalani & Gottesman, 2005). BglJ is a transcription factor that activates bgl operon expression (Venkatesh et al.). Stratmann et al., have described in E. coli the presence of two new promoters in the intergenic region between leuABCD and leuO. One of them, P2leuO, is located 149 bp downstream PleuO, previously described by Fang and Wu (Fang & Wu, 1998a). P2leu is located 289 bp upstream Pleu (Wessler & Calvo, 1981) (Figure I.2.4). In this model, it is proposed that H-NS or StpA act as silencers by binding at the intergenic region between P2leuO and PleuO. Transcription can be activated by binding of BcsB-BglJ upstream PleuO avoiding H-NS spreading. Under these conditions, LeuO can act as a weak activator. However, when the LeuO concentration is very high, it can act as a strong repressor of its own transcription (Stratmann et al.) (Figure I.2.4). Materials and methods 43 M.1. Bacterial strains Salmonella enterica serovar Typhimurium and Escherichia coli strains used in this Thesis are listed in Table M1. Salmonella enterica strains are derivatives of ATCC 14028 or SL1344. Table M1. Table of strains used in this work. Strain Genotype Reference E. coli DH5α supE44 ∆lacU169 (Φ80 lacZ∆M15) hsdR17 recA1 endA1 gyrA96 thi-1 reA1 (Hanahan, 1983) BL-21 F- dcm ompT hsdS (rB- mB-) gal (malB+) K-12 (λS) Stratagene S. enterica 14028 Wild type strain ATCC SL1344 his Hoiseth & Stocker, 1981 CJD1034scd SL1344 his leuO::3xFLAG This work CJD1028scd SL1344 his hns::3xFLAG S. Dillon - SL1344 his hns::Km - SV5282 14028 hilA::lacZ J.López-Garrido SV5295 14028 invF::lacZ J.López-Garrido SV5301 14028 invH::lacZ J.López-Garrido SV5384 14028 hilC::lacZ J.López-Garrido SV5386 14028 hilD hilC::lacZ J.López-Garrido SV5534 14028 –pSLT trg::MudQ M.García-Quintanilla SV5546 14028 hilD rtsA::lacZ This work SV5556 14028 spvA::tn5dkm Hensel et al., 1995 SV5584 14028 rtsA::lacZ J.López-Garrido SV5586 14028 hilE::Km This work SV6055 14028 SPI1::Km Baison-Olmo et al., 2012 SV6141 14028 T-POP leuO This work SV6142 14028 T-POP ∆leuO This work SV6413 14028 hilD930::lacZ Lopez-Garrido & Casadesus, 2012 SV6841 14028 T-POP leuO hilA::lacZ This work SV6842 14028 T-POP ∆leuO hilA::lacZ This work SV6844 14028 T-POP leuO hilC::lacZ This work SV6845 14028 T-POP ∆leuO hilC::lacZ This work SV6847 14028 T-POP leuO invF::lacZ This work SV6848 14028 T-POP ∆leuO invF::lacZ This work SV6850 14028 T-POP leuO hilD930::lacZ This work SV6851 14028 T-POP ∆leuO 930::lacZ This work SV6853 14028 T-POP leuO rtsA::lacZ This work SV6854 14028 T-POP ∆leuO rtsA::lacZ This work SV7034 14028 T-POP leuO invH::lacZ This work SV7035 14028 T-POP ∆leuO invH::lacZ This work SV7036 14028 T-POP leuO hilE::Tn10dCm hilC::lacZ This work SV7037 14028 T-POP leuO hilE::Km This work Materials and methods 44 SV7038 14028 T-POP ∆leuO hilE::Km This work SV7044 14028 T-POP leuO hilD hilC::lacZ This work SV7045 14028 T-POP ∆leuO hilD hilC::lacZ This work SV7048 14028 T-POP leuO hilD rtsA::lacZ This work SV7049 14028 T-POP ∆leuO hilD rtsA::lacZ This work SV7312 14028 T-POP leuO hilD::HA This work SV7313 14028 T-POP ∆leuO hilD::HA This work SV7315 14028 T-POP leuO hilE hilD::HA This work SV7316 14028 T-POP ∆leuO hilD::HA This work SV7317 14028 hilD hilE rtsA::lacZ This work SV7318 14028 T-POP leuO hilD hilE rtsA::lacZ This work SV7319 14028 T-POP ∆leuO hilD hilE rtsA::lacZ This work SV7320 14028 hilD hilE hilC::lacZ This work SV7321 14028 T-POP leuO hilD hilE hilC::lacZ This work SV7322 14028 T-POP ∆leuO hilD hilE hilC::lacZ This work SV7323 SL1344 his dam T-POP ∆leuO pefA::GFP This work SV7327 14028 T-POP leuO hilE::lacZ This work SV7328 14028 T-POP ∆leuO hilE::lacZ This work SV7424 SL1344 his T-POP leuO This work SV7425 SL1344 his T-POP ∆leuO This work SV7741 14028 T-POP leuO/pIC552 This work SV7742 14028 T-POP ∆leuO/pIC552 This work SV7743 14028 T-POP leuO/pIZ1997 This work SV7744 14028 T-POP ∆leuO/pIZ1997 This work SV7745 14028 T-POP leuO/pIZ1998 This work SV7746 14028 T-POP ∆leuO/pIZ1998 This work SV7747 14028 T-POP leuO/pIZ1999 This work SV7748 14028 T-POP ∆leuO/pIZ1999 This work SV7749 14028 T-POP leuO/pIZ2000 This work SV7750 14028 T-POP ∆leuO/pIZ2000 This work SV7783 14028 T-POP leuO spvA::tn5dKm This work SV7784 14028 T-POP ∆leuO spvA:.tn5dKm This work SV7892 14028 traN::3xflag M. García-Quintanilla SV7952 14028 T-POP leuO traN::3xflag This work SV7953 14028 T-POP ∆leuO traN::3xflag This work SV7975 14028 sipB::GFP I. Cota & S.B. Hernández SV7976 14028 hilE sipB::GFP This work SV7977 14028 T-POP leuO sipB::GFP This work SV7978 14028 T-POP ∆leuO sipB::GFP This work SV7979 14028 T-POP leuO hilE sipB::GFP This work SV7980 14028 T-POP ∆leuO hilE sipB::GFP This work SV strains belong to Professors J. Casadesús and F. Ramos-Morales laboratory collection. CJD strains belong to Professor C. Dorman laboratory collection. Materials and methods 45 M.2. Bacteriophages P22 HT105/1 int201 (Schmieger, 1972) was used as transducing bacteriophage. For P22 sensitivity assays, the clear-plaque H5 derivative, which harbors a mutation in c2 gene, was used. The P22 c2 gene is an equivalent of cI gene in phage λ. M.3. Culture media, solutions and growth conditions M.3.1. Bacterial media and growth conditions Culture media  LB: Luria-Bertani medium. Rich medium used for the normal growth of Salmonella and E. coli. Tryptone 10 g/l Yeast extract 5 g/l NaCl 10 g/l  LB + 0.3M: Rich media used to obtain the highest rates of invasiveness; in this case LB was supplemented with NaCl at final concentration of 0.3 M.  Low phosphate medium (LPM): Minimal medium that mimics the growth conditions inside the SVC of S. enterica. KCl 5 mM (NH4)2SO4 7.5 mM K2SO4 0.5 mM Casamino acids 0.1% Glycerol 38 mM MES 80 mM K2HPO4/KH2PO4 337.5 µM MgCl2 10 mM pH 7adjusted with KOH Materials and methods 46  EBU: Rich medium used to discard the presence of lysogenic isolates after transduction. EBU is LB medium supplemented with the following components: K2HPO4 25% 10 ml/l Glucose 50% 5 ml/l Fluorescein 1% 2.5 ml/l Evans Blue 1% 1.25 ml/l  SOB: Rich medium used to grow competent cells: Tryptone 20 g/l Yeast extract 5 g/l NaCl 0.5 g/l KCl 0.19 g/l pH 7 adjusted with NaOH After autoclaving, 5 ml of MgCl2 2 M was added. For solid media, agar was added as a final concentration of 15 g/l. When necessary, antibiotics or other chemicals were added to the medium to the final concentrations shown in Table M2. Table M2. Final concentration of antibiotics and other chemicals used in this Thesis. Chemical Final concentration Antibiotics Ampicilin (Ap) 100 µg/ml Chloramphenicol (Cm) 20 µg/ml Kanamycin (Km) 50 µg/ml Tetracycline (Tet) 5 µg/ml Chlortetracycline* 5 µg/ml Other chemicals EGTA 0.004 µg/ml X-Gal 40 µg/ml Materials and methods 47 Chlortetracycline* was added to LB medium. Autoclaving eliminates the antibiotic activity of chlortetracycline but does not affect the capacity of the antibiotic to induce the tetracycline efflux system of Tn10 (Rappleye & Roth, 1997). Growth conditions: E. coli and S. enterica were routinely grown at 37oC, and exceptionally at 30oC. Cultures were shaken at 200 rpm. For microaerophilic conditions, 5 ml of bacteria were incubated at 37o C without shaking in plastic tubes of 10 ml of capacity. M.3.2. Epithelial cells For invasion assays, HeLa human epithelial cells (ATCC CCL2) were used. The medium used was DMEM (“Dulbecco's modified Eagle's medium”, PAA) supplemented with 10% of inactivated bovine fetal serum (to inactivate it, serum was incubated at 56o C for 30 minutes, to avoid the lysis of tumorigenic cells), L-glutamine 2 mM, penicillin 100 U/ml and streptomycin 100 µg/ml. In Salmonella invasion experiments, antibiotics were not added to the medium. Cells were grown in plates of 10 cm of diameter (with 10 ml of culture medium) or 24 multiwell plates (with 1 ml of culture medium per well) at 37o with 5% CO2 in a Biotech Galaxy incubator (New Brunswick Scientific, Eppendorf, Enfield, USA). Cells were sub-cultured twice per week as follows: DMEM was removed, HeLa cells were washed twice with PBS 1x and 1 ml of trypsin 1x (diluted in PBS 1x) was added. Cells were incubated for 10 minutes at 37o C and 5% CO2 and were collected in fresh medium. M.3.3. Solutions  PBS 10x: NaCl 1.37 M KCl 27 mM Na2HPO4·7H2O 43 mM KH2PO4 14 mM pH 7.3 Materials and methods 48 M.4. Bacterial transduction M.4.1. P22 lysates To prepare P22 lysates, 4 ml of P22 stock was mixed with 1 ml of the donor strain. The mixture was incubated at 37o C and 200 rpm for 8-16 h (8 h is the optimal time to obtain the highest rates of cellular lysis). Bacterial debris was removed by centrifugation for 20 min at 4,500 rpm. The supernatant was recovered in a glass fresh tube, and 800 µl of chloroform were added and vortexed. The lysates were maintained at room temperature for a few hours and then stored at 4o C; under these conditions the lysates are stable for months or years.  P22 stock: NB 100 ml E50x 2 ml Glucose 20% 1 ml P22 phage 0.1 ml  NB: Nutrient broth Meat extract 3 g/l Peptone 5 g/l  E50x: H3C6H5O7·H2O 300 g/l MgSO4 14 g/l K2HPO4·3H2O 1965 g/l NaNH4HPO4·H2O 525 g/l The chemicals were added to 1 l of warm H2O following the order indicates in the table. Water was added until the total volume reached 3 l. The medium was cooled and sterilized with chloroform. Materials and methods 49 M.4.2. Transduction in liquid medium To carry out transduction in liquid medium, an aliquot of the recipient strain and an aliquot of an appropriate dilution of the lysate of the donor strain were mixed in a sterile 1.5 ml tube. This mixture was incubated at 37o C and 200 rpm for 30-45 min (depending on the marker of transduction). The mixture was spread on selective plates that were incubated at 37o C until colonies appeared. This method does not yield independent transductants, but incubations shorter than 30 minutes do not permit transductants to divide, so the proportion of twins is minimal. On the other hand, it has the advantages of being fast and repetitive. Using dilutions of the transduction mixture, a number of multiplicities of infection can be tested for the same transduction. M.4.3. Detection of lysogenic transductants Transductans harboring a selective marker could have been infected by P22 phage and become pseudolysogenic (the int mutation avoids integration, and delays the formation of true lysogens). As time goes on, pseudolysogens become resistant or immune to new P22 infections and cannot be lysed or transduced again. Pseudolysogeny should thus be avoided. For this purpose, transductant colonies were isolated in EBU plates (with antibiotics if necessary). In these plates, pseudolysogens are dark colored and P22-free colonies are light colored. This color difference is due to cell lysis in the pseudolysogenic colony, which causes acidification of the medium and turning of the pH indicator, darkening the agar. A transductant was considered P22-free when streaking did not give rise to any dark colony. M.4.4. P22 sensitivity assay In EBU plates, isolates that forms light colour colonies could be lysogens that do not undergo visible lysis. These isolates are P22-resistant and can be mistaken by real P22-free isolates. To avoid this situation, an assay to detect P22-sensitive strains is advisable. A streak with a P22 H5 lysate is done on an LB or EBU plate, and air-dried. The test strain is then streaked in a perpendicular way to the H5 streak. P22-sensitive strains grow until they reach the H5 streak, while P22-resistant strains grow over the streak. Materials and methods 50 M.5. Conjugation To perform assays of conjugative transfer of the pSLT plasmid, cultures of donor and recipient strains were grown overnight in LB with chlortetracycline. An aliquot of 1 ml was recovered, centrifuged at 13,000 rpm for 3 minutes and washed with 1 ml of LB with chlortetracycline. Cells were harvested by centrifugation and the pellet was re-suspended in 20 µl of LB with chlortetracycline. The donor and the recipient were then sucked onto a Millipore filter of 0.45 µm pore size. The filters were placed on LB plates with chlortetracycline and incubated at 37o C for 4 h in a GasPak microaerophilic jar (Camacho & Casadesus, 2002). Microaerophilic conditions were obtained by a GENbox Anaer bag, supplied by BioMériex (Marcy l'Etoile, France). An anaerobic indicator was used to show to monitor microaerophilic conditions. M.6. DNA manipulation and transfer M.6.1. Plasmids Plasmids used in this Thesis are listed in Table M3. Table M3. List of plasmids used in this thesis. Plasmid Description Reference pCE36 FRT lacZY oriR6K, Kmr Ellermeier et al., 2002 pCE37 FRT lacZY oriR6K, Kmr Ellermeier et al., 2002 pCE40 aph FRT 'lacZ lacY+ this oriR6K, Kmr Ellermeier et al., 2002 pCP20 bla cat cI857 λPR flp pSC101 oriTS, Apr, Cmr Cherepanov & Wackernagel, 1995 pIC552 galK' lac+, Apr Macian et al., 1994 pKD3 bla FRT cat FRT PS1 PS2 oriR6K, Apr, Cmr Datsenko & Wanner, 2000 pKD4 bla FRT aph FRT PS1 PS2 oriR6K, Apr, Kmr Datsenko & Wanner, 2000 pKD13 bla FRT aph FRT PS1 PS4 oriR6K, Apr, Kmr Datsenko & Wanner, 2000 pKD46 bla PBAD gam bet exo pSC101 oriTS, Apr Datsenko & Wanner, 2000 pNK2880 Ptac-tnpA ats-1 ats-2, Apr Kleckner et al., 1991 pSUB11 Kmr, 3xFLAG Uzzau et al., 2001 pET21a vector used to construct 6His fusions ,Apr Novagen pIZ1871 pET21a-leuO-6His This work Materials and methods 51 pIZ1997 pIC552-hilE(-505/-56)Apr This work pIZ1998 pIC552-hilE(-159/-56)Apr This work pIZ1999 pIC552-hilE(-334/-161)Apr This work pIZ2000 pIC552-hilE(-505/-336)Apr This work M.6.2. Extraction of plasmid DNA For the extraction of plasmid DNA was used the commercial system GenEluteTM Plasmid Miniprep Kit provided by Sigma-Aldrich Co (St. Louis, Missouri, USA). M.6.3. Extraction of genomic DNA For the extraction of genomic DNA, 5 ml of cells grown in exponential phase were collected and re-suspended in 0.4 ml of buffer lysis, 4 µl of RNAse (10 mg/ml) were added and the mixture was incubated at 37o C for 30 minutes. After that, 20 µl of proteinase K (20 mg/ml) was added and it was incubated for 2 h at 65o C. Finally, were performed 3 or 4 extractions with phenol: chloroform-isoamyl alcohol in a 2: 1 proportion. Optionally, one extraction with chloroform: isoamyl alcohol (24:1) can be performed. DNA was precipitated al -20o C by adding 1/10 volume of sodium acetate 3 M and 2.5 volumes of ethanol. After precipitation, genomic DNA was washed with 70 % ethanol and re-suspended in 20 µl of TER buffer.  Buffer lysis Tris-HCl 50 mM pH 8 EDTA 10 mM NaCl 100 mM SDS 0.2 %  TER: Tris-HCl 10 mM pH 7.5 EDTA 1 mM pH 8 RNAse 20 µg/ml Materials and methods 58 hilE-Rev-EMSA-P3 TGTGAATATATTTAATGTTTTTATCGCG STM4318-Dir-EMSA-6xFAM FAM-AACACCTTCACCTAATGCCG STM4318-Rev-EMSA AACATCATCGGATCCATCG finP2-Dir-EMSA-6xFAM FAM-CCTCCTCACAAATTCACCTC finP-Rev-EMSA TATTGAACTCTTCTCTAAAG Footprinting envR-For-Dnase ATCATTCAACGTCGTGTTGG envR-Rev-Dnase TTATTTTGGGATGGGGTTCA M.9.2. Polymerase chain reaction (PCR) For PCR reactions, a Perkin Elmer Gene-Amp PCR system 2400 thermocycler (Perkin Elmer Cetus, Waltham, Massachusetts, USA) was used. PCR reactions were carried out with 1 ng of DNA, 100 µM of dNTPs (final concentration each), 1 µM of oligonucleotides, 1mM of MgCl2, and 1 U of Taq polymerase per reaction in a final volume of 100 µl. The polymerase used in these reactions was Taq ExpandTM High Fidelity PCR System supplied by Roche Diagnostics GmbH. To confirm clones and mutations, colony PCR was performed using Go Taq® Flexi DNA Polymerase (Promega Co.), in these cases, a mixture with 100 µM of dNTPs each one, 0.2 µM of oligonucleotides, 1 mM of MgCl2 as final concentration and 1 U of Taq polymerase per reaction in a final volume of 25 µl was prepared. A colony was re-suspended in this mixture and was used as DNA template. Before use PCR products, enzyme, oligonucleotides and dNPTs were cleaned using the commercial Wizard® SV Gel and PCR Clean-Up System, which was supplied by Promega Co. M.10. Semi-random, two-step PCR (ST-PCR) The ST-PCR protocol was used to amplify genomic regions adjacent to a Tn10d::Cm insertion (Fig M1). In a first step, a PCR reaction was carried out over candidates using oligonucleotides ST-PCR-Cm2-EXT and STGATAT or STACGCC (Table M4) in a final volume of 25 µl, following the next protocol: (i) first denaturation, 2 min at 94o C; (ii) 6 cycles of Materials and methods 59 Chromosomal DNA Tn10dCm STGATAT ST1 5’ GGCCACGCGTCGACTAGTAC-NNNNNNNNNN-GATAT 3’ Defined sequence Degenerate sequence ST-PCR-Cm-2-EXT ST-PCR-Cm-2-INT denaturation (94o C, 30 s), annealing (42o C, 30 s, -1o C per cycle), and extension (72o C, 3 minutes); (iii) 25 cycles of denaturing (94o C, 30 s), annealing (65o C, 30 s), and extension (72o C, 3 minutes); and (iv) a final incubation at 72o C for 7 min to finish the extension. The second reaction was carried out with the oligonucleotides ST1 and ST-PCR-Cm2-INT. The DNA product of the previous PCR was diluted 1:5 and 1 µl was used as DNA template. The second PCR protocol was: (i) first denaturation, 30 s at 94o C; (ii) 30 cycles of denaturation (94o C, 30 s), annealing (56o C, 30 s), and extension (72o C, 2 min); and (iii) a final extension at 72o C for 7 minutes to finish the extension. Final products were sequenced using the oligonucleotides ST1 and ST-PCR-Cm2-INT. Fig. M1. Representative scheme of the PCR reactions. The last five nucleotides of the oligonucleotides STGATAT allows the hybridization of the oligonucleotides along the genome of Salmonella at a certain number of base pairs. There were used two different kinds of these oligonucleotides, one finished in GATAT and the other, in ACGCC. Because the Salmonella genome has a G+C content of 52%, oligonucleotides STGATAT will bind every 1159 bp [1/(0,26 x 0,24 x 0,24 x 0,24 x 0,24)], and oligonucleotides STACGCC will bind every 912 bp [1/(0,24 x 0,26 x 0,26 x 0,26 x 0,26)]. The drawing has been adapted from Chun et al. 1997 (Chun et al., 1997). M.11. Chromosomal gene disruption using PCR products To obtain knockout mutants of chromosomal genes, the method described by Datsenko and Wanner was used (Datsenko & Wanner, 2000). This method is based in the λ Red recombination system. One of the reasons why E. coli and Salmonella are not transformable with linear DNA is due to the presence of intracellular exonuceases that degrade it. The λ Red system harbors α, β and exo genes that codify for the proteins Gam, Bet and Exo, respectively. Gam inhibits host exonuclease V, allowing the Bet and Exo proteins to carry out recombination of the DNA. The strategy consists in replacing the chromosomal sequence (for example gene B in Fig. M2) by an antibiotic resistance marker that is generated by PCR using oligonucleotides that harbor 40 nucleotides of homology with the sequence to be Materials and methods 60 Step 1: PCR amplification of the antibiotic resistance marker flanked by FRT sequences Step 2: Transformation of the strain that expresses Red recombinase Step 3: Selection of the transformants resistant to the antibiotic Step 1: Excision of the resistance marker using the FLP system Gene A Gene B Gene C H1 H2 Gene A Antibiotic resistance Gene C H1 H2 P1 P2 Antibiotic resistance Gene A Gene C replaced (H1 and H2 in Fig. M2). λ Red recombination gene expression is carried out under an inducible promoter inside a termosensitive low copy number plasmid (pKD46). After selection, gene resistant marker can be removed using a different plasmid (pCP20) that harbors the FLP recombinase of the 2 µ plasmid of Saccharomyces cerevisiae. FLP system acts over FRT repetitions (“FLP recognition target”) that flank the sequence (Fig M2). Plasmids that harbors Red and FLP system are termosensitives and can by cured easily growing the cells at 37o C. Fig. M2: Scheme of the inactivation system by PCR. H1 and H2 are related to the homology regions with the disrupting sequence. P1 and P2 are the homology sequences that flank the antibiotic gene sequence. Figure adapted from Datsenko and Wanner (Datsenko & Wanner, 2000). M.11.1. Preparation of DNA for substitution Plasmids used as templates in PCR reactions were pKD3 (CmR), pKD4 (KmR) and pKD13 (KmR). Oligonucleotides had 40 nucleotides that were homologous to the genomic DNA and 20 nucleotides that were homologous with pKD3, pKD4 and pKD13. PCR reactions were carried out at 55o C of annealing temperature and 2 minutes of extension, the enzyme employed was “Taq ExpandTM High Fidelity PCR System” supplied by Roche Diagnostics GmbH. PCR product was subjected to an electrophoresis in agarose gel and the amplification band was purified Materials and methods 61 using the commercial system “Wizard® SV Gel and PCR Clean-Up System”, which was supplied by Promega Co. M.11.2. Cell transformation Competent cells of wild type strain that harbored pKD46 plasmid were prepared. This plasmid expresses λ Red system under the araB promoter, which is inducible by arabinose. Cultures grown in LB with ampicillin at 30o C were diluted 1:100 into LB with ampicillin and arabinose (1 mM) and they were incubated in a shaker at 30o C until they reached an OD600 0.5. The competent cells were prepared and electroporation was done as described previously. M.11.3. Excision of the resistance marker After the substitution of the genomic genes, mutations were transferred to different genomic backgrounds by transduction with P22 and selecting in the appropriate selective media. When it was necessary the resistance marker of the host was excised by transducing the plasmid pCP20 with P22. This transduction was incubated at 30o C for 1 h and was spread in LB with ampicillin. To eliminate the plasmid, EBU plates were prepared without antibiotic and incubated at 37o C. To confirm the excision of the marker, the strains were streaked in plates of LB ampicillin and plates of LB with chloramphenicol or kanamycin. The excision of the antibiotic marker was checked by colony PCR with external oligonucleotides. M.11.4. Strain construction by transductional transfer of genetic markers Genetic markers were transferred from one strain to another by transduction. The recipient strain was transduced using a P22 lysate from a strain with the desirable genetic marker. All the markers used in this thesis were selected directly by spreading the transduction mixture on selective media. If necessary, acquisition of the marker by the transductant was confirmed by PCR or phenotypic analysis. Materials and methods 62 KmR +FLP (pCP20) pCE36 +FLP (pCP20) lacZ lacY KmR oriR6K this lacZ lacY this KmRoriR6K M.12. Construction of lac fusions M.12.1 Chromosomal fusions The method described by Ellermeier et al. was used to construct transcriptional and translational fusions (Ellermeier et al., 2002). This method allows the construction of lac fusions using the FLP/FRT recombination system. As described previously in the method developed by Datsenko and Wanner (Datsenko & Wanner, 2000), a selectable marker (e. g., conferring antibiotic resistance) can be inserted at any place in the bacterial chromosome. The insertion is flanked by two FRT sites, and the marker can be removed using the plasmid pCP20, that harbors the FLP system. As a result of the excision there is one FRT site only at the insertion place (Fig M3). This FRT site can be used to insert a plasmid that harbors a FRT site upstream of the lacZY genes, yielding a transcriptional or translational fusion depending on the plasmid chosen. Ellermeier et al. constructed three different plasmids: pCE36 and pCE37 for transcriptional fusions, and pCE40 for translational fusions. Plasmid pCE40 lacks the ribosomal binding site of lacZ and has STOP codons in all the frames, except one. These plasmids harbor a Km resistant gene and the replication origin of R6K (which is active when the protein π is present). Choice of plasmid depended on the orientation of the FRT in the original mutation (Fig M3). Materials and methods 63 Fig. M3: Scheme of construction of a lac fusion in the chromosome. As an example, the construction of a transcriptional fusion using the plasmid pCE36 is shown (Ellermeier et al., 2002). M.12.2. Plasmid fusions Plasmid pIC552 was used to construct transcriptional lacZ fusions in vitro; in this plasmid, the lacZ ORF is preceded by the translational start site of galK (Macian et al., 1994). The galK ribosomal binding site and its adjacent region guarantee a high efficiency of the lacZ translation, so that the β-galactosidase activity is directly proportional to the transcriptional activity in vivo of the fragment cloned. Cloning of hilE promoters on pIC522 plasmid was performed using oligonucleotides listed in Table M4. M.13. Construction of 3xFLAG fusions The method described by Uzzau et al. (Uzzau et al., 2001) was used for tagging proteins with the 3xFLAG epitope. This method is an adaptation of the Datsenko and Wanner recombineering procedure (Datsenko & Wanner, 2000). The objective is to manipulate the chromosomal sequence, adding a DNA fragment that contains the sequence of the 3xFLAG epitope and a selectable marker (KmR). The construction is made by PCR and transformation (Fig. M4). As a rule, one of the oligonucleotides used in the amplification has a sequence of roughly 40 nucleotides P1 in Fig M4) that corresponds to the downstream nucleotides of the gene to be tagged without its STOP codon. The other oligonucleotide (P2 in Fig M4) contains a sequence of 40 nucleotides homologous to the sequence next to the STOP codon (but in the complementary DNA strand). The plasmid used as template is pSUB11 (Table M3) which harbors three copies of the FLAG epitope next to a Km resistance gene. The PCR product is used to transform a strain that contains the pKD46 plasmid, which expresses the λ Red system. Correct insertion of the epitope can be proven by PCR using external oligonucleotides, and by Western blot using anti-FLAG monoclonal antibodies. If necessary, the Km marker can be excised by FLP recombinase. Materials and methods 64 3xFLAG KmR P1 P2 Step 1: PCR amplification of the 3xFLAG epitope and the antibiotic resistance Step 2: Transformation of the strain that expresses Red recombinase 3xFLAG KmR Gene A Gene B Step 3: Confirmation of the construction by western blot 3xFLAG KmR Gene A Gene B Fig M4: Construction of fusion proteins with the 3xFLAG epitope. M.15. DNA sequencing Plasmid DNA and chromosomal DNA obtained by PCR were sequenced in the sequencing service of Sistemas Genómicos S.L. (Parque Tecnológico de Paterna, Valencia) or by Stab Vida (Oeiras, Portugal). M.16. DNA sequence analysis Bioinformatic analysis of DNA sequences was performed using the algorithms of molecular biology of the National Center for Biotechnology Information (NCBI) at www.ncbi.nlm.nih.gov. Materials and methods 65 M.17. ChIP-on-CHIP M.17.1. Chromatin immunoprecipitation For chromatin immunoprecipitation, 25 ml of SL1344 cells were harvested for each ChIP procedure following the protocol described in Dillon et al., (Dillon et al.,2010). Fixation Cells were collected by centrifugation at 4,000 rpm for 8 min at room temperature and re-suspended in 50 ml of pre-warmed PBS 1x at 37o C in a glass flask. DNA-protein and proteinprotein interactions were cross-linked by adding formaldehyde (37%). Addition of 1355 µl formaldehyde was performed drop-wise to a final concentration of 1%. The cross-linking was carried out at room temperature with constant but gentle stirring for 30 min. Addition of 3.425 ml of ice-cold 2M glycine to a final concentration of 0.125 M was performed by constant but gentle stirring for 5 min at room temperature to stop the cross-linking reaction. Cells were transferred to 50 ml falcon tubes and kept on ice whenever possible. The cells were pelleted by centrifuging at 4000 rpm for 8 min at 4o C. Cell lysis After removing the supernatant, the cells were re-suspended in 1.2 ml of lysis buffer (LB) and incubated on ice for 10 minutes. Sonication 1.8 ml of IP dilution buffer (IPDB) was added, and the samples were transferred to 5 ml glass falcon tubes (Falcon 2058). The chromatin was sonicated to reduce the DNA length to an average size of approximately 550 bp using the Sanyo/MSE Soniprep sonicator (London, UK). The tip of the probe was dipped to reach approximately halfway down the total level of the liquid sample and the tube was kept constantly on ice. The settings used for the sonicator were: amplitude, 10 microns; number of bursts, 8; length of bursts, 30 seconds. The samples were allowed to cool on ice for 1 min each pulse (5 µl of the sheared chromatin was run on an Materials and methods 66 agarose gel to check sonication). The sonicated chromatin was transferred to 2 ml microfuge tubes and spun down at 13000 for 10 minutes at 4o C. Immunoprecipitation The supernatant was transferred to a 15 ml falcon tube and 3 ml of IPBD was added (LB:IPBD ratio was 1:4), the sheared chromatin can be snap frozen in liquid nitrogen at this stage and the frozen samples should be stored at -70o C. When needed, the samples should be thawed on ice and the experiment carried on as per protocol. The chromatin was pre-cleared by adding 50 µl of normal rabbit IgG (Upstate Biotechnology, New YorK, USA). The samples were incubated for 1 hour at 4o C on rotating wheel. 100 µl of homogeneous protein G-agarose (Roche) was added to the pre-cleared chromatin and the samples were incubated for 3-5 hours at 4o C on a rotating wheel. The samples were centrifuged at 7500 rpm for 2 minutes at 4o C to pellet the protein G-agarose beads and the supernatant was used to set up various immunoprecipitation (IP) conditions in 2 ml microfuge tubes. An aliquot of 200 µl of chromatin was stored at -20o C to be used as input sample for array hybridizations. Experimental and control ChIP conditions were set up as follows: - Normal species specific IgG control (matching the species from which antibody used in ChIP conditions(s) was derived) – 1350 ml of chromatin + 10 µg species specific IgG. - ChIP conditions – 1350 of chromatin + 5-10 µg of antibody (3 µl for FLAG-tag antibody and 10 µl of RNAP). The samples were incubated at 4o C overnight on a rotating wheel, centrifuged at 13000 for 5 minutes at 4o C and transferred to fresh 2 ml microfuge tubes. 50 µl of homogeneous protein G-agarose suspension was added to each sample and the samples were incubated at 4o C for at least 3 hours on a rotating wheel. The samples were centrifuged at 7500 rpm for 2 minutes at 4o C to pellet the protein G-agarose beads. The supernatant was removed and the protein G-agarose beads were carefully washed. For each wash, buffer was added, the samples were vortexed briefly, were centrifuged at 7500 rpm for 2 minutes at 4o C and left to stand on ice for 1 minute before removing the supernatant. These washes were carried out in the following sequence: a) The beads were washed twice with 750 µl of cold IP wash buffer 1. The beads were transferred to a 1.5 microfuge tube after the first wash. Materials and methods 67 b) The beads were washed once with 750 µl of cold IP wash buffer 2. c) The beads were washed twice with 750 µl of cold TE pH 8.0. Elution DNA-protein-antibody complexes were eluted from the protein G-agarose beads by adding 225 IP elution buffer (IPEB). The bead pellets were re-suspended in IPEB, briefly vortexed and centrifuged at 7500 rpm for 2 minutes at room temperature. The supernatant was collected in fresh 1.5 ml microfuges tubes. The bead pellets in the original tubes were resuspended in 225 µl of IPEB again, briefly vortexed and centrifuged at 7500 rpm for 2 minutes. Both elutions were combined in the same tube. Reversal of cross-link The reversal of cross-link step was carried out on the Input sample which was stored at -20o C previously. 0.1 µl of RNase A (10 mg/ml, 50 Kuntiz units/mg, ICN Biochemicals, Santa Ana, California, USA) and 16 µl of 5M NaCl (to the final concentration of 0.3 M) was added to the Input DNA sample. Similarly, 0.2 µl of RNase A (10 mg/ml, 50 Kunitz units/mg) and 27 µl of 5 M NaCl (to a final concentration of 0.3 M) was added to each of the IP test samples. All the samples including the Input DNA sample were incubated at 65o C for 6 hours to reverse the cross-links. 9 µl of Proteinase K (10 mg/ml, 20 U/mg, Gibco BRL) was added to each sample and incubated at 45o C overnight, the samples can be stored after this step. When needed the samples can be thawed at room temperature and the DNA extracted as per the protocol. Extraction of DNA Two µl yeast tRNA (5 mg/ml, Invitrogen, Life Technologies) was added to each sample just before adding 250 µl of phenol (Sigma) and 250 µl of chloroform. The samples were vortexed and centrifuged at 13000 rpm for 5 min at room temperature. The aqueous layer (top layer) was collected in fresh 1.5 ml microfuge tubes and 500 µl of chloroform was added to each sample. The samples were vortexed and centrifuged at 13000 rpm for 5 min at room temperature. The aqueous layer was transferred to a fresh 2 ml microfuge tube. 5 µg of glycogen (5 mg/ml, Roche), 1 µl of yeast tRNA (5 mg/ml, Invitrogen) and 50 µl of 3 M NaAc (pH 5.2) was added to each sample and mixed well. The DNA was precipitated with 1375 µl of Materials and methods 74 a Mini Protean® III (Bio-Rad) vertical system, proteins were packed in a stacking gel 1 cm long, to be separated afterwards in a resolving gel 5 cm long. The acrylamide percentage varied between 10% and 12% depending on the size of the proteins to be separated, and the stacking gel contained 4% acrylamide. Electrophoresis was performed in running buffer 1x, subjected to an electric field of 175 V for 45-60 min.  Stacking gel: Tris-HCl 125 mM pH 6.8 SDS 0.1 % (w/v) Acrylamide: bisacrylamide 40% 4% (Solu Gel 29:1 Ultra Pure, Pronadisa) TEMED 0.1% (v/v) Ammonium persulfate 0.05% (w/v)  Resolving gel: Tris-HCl 375 mM pH 8.8 SDS 0.1 % (w/v) Acrylamide: bisacrylamide 40% 10-12% TEMED 0.05% (v/v) Ammonium persulfate 0.05% (w/v)  Running buffer (10x): Glycine 144.1 g/l SDS 10 g/l Trizma base 30.3 g/l pH 8.8 M.20.3. Molecular weight markers As molecular weight ladders, two different commercial markers were used: SDS-PAGE Molecular Weight Standards Low Range and Prestained SDS-PAGE Standards Broad Range (Bio- Rad). Materials and methods 75 M.20.4. Coomasie blue staining Coomassie Brilliant Blue R-250 (Sigma-Aldrich) was used to stain SDS-PAGE gels. For staining, gels were submerged into a staining solution for 30 min. The staining solution was then removed, the gel was washed with dH2O, and submerged into destaining solution. The gel was covered with destaining solution until protein bands were visible.  Staining solution: Coomassie Brilliant Blue R-250 0.25% (w/v) Acetic acid 10% (v/v) Ethanol 10% (v/v)  Destaining solution: Acetic acid 10% (v/v) Ethanol 40% (v/v) M.21. Immunodetection of proteins by Western blot M.21.1. Nitrocellulose membrane transfer Proteins subjected to SDS-PAGE were transferred to a nitrocellulose filter (Amersham Hybond-ECL, GE Healthcare) using a wet transfer system (Trans-Blot cell, Bio-Rad). The gel in contact with the nitrocellulose filter was enclosed with Whatman 3MM paper, and everything was soaked in transfer buffer 1x. Upon introduction into the electrophoretic tank, the sample was subjected to an electric field of 80 V for 120 min. To avoid increasing the temperature of the tank, an ice container was introduced inside it.  Transfer buffer 4x: Trizma base 12.1 g/l Glycine 57.6 g/l Transfer buffer 1x contains 20% ethanol and 0.04% SDS. Materials and methods 76 M.21.2. Ponceau staining After transfer, the membrane was washed twice with dH2O and was stained with Red Ponceau Solution for 3 minutes. The membrane was washed again with dH2O until bands were visible. This provided a loading control if necessary.  Red Ponceau Solution Red Ponceau 0.5% (w/v) Acetic acid 1% M.21.3. Nitrocellulose membrane blocking Previously to the incubation with antibodies, a nitrocellulose membrane was saturated with blocking buffer for at least 30 min at room temperature with soft shaking or at 4oC overnight.  Blocking buffer: Skimmed milk (Difco, BD, Massachusets, USA) 5% (w/v) Sodium azide 0.02% This buffer was prepared in TBS-Tween 1x.  TBS-Tween 10x: Trizma base 24.2 g/l NaCl 80 g/l Tween-20 10 ml pH 7.6 M.21.4. Incubation with primary antibody After membrane blocking, the primary antibody, which was appropriately diluted in blocking buffer, was added. The preparation was incubated two hours at room temperature or at 4o C overnight. Primary antibodies used in this Thesis are listed in table M5. Materials and methods 77 M.21.5. Incubation with secondary antibody After the incubation with primary antibody, membranes were washed three times with TBS-Tween 1x buffer for 10 minutes each one, then, membranes were incubated with secondary antibody (Table M5) in an appropriate dilution in TBS-Tween 1x for 1 h at room temperature. Secondary antibodies have the peroxidase enzyme conjugated (HRP). After this step, membranes were washed six times with TBS-Tween 1x for 5 min. Table M5. List of antibodies used in this work. Antibody Type Source Company Dilution Anti-FLAG M2 Primary, monoclonal Mouse Sigma 1:5000 Anti-HA Primary, monoclonal Mouse Covance 1:1000 Anti-RNA polymerase β’ subunit Primary, monoclonal Mouse Neoclone - Anti-GroEL Primary, polyclonal Rabbit Sigma 1:20000 Anti-DnaK (8E2/2) Primary, monoclonal Mouse Assay Designs 1:5000 Anti-mouse HRP conjugated Secondary, polyclonal Goat Bio-Rad 1:5000 Anti-rabbit HRP conjugated Secondary, polyclonal Goat Ge Healthcare 1:7500 M.21.6. Signal detection Finally, signal detection was performed using SuperSignal® West Pico Chemiluminescent Substrate” (Thermo Scientific, Waltham, Massachusetts, USA). This substrate is very sensitive to the reaction carried out by HPR. Pictures were taken using the Fujifilm LAS 3000 mini system. M.22. LeuO6His protein purification M. 22.1. Cloning of leuO gene in pET21a In first step, a 6His C-terminal fusion of leuO was carried out by cloning the gene in the protein expression vector pET21a. Cloning was carried out by a PCR of leuO gene using the oligonucleotides pET21-leuO-BamHI and pE21-leuO-SalI (Table M4). The PCR fragment was Materials and methods 78 purified using the commercial kit Wizard® SV Gel and PCR Clean-Up System, supplied by Promega Co. This fragment was excised with the restriction enzymes BamHI and SalI, and was cloned in frame in the vector pET21a. The ligation mixture was transformed into E. coli DH5α. Clones were confirmed by purification of the plasmid, enzyme restriction and DNA sequencing of the candidates. M.22.2. Expression of LeuO6His protein In a first step, pIZ1871 (pET21a-leuO6His) was transformed into the protease-free strain E. coli BL21. An LB with Ap overnight culture grown at 30o C was diluted 1:100 in 200 ml of LB with Ap and incubated in a shaker at 30o C until cells reached OD600 0.4. IPTG 1 mM was then added to the culture and it was incubated at 30o C for 4 h. Cells were harvested by centrifugation at 4o C and 4,500 rpm for 15 minutes. Supernatant was discarded and pellets were kept at -20o C. Pellets were thawed and re-suspended in lysis buffer (5 ml per 0.5 g of pellet) with a protease inhibitor cocktail (Sigma Aldrich). The mixture was sonicated in a 50 ml tube for 1 minute 4 times using a Branson Sonifier 250 sonicator supplied by Biogen Cientifíca S.A. (Madrid, Spain). Samples were centrifuged at 4o C for 30 min at 10,000 rpm. M.22.3. Purification of LeuO6His protein The next step was the isolation of the LeuO6His protein from the rest of the proteins, after the centrifugation the supernatant was recovered and filtrated with a 0.22 µm filter. LeuO6His was purified by chromatography affinity at 4o C using a column that contains an agarose matrix bound to nickel ions (Ge Healthcare). Column was washed with 5 ml of washing buffer 1 and 5 ml of washing buffer 2. In this way, unspecific proteins bound to the Ni2+ column were removed. LeuO6His protein was eluted with 5 ml of elution buffer and was analyzed in a polyacrylamide gel. During the elution the protein was recovered in 5 fractions of 1 ml each one. The fractions that contained the protein were mixed and dialyzed against the dialysis buffer in dialysis tubes (Dialysis tubing cellulose membranes, Sigma-Aldrich). The dialyzed fraction was analyzed by SDS-PAGE. When it was necessary the protein was concentrated using an Amicon® Ultra Centrifugal Filters (Milliopore, Darmstadt, Germany). Protein was frozen in liquid N2 and kept at -80o C. Materials and methods 79  Lysis buffer: Tris-HCl 20 mM NaCl 300 mM Imidazole 10 mM  Wash buffer 1: Tris-HCl 20 mM NaCl 300 mM Imidazole 50 mM  Wash buffer 2: Tris-HCl 20 mM NaCl 300 mM Imidazole 100 mM  Elution buffer: Tris-HCl 20 mM NaCl 300 mM Imidazole 300 mM  Dialysis buffer: Tris-HCl 20 mM NaCl 300 mM Glycerol 10 % M.22.4. Protein quantification Protein concentration was quantified in polyacrylamide gel. Increasing concentrations of bovine serum albumin (BSA) and LeuO6His were loaded in a polyacrylamide gel and stained with Coomasie. Gel was scanned and intensity of each BSA band sample was measured using Image J software. A linear regression was performed representing the BSA concentration versus its band intensity obtained with Image J. LeuO6His amount was extrapolated from this linear regression. Materials and methods 80 M.23. Interaction DNA-protein DNA fragments used for DNA-protein interactions were amplified by PCR using the oligonucleotides listed in table M4. Salmonella 14028 or Salmonella SL1344 were used as DNA templates. Oligonucleotides (Table M4) were labeled with 6-carboxifluorescein (6xFAM) M.23.1. Electrophoretic mobility shift assays (EMSA) To carry out binding assays, DNA fragments and increasing concentrations of LeuO6His protein were mixed as described by De la Cruz et al., (De la Cruz et al., 2007). DNA fragments and protein were mixed in LeuO binding buffer in a final volume of 15 µl and were incubated at room temperature for 30 minutes, loading buffer was added to the samples and were loaded into a TBE 0.5x gel (6% acrylamide:bisacrylamide 29:1, TBE 0.5x) and subjected to an electric field of 25 mA per gel for 30-90 minutes. DNA fragments were visualized with a FLA- 5100 Imaging system (Fujifilm, Tokyo, Japan).  LeuO binding buffer 10x: HEPES 20 mM KCl 100 mM MgCl2 2 mM EDTA 0.1 mM Glycerol 20 %  Loading buffer: TBE 0.5x Glycerol 20% Bromophenol blue Xylene cyanol M.23.2. Slot blot assays To carry out slot blot assays, DNA-protein binding was performed as previously described. After binding, 500 µl of PBS 1x were added to the sample and were blotted to a Materials and methods 81 nitrocellulose filter, using a PR 600 Slot Blot Manifold (Hoefer Scientific Instruments, San Francisco, California, USA). Slot blot was connected to a portable vacuum/pressure pump (Millipore). Wells were washed five times with PBS 1x, and membranes were air-dried. DNA fragments were visualized as described above. M.23.3. Footprinting DNase footprinting was performed as described by Cameron and Dorman (Cameron & Dorman, 2012) with minor modifications. DNase footprinting reactions were performed in 15 µl containing 1x LeuO binding buffer, 0.01 mM DDT, 100 ng µl-1 BSA, 50 nM of bait DNA and 4 µM of LeuO6His protein. LeuO-DNA binding was allowed to equilibrate at room temperature for 30 minutes. One µl (0.05 units) of DNase I (Roche) was then added, mixed gently, and incubated at room temperature for 5 minutes. Reactions were stopped by addition of 2 µl of EDTA (100 mM) following by vigorous vortexing and heat denaturation at 95o C for 10 minutes. Digestion products were desalted using microspin G-25 columns (GE, Healthcare), and were analyzed on an “ABI 3730 DNA Analyzer” along with GeneScan 500-LIZ size standards (Applied Biosystems, Alcobendas, Spain). M.24. β-galactosidase assays Β-galactosidase assays were performed following the method described by Miller (Miller, 1972), modified by Maloy (Maloy, 1990). CHCH3-SDS was used to make cells permeable. One hundred µl of a culture were mixed with 700 µl of Z buffer, 30 µl of chloroform and 15 µl of SDS 0.1%. Samples were mixed by vortexing and were incubated for 5 minutes at 30o C. Two hundred µl of a solution of orto-nitrophenyl-β-galactoside (ONPG) at 4 mg/ml concentration were added. The mixture was vortexed and incubated at 30o C until the samples turned yellow. Five hundred µl of Na2CO3 1 M were then added to stop the reaction. The samples were centrifuged for 15 minutes at 13,000 rpm. The absorbance (Abs) was measured at 420 and 550 nm. Β-galactosidase activity was calculated using the following equation: Materials and methods 82 ( ) In which V is the volume of the culture in the reaction (ml), OD600 is the absorbance of the culture at 600 nm, and t is the time of the reaction (minutes).  Z buffer: Na2HPO4· 7H2O 16.1 g/l NaH2PO4· H2O 5.5 g/l KCl 0.75 g/l MgSO4· 7H2O 0.246 g/l dH2O was added until 1 l was reached. Before use, 2.7 ml of βmercaptoethanol were added per liter of buffer. M.25. Flow cytometry Cells were grown in LB with chlortetracycline at 37o C until stationary phase (OD600~2). Cells were washed and re-suspended in PBS to a final concentration 5x106 cells ml-1. Data acquisition and analysis were performed using a “Cytomics FC500-MPL cytometer” (Beckman Coulter, Brea, California, USA). Approximately, 5x106 cells were analyzed for GFP expression. Data were collected for 40000 events per sample, and were analyzed with CPX and Flow Jo 8.7 Software. M.27. Infection of HeLa cells Epithelial cells were seeded in 24 well plates at a concentration 1.5x106 cells/well. And they were incubated for 24 h at 37o C with 5% CO2 in DMEM media without antibiotics. For these kind of infections, bacteria were grown under invasive conditions (LB 0.3 M NaCl with chlortetracycline in a sealed tube without shaking overnight) and were added as a multiplicity of infection (MOI) of 50 bacteria per cell. Cells were incubated at 37o C for 30 minutes and 5% CO2, cells were washed twice with PBS 1x, covered with 500 µl of DMEM with Gm 100 µg/ml (Gm100) and incubated again at 37o C for 90 minutes. Cells were washed again twice with PBS 1x and incubated for 10 minutes at 37o C with Triton X-100 1% to lysate the cells, 150 µl of PBS 1x were added to the cells and recovered. The invasion rate was calculated using the following equation: Materials and methods 83 ( ) Where cfu (colony forming unit) are the colonies obtained in the seeded plates, multiplied by the dilution factor of the plate and the volume. M.28. DNA sequence analysis To test for the presence of over-represented motifs in DNA sequences bound by LeuO in E. coli and S. Typhimurium, the SELEX screening (Shimada et al., 2011) and ChIPOTle datasets were manually curated to define short binding regions that could be analyzed by the Meme motif-finding program. For the SELEX data this involved extracting 500 bp of DNA sequence centred on the genomic co-ordinate presented for each LeuO binding site in Shimada et al., (Shimada et al., 2011). For S. Typhimurium this involved selecting the highestscoring probes from the broader binding regions identified by ChIPOTle and the corresponding DNA sequences were extracted using the Artemis genome viewer (Rutherford et al., 2000). The unbiased motif-finding program Meme (Bailey et al., 2009) was used to search the curated datasets. Meme parameters were sets as follows: motifs could range in size from 10 to 50 bp, each DNA sequence could contain multiple or not motif sites, and both palindromic and non-palindromic motif could be found. The MAST program (Bailey et al., 2009) was used to generate PSSM from the E. coli and S. Typhimurium LeuO motifs. The PSSMs were used to scan the E. coli K-12 MG1655 and S. Typhimurium SL1344 genome sequences for matches with an E-value < 0.1 and a position P-value < 0.0001. M.29. Statistical analysis To calculate averages and standard deviations, the programs used were “Prism 5.0” and “Microsoft Excel”. Chapter 1 91 upstream of an individual gene), Intergenic Convergent (IC, located between two convergently transcribed genes), Intergenic Divergent (ID, located between two divergently transcribed genes), ORF 3′ (located within the 3′ promoter-distal half of an ORF) and ORF 5′ (located within the 5′ promoter-proximal half of the ORF) (Figure C.1.3). Figure C.1.3. Schematic representation of LeuO binding site classification as outlined in the text. The pie chart shows the relative distribution of LeuO binding sites among the location classes summarized in the genetic diagram on the left, with horizontal arrows used to represent ORFs and their relative orientations. The colours of the vertical arrows correspond to the colours in the pie chart segments. Surprisingly, we found that only about 33% of binding sites were located in intergenic regions with the remaining ~ 66% of binding sites being located within ORFs (Figure C.1.3). Thirty-six of the 60 intergenic binding events were located upstream of an individual gene, 18 were located between divergently transcribed genes and six binding events were located between convergently transcribed genes, making target gene predictions based on binding site location difficult. The same number (59) of ORF binding events were distributed equally between the 5′ and 3′ regions of ORFs. It is possible that a proportion of these intra-ORF binding events have been incorrectly classified in the case of adjacent genes that share short intergenic regions. This is because the resolution capacity of the ChIP-chip method is limited by the average size of the sonicated DNA fragments (~ 500 bp). However, most represent intra- ORF LeuO binding sites of the type that have been documented previously for LeuO and other LysR-like regulators (Wilson et al., 1995; Viswanathan et al., 2007; Shimada et al., 2011). C.1.2. Extension of the LeuO regulon. Our ChIP-chip analysis greatly extended the number of known LeuO target genes in S. Typhimurium. LeuO binding has been mapped previously to the CRISPR-associated casA and Chapter 1 92 cas3 promoters in S. Typhi (Medina-Aparicio et al., 2011); here, we observed high levels of LeuO binding at the promoter for the CRISPR repeats with little or no binding at the casA and cas3 promoters in S. Typhimurium (Figure C.1.2.). Other notable LeuO target genes are sopA, encoding an effector protein that is translocated by the Salmonella pathogenicity island (SPI) 1 type III secretion system, and sifA, the SPI-2 translocated effector gene. These are important virulence determinants of S. Typhimurium and their detection is consistent with the previous characterization of LeuO as a Salmonella virulence factor required for host-pathogen interactions (Tenor et al., 2004). The rcsA gene was also identified as a LeuO target. Its product, RcsA, is an auxiliary regulator for the Rcs (regulation of capsular polysaccharide biosynthesis) two-component phosphophorelay system that senses alterations in the outer membrane and the peptidoglycan layer of the cell envelope (Majdalani and Gottesman, 2005). The rssB gene, which encodes a response-regulatorlike adaptor protein (RssB) for ClpXP proteolytic degradation of the RpoS stress and stationary phase sigma factor (Klauck et al., 2001), was found to be a LeuO target. The observed binding of LeuO to its known target ompS2/ompN but not to ompS1/ompS provided an important insight. LeuO is known to induce ompS2 expression at a lower concentration than required for the induction of ompS1 (De la Cruz et al., 2007), consistent with LeuO having a higher affinity for the regulatory region of ompS2. The low intracellular concentration of LeuO when cultured in LPM may not allow LeuO to occupy lower affinity sites such as the regulatory region of ompS1. To investigate if the genome-wide binding pattern of LeuO was altered upon an increase in the intracellular concentration of LeuO, we used the inducible pBAD system to express 3xFLAG tagged LeuO and monitored its binding pattern using the ChIP-chip technique. This analysis revealed that LeuO bound to 331 chromosomal locations (after removal of any false positives also present in a mouse IgG control ChIP-chip) (Table S.1). We observed LeuO binding to other known targets including ompS1 and cas3, which we did not detect previously. This is consistent with LeuO having a lower affinity for these sites so that a higher intracellular concentration of LeuO is required before full binding is achieved. C.1.3. LeuO binding in close proximity to H-NS LeuO has recently emerged as an important antagonist of H-NS (Hernandez-Lucas et al., 2008; Shimada et al., 2009; 2011) and it may exert this function by simply competing with H-NS for binding to DNA(Shimada et al., 2011) or acting as a barrier to H-NS polymerization (Chen et al., 2003; 2005; Chen and Wu, 2005). While LeuO is known to antagonize H-NS, its Chapter 1 93 own gene is repressed by H-NS (Klauck et al., 1997; Chen et al., 2001; Stratmann et al., 2012). Deletion of hns in Salmonella Typhimurium strain SL1344 resulted in a dramatic increase in LeuO protein levels (Figure C.1.4), confirming the repressive action of H-NS at the leuO gene in SL1344. Figure C.1.4. Western immunoblot analysis of LeuO protein levels in wild-type SL1344 and SL1344 hns are shown in the top panel. DnaK loading controls are indicated in the bottom panel. LeuO binding was observed in close proximity to a previously mapped H-NS binding site at leuO (Dillon et al., 2010), consistent with LeuO functioning as an H-NS antagonist in S. Typhimurium. It was important to determine which of the 178 S. Typhimurium LeuO binding events were associated with H-NS and to ascertain whether LeuO mediated its function by displacing H-NS or by another mechanism. To address these questions, H-NS binding to the SL1344 chromosome was examined by ChIP-chip analysis under the same growth conditions that are known to promote leuO expression (i.e. grown to stationary phase in LPM) (Figure C.1.5). In addition, previously published data (Dillon et al., 2010) on H-NS binding under standard laboratory growth conditions in which LeuO is undetectable [i.e. grown to exponential phase in Luria–Bertani (LB)] were analysed and the findings were integrated with those from the present investigation. Chapter 1 94 Figure C.1.5. Visualization of H-NS (red) and LeuO (blue) ChIP-chip data in the IGB with ChIPOTle identified binding sites depicted below each lane as horizontal bars. The locations of known CDS on the plus (+) and minus (-) DNA strands and SL1344 chromosome co-ordinates are also shown. The ChIPOTle algorithm identified 496 H-NS binding regions in SL1344 grown in LPM (Table S.2) (456 binding regions were identified in LB, Dillon et al., 2010). The locations of these H-NS binding regions were compared with the LeuO binding sites and those LeuO binding sites that overlapped with, or were located within 200 bp of, an H-NS binding region were classified as LeuO + H-NS sites; the remaining sites were classified as LeuO sites (Figure C.1.6 and Table S.1). We identified 68 LeuO sites that met our criteria for classification as LeuO + H-NS sites; the remaining 110 LeuO sites were not associated with H-NS colocalization and so were designated as LeuO sites. LeuO colocalization with H-NS at 68 locations is consistent with a global H-NS antagonism function. However, it is important to consider that LeuO may also repress some of its target genes, perhaps in conjunction with H-NS. Figure C.1.6. Schematic representation of LeuO and H-NS overlap analysis. The Venn diagram illustrates the number of LeuO sites that did (LeuO + H-NS) and did not (LeuO) overlap with an H-NS binding site. Quantitative LeuO (blue) and H-NS (red) ChIP-chip data are shown for representative examples of LeuO and LeuO + H-NS binding sites. Chapter 1 95 This possibility is supported by the observation that LeuO and H-NS are both known to repress the fimAICDFGH operon in E. coli (Shimada et al., 2011). The 68 LeuO + H-NS sites represent only 38% of the total number of LeuO binding events; in contrast, Shimada et al. (2011) found that 95% of LeuO sites in E. coli overlapped with H-NS sites. We then examined average LeuO and H-NS occupancy at the two classes of LeuO binding sites. Average H-NS and LeuO ChIP occupancies were calculated +/-500 bp with respect to the centre of the LeuO binding sites. These surveys showed that the peak of LeuO binding was offset by 100 bp from the ChIPOTle peak centre (Figure C.1.7). However, an interesting pattern emerged: close analysis of regions of LeuO and H-NS co-occupancy revealed that the LeuO binding peak coincided consistently with a trough in the H-NS binding landscape (Figure C.1.7). The significance of this is not clear but may indicate that LeuO functions as an H-NS barrier or antagonist, taking up a position interposed between two consecutive H-NS binding peaks. It is also possible that the intracellular concentrations of LeuO might not be high enough to displace H-NS completely. Figure C.1.7. Average plots of LeuO and H-NS occupancy (ChIP-chip enrichment ratios) at LeuO + H-NS and LeuO only sites. Averaged LeuO and H-NS data were plotted in 100 bp windows respect to the centre of ChIPOTle-defined LeuO binding sites. We wished to know if LeuO could antagonize H-NS binding by competing with and displacing this protein from DNA. We examined H-NS binding at the 110 LeuO-only sites in LB- grown SL1344 and found that none of these 110 locations was occupied by H-NS (Table S.1). Therefore, the presence of LeuO had not simply resulted in the complete displacement of H-NS in LPM since these locations lacked H-NS binding in the absence of detectable levels of LeuO. Next we examined H-NS occupancy at the 68 LeuO + H-NS sites in LB-grown cultures and found Chapter 1 96 that fewer LeuO target genes were bound by H-NS in LB when compared with LPM (41 of the 68 genes were bound by H-NS in LB) (Table C.1.1). LeuO LPM target genes (n=178) H-NS only H-NS + RNAP RNAP only None LPM 5 63 105 5 LB 30 11 50 46 Table C.1.1. The number of H-NS, RNA polymerase (RNAP) and LeuO colocalization events in LeuO- inducing conditions (LPM) is indicated in the first row of the table. The second row indicates the number of H-NS and RNAP binding events at the LPM defined LeuO sites in non-inducing conditions (LB). Therefore, the presence of LeuO appeared to correlate with H-NS binding to more LeuO target genes, which would not be expected if LeuO simply displaced H-NS from its cognate binding sites. However, these results did not rule out the possibility that LeuO influenced the pattern of H-NS occupancy without completely displacing H-NS. Therefore, we calculated the average H-NS binding levels at LeuO binding sites in both LPM and LB (Figure C.1.8). This analysis revealed much higher levels of H-NS binding at LeuO target genes in LeuO- inducing (i.e. LPM) conditions compared with repressive (LB) conditions Figure C.1.8. An average plot of H-NS occupancy with respect to LeuO binding site location in LeuO inducing conditions (LPM) and non-inducing conditions (LB). Chapter 1 97 C.1.4. RNA polymerase recruitment to LeuO target genes. To determine whether LeuO might recruit RNA polymerase, we examined RNA polymerase binding at LeuO target genes under LeuO-inducing growth conditions (LPM) and non-inducing growth conditions (LB). ChIPOTle analysis of both datasets and comparison with the location of LeuO binding sites revealed that 173 of the 178 LeuO binding sites were also associated with RNA polymerase binding in LPM (co-occupancy was defined as a LeuO binding region located within 200 bp of an RNA polymerase binding region), whereas only 61 of the LeuO binding sites were occupied by RNA polymerase upon growth in LB (Table C.1.1. and Table S.1). Next we plotted the mean RNA polymerase occupancy in both growth conditions with respect to the location of the LeuO binding sites (Figure C.1.9). RNA polymerase occupancy was plotted for a distance of +/-500 bp from the centre of the LeuO binding sites and was found to peak with respect to the centre of LeuO binding sites in both growth media. However, the average RNA polymerase occupancy in LeuO-inducing conditions (LPM) was much higher than in non-inducing conditions (LB) and the peak of binding was also broader. This is consistent with LeuO promoting the recruitment of RNA polymerase to target genes, and the broader peaks of binding are consistent with the detection of elongating RNA polymerase. Figure C.1.9. An average plot of RNAP occupancy with respect to LeuO binding site location in LeuO inducing conditions (LPM) and non-inducing conditions (LB). Chapter 1 98 C.1.5. Identification of an A-T rich LeuO binding motif We wanted to determine if LeuO binding was associated with a specific DNA motif in our ChIP-chip binding sites. The recent SELEX study of LeuO binding in E. coli (Shimada et al., 2011) also gave us information on the location of LeuO binding sites in a related species and we were able to incorporate this information into our analysis. First, the S. Typhimurium LeuO + H-NS binding regions described above in which LeuO binding overlapped with or was close to an H-NS binding location were selected for DNA sequence motif analysis. We also created a list of DNA sequences bound by LeuO in E. coli by extracting 500 bp DNA sequences that centred on the genomic co-ordinate provided for each LeuO binding site by Shimada et al. (2011). Recall that almost all of the E. coli sites were of the LeuO + H-NS type. The details of these datasets are provided in Table C.1.2 and in the Material and methods. Species Dataset Number of sequences Average size (bp) Total size (bp) %A+T Source Salmonella Typhimurium LeuO+H-NS 64 653 41825 50.5 This study Escherichia coli E. coli LeuO 119 501 59619 59.9 Shimada et al. (2011) Table C.1.2. Details of the manually curated S. Typhimurium and E. coli LeuO datasets used to derive the LeuO binding motifs. Next we used the unbiased motif-finding algorithm Meme to search the two datasets for significantly over-represented sequence motifs (Bailey et al., 2009). Meme identified a 28 bp motif in both datasets (Figure C.1.10). Two striking features of the LeuO motifs are their imperfect dyad symmetry and their A + T richness. While some dyad symmetry is discernable in the E. coli logo, it is much harder to detect in its S. Typhimurium counterpart. Furthermore both motifs contain a central region matching the T-N11-A LTTR box motif and alignment of the central T-N11-A motifs of the sequence logos shows significant overlap between the two motifs (Figure C.1.10). However, the E. coli LTTR box displays a much stronger nucleotide preference at most positions, a sequence divergence that may explain why only 15 of the E. coli LeuO target genes were common to S. Typhimurium (Table S.1). Chapter 1 99 Figure C.1.10. Aligment of sequence logos illustrating the E. coli and S. Typhimurium motifs identified by Meme. The location of the LLTTR T-N11-A box is indicated below each Logo. C.1.6. Genome-wide prediction and validation of LeuO binding sites. The identification of the 28 bp LeuO DNA binding motifs suggested that accurate prediction of LeuO binding sites in E. coli and S. Typhimurium genome sequences would be possible. We used the Motif Alignment and Search Tool (MAST), which is part of the MEME suite of tools used for motif discovery and searching (Bailey et al., 2009), to generate a position-specific scoring matrix (PSSM) from the LeuO sequence logos. This PSSM was used to search for sequence matches in the S. Typhimurium SL1344 and E. coli K-12 MG1655 genome sequences as described in the Material and methods section. This analysis resulted in the identification of 1263 and 1094 matches in the S. Typhimurium and E. coli genome sequences respectively (Figure C.1.11A and B; Table S.3). These predicted sites were often located in intrinsically curved A + T rich regions and are also associated with H-NS binding (Figure C.1.11A and Table S.4). Eight hundred and eighty-nine of the 1263 predicted LeuO binding sites in S. Typhimurium were associated with H-NS binding in vivo, suggesting that LeuO may function as a more global antagonist of H-NS than previously thought. In order to validate our genome-wide prediction of LeuO binding sites we searched for sites in other known LeuO regulated genes that were not identified in our ChIP-chip study. We correctly predicted sites in the 5′ regulatory region of leuO itself (Chen and Wu, 2005), in the yjjQ-bglJ operon (Stratmann et al., 2008), in ompS1, assT (stm3192), and in the CRISPR-associated casA and cas3 genes (Westra et al., 2010; Medina-Aparicio et al., 2011; Gallego-Hernandez et al., 2012). Furthermore LeuO binding sites Chapter 1 100 have been precisely mapped in the regulatory regions of Salmonella Typhi casA (Medina- Aparicio et al., 2011) and ompS1 (De la Cruz et al., 2007) and our predicted binding sites map to these locations. To further validate our genome-wide prediction of LeuO binding sites, three S. Typhimurium regions were tested for in vitro binding of purified LeuO protein by electrophoretic mobility shift assays (EMSA). The pipA and envR genes each contain one and two predicted LeuO sites respectively, while SL3361, which is located beside envR and does not contain a predicted LeuO binding site motif, was used as a negative control (Figure C.1.12A). Both pipA and envR DNA probes showed a clear pattern of retarded migration after incubation with increasing concentrations of purified LeuO while LeuO did not bind to the SL3361 DNAprobe (Figure C.1.12A). The envR 5′ regulatory region (PenvR) contains two predicted LeuO binding sites located in close proximity to each other (81 bp spacing) and displayed a higher affinity for LeuO binding than the pipA region. Figure C.1.12. EMSA analysis was used to validate predicted LeuO binding sites. pipA and envR were associated with one and two predicted binding sites respectively (indicated by thin black arrows) while SL3361 was not associated with a predicted site. DNA probes were incubated with increasing amounts of LeuO and complex formation is indicated by thick black arrows. Chapter2 108 Use of T-POP to drive leuO transcription does not cause viability problems, and has two additional advantages: (i) the transcription rate can be controlled by using different concentrations of tetracycline or chlortetracycline (Lee et al., 2007); (ii) in the strain engineered for this study (SV6141), T-POP prevents transcription from the native leuO promoter, thus avoiding a feedback loop of autogenous activation (Fang and Wu, 1998a,b) that might yield undesirably high levels of LeuO. Under the conditions employed in this study, the level of leuO expression was similar to that of an Hns− mutant (Figure C.2.3). Figure C.2.3. A. Levels of leuO mRNA in strains SV6141 (T-POP leuO) and SV7853 (Δhns), monitored by quantitative reverse transcriptase PCR. The RNA level found in SV6141 has been normalized to 1. B. Levels of leuO mRNA in strains ATCC 14028, SV6141, and SV7853, monitored by quantitative reverse transcriptase PCR. The RNA level found in ATCC 14028 has been normalized to 1. The primers used for RT-PCR are included in Table M.4 (leuO-RT-Dir and leuO-RTRev, and gmk-RT-Dir and gmk-RT-Rev as a control). Expression of SPI-1 was monitored by measuring the β-galactosidase activity of lac fusions in six genes: hilA, hilC, hilD and invF, which encode transcriptional regulators of SPI-1 (Altier, 2005; Jones, 2005; Ellermeier and Slauch, 2007); invH, which encodes a component of the SPI-1 secretion apparatus (Ellermeier and Slauch, 2007); and rtsA, a transcriptional regulator of SPI-1 encoded outside SPI-1 (Ellermeier and Slauch, 2003; 2007; Jones, 2005). Activation of leuO transcription reduced the expression of all lac fusions (Figure C.2.4). Chapter2 109 Figure C.2.4. Regulation of SPI-1 expression by LeuO. β-Galactosidase activity of hilD::lac, hilC::lac, invF::lac, rtsA::lac, hilA::lac and invH::lac fusions in the presence and in the absence of LeuO. Data are averages and standard deviations from > 3 independent experiments. As controls, strains carrying the same lac fusions and a T-POP insertion unlinked to leuO (zzz:T-POP) were used. In four control strains, the β-galactosidase activities were similar to that of the wild type, in one strain was slightly higher, and in another strain was lower (Figure C.2.5). This experiment ruled out the possibility of an artefact caused by either T-POP or chlortetracycline. We thus concluded that LeuO does repress SPI-1. Figure C.2.5. Control experiment to confirm regulation of SPI-1 expression by LeuO. The strains used as controls contained a T-POP element unlinked to leuO: SV6849 (zzz::T-POP hilD930::lacZ), SV6843 (zzz::TPOP hilC::lacZ), SV6846 (zzz::T-POP invF::lacZ), SV6852 (zzz::T-POP rtsA::lacZ), SV6840 (zzz::T-POP hilA::lacZ), and SV7033 (zzz::T-POP invH::lacZ). Histograms represent ß-galactosidase activities of hilD::lac, hilC::lac, invF::lac, rtsA::lac, hilA::lac, and invH::lac fusions in the presence and in the absence of the T-POP element. Data are averages and standard deviations from >3 independent experiments. The activity of the hilA::lac fusion decreased moderately in the presence of the T-POP element and the activity of hilC::lac increased, but the others remained unaltered. This experiment confirmed that T-POP does not regulate SPI-1. C.2.2. LeuO downregulates SPI-1 expression via HilE and HilD Because SPI-1 expression is responsive to multiple regulators (Ellermeier and Slauch, 2007), we devised a genetic screen to ascertain whether a single cell function might transmit LeuO-mediated regulation to SPI-1. For this purpose, Tn10dCm mutagenesis was performed in a strain that carried the T-POP leuO construct and a hilC::lac translational fusion (SV6844). Chapter2 110 When leuO transcription is activated, strain SV6844 is Lac− and forms white colonies on plates containing Xgal. In the screen, Lac+ (blue) colonies were sought among the Cmr isolates generated by Tn10dCm insertion. One such isolate was purified and re-constructed by P22 HT transduction to confirm that the Tn10dCm insertion suppressed hilC::lac downregulation by LeuO. The isolate was propagated as strain SV7036. Amplification by semi-random PCR and sequencing of the Tn10dCm boundaries indicated that the Tn10dCm element of SV7036 had disrupted the hilE gene. Use of a HilE− null mutant constructed ad hoc (strain SV5586) provided independent evidence that lack of HilE suppressed hilC::lac downregulation by LeuO. Single cell analysis of gene expression by flow cytometry (Figure C.2.6.) confirmed that HilE plays a role in LeuO-mediated repression of SPI-1: (i) activation of leuO expression decreased the activity of a sipB::GFP fusion, abolishing bistable SPI-1 expression; (ii) lack of LeuO restored the wild type pattern of sipB::GFP expression, indicating that SPI-1 downregulation was caused by LeuO indeed; (iii) a hilE null mutation increased sipB::GFP expression and reduced the size of the SPI-1 (OFF) subpopulation, in agreement with the role of HilE as a SPI-1 repressor (Baxter et al., 2003); (iv) activation of leuO expression in a HilE− background yielded a small subpopulation of sipB-::GFP (OFF) cells; and (v) absence of both LeuO and HilE restored the wild type pattern of sipB::GFP expression. Altogether, these observations suggest that activation of LeuO expression downregulates SPI-1 by both HilE-dependent and HilE-independent mechanisms. However, activation of leuO transcription in a HilE+ background yields a homogeneous population of (SPI-1) OFF cells while activation of leuO transcription in the absence of HilE yields a small subpopulation of SPI-1 (OFF) cells. Hence, HilE-dependent downregulation seems to be the major ‘pathway’ of SPI-1 repression by LeuO. Because HilE is a negative regulator of hilD (Baxter et al., 2003), a tentative interpretation for the occurrence of HilE-dependent SPI-1 repression was that LeuO might increase the HilE level, which in turn might inhibit HilD activity. Western blot analysis revealed that activation of leuO transcription decreased the HilD level, and the decrease was suppressed in a ΔleuO background (Figure C.2.7). We also observed that a hilE null mutation increased the HilD levels in the presence and in the absence of LeuO (Figure C.2.7), in accordance with two well known facts: the inhibition of HilD activity by HilE (Baxter et al., 2003) and the occurrence of autogenous activation of hilD transcription (Ellermeier et al., 2005). These experiments support the view that downregulation of SPI-1 by LeuO may involve HilE-mediated inhibition of HilD activity. Chapter2 111 Figure C.2.6. Flow cytometry analysis of SPI-1 expression. Effect of a hilE null mutation on sipB::GFP expression in the presence and in the absence of LeuO (left column). Data were collected for 40 000 events per sample. In the histograms presented, the cell numbers have been normalized to 100. Data are also represented by a dot plot (right column). Chapter2 112 Figure C.2.7. Effect of a hilE mutation on the levels of HilD protein in the presence and in the absence of LeuO. DnaK was used as loading control in Western blots. The involvement of HilD in LeuO-mediated SPI-1 repression was further investigated by epistasis analysis. This kind of analysis takes advantage of two well known traits of SPI-1 expression. One is redundancy of certain transcription factors involved in SPI-1 control (Altier, 2005; Jones, 2005; Ellermeier and Slauch, 2007). Another is that lack of a single transcription factor does not completely abolish expression of certain SPI-1 transcriptional units (Ellermeier et al., 2005). We thus designed experiments to test the effect of a hilD null mutation on the expression of rtsA::lac and hilC::lac fusions in the presence and in the absence of LeuO. If HilD was required for SPI-1 repression by LeuO, we reasoned, downregulation of SPI-1 by LeuO should not be observed in the absence of HilD. Results shown in Figure C.2.8 did not completely fulfil this prediction: moderate downregulation of SPI-1 by LeuO was observed in a HilD−background. Furthermore, even though a hilD mutation was epistatic over hilE, moderate repression of SPI-1 by LeuO was still observed in a HilD− HilE− background (Figure C.2.8). Hence, LeuO seems to repress SPI-1 by a major ‘pathway’ involving HilD and HilE, and also by minor, HilD and HilE-independent mechanisms. This conclusion is coherent with the detection of a subpopulation of SPI-1 (OFF) cells when LeuO expression was activated in a HilE− background (Figure C.2.6). Chapter2 113 Figure C.2.8. Epistasis analysis of SPI-1 expression. Effect of LeuO expression on the β-galactosidase activity of rtsA::lac and hilC::lac translational fusions in HilD− and HilD− HilE− backgrounds. Data are averages and standard deviations from > 3 independent experiments. C.2.3. LeuO activates hilE transcription A tentative model for LeuO-mediated downregulation of SPI-1 via HilE and HilD is that LeuO may activate hilE expression, and that HilE-mediated inhibition of HilD activity (Baxter et al., 2003) may contribute to SPI-1 downregulation. To test whether LeuO is an activator of hilE expression, a hilE::lacZ translational fusion was constructed on the Salmonella chromosome. Comparison of β-galactosidase activities in the presence and in the absence of LeuO (strains SV7327 and SV7328) indicated that hilE expression is activated by LeuO (Figure C.2.9). Figure C.2.9. β-Galactosidase activity of an hilE::lac translational fusion in the presence and in the absence of LeuO. Transcription of hilE is known to be driven by three promoters (Lim et al., 2007). To identify the hilE promoter(s) under LeuO control, the P1, P2 and P3 promoters were cloned on the promoter-probe vector pIC552 (Macian et al., 1994) to generate transcriptional lac fusions. A construct contained the three promoters (pIZ1997), and the others contained individual promoters P1 (pIZ1998), P2 (pIZ1999) and P3 (pIZ2000). Diagrams of the constructs are shown in Figure C.2.10A. Measurements of β-galactosidase activities of the plasmid-borne lac fusions showed that LeuO regulates expression of the P1, P2 and P3 hilE promoters in an independent manner (Figure C.2.10B). However, LeuO-dependent regulation was found to be stronger when the three promoters were present (Figure C.2.10B). Chapter2 114 Figure C.2.10. A. Diagram of the hilE promoter region, drawn using information from (Lim et al., 2007). The DNA fragments cloned on pIC552 are represented below. The −505 to −56 fragment contains the three hilE promoters (plasmid pIZ1997). The −159 to −56 fragment contains the P1 promoter (pIZ1998). The −334 to −161 fragment contains the P2 promoter (pIZ1999). The −505 to −336 fragment contains the P3 promoter (pIZ2000). B. β-Galactosidase activities of pIZ1997, pIZ1998, pIZ1999 and pIZ2000 in the presence and in the absence of LeuO. The pIC552 vector was included as control. Data are averages and standard deviations from > 3 independent experiments. C.2.4. Binding of LeuO to the hilE promoter To test whether LeuO is able to bind the hilE promoter region, a slot blot binding assay was performed. A 449 bp DNA fragment containing the P1, P2 and P3 hilE promoters was incubated with increasing concentrations of LeuO protein. Binding was unambiguously detected (Figure C.2.11A). Quantitative analysis of binding (Figure C.2.11.B) indicated that, under the conditions of the assay, LeuO bound the hilE DNA fragment with an approximate Kd of 0.37 μM. As a negative control, a binding assay with the rtsA promoter was performed, and LeuO was unable to bind the DNA fragment (data not shown). 0.0 0.5 1.0 1.5 0 2.0106 4.0106 6.0106 8.0106 1.0107 1.0 x 107 8.0 x 106 6.0 x 106 4.0 x 106 2.0 x 106 nM LeuO Fluorescence (A. U.) Figure C.2.11. Slot blot binding assay. A 449 bp DNA fragment containing the P1, P2 and P3 hilE promoters was incubated with increasing concentrations of LeuO-His6x. B. Quantification of the binding assay. The fluorescence of the DNA bound to the membrane was represented versus the concentration of LeuO-His6x protein. A B A B PhilE Chapter2 115 Binding of LeuO to the hilE promoter region was also tested by electrophoretic mobility shift assays. DNA fragments that contained the entire promoter region or the individual P1, P2 and P3 promoters were used. LeuO binding was observed upstream of P2 and P3 but not upstream of P1 (Figure C.2.12A). This observation is consistent with two facts: (i) the weak level of P1-driven hilE transcription detected with the promoter-probe plasmid (Figure C.2.10B); (ii) the existence of putative LeuO binding sites upstream of P2 and P3 but not upstream of P1 (Figure C.2.13). Further evidence of LeuO binding to the hilE promoter region was obtained by DNA footprinting using the customary 449 bp DNA fragment as target. Protection from DNase I digestion was observed in the presence of LeuO (Figure C.2.12B). Protection was stronger at a region that overlaps the P3 promoter. Because LTTRs can act at a distance (Maddocks and Oyston, 2008; Momany and Neidle, 2012), LeuO binding at the P3 region may be sufficient to permit regulation of the downstream promoter P2 (and perhaps P1). It is also possible that lower affinity binding to P2 may boost transcription. Figure C.2.12. A. Electrophoretic mobility shift assays of LeuOxHis6x binding to the hilE promoter region. PhilE designates a DNA fragment containing the entire hilE promoter region, while P1, P2 and P3 designate DNA fragments containing individual hilE promoters. A DNA fragment containing the S. enterica gene STM4318 was used as control. The concentrations of LeuO-His6x are indicated above each lane. B. DNase I footprinting of LeuOxHis6x binding to the hilE promoter region using end-labelled linear A B Chapter2 116 DNA fragments. The size and quantity of 6-FAM-labelled digestion products were measured using a capillary electrophoresis DNA sequencing instrument. Figure C.2.13. Putative LeuO binding sites found in the hilE promoter region, identified with Clustal software (green) and with MEME (Bailey et al., 2009) (http://meme.nbcr.net/meme/cgi-bin/meme.cgi) (blue). The transcription start sites are according to (Lim et al., 2007). C.2.5. Activation of leuO transcription inhibits epithelial cell invasion. During infection of animals, Salmonella Typhimurium invades epithelial cells using the SPI-1 type 3 secretion system. The observation that LeuO downregulates SPI expression thus raised the question of whether activation of hilE transcription by LeuO might inhibit epithelial cell invasion. To test this possibility, assays of epithelial cell invasion were performed in vitro, and the invasion rates of T-POP leuO and T-POP ΔleuO strains were compared. As a control, a SPI-1 deletion mutant was included in the assays. Activation of leuO transcription decreased invasion > 100-fold, and lack of LeuO restored the wild type invasion rate (Figure C.2.14A). A HilE− mutant was more invasive than the wild type (Figure C.2.14B), an observation coherent with the role of HilE as a negative regulator of SPI-1 (Fahlen et al., 2000; Baxter et al., 2003). In the absence of HilE, activation of leuO transcription reduced epithelial cell invasion three- to fourfold (Figure C.2.14B), thereby providing further evidence for HilE-independent downregulation of SPI-1 by LeuO. We thus conclude that LeuO inhibits invasion of epithelial Chapter2 117 cells by Salmonella enterica serovar Typhimurium, and that the main inhibition ‘pathway’ requires HilE. These conclusions are in agreement with the ability of LeuO to activate hilE transcription (Figure C.2.9, Figure C.2.10). Figure C.2.14. Inhibition of S. enterica invasion by LeuO. A. Invasion of HeLa cells by the wild type (WT), a strain carrying a SPI-1 deletion (ΔSPI-1), a strain with leuO transcription driven by T-POP (T-POP leuO), and a leuO deletion mutant (T-POP ΔleuO). B. Invasion of HeLa cells by the wild type (WT), a strain carrying a SPI-1 deletion (ΔSPI-1), a HilE− null mutant, (ΔhilE), a HilE− null mutant with leuO transcription driven by T-POP (T-POP leuO ΔhilE), and a strain lacking both LeuO and HilE (T-POP ΔleuO ΔhilE). The invasion rate of the wild type was 0.1–0.3%, and was normalized to 1. Data are averages and standard deviations from > 6 independent experiments. Because of the disparate invasion rates of the strains under study, different scales are used in each graph. A B Chapter 3 125 Figure C.3.4. Effect of leuO expression on conjugal transfer. SV5556, SV7783 and SV7784 were used as donors and SV5534 was used as recipient. SV7783 expresses leuO under the control of a heterologous promoter (T-POP leuO). In SV7784, the leuO gene has been deleted (T-POP ΔleuO). Data are averages and standard deviations from >3 independent matings. Altogether, the above observations support the idea that LeuO acts as a negative regulator of conjugation by binding upstream the finP promoter, and activating its transcription. An increased FinP RNA level must enhance traJ mRNA turnover, resulting in lowered expression of the tra operon. DISCUSSION Discussion 129 D.1. LeuO acts as a global regulator in S. Typhimurium LeuO is a LTTR highly conserved among members of the family Enterobacteriaceae. The leuO gene is located at the intergenic region between the ilvIH and leuABCD operons {Fang, 1998 #42}. LeuO was initially described as a regulator involved in DNA supercoiling, and later as an H-NS antagonist {Fang, 1998 #42}{Hernandez-Lucas, 2008 #73}{Shimada, #70}{Stratmann, #44}. Genetic and biochemical analyses of LeuO have been mostly performed in E. coli (Shimada et al., Shimada et al., 2009). In Salmonella, roles for LeuO in virulence gene regulation have been described in serovar Typhi (Gallego-Hernandez et al., Hernandez-Lucas et al., 2008) but not in S. Typhimurium. We identified the LeuO targets in the genome of serovar Typhimurium (strain SL1344) by chromatin immunoprecipitation. A large number of LeuO targets (178) were found in a wide variety of chromosome locations. In previous genome-wide studies, the majority of bacterial transcription factors have been found to bind predominantly to non-coding DNA sequences (Grainger et al., 2007, Grainger et al., 2006, Grainger et al., 2005, Grainger et al., 2004, Cho et al., 2008, Shimada et al., Wei et al.). Because most transcription factors regulate transcription by binding to DNA sites located upstream of promoters, it is not surprising that LTTRs bind intergenic regions upstream of the genes they regulate (Maddocks & Oyston, 2008). Some such binding sites are close to the promoters (-55 to +20) wilhe others are located more than 200 bp upstream of the promoter. However, binding sites within ORFs are also found (Wilson et al., 1995, Viswanathan et al., 2007). In our experiments, the majority of LeuO binding sites were located within ORFs. The significance of intra-ORF binding is unclear. Because in in some instances LeuO has been shown to act as a negative regulator (Hernandez-Lucas et al., 2008, Shimada et al., 2009), LeuO binding to intragenic regions might contribute to repress transcription. In other coding regions bound by H-NS forming transcriptionally repressive nucleoprotein complexes (Nagarajavel et al., 2007), binding of LeuO to internal regions might antagonize H-NS activity.. It is also possible that LeuO binding across ORFs may reflect an architectural role for the LeuO protein in determining the structure of the nucleoid (Chen & Wu, 2005). Before this study, knowledge of LeuO targets in the Salmonella genome was limited to to relatively few loci in S. Typhi rather than S. Typhimurium (De la Cruz et al., 2007; Hernandez- Lucas et al., 2008; Medina-Aparicio et al., 2011; Turnbull et al., 2012). The 164 new S. Typhimurium LeuO binding sites identified here are located in genes involved in a variety of Discussion 130 cellular processes. The list includes inner/outer membrane proteins, transport proteins, motility factors, cell division proteins, oxidative stress response proteins and also other LTTRs (Table S1). Despite the large number of targets found, the list may be incomplete: it is not inconceivable that under appropriate growth conditions Salmonella might synthesize larger amounts of LeuO that might in turn occupy even more binding sites than documented here. The fact that we are only starting to understand the growth conditions under which LeuO plays a regulatory role justifies this caveat (Gallego-Hernandez et al., 2012). The nucleoid protein H-NS protein acts as a global repressor of ~ 20% of genes in S. Typhimurium (Dorman, 2004; Dillon and Dorman, 2010). H-NS represses transcription by binding to curved AT-rich DNA sequences, and mediates its repressive function by preventing RNA polymerase binding or by trapping RNA polymerase at promoters (Dame et al., 2006; Lucchini et al., 2006; Navarre et al., 2006; Walthers et al., 2011). Counteracting the repressive function of H-NS may be important if the cell needs to express H-NS regulated genes; not surprisingly, a number of H-NS antagonism mechanisms have been described (Stoebel et al., 2008). LeuO has recently emerged as an antagonist of H-NS (Hernandez-Lucas et al., 2008; Shimada et al., 2009; 2011), and and may exert this function by competing with H-NS for binding to DNA (Shimada et al., 2011) or by acting as a barrier to H-NS polymerization (Chen et al., 2003; 2005; Chen and Wu, 2005). We identified 68 LeuO sites that colocalized with H-NS, a number lower than that reported in the E. coli genome (Shimada et al.). After the analysis of the average LeuO and H- NS occupancy in those targets, it was observed that LeuO peak coincided with the H-NS binding landscape. This may indicate that LeuO functions as an H-NS barrier or antagonist, taking up a position interposed between two consecutive H-NS binding peaks. Analysis of target occupancy by LeuO and H-NS under conditions that induce leuO expression (LPM) and under non-inducing conditions (LB) supports a model in which LeuO may induce remodeling of the nucleoprotein complex, overcoming H-NS-mediated repression without stripping H-NS from the DNA. A mechanism of this kind has been proposed for other H-NS antagonists in S. Typhimurium, such as the SlyA protein and OmpR (Perez et al., 2008; Cameron and Dorman, 2012). The ability of LeuO to form DNA-protein-DNA bridges, analogous to those created by LacI, might also allow LeuO to interfere with H-NS activity without removing the protein from the DNA. Significantly, the LacI protein can replace LeuO as an H-NS antagonist at leuO (Chen and Wu, 2005), a finding that is consistent with the two proteins operating through a common mechanism. Here, the LeuO/LacI proteins erect a DNA–protein– Discussion 131 DNA bridge between two binding sites that contains H-NS behind a LeuO/LacI barrier. This barrier may protect a nearby promoter from encroachment by H-NS polymerization without the need to displace H-NS from the DNA. LTTRs are known to bind sites overlapping or adjacent to the target promoter to repress or activate transcription (Maddocks and Oyston, 2008). It has been suggested that LTTRs activate transcription by interacting with the C-terminal domain of the alpha subunit of RNA polymerase (aCTD). For example, the LTTR family member OxyR increases RNA polymerase binding to OxyR-dependent promoters, suggesting that OxyR activates transcription partly by recruiting RNA polymerase (Kullik et al., 1995). LeuO appears to be associated with active transcription, as the vast majority of LeuO target genes are associated with RNA polymerase binding in LPM. However, it cannot be excluded that some of these co-localization events represent transcriptionally repressive events as LeuO may prevent promoter clearance by trapping RNA polymerase at promoters, a property already described for H-NS (Dame et al., 2002). The presence of RNA polymerase at 105 LeuO target genes in inducing conditions (and its absence in non-inducing conditions) suggests that LeuO recruits RNA polymerase, but the observation that 63 of the 68 LeuO + H- NS co-occupancy sites are also associated with RNA polymerase binding is intriguing as binding of H-NS and RNA polymerase are believed to be mutually exclusive in Salmonella (Lucchini et al., 2006). However, as discussed above, this may indicate trapping of RNA polymerase by LeuO and H-NS. Alternatively, LeuO may remodel H-NS oligomers and allow RNA polymerase to bind to promoters without the need to displace H-NS. We cannot discount the other possibility: that all three factors do not in fact colocalize in all individual cells as ChIP quantifies protein occupancy across a population of cells. The ability of proteins to recognize specific DNA sequences is a key feature of many biological processes. Recognition of a specific DNA sequence by a protein often involves the formation of specific hydrogen bonds between amino acids and nucleotides (Garvie and Wolberger, 2001). For LysR-like proteins, a DNA sequence known as the LTTR box has been identified (Maddocks and Oyston, 2008). The consensus sequence of the LTTR box is T-N11-A and often displays imperfect dyad symmetry (Parsek et al., 1994). However, this motif is highly degenerate and does not give an accurate understanding of the DNA sequences with which LeuO interacts. In the S. Typhimurium and E. coli genomes, we identified a 28 bp LeuO binding motif with a central region that matched to the regions described previously to LTTR binding motifs. There is a clear divergence between the motifs in both species, and this divergence Discussion 132 may explain why only 15 of the E. coli LeuO target genes are shared with S. Typhimurium (Table S1). Regulon divergence is not uncommon even in closely related species, and this is reflected in differences in the presence and nature of regulatory protein binding sites (Perez and Groisman, 2009). While the E. coli and S. Typhimurium LeuO proteins are highly related (87% amino acid identity) there are a number of amino acid differences in the N-terminal DNA binding domain which may have altered DNA binding site specificity. Furthermore, selective pressure associated with the acquisition and regulatory integration of horizontally acquired SPIs that contain a large number of predicted LeuO binding sites may have also altered DNA binding site preference. We know that the LTTR box motif is often associated with dyad symmetry (Schell, 1993; Grob et al., 1997; Sheehan and Dorman, 1998) and this property appears to be a general feature of the extended 28 bp motifs identified here, albeit weakly in S. Typhimurium. The presence of dyad symmetry is consistent with individual LeuO subunits binding to half-sites to form a dimer. However, LTTRs are known to be functionally active as tetramers that protect large regions of DNA (50–60 bp) (Maddocks and Oyston, 2008). Tetramer formation by LeuO would lend itself to DNA–protein–DNA bridging, as it is the case with tetrameric LacI (Chen and Wu, 2005). This would allow LeuO to participate in both short-range and long-range protein– DNA interactions, facilitated by DNA looping. The extremely high A+T content of both logos (Fig. C1.10) is consistent with the proposed role of LeuO as an H-NS antagonist as H-NS binds to A + T rich sequences (Lucchini et al., 2006; Navarre et al., 2006; Dillon et al., 2010). Furthermore both logos contain a central A- tract at nucleotide positions 15–17. These A-tracts are intriguing because DNA structural studies have determined that A-tracts are associated with narrowing of the DNA minor groove (Beveridge et al., 2004; Rohs et al., 2009). Variation in DNA shape, in particular DNA minor groove width and DNA twist, is emerging as an important ‘indirect’ mechanism used by proteins to achieve DNA binding specificity in the absence of base-specific contacts (Rohs et al., 2009; Cameron and Dorman, 2012). In this mechanism the bases are not necessarily involved in contacting the protein but in allowing the DNA to assume a conformation that facilitates protein binding (Rohs et al., 2009). These flexible bases are often located in linker sequences that connect two half-sites that are directly bound by protein subunits (Hizver et al., 2001; Rohs et al., 2009). The quasi-palindromic nature and presence of A-tracts in the LeuO Discussion 133 motifs suggests that a combination of direct amino-acid-base-pair interactions and DNA shape may be important features in determining LeuO binding specificity. After the identification of the LeuO DNA binding motif, we validated our genome-wide prediction, and observed that LeuO seems to have indeed a dual role as transcriptional activator and repressor (Figure C1.14.). Transcriptional activation by LeuO is well documented. In addition, LeuO has been shown to repress the acid stress regulator cadC, the gene encoding the small RNA dsrA, and the fimAICDFGH operon in E. coli (Shi and Bennett, 1995; Repoila and Gottesman, 2001; Shimada et al., 2011). Furthermore, LeuO has a complex relationship with its own gene, antagonizing H-NS-mediated leuO repression and antagonizing RcsB-BglJ-mediated leuO activation (Chen and Wu, 2005; Stratmann et al., 2012). Many of the genes on the A + T- rich SPIs 1 and 2 are repressed by H-NS (Dillon et al., 2010) and our analysis identified 25 predicted LeuO sites in SPI1 and 11 in SPI2. This may explain why LeuO was identified as a virulence factor in a S. Typhimurium host-pathogen model system (Tenor et al., 2004) and in a long-term systemic infection mouse model system (Lawley et al., 2006). It is also important to point out that 24 of 44 genes encoding S. Typhimurium LTTRs (Lahiri et al., 2009) contain one or more predicted LeuO binding site(s) in their regulatory region. These include the gene encoding TdcA, which is involved in the metabolism of L-serine and L-threonine (Kim et al., 2009), and the gene encoding NhaR, which regulates a sodium proton antiporter (Rahav- Manor et al., 1992). These LTTRs and their neighbouring regulatory targets are also repressed by H-NS (Table S2), suggesting a complex regulatory interplay between LeuO, other LTTRs and H-NS. As LTTRs often auto-regulate their own expression (Maddocks and Oyston, 2008), it is possible that LeuO establishes a heterotypic interaction with the corresponding LTTR family member to facilitate this auto-regulation (Knapp and Hu, 2010). The presence of LeuO binding sites at so many LTTR genes shows that LeuO also has the potential to co-ordinate their expression within a LeuO dependent regulatory network. D.2. Regulation of SPI-1 by LeuO In serovars Typhi and Typhimurium of Salmonella enterica LeuO has been shown to regulate virulence-related genes (Fernandez-Mora et al., 2004; Tenor et al., 2004; Rodriguez- Morales et al., 2006; Hernandez-Lucas et al., 2008). Given these antecedents, the identification of LeuO binding sites in Salmonella pathogenicity island 1 (Chapter 1), combined with the observation that deletion of leuO increased expression of the SPI-1 gene sopA (Chapter 1), suggested that LeuO might regulate SPI-1, a major determinant of Salmonella virulence (Galan and Curtiss, 1989). Multiple controls adjust SPI-1 expression to conditions that permit invasion Discussion 134 of epithelial cells (Altier, 2005; Jones, 2005; Ellermeier and Slauch, 2007). Because activation of SPI-1 expression requires relief from H-NS-mediated silencing (Lucchini et al., 2006; Navarre et al., 2006) and LeuO acts often as an H-NS antagonist (Hernandez-Lucas et al., 2008; Shimada et al., 2009; 2011; Stratmann et al., 2012), the possibility that LeuO might repress SPI-1 was intriguing. LeuO is a quiescent LTTR under standard laboratory conditions because leuO transcription is repressed by H-NS (Klauck et al., 1997). To study LeuO-dependent regulation of SPI-1 in S. enterica serovar Typhimurium, transcription of the leuO gene was freed from H-NS repression by introducing a T-POP element upstream of leuO (Figure C.2.2.). Activation of leuO transcription was found to downregulate genes belonging to independent transcriptional units within SPI-1, as well as the SPI-1- controlled rtsA gene located outside SPI-1 (Figure C.2.4.). These experiments confirmed that LeuO represses SPI-1 expression. A consequence of SPI-1 repression by LeuO is reduced invasion of epithelial cells in vitro (Figure C.2.14.). A genetic screen for loss-of-function mutations that restored SPI-1 expression in the presence of LeuO provided evidence that the hilE gene is necessary for LeuO mediated repression of SPI-1, an hypothesis confirmed upon directed construction of a HilE− mutant. The hilE gene is located outside SPI-1, and encodes a repressor of SPI-1 expression (Baxter et al., 2003). HilE inactivates the transcriptional activator HilD (Baxter et al., 2003). HilD inactivation disrupts a positive feedback loop for hilD autogenous activation and causes SPI-1 repression (Ellermeier et al., 2005). We thus considered that LeuO might activate hilE transcription, and that HilE might repress SPI-1 via HilD inactivation (Figure D.1). The existence of a LeuO-HilE-HilD ‘pathway’ of SPI-1 repression in S. enterica serovar Typhimurium is supported by several lines of evidence: (i) lack of HilE relieves LeuO-mediated repression of SPI-1 (Figure C.2.6.); (ii) activation of leuO transcription decreases the level of HilD protein (Figure C.2.7); (iii) the HilD protein decrease caused by LeuO is suppressed by a hilE mutation (Figure C.2.7); and (iv) LeuO activates transcription of hilE (Figure C.2.10.). In the absence of HilE, however, LeuO remains able to downregulate expression of SPI- 1 (Figure C.2.8) and to reduce epithelial cell invasion (Figure C.2.14.). HilD is likewise dispensable for HilE-independent downregulation of SPI-1 by LeuO (Figure C.2.8). However, HilE-independent SPI-1 repression appears to be weak in comparison with the HilE-dependent ‘pathway’ (Figures C.2.6, C.2.8 and D.1). This conclusion is in agreement with the observation Discussion 135 that activation of leuO transcription decreases epithelial cell invasion > 100-fold in the presence of HilE and only three- to fourfold in the absence of HilE (Figure C.2.14.). Our ignorance of natural conditions that permit leuO expression advises against interpretation of the physiological significance of SPI-1 regulation by LeuO. However, a conceivable scenario is that LeuO might either backup or relieve H-NS repression of certain loci, in a fashion reminiscent of the HN-S-repressed VirT-VirB regulatory cascade in Shigella (Tobe et al., 1993). Because HilE is a SPI-1 repressor, a tentative model is that activation of hilE transcription by LeuO might boost SPI-1 repression, perhaps under conditions in which H-NS fails to do so. Such hypothetical conditions can be expected to activate leuO expression because leuO transcription is also repressed by H-NS (Klauck et al., 1997). The existence of a subordinate machinery to secure SPI-1 silencing might have selective value because SPI-1 expression causes growth retardation (Sturm et al., 2010). Tight repression of SPI-1 might have also selective value in environments different from the animal intestine. For instance, colonization of plants by Salmonella is more efficient in the absence of SPI-1 components, perhaps because the presence of the SPI-1 secretion apparatus in the Salmonella envelope triggers a defence response by the plant (Iniguez et al., 2005). The view that LeuO may back up or replace H-NS to silence SPI-1 is consistent with the existence of overlapping controls that contribute to silencing of horizontally acquired genes. For instance, the E. coli nucleoid associated proteins Hha and YdgT enhance silencing of foreign genes by H-NS (Vivero et al., 2008; Banos et al., 2009). Interestingly, YdgT and Hha appear to be redundant, and YdgT has been proposed to act as a backup molecule (Paytubi et al., 2004). The intricacy of accommodating horizontally acquired genes in the host regulatory network (Ochman et al., 2000; Lercher and Pal, 2008; Price et al., 2008) may confer adaptive value to redundant control. References 145 Achtman, M., N. Kennedy & R. Skurray, (1977) Cell-cell interactions in conjugating Escherichia coli: role of TraT protein in surface exclusion. Proc Natl Acad Sci USA 74: 5104-5108. Ackrell, B. A., M. K. Johnson, R. P. Gunsalus, & G, Ceccini, (1992). Structure and function of succinate dehydrogenase and fumarete reductase. Chemistry and biochemistry of flavoenzymes, vol. 3. Muller, f. (ed.) boca raton: crc press, pp. 229-297. Ahmer, B. M., M. Tran & F. Heffron, (1999) The virulence plasmid of Salmonella typhimurium is selftransmissible. J Bacteriol 181: 1364-1368. Akbar, S., L. M. Schechter, C. P. Lostroh & C. A. Lee, (2003) AraC/XylS family members, HilD and HilC, directly activate virulence gene expression independently of HilA in Salmonella typhimurium. Mol Microbiol 47: 715-728. Altier, C., (2005) Genetic and environmental control of Salmonella invasion. J Microbiol 43 Spec No: 85-92. Altier, C., M. Suyemoto, A. I. Ruiz, K. D. Burnham & R. Maurer, (2000) Characterization of two novel regulatory genes affecting Salmonella invasion gene expression. Mol Microbiol 35: 635-646. Arthur, D. C., A. F. Ghetu, M. J. Gubbins, R. A. Edwards, L. S. Frost & J. N. Glover, (2003) FinO is an RNA chaperone that facilitates sense-antisense RNA interactions. EMBO J 22: 6346-6355. Arutyunov, D., B. Arenson, J. Manchak & L. S. Frost, (2010) F plasmid TraF and TraH are components of an outer membrane complex involved in conjugation. J Bacteriol 192: 1730-1734. Arutyunov, D. & L. S. Frost, F conjugation: back to the beginning. Plasmid 70: 18-32. Arutyunov, D., J. M. Rodriguez-Maillard & L. S. Frost, A PAS domain within F plasmid TraJ is critical for its function as a transcriptional activator. Biochem Cell Biol 89: 396-404. Bailey, T. L., M. Boden, F. A. Buske, M. Frith, C. E. Grant, L. Clementi, J. Ren, W. W. Li & W. S. Noble, (2009) MEME SUITE: tools for motif discovery and searching. Nucleic Acids Res 37: W202-208. Baison-Olmo, F., E. Cardenal-Munoz & F. Ramos-Morales, PipB2 is a substrate of the Salmonella pathogenicity island 1-encoded type III secretion system. Biochem Biophys Res Commun 423: 240-246. Bajaj, V., C. Hwang & C. A. Lee, (1995) HilA is a novel ompR/toxR family member that activates the expression of Salmonella typhimurium invasion genes. Mol Microbiol 18: 715-727. Bajaj, V., R. L. Lucas, C. Hwang & C. A. Lee, (1996) Co-ordinate regulation of Salmonella typhimurium invasion genes by environmental and regulatory factors is mediated by control of hilA expression. Mol Microbiol 22: 703-714. Baker, C. S., I. Morozov, K. Suzuki, T. Romeo & P. Babitzke, (2002) CsrA regulates glycogen biosynthesis by preventing translation of glgC in Escherichia coli. Mol Microbiol 44: 1599-1610. Balbontin, R., G. Rowley, M. G. Pucciarelli, J. Lopez-Garrido, Y. Wormstone, S. Lucchini, F. Garcia-Del Portillo, J. C. Hinton & J. Casadesus, (2006) DNA adenine methylation regulates virulence gene expression in Salmonella enterica serovar Typhimurium. J Bacteriol 188: 8160-8168. References 146 Barrangou, R., C. Fremaux, H. Deveau, M. Richards, P. Boyaval, S. Moineau, D. A. Romero & P. Horvath, (2007) CRISPR provides acquired resistance against viruses in prokaryotes. Science 315: 1709- 1712. Baumler, A. J., R. M. Tsolis, F. A. Bowe, J. G. Kusters, S. Hoffmann & F. Heffron, (1996) The pef fimbrial operon of Salmonella typhimurium mediates adhesion to murine small intestine and is necessary for fluid accumulation in the infant mouse. Infect Immun 64: 61-68. Baumler, A. J., R. M. Tsolis, T. A. Ficht & L. G. Adams, (1998) Evolution of host adaptation in Salmonella enterica. Infect Immun 66: 4579-4587. Baxter, M. A., T. F. Fahlen, R. L. Wilson & B. D. Jones, (2003) HilE interacts with HilD and negatively regulates hilA transcription and expression of the Salmonella enterica serovar Typhimurium invasive phenotype. Infect Immun 71: 1295-1305. Baxter, M. A. & B. D. Jones, (2005) The fimYZ genes regulate Salmonella enterica serovar Typhimurium invasion in addition to type 1 fimbrial expression and bacterial motility. Infect Immun 73: 1377-1385. Behlau, I. & S. I. Miller, (1993) A PhoP-repressed gene promotes Salmonella typhimurium invasion of epithelial cells. J Bacteriol 175: 4475-4484. Belden, W. J. & S. I. Miller, (1994) Further characterization of the PhoP regulon: identification of new PhoP-activated virulence loci. Infect Immun 62: 5095-5101. Beutin, L. & M. Achtman, (1979) Two Escherichia coli chromosomal cistrons, sfrA and sfrB, which are needed for expression of F factor tra functions. J Bacteriol 139: 730-737. Beveridge, D. L., S. B. Dixit, G. Barreiro & K. M. Thayer, (2004) Molecular dynamics simulations of DNA curvature and flexibility: helix phasing and premelting. Biopolymers 73: 380-403. Bispham, J., B. N. Tripathi, P. R. Watson & T. S. Wallis, (2001) Salmonella pathogenicity island 2 influences both systemic salmonellosis and Salmonella-induced enteritis in calves. Infect Immun 69: 367-377. Boddicker, J. D., B. M. Knosp & B. D. Jones, (2003) Transcription of the Salmonella invasion gene activator, hilA, requires HilD activation in the absence of negative regulators. J Bacteriol 185: 525-533. Bolotin, A., B. Quinquis, A. Sorokin & S. D. Ehrlich, (2005) Clustered regularly interspaced short palindrome repeats (CRISPRs) have spacers of extrachromosomal origin. Microbiology 151: 2551-2561. Boyd, E. F. & D. L. Hartl, (1998) Salmonella virulence plasmid. Modular acquisition of the spv virulence region by an F-plasmid in Salmonella enterica subspecies I and insertion into the chromosome of subspecies II, IIIa, IV and VII isolates. Genetics 149: 1183-1190. Brescia, C. C., M. K. Kaw & D. D. Sledjeski, (2004) The DNA binding protein H-NS binds to and alters the stability of RNA in vitro and in vivo. J Mol Biol 339: 505-514. References 147 Brouns, S. J., M. M. Jore, M. Lundgren, E. R. Westra, R. J. Slijkhuis, A. P. Snijders, M. J. Dickman, K. S. Makarova, E. V. Koonin & J. van der Oost, (2008) Small CRISPR RNAs guide antiviral defense in prokaryotes. Science 321: 960-964. Browning, D. F., D. C. Grainger & S. J. Busby, Effects of nucleoid-associated proteins on bacterial chromosome structure and gene expression. Curr Opin Microbiol 13: 773-780. Buck, M. J., A. B. Nobel & J. D. Lieb, (2005) ChIPOTle: a user-friendly tool for the analysis of ChIP-chip data. Genome Biol 6: R97. Burkinshaw, B. J. & N. C. Strynadka, Assembly and structure of the T3SS. Biochim Biophys Acta. Bustamante, V. H., L. C. Martinez, F. J. Santana, L. A. Knodler, O. Steele-Mortimer & J. L. Puente, (2008) HilD-mediated transcriptional cross-talk between SPI-1 and SPI-2. Proc Natl Acad Sci USA 105: 14591-14596. Byrd, D. R. & S. W. Matson, (1997) Nicking by transesterification: the reaction catalysed by a relaxase. Mol Microbiol 25: 1011-1022. Camacho, E. M. & J. Casadesus, (2002) Conjugal transfer of the virulence plasmid of Salmonella enterica is regulated by the leucine-responsive regulatory protein and DNA adenine methylation. Mol Microbiol 44: 1589-1598. Camacho, E. M. & J. Casadesus, (2005) Regulation of traJ transcription in the Salmonella virulence plasmid by strand-specific DNA adenine hemimethylation. Mol Microbiol 57: 1700-1718. Camacho, E. M., A. Serna, C. Madrid, S. Marques, R. Fernandez, F. de la Cruz, A. Juarez & J. Casadesus, (2005) Regulation of finP transcription by DNA adenine methylation in the virulence plasmid of Salmonella enterica. J Bacteriol 187: 5691-5699. Cameron, A. D. & C. J. Dorman, (2012) A fundamental regulatory mechanism operating through OmpR and DNA topology controls expression of Salmonella pathogenicity islands SPI-1 and SPI-2. PLoS Genet 8: e1002615. Carte, J., R. Wang, H. Li, R. M. Terns & M. P. Terns, (2008) Cas6 is an endoribonuclease that generates guide RNAs for invader defense in prokaryotes. Genes Dev 22: 3489-3496. Cashel, M., D. R. Gentry, V. J. Hernandez, & Vinella, (1996). The stringent response, p. 1458-96. In Neidhart, F. C., R. I. Crustiss, J. L. Ingraham, E. C. C. Lin, K. B. Low, B. Magasanik, & al., e. (ed.), Escherichia coli and Salmonella: cellular and molecular biology, American society for microbiology press, washintong press, Washington dc. Cheah, K. C. & R. Skurray, (1986) The F plasmid carries an IS3 insertion within finO. J Gen Microbiol 132: 3269-3275. Chen, C. C., M. Y. Chou, C. H. Huang, A. Majumder & H. Y. Wu, (2005) A cis-spreading nucleoprotein filament is responsible for the gene silencing activity found in the promoter relay mechanism. J Biol Chem 280: 5101-5112. References 148 Chen, C. C., M. Fang, A. Majumder & H. Y. Wu, (2001) A 72-base pair AT-rich DNA sequence element functions as a bacterial gene silencer. J Biol Chem 276: 9478-9485. Chen, C. C., M. Ghole, A. Majumder, Z. Wang, S. Chandana & H. Y. Wu, (2003) LeuO-mediated transcriptional derepression. J Biol Chem 278: 38094-38103. Chen, C. C. & H. Y. Wu, (2005) LeuO protein delimits the transcriptionally active and repressive domains on the bacterial chromosome. J Biol Chem 280: 15111-15121. Chen, D., R. Bowater, C. J. Dorman & D. M. Lilley, (1992) Activity of a plasmid-borne leu-500 promoter depends on the transcription and translation of an adjacent gene. Proc Natl Acad Sci USA 89: 8784- 8788. Chen, D., R. Bowater & D. M. Lilley, (1994) Topological promoter coupling in Escherichia coli: delta topA-dependent activation of the leu-500 promoter on a plasmid. J Bacteriol 176: 3757-3764. Cheng, X., (1995) Structure and function of DNA methyltransferases. Annu Rev Biophys Biomol Struct 24: 293-318. Cherepanov, P. P. & W. Wackernagel, (1995) Gene disruption in Escherichia coli: TcR and KmR cassettes with the option of Flp-catalyzed excision of the antibiotic-resistance determinant. Gene 158: 9-14. Cho, B. K., E. M. Knight, C. L. Barrett & B. O. Palsson, (2008) Genome-wide analysis of Fis binding in Escherichia coli indicates a causative role for A-/AT-tracts. Genome Res 18: 900-910. Chubiz, J. E., Y. A. Golubeva, D. Lin, L. D. Miller & J. M. Slauch, FliZ regulates expression of the Salmonella pathogenicity island 1 invasion locus by controlling HilD protein activity in Salmonella enterica serovar Typhimurium. J Bacteriol 192: 6261-6270. Chun, K. T., H. J. Edenberg, M. R. Kelley & M. G. Goebl, (1997) Rapid amplification of uncharacterized transposon-tagged DNA sequences from genomic DNA. Yeast 13: 233-240. Crump, J. A. & E. D. Mintz, Global trends in typhoid and paratyphoid Fever. Clin Infect Dis 50: 241-246. Dame, R. T., (2005) The role of nucleoid-associated proteins in the organization and compaction of bacterial chromatin. Mol Microbiol 56: 858-870. Dame, R. T., M. C. Noom & G. J. Wuite, (2006) Bacterial chromatin organization by H-NS protein unravelled using dual DNA manipulation. Nature 444: 387-390. Dame, R. T. & G. J. Wuite, (2003) On the role of H-NS in the organization of bacterial chromatin: from bulk to single molecules and back. Biophys J 85: 4146-4148. Dame, R. T., C. Wyman & N. Goosen, (2000) H-NS mediated compaction of DNA visualised by atomic force microscopy. Nucleic Acids Res 28: 3504-3510. Dame, R. T., C. Wyman & N. Goosen, (2001) Structural basis for preferential binding of H-NS to curved DNA. Biochimie 83: 231-234. References 149 Dame, R. T., C. Wyman, R. Wurm, R. Wagner & N. Goosen, (2002) Structural basis for H-NS-mediated trapping of RNA polymerase in the open initiation complex at the rrnB P1. J Biol Chem 277: 2146-2150. Darwin, K. H. & V. L. Miller, (1999) InvF is required for expression of genes encoding proteins secreted by the SPI1 type III secretion apparatus in Salmonella typhimurium. J Bacteriol 181: 4949-4954. Darwin, K. H. & V. L. Miller, (1999) Molecular basis of the interaction of Salmonella with the intestinal mucosa. Clin Microbiol Rev 12: 405-428. Darwin, K. H. & V. L. Miller, (2001) Type III secretion chaperone-dependent regulation: activation of virulence genes by SicA and InvF in Salmonella typhimurium. EMBO J 20: 1850-1862. Datsenko, K. A. & B. L. Wanner, (2000) One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc Natl Acad Sci USA 97: 6640-6645. De la Cruz, M. A., M. Fernandez-Mora, C. Guadarrama, M. A. Flores-Valdez, V. H. Bustamante, A. Vazquez & E. Calva, (2007) LeuO antagonizes H-NS and StpA-dependent repression in Salmonella enterica ompS1. Mol Microbiol 66: 727-743. de Vries, R., DNA condensation in bacteria: Interplay between macromolecular crowding and nucleoid proteins. Biochimie 92: 1715-1721. De Wulf, P., O. Kwon & E. C. Lin, (1999) The CpxRA signal transduction system of Escherichia coli: growth-related autoactivation and control of unanticipated target operons. J Bacteriol 181: 6772-6778. Deighan, P., A. Free & C. J. Dorman, (2000) A role for the Escherichia coli H-NS-like protein StpA in OmpF porin expression through modulation of micF RNA stability. Mol Microbiol 38: 126-139. Deiwick, J., S. P. Salcedo, E. Boucrot, S. M. Gilliland, T. Henry, N. Petermann, S. R. Waterman, J. P. Gorvel, D. W. Holden & S. Meresse, (2006) The translocated Salmonella effector proteins SseF and SseG interact and are required to establish an intracellular replication niche. Infect Immun 74: 6965- 6972. Dempsey, W. B., (1987) Transcript analysis of the plasmid R100 traJ and finP genes. Mol Gen Genet 209: 533-544. Dillon, S. C., A. D. Cameron, K. Hokamp, S. Lucchini, J. C. Hinton & C. J. Dorman, (2010) Genome-wide analysis of the H-NS and Sfh regulatory networks in Salmonella Typhimurium identifies a plasmidencoded transcription silencing mechanism. Mol Microbiol 76: 1250-1265. Dillon, S. C. & C. J. Dorman, (2010) Bacterial nucleoid-associated proteins, nucleoid structure and gene expression. Nat Rev Microbiol 8: 185-195. Dillon, S. C., E. Espinosa, K. Hokamp, D. W. Ussery, J. Casadesus & C. J. Dorman, LeuO is a global regulator of gene expression in Salmonella enterica serovar Typhimurium. Mol Microbiol 85: 1072- 1089. Dorman, C. J., (2004) H-NS: a universal regulator for a dynamic genome. Nat Rev Microbiol 2: 391-400. Dorman, C. J., (2007) H-NS, the genome sentinel. Nat Rev Microbiol 5: 157-161. References 150 Dorman, C. J., J. C. Hinton & A. Free, (1999) Domain organization and oligomerization among H-NS-like nucleoid-associated proteins in bacteria. Trends Microbiol 7: 124-128. Dostal, L., S. Shao & J. F. Schildbach, Tracking F plasmid TraI relaxase processing reactions provides insight into F plasmid transfer. Nucleic Acids Res 39: 2658-2670. Dowman, J. E. & G. G. Meynell, (1970) Pleiotropic effects of de-repressed bacterial sex factors on colicinogeny and cell wall structure. Mol Gen Genet 109: 57-68. Ehrbar, K. & W. D. Hardt, (2005) Bacteriophage-encoded type III effectors in Salmonella enterica subspecies 1 serovar Typhimurium. Infect Genet Evol 5: 1-9. Eichelberg, K. & J. E. Galan, (1999) Differential regulation of Salmonella typhimurium type III secreted proteins by pathogenicity island 1 (SPI-1)-encoded transcriptional activators InvF and HilA. Infect Immun 67: 4099-4105. Ellermeier, C. D., J. R. Ellermeier & J. M. Slauch, (2005) HilD, HilC and RtsA constitute a feed forward loop that controls expression of the SPI1 type three secretion system regulator HilA in Salmonella enterica serovar Typhimurium. Mol Microbiol 57: 691-705. Ellermeier, C. D., A. Janakiraman & J. M. Slauch, (2002) Construction of targeted single copy lac fusions using lambda Red and FLP-mediated site-specific recombination in bacteria. Gene 290: 153- 161. Ellermeier, C. D. & J. M. Slauch, (2003) RtsA and RtsB coordinately regulate expression of the invasion and flagellar genes in Salmonella enterica serovar Typhimurium. J Bacteriol 185: 5096-5108. Ellermeier, J. R. & J. M. Slauch, (2007) Adaptation to the host environment: regulation of the SPI1 type III secretion system in Salmonella enterica serovar Typhimurium. Curr Opin Microbiol 10: 24-29. Elton, T. C., S. J. Holland, L. S. Frost & B. Hazes, (2005) F-like type IV secretion systems encode proteins with thioredoxin folds that are putative DsbC homologues. J Bacteriol 187: 8267-8277. Fabrega, A. & J. Vila, Salmonella enterica serovar Typhimurium skills to succeed in the host: virulence and regulation. Clin Microbiol Rev 26: 308-341. Fahlen, T. F., N. Mathur & B. D. Jones, (2000) Identification and characterization of mutants with increased expression of hilA, the invasion gene transcriptional activator of Salmonella typhimurium. FEMS Immunol Med Microbiol 28: 25-35. Fahlen, T. F., R. L. Wilson, J. D. Boddicker & B. D. Jones, (2001) Hha is a negative modulator of transcription of hilA, the Salmonella enterica serovar Typhimurium invasion gene transcriptional activator. J Bacteriol 183: 6620-6629. Fang, M., A. Majumder, K. J. Tsai & H. Y. Wu, (2000) ppGpp-dependent leuO expression in bacteria under stress. Biochem Biophys Res Commun 276: 64-70. Fang, M. & H. Y. Wu, (1998) A promoter relay mechanism for sequential gene activation. J Bacteriol 180: 626-633. References 151 Fang, M. & H. Y. Wu, (1998) Suppression of leu-500 mutation in topA+ Salmonella typhimurium strains. The promoter relay at work. J Biol Chem 273: 29929-29934. Feasey, N. A., G. Dougan, R. A. Kingsley, R. S. Heyderman & M. A. Gordon, Invasive non-typhoidal salmonella disease: an emerging and neglected tropical disease in Africa. Lancet 379: 2489-2499. Fernandez-Mora, M., J. L. Puente & E. Calva, (2004) OmpR and LeuO positively regulate the Salmonella enterica serovar Typhi ompS2 porin gene. J Bacteriol 186: 2909-2920. Fink, R. C., M. R. Evans, S. Porwollik, A. Vazquez-Torres, J. Jones-Carson, B. Troxell, S. J. Libby, M. McClelland & H. M. Hassan, (2007) FNR is a global regulator of virulence and anaerobic metabolism in Salmonella enterica serovar Typhimurium (ATCC 14028s). J Bacteriol 189: 2262-2273. Finkel, S. E. & R. C. Johnson, (1993) The Fis protein: it's not just for DNA inversion anymore. Mol Microbiol 7: 1023. Finlay, B. B., L. S. Frost, W. Paranchych & N. S. Willetts, (1986) Nucleotide sequences of five IncF plasmid finP alleles. J Bacteriol 167: 754-757. Finlay, B. B., S. Ruschkowski & S. Dedhar, (1991) Cytoskeletal rearrangements accompanying salmonella entry into epithelial cells. J Cell Sci 99 ( Pt 2): 283-296. Finnegan, D. & N. Willetts, (1972) The nature of the transfer inhibitor of several F-like plasmids. Mol Gen Genet 119: 57-66. Fortune, D. R., M. Suyemoto & C. Altier, (2006) Identification of CsrC and characterization of its role in epithelial cell invasion in Salmonella enterica serovar Typhimurium. Infect Immun 74: 331-339. Foster, J. W. & H. K. Hall, (1991) Inducible pH homeostasis and the acid tolerance response of Salmonella typhimurium. J Bacteriol 173: 5129-5135. Franch, T., M. Petersen, E. G. Wagner, J. P. Jacobsen & K. Gerdes, (1999) Antisense RNA regulation in prokaryotes: rapid RNA/RNA interaction facilitated by a general U-turn loop structure. J Mol Biol 294: 1115-1125. Francis, C. L., T. A. Ryan, B. D. Jones, S. J. Smith & S. Falkow, (1993) Ruffles induced by Salmonella and other stimuli direct macropinocytosis of bacteria. Nature 364: 639-642. Frost, L., S. Lee, N. Yanchar & W. Paranchych, (1989) finP and finO mutations in FinP anti-sense RNA suggest a model for FinOP action in the repression of bacterial conjugation by the Flac plasmid JCFL0. Mol Gen Genet 218: 152-160. Frost, L. S., K. Ippen-Ihler & R. A. Skurray, (1994) Analysis of the sequence and gene products of the transfer region of the F sex factor. Microbiol Rev 58: 162-210. Frost, L. S., J. Simon, (1993) Studies on the pili of the promiscuoud plasmid RP4. In: Kado, c. (ed.) promiscuous plasmids of Gram-negative and –positive bacteria. Kluwer Academic Publishers, Dordrecht, pp. 47-63. References 152 Galan, J. E., (2001) Salmonella interactions with host cells: type III secretion at work. Annu Rev Cell Dev Biol 17: 53-86. Gallego-Hernandez, A. L., I. Hernandez-Lucas, M. A. De la Cruz, L. Olvera, E. Morett, L. Medina- Aparicio, J. A. Ramirez-Trujillo, A. Vazquez, M. Fernandez-Mora & E. Calva, Transcriptional regulation of the assT-dsbL-dsbI gene cluster in Salmonella enterica serovar Typhi IMSS-1 depends on LeuO, H-NS, and specific growth conditions. J Bacteriol 194: 2254-2264. Garcia Vescovi, E., F. C. Soncini & E. A. Groisman, (1996) Mg2+ as an extracellular signal: environmental regulation of Salmonella virulence. Cell 84: 165-174. Garcia-del Portillo, F. & B. B. Finlay, (1995) Targeting of Salmonella typhimurium to vesicles containing lysosomal membrane glycoproteins bypasses compartments with mannose 6-phosphate receptors. J Cell Biol 129: 81-97. Garcia-Del Portillo, F., M. G. Pucciarelli & J. Casadesus, (1999) DNA adenine methylase mutants of Salmonella typhimurium show defects in protein secretion, cell invasion, and M cell cytotoxicity. Proc Natl Acad Sci USA 96: 11578-11583. Garcia-del Portillo, F., M. B. Zwick, K. Y. Leung & B. B. Finlay, (1993) Salmonella induces the formation of filamentous structures containing lysosomal membrane glycoproteins in epithelial cells. Proc Natl Acad Sci USA 90: 10544-10548. Garcia-Quintanilla, M. & J. Casadesus, Virulence plasmid interchange between strains ATCC 14028, LT2, and SL1344 of Salmonella enterica serovar Typhimurium. Plasmid 65: 169-175. Garcia-Quintanilla, M., A. I. Prieto, L. Barnes, F. Ramos-Morales & J. Casadesus, (2006) Bile-induced curing of the virulence plasmid in Salmonella enterica serovar Typhimurium. J Bacteriol 188: 7963- 7965. Garcia-Quintanilla, M., F. Ramos-Morales & J. Casadesus, (2008) Conjugal transfer of the Salmonella enterica virulence plasmid in the mouse intestine. J Bacteriol 190: 1922-1927. Garneau, J. E., M. E. Dupuis, M. Villion, D. A. Romero, R. Barrangou, P. Boyaval, C. Fremaux, P. Horvath, A. H. Magadan & S. Moineau, The CRISPR/Cas bacterial immune system cleaves bacteriophage and plasmid DNA. Nature 468: 67-71. Garvie, C. W. & C. Wolberger, (2001) Recognition of specific DNA sequences. Mol Cell 8: 937-946. Glickman, B., P. van den Elsen & M. Radman, (1978) Induced mutagenesis in dammutants of Escherichia coli: a role for 6-methyladenine residues in mutation avoidance. Mol Gen Genet 163: 307- 312. Golubeva, Y. A., A. Y. Sadik, J. R. Ellermeier & J. M. Slauch, Integrating global regulatory input into the Salmonella pathogenicity island 1 type III secretion system. Genetics 190: 79-90. Gong, H., G. P. Vu, Y. Bai, E. Chan, R. Wu, E. Yang, F. Liu & S. Lu, A Salmonella small non-coding RNA facilitates bacterial invasion and intracellular replication by modulating the expression of virulence factors. PLoS Pathog 7: e1002120. References 153 Gottesman, S., (2004) The small RNA regulators of Escherichia coli: roles and mechanisms*. Annu Rev Microbiol 58: 303-328. Graham, S. M., Nontyphoidal salmonellosis in Africa. Curr Opin Infect Dis 23: 409-414. Grainger, D. C., H. Aiba, D. Hurd, D. F. Browning & S. J. Busby, (2007) Transcription factor distribution in Escherichia coli: studies with FNR protein. Nucleic Acids Res 35: 269-278. Grainger, D. C., D. Hurd, M. D. Goldberg & S. J. Busby, (2006) Association of nucleoid proteins with coding and non-coding segments of the Escherichia coli genome. Nucleic Acids Res 34: 4642-4652. Grainger, D. C., D. Hurd, M. Harrison, J. Holdstock & S. J. Busby, (2005) Studies of the distribution of Escherichia coli cAMP-receptor protein and RNA polymerase along the E. coli chromosome. Proc Natl Acad Sci USA 102: 17693-17698. Grainger, D. C., T. W. Overton, N. Reppas, J. T. Wade, E. Tamai, J. L. Hobman, C. Constantinidou, K. Struhl, G. Church & S. J. Busby, (2004) Genomic studies with Escherichia coli MelR protein: applications of chromatin immunoprecipitation and microarrays. J Bacteriol 186: 6938-6943. Grob, P., D. Kahn & D. G. Guiney, (1997) Mutational characterization of promoter regions recognized by the Salmonella dublin virulence plasmid regulatory protein SpvR. J Bacteriol 179: 5398-5406. Groisman, E. A. & H. Ochman, (1997) How Salmonella became a pathogen. Trends Microbiol 5: 343- 349. Groisman, E. A., M. A. Sturmoski, F. R. Solomon, R. Lin & H. Ochman, (1993) Molecular, functional, and evolutionary analysis of sequences specific to Salmonella. Proc Natl Acad Sci USA 90: 1033-1037. Guadarrama, C., A. Medrano-Lopez, R. Oropeza, I. Hernandez-Lucas & E. Calva, The Salmonella enterica serovar Typhi LeuO Global Regulator Forms Tetramers: Residues Involved in Oligomerization, DNA Binding, and Transcriptional Regulation. J Bacteriol 196: 2143-2154. Gubbins, M. J., I. Lau, W. R. Will, J. M. Manchak, T. L. Raivio & L. S. Frost, (2002) The positive regulator, TraJ, of the Escherichia coli F plasmid is unstable in a cpxA* background. J Bacteriol 184: 5781-5788. Gulig, P. A. & R. Curtiss, 3rd, (1987) Plasmid-associated virulence of Salmonella typhimurium. Infect Immun 55: 2891-2901. Gulig, P. A., H. Danbara, D. G. Guiney, A. J. Lax, F. Norel & M. Rhen, (1993) Molecular analysis of spv virulence genes of the Salmonella virulence plasmids. Mol Microbiol 7: 825-830. Hale, C. R., P. Zhao, S. Olson, M. O. Duff, B. R. Graveley, L. Wells, R. M. Terns & M. P. Terns, (2009) RNA-guided RNA cleavage by a CRISPR RNA-Cas protein complex. Cell 139: 945-956. Hanahan, D., (1983) Studies on transformation of Escherichia coli with plasmids. J Mol Biol 166: 557- 580. Harris, R. L., V. Hombs & P. M. Silverman, (2001) Evidence that F-plasmid proteins TraV, TraK and TraB assemble into an envelope-spanning structure in Escherichia coli. Mol Microbiol 42: 757-766. GGCAAAATCCAACATAGCTAAATTAAAA TTATATCTGTAAAAAAACGTAATTAAAA +++++ ++ + +++ ++++++++ AATATTTCCCGCAATGACATAGAGAAAA TTATATCTGTAAAAAAACGTAATTAAAA ++ +++ + ++ +++++ +++++ ATAAAATTATTAAACGCGCCAATGAAAA TTATATCTGTAAAAAAACGTAATTAAAA ++++++ +++ +++ +++++++++ TTTTATTCATATTGATTCCTTTTAATAT TTTTAATTACGTTTTTTTACAGATATAA +++++ ++++ ++ ++++ + +++++++ TTCAATATCCAGAATGACAAGGTCAACA TTATATCTGTAAAAAAACGTAATTAAAA ++ +++++ + ++ +++ + + ++ + TTACAATAGGGTGTTCGTCCATAATGAT TTTTAATTACGTTTTTTTACAGATATAA ++ +++ + ++ +++ + ++++++ ++ GTTTTTAAGTATAAAAATAATATGAAAG TTATATCTGTAAAAAAACGTAATTAAAA + ++++ +++ +++++ + ++++++ TATTTACATTTAATGGAAGTGAAAATAA TTATATCTGTAAAAAAACGTAATTAAAA ++ ++++ + +++ ++++++ + ++ TTTTCTTTATCGCATTTATTACAAATAA TTTTAATTACGTTTTTTTACAGATATAA +++++ ++++ +++ ++ ++++++ TTATATATCCATAATGATTTTATATAAA TTATATCTGTAAAAAAACGTAATTAAAA ++++++++ + ++ + + ++ +++ TTTATTTCTATTCATTATAAAGAAATAT TTTTAATTACGTTTTTTTACAGATATAA +++ ++ ++ ++ ++ ++++++++ TATTAATTGATCGTTGTTACCGATCAAT TTTTAATTACGTTTTTTTACAGATATAA + +++++++ ++ ++ ++++ +++ ++ AAAAAACGACAGCTAAAAGGGATGTAAA TTATATCTGTAAAAAAACGTAATTAAAA +++++++ + + ++++++ ++++ +++ GAATTCACGGACAAAAGCTTTGTGAAAA TTATATCTGTAAAAAAACGTAATTAAAA ++++ + + + ++++++ + ++++++ AACGATAAACAAATTGCGTTAATTAATA TTATATCTGTAAAAAAACGTAATTAAAA ++ +++ + ++++ +++++++ + TAATAATAATTTGATTATTAGTTTATAT TTTTAATTACGTTTTTTTACAGATATAA + ++++ ++++ ++ + +++++++ TTTAAATGTTATTTATTTTCAATAAATT TTTTAATTACGTTTTTTTACAGATATAA +++ +++ + +++++++ ++ +++ ++ 161 7.10E-05 forward 636374 636401 159 7.50E-05 reverse 631146 631173 160 5.80E-05 forward 631301 631328 157 8.00E-05 reverse 617910 617937 158 3.20E-05 reverse 618797 618824 155 5.10E-05 forward 615345 615372 156 3.30E-06 forward 617321 617348 153 9.00E-05 forward 612546 612573 154 1.10E-05 reverse 614575 614602 151 1.80E-05 reverse 610739 610766 152 3.00E-05 reverse 610911 610938 149 9.60E-05 reverse 610203 610230 150 9.00E-05 forward 610331 610358 147 9.60E-05 reverse 598837 598864 148 3.60E-06 forward 601301 601328 145 5.80E-05 reverse 587364 587391 146 6.60E-05 reverse 587925 587952 144 9.00E-05 reverse 586136 586163 Table S1 257 TATTCATCCGACATAAACACCATCAAAA TTATATCTGTAAAAAAACGTAATTAAAA ++ + + + ++++++++ ++ ++++ AAAATTCATAATAAACACAGGGTTATAA TTATATCTGTAAAAAAACGTAATTAAAA +++++++ + +++ +++ + +++ ++ TATTAATTCTTTTAACATAAGTGATACA TTTTAATTACGTTTTTTTACAGATATAA + ++++++ ++++ ++ ++ + ++ + TTCTCCGTATGTCATGGATCAATTAAAA TTATATCTGTAAAAAAACGTAATTAAAA ++ + ++++ + ++ +++++++++ TTAAAACCGCGGCGAGACTCAGTAATAA TTATATCTGTAAAAAAACGTAATTAAAA +++++++ + + + ++ ++ + + ++ AGCGAACTAAAAATAGAAATAATAATCA TTATATCTGTAAAAAAACGTAATTAAAA + +++++ +++++ +++++++ + + TTTTTATGGGCTCTATATCGCCAAAAAA TTTTAATTACGTTTTTTTACAGATATAA ++++ ++ + + +++ + +++ ++ ATAAACATATACATTAAATTTATATTAA TTATATCTGTAAAAAAACGTAATTAAAA +++++ +++++ ++ +++ + ++ ++ ATAGAATTGTATGGGAGCAATGGTAAAA TTATATCTGTAAAAAAACGTAATTAAAA +++ ++ ++++ + ++++ +++++ TATTTAAACTAAAATACCACAGTTATGA TTATATCTGTAAAAAAACGTAATTAAAA ++ ++++ +++++ + ++++ +++ + TAATATCAAAGCGAAAAGAGTATTAATG TTATATCTGTAAAAAAACGTAATTAAAA +++++++ + + +++++ + +++++ TTTAACTGGAATTTTTCTGTTTTTTTAT TTTTAATTACGTTTTTTTACAGATATAA +++ + + + +++++ + + +++++++ TAAGCAGCCGGAGGACAAGTAATGGAAA TTATATCTGTAAAAAAACGTAATTAAAA +++ + +++ + ++++++++ +++ GTCGATTTCGGTATAACAGTGATTAATA TTATATCTGTAAAAAAACGTAATTAAAA + ++ + + ++++ +++++++++ + TGATAACTTTTTCTTTTCAGTCAGAGTA TTTTAATTACGTTTTTTTACAGATATAA + +++ + +++ ++++++ + + ++ TTTTGATTTATTTCACAAAGCGTTAGAT TTTTAATTACGTTTTTTTACAGATATAA ++++ +++ +++ ++ + ++++ ++ TTTTCTTTATTCCTTCCGAAAGTGAAAA TTTTAATTACGTTTTTTTACAGATATAA +++++ ++++++ +++ + +++ + ++ TTAATTTATTGTTATTTTATTGTTTTAT 179 4.20E-05 forward 691439 691466 177 3.00E-05 forward 687297 687324 178 7.50E-05 forward 689111 689138 175 3.70E-05 reverse 686411 686438 176 7.10E-05 forward 687197 687224 173 9.00E-05 forward 672528 672555 174 6.20E-05 reverse 676004 676031 171 5.80E-05 reverse 668528 668555 172 6.60E-05 reverse 669509 669536 169 6.20E-05 reverse 667481 667508 170 4.20E-05 reverse 667606 667633 167 5.50E-05 reverse 655559 655586 168 9.00E-05 forward 660911 660938 165 4.80E-05 reverse 649452 649479 166 4.50E-05 reverse 652982 653009 163 3.40E-05 reverse 643463 643490 164 7.50E-05 forward 648915 648942 162 3.20E-05 reverse 637776 637803 Table S1 258 TTTTAATTACGTTTTTTTACAGATATAA ++ + ++++ ++++++ +++++++ TTTTATTCAGGTTAATGTTGTTATTATC TTTTAATTACGTTTTTTTACAGATATAA +++++ +++ +++ ++ + ++++ + TATTCCTTCAGTCTCTGCGGCGGATAAA TTTTAATTACGTTTTTTTACAGATATAA + +++ ++ ++ + + + + ++ ++ TAAAAAGTCTTAAAAAACAATAAGTAGA TTATATCTGTAAAAAAACGTAATTAAAA ++++++ + + ++++++++ + + + + TATTTATCACTTTTTCGCAAAGTTCGAC TTTTAATTACGTTTTTTTACAGATATAA + ++ +++++++++++ ++ ++++ + TTATTATGATGTTTTTTTACGCAAAGCT TTTTAATTACGTTTTTTTACAGATATAA ++ + ++ ++++++++++++ +++ + TTAAAATTACTCTTATGAATGTATTTTT TTTTAATTACGTTTTTTTACAGATATAA ++ ++++++++++++ ++ +++++++ TTTTGCTTTCTGTTTCACGGCCTTTATA TTTTAATTACGTTTTTTTACAGATATAA ++++ ++ ++ ++++ + +++ ++ TACGACGTCCGTGATGAAATTAAAAAAA TTATATCTGTAAAAAAACGTAATTAAAA ++ + + + ++ ++++ + ++++ AATATAAAACAAGGGAAAATGATTATGA TTATATCTGTAAAAAAACGTAATTAAAA ++ ++++ + +++ ++++++++++ + TTTTTACCTTACAGGGAAATGATAAAGA TTATATCTGTAAAAAAACGTAATTAAAA ++ ++++ ++ + +++++++ ++ + AACGATCCAAGAGGTGAAGTGATGAACA TTATATCTGTAAAAAAACGTAATTAAAA ++ +++ + +++ ++++++++++ + TATTCACCAAATTTATTAGGTATTAATT TTTTAATTACGTTTTTTTACAGATATAA + ++++ ++ ++++++ +++ ++ ATCAATCAACAAGGGAGAATGGGTATAA TTATATCTGTAAAAAAACGTAATTAAAA ++ ++++ + +++ ++++++ ++ ++ TTCGAACCAGGGAATGCCGGTATCAAAA TTATATCTGTAAAAAAACGTAATTAAAA ++ +++ + + ++ ++ ++ ++++ TTCGAACCAGGGAATGCCGGTATCAAAA TTATATCTGTAAAAAAACGTAATTAAAA ++ +++ + + ++ ++ ++ ++++ TGTTCAGCGCGGTTATTCGTATGTTTAA TTTTAATTACGTTTTTTTACAGATATAA + ++++ ++++ ++++++ +++ +++++ AATTTTCCGTAGGGAAGGGTGAGAAAGA TTATATCTGTAAAAAAACGTAATTAAAA 195 6.00E-06 forward 745729 745756 196 8.00E-05 reverse 752225 752252 193 8.50E-05 reverse 737767 737794 194 8.50E-05 reverse 737877 737904 191 4.50E-05 forward 723514 723541 192 5.50E-05 reverse 723879 723906 189 1.10E-05 reverse 714337 714364 190 3.70E-05 reverse 715955 715982 187 9.00E-05 reverse 699110 699137 188 2.40E-05 reverse 711694 711721 185 2.10E-05 forward 696546 696573 186 9.60E-05 forward 698254 698281 183 4.70E-06 forward 692297 692324 184 5.50E-06 forward 693924 693951 181 6.20E-05 forward 691711 691738 182 7.50E-05 reverse 692244 692271 179 4.20E-05 forward 691439 691466 180 7.50E-05 forward 691594 691621 Table S1 259 ++ ++++ +++ + +++ ++++ ++ + AAAAATCAGTAAATTAGCTTTATTTTAG TTATATCTGTAAAAAAACGTAATTAAAA +++++++ ++++++ +++ + +++ + TTTTTATATCCTCTATAAAATATAATAT TTTTAATTACGTTTTTTTACAGATATAA ++++ ++ + + +++ + ++++++ TTTTCATTTCGCGCACGTCGATTTTTTT TTTTAATTACGTTTTTTTACAGATATAA ++++++++ +++ ++ + ++++++++ TAAATCTGCTGGAAAAGCGTGAAAATAA TTATATCTGTAAAAAAACGTAATTAAAA +++++ ++ ++++++++++ + ++ TTATGATGGATTTGTTTTGTGAAAAGAA TTTTAATTACGTTTTTTTACAGATATAA ++ + ++ + +++ ++++ + +++ ++ ATATAACAATAAAAAAACTAAGGGAAAA TTATATCTGTAAAAAAACGTAATTAAAA +++++++ ++++++++++ + +++++ TTATACTCGGATTACTGAGCACAAATAT TTTTAATTACGTTTTTTTACAGATATAA ++ ++ +++ ++ + ++ ++++++ TTTAACCGTCTTGAAAAATTAAAAAAAA TTATATCTGTAAAAAAACGTAATTAAAA ++ ++ + ++++++ +++ ++++ TTTTATTGGTGAAGAGATTATAAAAAAA TTATATCTGTAAAAAAACGTAATTAAAA ++ +++ +++++ + + + ++++ TATTTATAAATTCTCTATAGAGAAAAAA TTTTAATTACGTTTTTTTACAGATATAA + ++ ++ + ++ + + ++ +++++ ++ GATAAATAGTATGTAAATATTATAGAAA TTATATCTGTAAAAAAACGTAATTAAAA + +++ +++ +++++ ++ ++ +++ TTATTACTTTATGGAGATGCTCAGGAAA TTATATCTGTAAAAAAACGTAATTAAAA ++++++++ ++ + + + ++ + +++ TTTTAATATTCTTATTGCAGTATTTATA TTTTAATTACGTTTTTTTACAGATATAA +++++++ + ++ ++ ++ +++ ++ TTATAATAGCGTTACCCCAGATAATATA TTTTAATTACGTTTTTTTACAGATATAA ++ ++++ +++++ + ++ +++++ ++ TTAACATCACTTTTTTTGCGGGTTAATA TTTTAATTACGTTTTTTTACAGATATAA ++ +++++++++++++ ++++ ++ TTAGATACTTTTGATAATGAAAGAAAAA TTATATCTGTAAAAAAACGTAATTAAAA +++ +++ + ++ ++ + ++ ++++ TATTAATGGTTTGTTTACGGCAGTCAAA TTTTAATTACGTTTTTTTACAGATATAA + +++++ ++++ +++ + + ++ 213 8.50E-05 forward 789962 789989 211 3.70E-05 forward 788517 788544 212 3.40E-05 reverse 789231 789258 209 9.10E-06 forward 788226 788253 210 3.90E-06 forward 788281 788308 207 9.60E-05 reverse 786654 786681 208 8.50E-05 reverse 787364 787391 205 1.10E-05 reverse 785595 785622 206 1.70E-07 forward 786033 786060 203 8.00E-05 forward 784258 784285 204 5.50E-05 reverse 784606 784633 201 6.20E-05 forward 781021 781048 202 1.20E-07 reverse 781723 781750 199 4.70E-06 forward 772201 772228 200 8.00E-05 reverse 773710 773737 197 9.00E-05 reverse 765083 765110 198 3.00E-05 forward 765642 765669 196 8.00E-05 reverse 752225 752252 Table S1 260 TTAAATCTGCAAAAAAAGAGATGAAAAA TTATATCTGTAAAAAAACGTAATTAAAA +++++++++ +++++++ + + ++++ ATAAAAAATTCAATAAAAAATCTGAAGA TTATATCTGTAAAAAAACGTAATTAAAA +++++++ + ++++++++ ++++ + TTTTAATTATATGACTATGATAATCTTA TTTTAATTACGTTTTTTTACAGATATAA ++++++++++ + + + ++ +++ TTTTGATGTTATTTATTACAGGAATTCT TTTTAATTACGTTTTTTTACAGATATAA ++++ ++ + ++++++ +++++ + CTTTCCTCGTGTTTATTCGATAAAAATT TTTTAATTACGTTTTTTTACAGATATAA ++++ ++++++++++++ +++ ++ TTTTTCTGGCCTTTTTTTATTCATTACC TTTTAATTACGTTTTTTTACAGATATAA ++++ + ++ +++++++++ +++ TTTTCATAAAATTTCTTATATTGAAAAT TTTTAATTACGTTTTTTTACAGATATAA +++++++ + +++ ++ + ++ ++ ATCGATCTGGAAATACAAATGGAGAAGA TTATATCTGTAAAAAAACGTAATTAAAA ++ +++++ +++++ +++++ +++ + TGAATACTTTTCAGAAGAACATGTAAAA TTATATCTGTAAAAAAACGTAATTAAAA + ++++++ + + +++++++ +++++ TTAAAACGGCCTGTGAAGGTTATAAAAA TTATATCTGTAAAAAAACGTAATTAAAA +++++++ + ++ ++ ++ ++ ++++ TGTTACCCGGATAGAGACGCGGGGAAAA TTATATCTGTAAAAAAACGTAATTAAAA + ++ + + + + + +++++ +++++ AATAATGAGGATAAGAAAAAAGGGAAAA TTATATCTGTAAAAAAACGTAATTAAAA ++ +++ + + ++ ++++ + +++++ TTTTCATGCCGTCAGTGTGCATTTCATT TTTTAATTACGTTTTTTTACAGATATAA +++++++ +++ + + +++++ ++ TAATAAGTATTGATAACCTGCAGAAAAA TTATATCTGTAAAAAAACGTAATTAAAA ++++++ +++ ++++ + + ++++ TACTCTTTGCAAAAACAAAAAGTTAACA TTATATCTGTAAAAAAACGTAATTAAAA ++ + + ++ +++++ +++ + ++++ + TGCATTCAATGAATAAACATTATTAACA TTATATCTGTAAAAAAACGTAATTAAAA + ++++ ++++++++++++ +++++ + ATTTAAATGTTGGAAAAGAGCATCAAAA TTATATCTGTAAAAAAACGTAATTAAAA ++ +++++++ +++++ + ++ ++++ 229 3.00E-07 reverse 808550 808577 230 2.40E-05 reverse 808606 808633 227 8.00E-05 reverse 808355 808382 228 2.10E-05 reverse 808510 808537 225 3.70E-05 reverse 795296 795323 226 2.40E-05 forward 795433 795460 223 3.40E-05 reverse 792379 792406 224 6.60E-05 reverse 793467 793494 221 2.30E-05 reverse 791448 791475 222 9.00E-05 reverse 792053 792080 219 6.60E-05 forward 790854 790881 220 3.20E-05 forward 791090 791117 217 8.00E-05 forward 790748 790775 218 3.00E-05 forward 790782 790809 215 4.80E-05 reverse 790066 790093 216 7.10E-06 forward 790142 790169 213 8.50E-05 forward 789962 789989 214 1.70E-06 reverse 790003 790030 Table S1 261 TATTACCAATATTAATGTATTATTATTT TTTTAATTACGTTTTTTTACAGATATAA + +++ ++ ++ ++ +++ ++++++ TCATAACAAGCTTTTTTTACAAGTTTTT TTTTAATTACGTTTTTTTACAGATATAA + +++ + ++++++++++ +++++ TTAAACAGAAACAAAAGCAGTAAGAATA TTATATCTGTAAAAAAACGTAATTAAAA +++++ + + + +++++++ + +++ + TATTGATTTTTCTTATTGGTGGAGTTAT TTTTAATTACGTTTTTTTACAGATATAA + ++ +++ ++++++++ + ++ ++++ TATCAATCGCGTGATCGTGCAGAATTTC TTTTAATTACGTTTTTTTACAGATATAA + + ++++++++ ++ + ++++++++ GGAGTTGCCCATGTTAGAGTTATTAAAA TTATATCTGTAAAAAAACGTAATTAAAA + ++ + ++ +++++ +++++++ TTTTCATTGACCCTCCCTGCGCTTCTAT TTTTAATTACGTTTTTTTACAGATATAA +++++++++ + + + + + ++ +++ TTATATCAGCGGGTATACAGAGGAAAAA TTTTAATTACGTTTTTTTACAGATATAA ++ ++ +++ +++ ++ ++ ++ ++ TTTCCATTCCATCATGGTGCATTATGAA TTTTAATTACGTTTTTTTACAGATATAA +++ ++++ + + + + ++++++ ++ ATATATCAATGTAAAAGTGTGATTTTCA TTATATCTGTAAAAAAACGTAATTAAAA +++++++ +++ +++++ ++++++ + TAATTTTCACCCTCATTTAAAGAAATAA TTTTAATTACGTTTTTTTACAGATATAA + + ++++ ++ +++++ ++++++++ ATTTTAAGGTGGATGCGCATGATTAAAG TTATATCTGTAAAAAAACGTAATTAAAA ++ ++++ +++ ++ +++++++++++ TATTCATCCCGTTTTCAAACTGAATAAA TTTTAATTACGTTTTTTTACAGATATAA + ++++++ +++++++ ++ ++++ ++ TAATTCCGGTACATTAGGGCAAAAAATA TTATATCTGTAAAAAAACGTAATTAAAA +++++ + +++ ++ ++ ++++ ++ + TTTTGATAACGGTCCGCTGTTTAAAAAT TTTTAATTACGTTTTTTTACAGATATAA ++++ ++ +++ + + + ++++ ++ TTAAATGAAAGAAGAGGATCTATCATAA TTATATCTGTAAAAAAACGTAATTAAAA ++++++ + +++ + ++ + ++ + ++ GATTATTTGCGTAGTAAAGGGATTGAAA TTATATCTGTAAAAAAACGTAATTAAAA + +++ ++ + + ++++ ++++ +++ TTAAAATAAGGTTAATGCAAGTTTAAAA 247 4.80E-05 reverse 908040 908067 248 8.50E-05 forward 909516 909543 245 5.50E-05 forward 905280 905307 246 1.20E-05 reverse 906213 906240 243 4.20E-07 forward 892165 892192 244 8.00E-05 reverse 893138 893165 241 1.30E-05 forward 871389 871416 242 7.50E-05 reverse 871879 871906 239 8.00E-05 forward 853690 853717 240 1.20E-05 reverse 869634 869661 237 3.20E-05 forward 847623 847650 238 8.00E-05 forward 852283 852310 235 5.80E-05 forward 840626 840653 236 7.50E-05 reverse 844603 844630 233 7.50E-05 reverse 827612 827639 234 2.80E-05 forward 828086 828113 231 5.80E-05 forward 824152 824179 232 8.50E-05 forward 825509 825536 Table S1 262 TTTTAATTACGTTTTTTTACAGATATAA ++ +++ + +++ ++ ++ ++++ ++ TATTCCTTTCGTTCAGCCACTTTTCATT TTTTAATTACGTTTTTTTACAGATATAA + +++ ++ ++++ + +++ +++ ++ TTTTATCTTTGTTATTGTAACAATAAAT TTTTAATTACGTTTTTTTACAGATATAA +++++ + ++++ ++ ++ +++ ++ TTAAAAAACGAAGAAAAAGTAATTTAAG TTATATCTGTAAAAAAACGTAATTAAAA +++++++ ++++++++++++++ ++ AAATTTATTAGCCAACATGTTAATAAAA TTATATCTGTAAAAAAACGTAATTAAAA ++++++++ + ++ + ++ + +++++ ATATCACCGTAAGATAGATGAAGCAAAA TTATATCTGTAAAAAAACGTAATTAAAA ++++ ++ ++++++ +++ ++ ++++ TTTTTCATCTGAGGGAGAAAGCTAAATA TTATATCTGTAAAAAAACGTAATTAAAA ++ ++ ++ ++++ ++++ + + ++ + TTTTTACAGGATAGTGAAACACAAAATA TTATATCTGTAAAAAAACGTAATTAAAA ++ ++++ + + + +++++ ++ + TTATATAGTGTAAGGAAATGGCTTAACA TTATATCTGTAAAAAAACGTAATTAAAA +++++++ ++ +++ + ++++ + TGTTATGCTCCCTTCTTCACTGATAGCA TTTTAATTACGTTTTTTTACAGATATAA + +++ + + +++ +++++ ++++ + TTAATATTACTCTTTTTTTCGCTATTTA TTTTAATTACGTTTTTTTACAGATATAA ++ +++++++++++++ + ++++++ TTACGCTACTGTTTTTATCATGAATTAA TTTTAATTACGTTTTTTTACAGATATAA ++ + +++++++ + +++++++ TTTAACGCGGAAGAAGACGCGCAAAAAA TTATATCTGTAAAAAAACGTAATTAAAA ++ ++ + +++++ +++++ ++++ TTTTTATGCTGCTATTAACCTTTATTTA TTTTAATTACGTTTTTTTACAGATATAA ++++ ++ ++++ ++ + +++++++ TTATCACATAGACAAAACCTGCATAAAA TTATATCTGTAAAAAAACGTAATTAAAA ++++ ++ ++ +++++ ++ +++++ TGTTAATGTTGGTGATTTACTCGTTTAA TTTTAATTACGTTTTTTTACAGATATAA + +++++ ++ + ++++++ +++++ TTTTAATTCTGTTTCTGCTGTTTATTCC TTTTAATTACGTTTTTTTACAGATATAA ++++++++ +++++ + + +++++ AACTTTCCGCAAAAACAGCCGATTTACA TTATATCTGTAAAAAAACGTAATTAAAA 265 9.60E-05 reverse 952443 952470 263 8.00E-05 forward 951017 951044 264 1.60E-05 forward 952269 952296 261 2.40E-05 forward 947347 947374 262 6.20E-05 reverse 947409 947436 259 9.00E-05 forward 943704 943731 260 2.40E-05 reverse 947240 947267 257 9.00E-05 forward 932112 932139 258 2.60E-05 forward 936810 936837 255 6.60E-05 reverse 931126 931153 256 9.60E-05 reverse 931816 931843 253 7.70E-06 reverse 928058 928085 254 4.20E-05 reverse 929349 929376 251 6.50E-06 reverse 926703 926730 252 2.40E-05 reverse 927283 927310 249 8.00E-05 forward 909619 909646 250 5.50E-05 forward 925284 925311 248 8.50E-05 forward 909516 909543 Table S1 263 ++ ++++ + +++++ + +++++ + + TTATCCCTTAACTATTTCATAAAAATAA TTTTAATTACGTTTTTTTACAGATATAA ++ ++ + ++ +++++++ ++++++ TTTAATTCAATTGGTTGTATTTATATAT TTTTAATTACGTTTTTTTACAGATATAA +++ + +++ ++ ++ +++ +++++++ TGTTATTAGTTTTATTTGGCCGTTATAC TTTTAATTACGTTTTTTTACAGATATAA + +++ + +++++ +++ + ++++++ TTTTCATGATGTCACTCCCGTAATCTTA TTTTAATTACGTTTTTTTACAGATATAA +++++++ ++++ + + ++ +++ TAAATATTTTAAAATGGATAAAAAAAGA TTATATCTGTAAAAAAACGTAATTAAAA ++++++ + +++++ ++ ++ ++ + AACATAGCACAAAATAGCAGGAGGAATA TTATATCTGTAAAAAAACGTAATTAAAA ++ +++ + ++++ ++++ ++ +++ + TGATTTCCTTATAGGCGATCGAGCAAAA TTATATCTGTAAAAAAACGTAATTAAAA + +++++ ++ + ++ +++ ++++ TTTTTCTCATTTTTCTGTGATTTGTTCT TTTTAATTACGTTTTTTTACAGATATAA ++++ ++++++++ + + ++ ++ + TTTAGATACGGTTTACTTTCTGGTTAAA TTTTAATTACGTTTTTTTACAGATATAA +++ ++ ++++++++ + + ++ ++ TTTTACTTTTGTTACTGATTTGTAAAAA TTTTAATTACGTTTTTTTACAGATATAA +++++ ++ ++++ + + ++++ ++ TTTTAATATTACTACCCAATTTTTTAAA TTTTAATTACGTTTTTTTACAGATATAA +++++++ + ++ + ++ ++++ ++ TAAGAAGAATATATAGATCACATAATAA TTATATCTGTAAAAAAACGTAATTAAAA +++ ++ +++ +++ + ++ + ++ TTTTGATTATCCTAATAAAAATAAATTT TTTTAATTACGTTTTTTTACAGATATAA ++++ +++++ ++ ++ + ++++++++ GAAGATTAGTATGAAAAATAAATCATTA TTATATCTGTAAAAAAACGTAATTAAAA ++ ++ +++ ++++++ +++ + + TATTTATTACCCTCATTGGTTTTTTTAT TTTTAATTACGTTTTTTTACAGATATAA + ++ +++++ ++ +++ + +++++++ AATAATATGTAAACAAATGTTATTTTTA TTATATCTGTAAAAAAACGTAATTAAAA ++ ++++++++++ +++ ++ +++ + TTTTATATCCATGATTTTATTGAATTTA TTTTAATTACGTTTTTTTACAGATATAA +++++ + + + ++++++ +++++++ 281 2.40E-05 reverse 1047630 1047657 282 7.10E-06 forward 1047719 1047746 279 5.50E-05 reverse 1020617 1020644 280 2.30E-05 forward 1047440 1047467 277 6.60E-05 reverse 1011511 1011538 278 1.10E-05 forward 1014996 1015023 275 2.60E-05 forward 991737 991764 276 5.10E-05 forward 1011293 1011320 273 6.20E-05 forward 964154 964181 274 7.50E-05 forward 975100 975127 271 4.50E-05 reverse 961147 961174 272 6.60E-05 reverse 961779 961806 269 3.20E-05 forward 957920 957947 270 6.20E-05 reverse 958018 958045 267 4.50E-05 forward 953572 953599 268 9.00E-05 forward 954141 954168 265 9.60E-05 reverse 952443 952470 266 3.20E-05 forward 953524 953551 Table S1 264 TTGTAATTAATTTTATTTACTTATTGAT TTTTAATTACGTTTTTTTACAGATATAA ++ ++++++ ++++++++++ ++++ ++ TTATTTCAATAAATAAACTTTAACAAAA TTATATCTGTAAAAAAACGTAATTAAAA +++++++ ++++++++++ + + ++++ GTTATTTTGTTGAAAAAATGCAGGAAAA TTATATCTGTAAAAAAACGTAATTAAAA + +++ +++ ++++++ + +++++ ATTATATTAAGAAAGGGCTCAATAAAAA TTATATCTGTAAAAAAACGTAATTAAAA ++ +++ ++ ++++ ++ ++++ ++++ TATTAACTGCTTTCAGGTTCATTTCGAT TTTTAATTACGTTTTTTTACAGATATAA + ++++ ++++++ + + +++++ ++ TGTTTTTTACTTCTTTGCCTTCATCAAT TTTTAATTACGTTTTTTTACAGATATAA + ++ ++++++ +++ + + ++ ++ TTTTTTGAGGTCGTTAATTAGATCAAAA TTATATCTGTAAAAAAACGTAATTAAAA ++ +++ + ++ ++ +++ ++++ TTACAACTATGCTTATTCTGGTAAAAAA TTTTAATTACGTTTTTTTACAGATATAA ++ ++ +++++++++++ ++++ ++ TCTTAATTGTGTTCTTTATGAATAAATA TTTTAATTACGTTTTTTTACAGATATAA + +++++++++++ +++ + +++ ++ TTATTACATGGAATTAACATTCTATAAA TTATATCTGTAAAAAAACGTAATTAAAA +++++++ ++++ +++++ + +++ TAATCAAAAAAAGGAAATGTTATGAAAA TTATATCTGTAAAAAAACGTAATTAAAA ++++ ++ + +++ +++ ++ +++++++ TTTTTTGCACATTCATTTCTTTTAATAA TTTTAATTACGTTTTTTTACAGATATAA ++++ +++ ++ ++++ + +++++++ TAATATATTATTAAACGCTTGATTATCA TTATATCTGTAAAAAAACGTAATTAAAA ++++++++ +++ ++ ++++++ + TATTTTGAATGTGTCTTAACATAATATA TTTTAATTACGTTTTTTTACAGATATAA + ++ ++++ + ++ +++++++ ++ TAATTATTATTTATGAAATTAATTAAAA TTATATCTGTAAAAAAACGTAATTAAAA ++++++ +++ ++ +++ +++++++++ TTTTTATTGTATTGTCGCATTTTTCTTA TTTTAATTACGTTTTTTTACAGATATAA ++++ +++++ ++ ++ +++ +++ +++ TAATAACTGTTTGTATATACAGTATTTT TTTTAATTACGTTTTTTTACAGATATAA + +++ +++++ +++ +++++++++++ 299 3.00E-06 forward 1100048 1100075 297 2.70E-07 reverse 1099652 1099679 298 3.60E-06 forward 1099745 1099772 295 5.50E-05 reverse 1099341 1099368 296 2.10E-05 forward 1099553 1099580 293 2.30E-06 reverse 1085970 1085997 294 5.10E-06 forward 1099283 1099310 291 1.20E-05 forward 1070255 1070282 292 3.20E-05 reverse 1071208 1071235 289 7.10E-05 reverse 1061620 1061647 290 5.50E-05 forward 1065466 1065493 287 7.50E-05 forward 1061029 1061056 288 1.40E-05 forward 1061254 1061281 285 9.00E-05 reverse 1051167 1051194 286 5.50E-06 reverse 1052308 1052335 283 4.20E-05 forward 1047954 1047981 284 8.60E-09 reverse 1050388 1050415 282 7.10E-06 forward 1047719 1047746 Table S1 265 TAAAAACTATGAGTACATATTATAAAAA TTATATCTGTAAAAAAACGTAATTAAAA +++++++++++++++ + ++ ++ ++++ AAAAACCCGTGAACGGCAAAAAGGAAAA TTATATCTGTAAAAAAACGTAATTAAAA +++++ + +++++ ++ ++ +++++ ATTGAAGGCGGAAAAACGACGATCAAAA TTATATCTGTAAAAAAACGTAATTAAAA ++ ++ ++++++ +++++ ++++ TGTTCAGTATGTGATTGCCAATAACAAT TTTTAATTACGTTTTTTTACAGATATAA + ++++ +++++ ++ + ++++ ++ ATAAAAAAGCAAATTAAGGTAATGATTA TTATATCTGTAAAAAAACGTAATTAAAA +++++++ + ++++ ++ +++++++ + GTATAACGGCGAATCAACGGACTTAACA TTATATCTGTAAAAAAACGTAATTAAAA ++++++ + ++++ ++++ + ++++ + TAAATAGTCTGACCCCAGGCGATAAAAA TTATATCTGTAAAAAAACGTAATTAAAA ++++++ + +++ + +++++ ++++ TGTAATTAATAAAGGAGAATAATAAAAA TTATATCTGTAAAAAAACGTAATTAAAA + +++ +++++ ++++++++ ++++ ATTAATCTGTAGGTGACCGGAAGCATAA TTATATCTGTAAAAAAACGTAATTAAAA ++ ++++++++ ++ + ++ ++ + ++ TTTTGACAAATCTTCCCCCTGGAAATCT TTTTAATTACGTTTTTTTACAGATATAA ++++ + + ++++ + + + +++++ + TGTATATTATGTTTACTCATCAGTTTTA TTTTAATTACGTTTTTTTACAGATATAA + + +++++++++++++++ +++++ GAAAATTTACTTAAAGAAAAAATAATAA TTATATCTGTAAAAAAACGTAATTAAAA +++++ ++ +++ +++ +++ + ++ GAATAAATGCGCGTAGATGGCGTAAAAA TTATATCTGTAAAAAAACGTAATTAAAA ++++++++ + +++ + + + ++++ GTTATCCTGCGAATAGGCTTGATGAAAG TTATATCTGTAAAAAAACGTAATTAAAA + ++ +++ +++++ ++ ++++++++ TGTTTCTTATTTGTTGTTCAATTGAATA TTTTAATTACGTTTTTTTACAGATATAA + ++ ++++++ ++ ++ +++ + ++ TAAGAAGAGTAAAAACATGATGAAAAAA TTATATCTGTAAAAAAACGTAATTAAAA +++ ++ +++++++ + + ++++ ATTTTTATGCACAATAAAGGTAAGATGA TTATATCTGTAAAAAAACGTAATTAAAA ++ ++++++ + ++ ++++ + ++ + TATTTATTTTATGCTCTTATTTTGTTTA 317 2.00E-05 forward 1154511 1154538 315 1.10E-05 reverse 1152638 1152665 316 3.90E-05 reverse 1153713 1153740 313 2.80E-05 reverse 1137677 1137704 314 8.00E-05 forward 1143653 1143680 311 3.90E-05 reverse 1133934 1133961 312 5.80E-05 reverse 1133998 1134025 309 9.60E-05 forward 1133129 1133156 310 5.10E-05 forward 1133223 1133250 307 1.90E-06 reverse 1131271 1131298 308 5.10E-05 reverse 1132525 1132552 305 3.40E-05 reverse 1122139 1122166 306 7.10E-05 reverse 1124335 1124362 303 5.80E-05 forward 1113347 1113374 304 3.60E-06 reverse 1121941 1121968 301 6.20E-05 reverse 1107642 1107669 302 5.80E-05 reverse 1111669 1111696 300 3.00E-08 reverse 1100323 1100350 Table S1 266 TTTACCTCTTTTTTACGCCCCGTATTAA TTTTAATTACGTTTTTTTACAGATATAA +++ + ++ +++++++ + + +++++++ TCTTCATTTTTTCATCAATAAGATATTT TTTTAATTACGTTTTTTTACAGATATAA + ++++++ +++ ++ ++++++++ TTTTTTTGCCGGTTTTTGACTTTTCTTT TTTTAATTACGTTTTTTTACAGATATAA ++++ + ++ +++++ ++ +++ +++ TTTTCTTTTCATTTTTTTATCCTTAAAA TTTTAATTACGTTTTTTTACAGATATAA +++++ ++ + +++++++++ +++ ++ TTTTAATTTAACTTTCTTGAGCGAAAAA TTTTAATTACGTTTTTTTACAGATATAA ++++++++ +++++++ ++ ++ AAAAATGAAATTGGAAGAATAATTATTA TTATATCTGTAAAAAAACGTAATTAAAA ++++++ + + +++++++++++ + TTTTTTCGCATCTTGTTTATAGATAAAT TTTTAATTACGTTTTTTTACAGATATAA ++++ ++++ ++++++++++ ++ TAAATTTAATAAGTTAATTTAATGTTAA TTATATCTGTAAAAAAACGTAATTAAAA ++++++ ++++++ ++ +++++ ++ TATATATTTCTTTCTTTTGCGGTAAAAA TTTTAATTACGTTTTTTTACAGATATAA + + +++ ++++ ++++ + ++++ ++ TTTTGATACCCTCGATTTGGTTTTCATT TTTTAATTACGTTTTTTTACAGATATAA ++++ ++ + + ++++ +++ ++ TTAATTGTCTCAAATAAGACGTTAAAAA TTATATCTGTAAAAAAACGTAATTAAAA ++++++ + + +++ ++ +++ + ++++ TGTTGATTCGTCTATTACAGGGTTAACA TTTTAATTACGTTTTTTTACAGATATAA + ++ +++ +++ ++ ++ ++++ + GTATTTATCCAGAAACGGTTTATCAATA TTATATCTGTAAAAAAACGTAATTAAAA +++++++ + +++ + + ++ ++ + ATTGATAACTATAACGAAATTATTAACA TTATATCTGTAAAAAAACGTAATTAAAA ++ +++ ++ ++ ++++ +++++ + TTTTCATCCTGGTGATACGTGTGAAGAA TTTTAATTACGTTTTTTTACAGATATAA ++++++++ ++ + ++ + + + ++ ++ TTTTACTGACGTTATTGTGCATGATACT TTTTAATTACGTTTTTTTACAGATATAA +++++ + +++++ ++ + +++ ++ + TCTTACTCACGTTTGCGAAATAATATAA TTTTAATTACGTTTTTTTACAGATATAA + +++ ++++++++ + + ++++++ 437 3.70E-05 forward 1541324 1541351 435 7.50E-05 forward 1536793 1536820 436 3.40E-05 forward 1536826 1536853 433 6.60E-05 reverse 1532775 1532802 434 9.80E-06 reverse 1536279 1536306 431 3.90E-05 reverse 1520899 1520926 432 4.80E-05 forward 1523150 1523177 429 8.40E-06 forward 1517233 1517260 430 6.20E-05 forward 1519160 1519187 427 1.60E-05 forward 1511486 1511513 428 4.50E-05 reverse 1512219 1512246 425 6.50E-06 forward 1507954 1507981 426 7.50E-05 reverse 1510794 1510821 423 3.40E-05 forward 1492813 1492840 424 5.20E-07 forward 1507651 1507678 421 8.00E-05 forward 1484809 1484836 422 9.60E-05 forward 1486103 1486130 420 6.60E-05 reverse 1472243 1472270 Table S1 273 TATTCATAACTTTGCCGTGCTGGGATTA TTTTAATTACGTTTTTTTACAGATATAA + +++++ +++++ + + + + ++++ AAATTCATGTTTGTAAAAACTAAAAATA TTATATCTGTAAAAAAACGTAATTAAAA +++++ ++++ ++++++++ + ++ + TTAATACGTCAAATAGACGTTATTAAGG TTATATCTGTAAAAAAACGTAATTAAAA +++++++ +++++ ++++ +++++ AAAATAATTCCTAATACAACGATAAAAA TTATATCTGTAAAAAAACGTAATTAAAA ++++++++ ++ + ++++++ ++++ AGAAAAAACCGAATAGGCGCAGTTAATA TTATATCTGTAAAAAAACGTAATTAAAA + +++++ +++++ +++++ ++++ + TAATTTTTGCGCGATTTCCGTCATTTTA TTTTAATTACGTTTTTTTACAGATATAA + + ++++++ ++++ ++++++ TTTTCATAACGCTAATTTAAAAATAAAT TTTTAATTACGTTTTTTTACAGATATAA +++++++ +++++ +++++ + +++ ++ CTTTATTATTGTTAATTTATTCTTTTAT TTTTAATTACGTTTTTTTACAGATATAA ++++ + ++++ ++++++ ++++++ CTTTAATAATGGGTTTATCGGTAATTAA TTTTAATTACGTTTTTTTACAGATATAA ++++++ +++ +++ + +++++++ TATTTATAACATGATGGGATTTTTTTAA TTTTAATTACGTTTTTTTACAGATATAA + ++ ++ ++ + + ++ +++++++ TTTACAAACAAGGAGAGCATGATGAAAA TTATATCTGTAAAAAAACGTAATTAAAA ++ + ++ + ++ +++++++++++++ TTTTAATAGCGTCGATAACCTGATCGTC TTTTAATTACGTTTTTTTACAGATATAA +++++++ ++++ ++ + +++ + TTTTAATTGCTCTCGCATAATCGTTTCT TTTTAATTACGTTTTTTTACAGATATAA +++++++++++++ + ++ +++ + TTCAATGCCGGAATAAGCAAAAGAAAAG TTATATCTGTAAAAAAACGTAATTAAAA ++ +++ +++++++++ ++ +++ AAAACAAGACAGAATAGGTTAATTAAAA TTATATCTGTAAAAAAACGTAATTAAAA ++++ ++ + + ++ ++ +++++++++ GTTGTCCAACAGAAAAATACAAACAAAA TTATATCTGTAAAAAAACGTAATTAAAA + + + + + +++++ ++++ ++++ TTTTCAAGCCGTTCCCTTAGCTTTTTTT TTTTAATTACGTTTTTTTACAGATATAA ++++++ ++++ ++++ +++++++ TTTTTATGTGCTTTATGTTCACTAAAAA 455 4.50E-05 forward 1587322 1587349 453 7.10E-05 reverse 1582383 1582410 454 4.50E-05 forward 1583596 1583623 451 5.10E-05 reverse 1581519 1581546 452 8.50E-05 reverse 1581955 1581982 449 9.00E-05 forward 1574526 1574553 450 6.20E-05 forward 1580633 1580660 447 8.00E-05 forward 1571983 1572010 448 5.10E-05 reverse 1572168 1572195 445 1.40E-05 forward 1564453 1564480 446 2.00E-05 forward 1571187 1571214 443 4.80E-05 forward 1554121 1554148 444 1.50E-07 forward 1562892 1562919 441 6.20E-05 reverse 1550973 1551000 442 7.70E-06 reverse 1552113 1552140 439 2.00E-05 reverse 1550111 1550138 440 2.00E-05 reverse 1550149 1550176 438 5.80E-05 forward 1542443 1542470 Table S1 274 TTTTAATTACGTTTTTTTACAGATATAA ++++ ++ +++++ + ++ +++ ++ TATTAAGCAATGTTTTTAATAATTCTTT TTTTAATTACGTTTTTTTACAGATATAA + ++++ ++ + +++++ +++ ++ +++ AATAATAAGGAAACAAGATGGATTTTAA TTATATCTGTAAAAAAACGTAATTAAAA ++ ++++ + +++ ++++ ++++ ++ TTTTCAGCGCGTTTAGGCCTGTTTCATC TTTTAATTACGTTTTTTTACAGATATAA ++++++ ++++++++ + + +++ + TTTTAAATAAACGTTCGCTGATAATGTA TTTTAATTACGTTTTTTTACAGATATAA ++++++ ++ + +++ + +++++ ++ TTTTGCTTAATTCACTCTGCGGGTTTTT TTTTAATTACGTTTTTTTACAGATATAA ++++ +++ ++ + + + + +++++ TATTCATTGTTGTTGCTCCAATAATTAT TTTTAATTACGTTTTTTTACAGATATAA + +++++++++ ++ +++ ++++++++ TATATTTTATATGTATATTGAGATTTAT TTTTAATTACGTTTTTTTACAGATATAA + + ++++ + +++ + ++++++++ CTTTTATCTATTGCCTGTGCGTATTTAA TTTTAATTACGTTTTTTTACAGATATAA +++ +++ ++ + + + +++++++ TTTTTTATCTATTCTTTCACTCAATATT TTTTAATTACGTTTTTTTACAGATATAA ++++ + + ++ ++++++ +++ ++ CATTAAGCAATTTTCTGTACAGATTAAC TTTTAATTACGTTTTTTTACAGATATAA ++++ ++ ++++ + ++++++++ + TTTTCAACCTGTGTGGTCAGGCTTATAT TTTTAATTACGTTTTTTTACAGATATAA ++++++ + +++ + +++ ++++++ GAATATAAGTAAAGCCGCAATTTTAAAA TTATATCTGTAAAAAAACGTAATTAAAA ++++++ +++++ +++ ++++++ TTTTCATTATTCGATCTCATTGAGCGCT TTTTAATTACGTTTTTTTACAGATATAA ++++++++++++ ++++++ ++ + TTTTCATTTGGTTTTGAGAAGGATCTTT TTTTAATTACGTTTTTTTACAGATATAA ++++++++ +++++ + +++ +++ TTTCATTCGTTTTATCTGACATATTTCA TTTTAATTACGTTTTTTTACAGATATAA +++ + +++++++ +++ ++++++++ + CTTTCTTTACGTTACTATGGGAAAAGAT TTTTAATTACGTTTTTTTACAGATATAA ++++ +++++++ + + +++ ++ TTATCATCACCGTCATGCAGAGGAAATT TTTTAATTACGTTTTTTTACAGATATAA 471 7.10E-05 forward 1649104 1649131 472 6.20E-05 forward 1649253 1649280 469 2.00E-05 forward 1647217 1647244 470 6.20E-05 forward 1648815 1648842 467 9.00E-05 reverse 1633880 1633907 468 3.20E-05 forward 1646665 1646692 465 3.40E-05 forward 1633045 1633072 466 3.90E-05 forward 1633563 1633590 463 4.20E-05 forward 1611574 1611601 464 3.90E-05 forward 1615938 1615965 461 9.80E-06 forward 1600734 1600761 462 9.60E-05 forward 1601747 1601774 459 8.50E-05 forward 1599923 1599950 460 4.50E-05 forward 1600446 1600473 457 9.00E-05 reverse 1591581 1591608 458 7.50E-05 forward 1595791 1595818 455 4.50E-05 forward 1587322 1587349 456 2.10E-05 forward 1588025 1588052 Table S1 275 ++ +++++++ + ++ ++ ++ ++ ++ TGCTATGTTTAAACGAGCTTACTGAATA TTATATCTGTAAAAAAACGTAATTAAAA + +++ + ++++ +++ ++ ++++ + TTATCACTGCCGTTACCTACTGTATTAT TTTTAATTACGTTTTTTTACAGATATAA ++ +++ +++ ++++ +++ +++++++ AAAATACCGTTTATGAAAGGACGCAATA TTATATCTGTAAAAAAACGTAATTAAAA +++++++ ++ ++ ++++ + ++ + TCTTCAAAATGCCATTTTGTTGATTTAA TTTTAATTACGTTTTTTTACAGATATAA + ++++ ++++ ++++ + +++++++ TTTTCACAACATTCATTCCAGAAAATTC TTTTAATTACGTTTTTTTACAGATATAA ++++++ ++ ++ ++++ +++++ TTTTTAATACCCAAAAGCGTCATCATTA TTATATCTGTAAAAAAACGTAATTAAAA ++ ++++++ ++++++++ ++ + + AAAGAAAATATAAAAAAATATATAATAA TTATATCTGTAAAAAAACGTAATTAAAA +++ +++ +++++++ ++ + ++ TTTTATTGGCGACGAAAAACTGTTAAAG TTATATCTGTAAAAAAACGTAATTAAAA ++ +++ + ++ ++++++ +++++ TAATTAACGGCTGTGAACACGATTAAAA TTATATCTGTAAAAAAACGTAATTAAAA +++++++ + ++ +++++++++++++ TATTAATCGTATTTATATTTATTACATA TTTTAATTACGTTTTTTTACAGATATAA + ++++++++ +++++ + +++++ ++ TATTTTACCTTCAAAAATAAGAAAAAGA TTATATCTGTAAAAAAACGTAATTAAAA ++ ++++ + +++++ + ++ ++ + TTATCAATGAGTTTTCTTCTGTATTAAA TTTTAATTACGTTTTTTTACAGATATAA ++ +++ ++ ++++++++ + ++++ ++ TTTTTATTTAGCGTTGATTAAGATTTTA TTTTAATTACGTTTTTTTACAGATATAA ++++ +++ ++ ++ + ++++++++ TTTTACACCCATTATTTCACCCTATTTA TTTTAATTACGTTTTTTTACAGATATAA +++++ + + ++ ++++++ ++++++ TTTAAACCACTGGTAAACTATATTAATA TTATATCTGTAAAAAAACGTAATTAAAA ++ ++++ + ++++++ +++++ + ATTTTATTTGTCATACAAATAAGTATAA TTATATCTGTAAAAAAACGTAATTAAAA ++ +++ + +++ ++++++ ++ ++ TTATTTTTGATTTTTTGTAAGATAATTT TTTTAATTACGTTTTTTTACAGATATAA ++ + +++ ++++++ ++ ++++++ 489 1.20E-05 forward 1696812 1696839 487 1.80E-05 reverse 1684887 1684914 488 7.50E-05 reverse 1686492 1686519 485 9.80E-06 forward 1683642 1683669 486 3.70E-05 forward 1684272 1684299 483 6.20E-05 reverse 1681326 1681353 484 7.10E-06 forward 1681951 1681978 481 5.10E-06 reverse 1679975 1680002 482 3.90E-06 forward 1680112 1680139 479 5.80E-05 reverse 1677206 1677233 480 8.50E-05 reverse 1678017 1678044 477 5.50E-05 forward 1674462 1674489 478 5.50E-05 reverse 1676412 1676439 475 8.50E-05 reverse 1660643 1660670 476 1.70E-05 forward 1666144 1666171 473 7.50E-05 reverse 1649866 1649893 474 6.60E-05 forward 1653168 1653195 472 6.20E-05 forward 1649253 1649280 Table S1 276 TCTTCAATACTTTTCTTCACGGTATTAA TTTTAATTACGTTTTTTTACAGATATAA + ++++ +++++++ +++++ +++++++ TATTCATCAAACTTATACTTGAATTATT TTTTAATTACGTTTTTTTACAGATATAA + +++++++ +++++ + + +++ ++ TATCGTTAAATTTTTCTCATTTATTGAT TTTTAATTACGTTTTTTTACAGATATAA + + + + ++++++++++ ++++ ++ TTTATTCAGAAACGTCAAGCAATTTAAA TTATATCTGTAAAAAAACGTAATTAAAA ++ ++++ + ++ ++++++++ +++ TATTAATATAGTTAACGTTTTGAAAGAA TTTTAATTACGTTTTTTTACAGATATAA + +++++ +++ ++ + + ++++ ++ TTTTAAGGTTGTTACTTAATATTGAATA TTTTAATTACGTTTTTTTACAGATATAA ++++++ ++++ ++ +++++ + ++ TTATATTTATACAAAAAGTTCATTAATA TTATATCTGTAAAAAAACGTAATTAAAA ++++++ ++++ +++++ + +++++ + TTTTCTGATGGTTTTCTGAGGTATTGTA TTTTAATTACGTTTTTTTACAGATATAA +++++ +++++++ + ++++ ++ ATAGATATGTGCAAAAACGTTATTATCA TTATATCTGTAAAAAAACGTAATTAAAA +++ +++++++ ++++++++ ++++ + ATAGAAGCGTATGAGGAAGCGCAGAATA TTATATCTGTAAAAAAACGTAATTAAAA +++ ++ +++ ++ +++++ +++ + ATCAATCAATAAAAACGATCAATATATA TTATATCTGTAAAAAAACGTAATTAAAA ++ ++++ +++++++ ++ ++++ + + AAAACAATATATGTTAACTTCATGATAA TTATATCTGTAAAAAAACGTAATTAAAA ++++ ++++++ ++ +++ + ++++ ++ ATTATAATACACATGCAAACATATAAAA TTATATCTGTAAAAAAACGTAATTAAAA ++ ++++++ + ++ +++++ +++++ TGTTAACGATCGTTTTTTACTGGATTTA TTTTAATTACGTTTTTTTACAGATATAA + ++++ ++ ++++++++ + +++++ TATTTTTCCCTTCTCTTTTCAGATTAAT TTTTAATTACGTTTTTTTACAGATATAA + ++ ++ +++ + +++ ++++++ ++ TTTTTTGTGCGTTATTTACGCGGTAAAT TTTTAATTACGTTTTTTTACAGATATAA ++++ ++++++ +++ + ++ ++ TTTTAATAGGGTGTCGACACGGTTAAAA TTTTAATTACGTTTTTTTACAGATATAA +++++++ + ++ + +++ ++++ ++ 505 9.00E-05 forward 1782273 1782300 506 8.80E-07 forward 1782345 1782372 503 4.80E-05 forward 1750078 1750105 504 3.30E-06 forward 1755424 1755451 501 2.80E-05 reverse 1746636 1746663 502 4.50E-05 reverse 1748406 1748433 499 6.60E-05 reverse 1741999 1742026 500 1.10E-05 reverse 1746594 1746621 497 9.00E-05 forward 1729285 1729312 498 9.50E-08 reverse 1737230 1737257 495 4.50E-05 forward 1726494 1726521 496 5.80E-07 reverse 1726603 1726630 493 3.90E-05 reverse 1721119 1721146 494 2.00E-05 forward 1722202 1722229 491 3.90E-05 forward 1711116 1711143 492 3.90E-05 forward 1712014 1712041 489 1.20E-05 forward 1696812 1696839 490 5.80E-07 forward 1709073 1709100 Table S1 277 TGTTAACCAATTCTCTTTTATGGAAAAA TTTTAATTACGTTTTTTTACAGATATAA + ++++ ++ ++ + +++ + ++ ++ TTTATTCTTTATAATCAATAAGTTGAAA TTATATCTGTAAAAAAACGTAATTAAAA ++ +++++ ++ ++ ++ + ++ +++ AGTAATGTTGATAATAGTTTGATTAATA TTATATCTGTAAAAAAACGTAATTAAAA + +++ + + ++ ++ +++++++ + TTATATTAGTATTTTTTATCATTTAAAC TTTTAATTACGTTTTTTTACAGATATAA ++ ++ + ++ ++++++ ++++++ + AAAGAACTTAAAGTAAACAGGAAAATCA TTATATCTGTAAAAAAACGTAATTAAAA +++ ++++ +++++++++ ++ + + TGTTATTTATATGTACTCGTTATGCTAA TTTTAATTACGTTTTTTTACAGATATAA + +++ ++++ + +++++ + + +++ GGTATCGTGGAAGACAAAGTGATTAAAA TTATATCTGTAAAAAAACGTAATTAAAA ++ ++ ++++ +++++++++++++ TATTTACAACGCCTATAAAGATGAAAAA TTTTAATTACGTTTTTTTACAGATATAA + ++ + ++++ +++ + ++ ++ ++ GATAATCTGGATGAAGGCCCAATCATTA TTATATCTGTAAAAAAACGTAATTAAAA + ++++++ + +++ ++ ++++ + + ATATAAATCAAAGGAAAAGTCGTCATCA TTATATCTGTAAAAAAACGTAATTAAAA ++++++++ +++ ++++++ + + + TTTTACGGAAATTAACTTTTTGTTATTT TTTTAATTACGTTTTTTTACAGATATAA +++++ + ++ ++++ + +++++++ GTAAAACTACGTAAAAAACCACTAAAAA TTATATCTGTAAAAAAACGTAATTAAAA ++++++++ + ++++++ ++ + ++++ TTTAAAAAATCTTTTTTTGAATATAATT TTTTAATTACGTTTTTTTACAGATATAA +++ ++ ++ +++++++ +++++ ++ TAATTTTTTACTTTAGATGCAGATAAAT TTTTAATTACGTTTTTTTACAGATATAA + + ++ ++++ + ++++++ ++ TTTAATATGATTAAGGAAATTATTAATA TTATATCTGTAAAAAAACGTAATTAAAA ++ ++++++ ++ ++++ +++++ + AAATCTACCCGAGGTCACTCGCTAAAAA TTATATCTGTAAAAAAACGTAATTAAAA ++++ ++ +++ ++ ++ + ++++ TTAATTGTTTAAAAAAGTGTTAAATTTA TTATATCTGTAAAAAAACGTAATTAAAA ++++++ + ++++++++ ++ + + TTCAATGTGGAGGAAACCGCAAAGAAAA 523 9.00E-05 reverse 1850334 1850361 524 7.70E-06 reverse 1861042 1861069 521 8.40E-06 reverse 1840614 1840641 522 5.80E-05 reverse 1841348 1841375 519 5.80E-05 forward 1840255 1840282 520 9.60E-05 forward 1840312 1840339 517 8.00E-05 forward 1825917 1825944 518 1.70E-06 reverse 1826006 1826033 515 8.50E-05 reverse 1809084 1809111 516 7.10E-05 reverse 1820857 1820884 513 6.20E-05 reverse 1800158 1800185 514 3.40E-05 forward 1800205 1800232 511 7.50E-05 reverse 1799460 1799487 512 4.80E-05 forward 1799628 1799655 509 8.00E-05 reverse 1798694 1798721 510 4.50E-05 forward 1798740 1798767 507 4.50E-05 forward 1798404 1798431 508 4.80E-05 reverse 1798475 1798502 Table S1 278 TTATATCTGTAAAAAAACGTAATTAAAA ++ +++ ++ + ++++ +++++ +++++ TTTTCTTTGGATTTTTTCCTTCGTCTTC TTTTAATTACGTTTTTTTACAGATATAA +++++ +++ +++++++ + + ++ TATTTACCGCAGTTACGTAAAGATATTC TTTTAATTACGTTTTTTTACAGATATAA + ++ + +++ ++++ ++ +++++++ TTTTATTGATGAATAAATCTAAATGAAA TTATATCTGTAAAAAAACGTAATTAAAA ++ +++ +++++++++ +++ + +++ GAAAAACCAGAAAAAACAATGCTAATAA TTATATCTGTAAAAAAACGTAATTAAAA ++++++ + ++++++ ++++ + + ++ TTTACAGAATGCCTTAAAATAATGAACA TTATATCTGTAAAAAAACGTAATTAAAA ++ + + +++ + +++++++++++ + TAAGTACTGTTAAATAATATTTTAATAA TTATATCTGTAAAAAAACGTAATTAAAA +++ ++++++ +++ ++ ++ + + ++ TATCCATTTGATTTTTATATTAAAATAA TTTTAATTACGTTTTTTTACAGATATAA + + ++++ +++++ +++ ++++++ TGTTTATATTTCTTGCTTTCAAAAAATA TTTTAATTACGTTTTTTTACAGATATAA + ++ ++ +++++ +++ ++ +++ ++ TTTTCATGACGTTCAGAAAAACTACAAA TTTTAATTACGTTTTTTTACAGATATAA +++++++ +++++ + + + ++ ++ TAATAATATCGCTTATTACATCTATTTT TTTTAATTACGTTTTTTTACAGATATAA + ++++ ++++++++ ++++++ ATAAATAAGTTAATTAAATGTATCAATA TTATATCTGTAAAAAAACGTAATTAAAA +++++++ ++ +++ +++ ++ ++ + TTATACTTCGAAAAAGACGTTATCAAAA TTATATCTGTAAAAAAACGTAATTAAAA +++++ + +++++ ++++ ++ ++++ AAATACCCATGTAGACGAAGGCTTAATA TTATATCTGTAAAAAAACGTAATTAAAA +++++ + +++ + + +++ + ++++ + AAATTTTTATCTAAACATATAAAAAACA TTATATCTGTAAAAAAACGTAATTAAAA ++++++ +++ +++ + ++++ ++ + ATTTTTATTTAAGTTAAATATTTTATAA TTATATCTGTAAAAAAACGTAATTAAAA ++ +++++ +++++ +++ +++ ++ TATTTATTTCATTTTGCGATATTGATTA TTTTAATTACGTTTTTTTACAGATATAA + ++ +++ + ++++ +++++ ++++ AACAACACACAGAGAACATAAATGAAAA TTATATCTGTAAAAAAACGTAATTAAAA 541 7.10E-05 reverse 1922630 1922657 539 4.80E-05 reverse 1920612 1920639 540 8.50E-05 forward 1922591 1922618 537 2.10E-05 reverse 1916160 1916187 538 3.70E-05 reverse 1916981 1917008 535 3.30E-06 reverse 1913036 1913063 536 9.50E-08 reverse 1913510 1913537 533 3.70E-05 forward 1910751 1910778 534 6.20E-05 forward 1911072 1911099 531 1.80E-05 forward 1909447 1909474 532 4.80E-05 forward 1910342 1910369 529 4.50E-05 reverse 1893871 1893898 530 3.40E-05 reverse 1895092 1895119 527 1.80E-05 reverse 1889402 1889429 528 5.10E-05 reverse 1892949 1892976 525 3.90E-05 forward 1866976 1867003 526 8.00E-05 forward 1870598 1870625 524 7.70E-06 reverse 1861042 1861069 Table S1 279 ++ ++ + + + + ++ + ++++++++ ATAACACCCCAACAACCCATGAAGAAAA TTATATCTGTAAAAAAACGTAATTAAAA ++++ ++ ++ ++ +++++ +++++ TGTTAACCACTTTCCCGTTCGGTAAATA TTTTAATTACGTTTTTTTACAGATATAA + ++++ ++++++ + + + ++++ ++ AATATAATCGGCAAAACGCCTAATAAAA TTATATCTGTAAAAAAACGTAATTAAAA ++ +++++ + ++++ + + +++++ ATAACATTTTCTGTAAGAATAATAAATA TTATATCTGTAAAAAAACGTAATTAAAA ++++ + + + +++++++++++ ++ + TTAGCTGTATGTCACAACTGGATGAAAA TTATATCTGTAAAAAAACGTAATTAAAA +++ + ++++ + +++ ++++++++ TATTCCTTCCGCGCCGGCATTAAAAAAA TTTTAATTACGTTTTTTTACAGATATAA + +++ ++ +++ +++ +++ ++ CGTTTATTGAATGCTTATGCAGATTATT TTTTAATTACGTTTTTTTACAGATATAA ++ ++++ + ++ + ++++++ ++ TAAATTAACGGAGGAAAATTCAACATAA TTATATCTGTAAAAAAACGTAATTAAAA +++++++ +++ ++++ + + + ++ TCTTTTTTGTTTCTCTCTGTTAAAATAA TTTTAATTACGTTTTTTTACAGATATAA + ++ ++++++ + + + + ++++++ TATTTTATTGAAATTAACATACTTGAAA TTATATCTGTAAAAAAACGTAATTAAAA ++ +++++ ++++ ++++++ ++ +++ TTTTATTCCCATTCGTATTTTTAATAAT TTTTAATTACGTTTTTTTACAGATATAA +++++ ++ + ++ + + + ++++ ++ TAATATTTTACCTTTTGCAAATAATAAA TTTTAATTACGTTTTTTTACAGATATAA + ++ ++ +++++ ++ +++++ ++ TTTTATCTCAACTTTGAAACGTAAAAAA TTTTAATTACGTTTTTTTACAGATATAA +++++ + ++++ ++ ++++ ++ TTTTGCTCTCGTTTTTGGAAATTATGTT TTTTAATTACGTTTTTTTACAGATATAA ++++ ++ +++++++ + +++++ ++ TTTTGATCGTGCCTTCATTGCCTTTTTT TTTTAATTACGTTTTTTTACAGATATAA ++++ +++++++ +++ + ++++++ TTTTCCCAAATTTTATAGAGAATTAAAT TTTTAATTACGTTTTTTTACAGATATAA +++++ + ++++++ + + +++ ++ TTTTAATCAAAACATAAAACAATTATTA TTATATCTGTAAAAAAACGTAATTAAAA ++ +++ + ++ + ++++++++++ + 557 3.70E-05 forward 2004198 2004225 558 4.20E-05 reverse 2012977 2013004 555 3.00E-05 forward 1996575 1996602 556 3.20E-05 forward 2001132 2001159 553 5.50E-05 forward 1986871 1986898 554 6.20E-05 forward 1996532 1996559 551 1.20E-05 reverse 1984427 1984454 552 5.10E-05 forward 1986837 1986864 549 2.60E-05 reverse 1971531 1971558 550 2.30E-05 forward 1980036 1980063 547 9.60E-05 forward 1958137 1958164 548 7.50E-05 forward 1960006 1960033 545 7.50E-05 reverse 1948446 1948473 546 2.00E-05 reverse 1954516 1954543 543 4.50E-05 forward 1929148 1929175 544 8.50E-05 reverse 1938846 1938873 541 7.10E-05 reverse 1922630 1922657 542 4.20E-05 reverse 1923930 1923957 Table S1 280 TTTTGCGAACATTTATTCAGCGAAATTT TTTTAATTACGTTTTTTTACAGATATAA ++++ ++ ++++++++ +++++++ TTTTACTAAGGTTTATCCGAAAATAAAT TTTTAATTACGTTTTTTTACAGATATAA +++++ + + ++++++ + + +++ ++ TATTTATTGTTTTTATGGCAATTGCTAA TTTTAATTACGTTTTTTTACAGATATAA + ++ +++++++++++ +++ +++ TTATTAGTAAGACAAAACTTATTGATTA TTATATCTGTAAAAAAACGTAATTAAAA ++++++ ++ ++ +++++ ++ +++ + AAAGAAAGATAAAAACGCATAATAAACA TTATATCTGTAAAAAAACGTAATTAAAA +++ +++ +++++++ +++++++ ++ + ATCAAAAAACATAACCCATTGATAAAAA TTATATCTGTAAAAAAACGTAATTAAAA ++ ++++ + + ++ + ++++ ++++ TAAAAAACCAAACAGAAACAAATTGAAA TTATATCTGTAAAAAAACGTAATTAAAA +++++++ ++ + +++ ++++ +++ TTTAAATACCTTTGTTACATGTTATTTT TTTTAATTACGTTTTTTTACAGATATAA +++ +++ ++++ ++ +++ +++++++ ATTAACTTATCTAATAACACGAGAAAAA TTATATCTGTAAAAAAACGTAATTAAAA ++ ++ +++ ++ +++++++ ++++ TTTTCAGAAAGTTAGCCTACTTATCAAA TTTTAATTACGTTTTTTTACAGATATAA ++++++ + +++ + +++ +++ ++ AAATACTTATTCAAAAATGTAATTTTAA TTATATCTGTAAAAAAACGTAATTAAAA +++++ +++ +++++ ++++++ ++ ATTGTTCTATACGGCACAATTATGAAGA TTATATCTGTAAAAAAACGTAATTAAAA ++ +++++++ + + +++ +++++ + ATAATTATTTGCAAACGTATGATATAAA TTATATCTGTAAAAAAACGTAATTAAAA ++++++++ ++ +++ + +++++ +++ TTAAATTTCATTTTTCGCGGGTATAAAA TTTTAATTACGTTTTTTTACAGATATAA ++ + ++ ++++++ + ++++ ++ TTTTTTTACCTGTTTTCAAGATATTTTT TTTTAATTACGTTTTTTTACAGATATAA ++++ + ++ ++++ + ++++++++ AAAAATTAATGTAATGAACGCATGAATA TTATATCTGTAAAAAAACGTAATTAAAA ++++++ +++ ++ ++ +++++ + ATTAATCAGTGTGGAGGATGTATTGAGA TTATATCTGTAAAAAAACGTAATTAAAA ++ ++++ +++ + + ++ +++ + + 575 8.00E-05 reverse 2077083 2077110 573 1.80E-05 forward 2064863 2064890 574 3.70E-05 reverse 2072223 2072250 571 1.40E-05 reverse 2041507 2041534 572 6.60E-05 forward 2060844 2060871 569 4.20E-05 reverse 2040308 2040335 570 8.50E-05 reverse 2041404 2041431 567 4.80E-05 reverse 2039823 2039850 568 3.00E-05 forward 2039873 2039900 565 8.50E-05 reverse 2034984 2035011 566 2.40E-05 forward 2035015 2035042 563 1.60E-06 reverse 2025524 2025551 564 7.10E-05 reverse 2034907 2034934 561 4.50E-05 forward 2025230 2025257 562 4.80E-05 reverse 2025277 2025304 559 3.90E-06 forward 2024633 2024660 560 6.00E-06 forward 2024725 2024752 558 4.20E-05 reverse 2012977 2013004 Table S1 281 TTTTAACAGACCCTATTCGGGTAATTTT TTTTAATTACGTTTTTTTACAGATATAA ++++++ + + +++++ +++++++ AGCTTTCTGCTCAGAGCTGGTATGAAAA TTATATCTGTAAAAAAACGTAATTAAAA + ++++++ + + + +++++++ GATAAAAAGTACAATGACAATATCAAAA TTATATCTGTAAAAAAACGTAATTAAAA + ++++ +++ ++ +++ ++ ++++ TTTTTCTACTATTCCTAACCAGGTTAAA TTTTAATTACGTTTTTTTACAGATATAA ++++ + + ++ + +++ ++ ++ AAATATTTCAGCAGAAGATGTCTCAAAA TTATATCTGTAAAAAAACGTAATTAAAA ++++++ + + + ++++ + ++++ ATCAATCAACGACAAAATAAAAGAATAA TTATATCTGTAAAAAAACGTAATTAAAA ++ ++++ + ++ ++++ + ++ + ++ TTTTCATCCATTTTCTCCTGACTTTAAC TTTTAATTACGTTTTTTTACAGATATAA ++++++++ ++++ + + + +++ + TTCATACTATAAATGCGAAATGAAAAAA TTATATCTGTAAAAAAACGTAATTAAAA ++ +++++++++++ +++ ++++ TTTTCATTATTCGCTCTCAGAATTAACT TTTTAATTACGTTTTTTTACAGATATAA ++++++++++++ +++++ + +++ + AATATTAAGCAAAAGCGATAAATCAATA TTATATCTGTAAAAAAACGTAATTAAAA ++ ++++ + ++++ ++ +++ ++ + TTTTACGCAGGCTAATTTATACAATTAT TTTTAATTACGTTTTTTTACAGATATAA +++++ ++ +++ +++++++ ++++++ TATTCAGTACTTCTCGGTAAGCTTAATA TTTTAATTACGTTTTTTTACAGATATAA + ++++ +++++ + ++ +++ ++ TAAATCATAAGTGGTGATGCAATTATAA TTATATCTGTAAAAAAACGTAATTAAAA +++++ +++ + + + +++++++ ++ TTTTTTTAACATCTTGTACTGTATCTTT TTTTAATTACGTTTTTTTACAGATATAA ++++ + ++ + ++ + + +++ +++ TGATAAATACTTTAATTCGTTTAAATAA TTTTAATTACGTTTTTTTACAGATATAA + +++ ++++++ ++++ + +++++++ TTTTAATTGCACTCTGCCAGCTTTTTTC TTTTAATTACGTTTTTTTACAGATATAA ++++++++++ ++ + ++ ++++++ AAAATCAGATTTATTAACACTATTATAA TTATATCTGTAAAAAAACGTAATTAAAA +++++ + ++ ++ +++++ ++++ ++ TAAAAAGCGAAAATACACTTTCTGAATA 593 1.40E-05 reverse 2164619 2164646 591 5.50E-05 forward 2164063 2164090 592 5.10E-05 reverse 2164484 2164511 589 3.70E-05 forward 2161978 2162005 590 9.10E-06 forward 2162366 2162393 587 4.20E-05 forward 2158624 2158651 588 4.80E-05 reverse 2159175 2159202 585 1.40E-05 reverse 2156991 2157018 586 3.60E-06 forward 2158596 2158623 583 2.80E-05 reverse 2147033 2147060 584 4.30E-06 forward 2156833 2156860 581 2.00E-05 reverse 2141909 2141936 582 2.80E-05 forward 2146964 2146991 579 6.60E-05 forward 2139311 2139338 580 3.90E-05 reverse 2139575 2139602 577 9.00E-05 reverse 2085300 2085327 578 1.60E-05 reverse 2113107 2113134 576 1.20E-05 forward 2080009 2080036 Table S1 282 GAAAATTCATGAATGCACATAAATAAAA TTATATCTGTAAAAAAACGTAATTAAAA +++++ ++++++ ++++++ +++++ TTTTTCTACGCGTTTTTCGTGCATTTTT TTTTAATTACGTTTTTTTACAGATATAA ++++ + ++++++ + ++++++ CATTCATCCATTTAATAAATATTTATAT TTTTAATTACGTTTTTTTACAGATATAA ++++++ +++ ++ ++++++++++ TTCATTCCATGAATACAAAAACGTAAAA TTATATCTGTAAAAAAACGTAATTAAAA ++ ++++ +++++++ +++ + +++++ CTTTCATCATTTGCAGATGCAGAGTTAT TTTTAATTACGTTTTTTTACAGATATAA +++++++++++ + + ++++ ++++ ATATATTCCTAAAAAGAAAAGTTTAATA TTATATCTGTAAAAAAACGTAATTAAAA ++++++ ++++++ +++ + ++++ + TAATATTGATATAATAAATAAAAAGAAA TTATATCTGTAAAAAAACGTAATTAAAA ++++++ +++ ++ +++ ++ +++ TATTTCTAATATTAATTTTCGGGAATAA TTTTAATTACGTTTTTTTACAGATATAA + ++ + ++ ++ ++++ + + +++++ ATAAATAGTTGAATCAATAAAAAGAATA TTATATCTGTAAAAAAACGTAATTAAAA +++++++ +++++ ++ + ++ +++ + TTTTAAAATAAAATGAGCATTAGCAACA TTATATCTGTAAAAAAACGTAATTAAAA ++ ++++ ++++ +++++ + ++ + ATTGAAACATTACAAAAATCTATTGATA TTATATCTGTAAAAAAACGTAATTAAAA ++ +++ ++ + +++++ + +++ + + TTATTTTCATTTGTTTTTCCTGAATATT TTTTAATTACGTTTTTTTACAGATATAA ++ + ++++++ +++++ + ++++ ++ TGTTTACGCCGCAGAAGAAAGAAGAAAA TTATATCTGTAAAAAAACGTAATTAAAA + ++++ + + +++++ ++ +++++ TTAATTTCCTGACGACGCATACGGAAAA TTATATCTGTAAAAAAACGTAATTAAAA ++++++ +++ + +++++ +++++ TGTTCATTACGCTATTAAAGGCTGCTTT TTTTAATTACGTTTTTTTACAGATATAA + +++++++++++ ++ + + +++ TTATTTAAGCGAAAAGGTAGAGGAATTA TTATATCTGTAAAAAAACGTAATTAAAA +++++++ + +++++ + + + + + ATTATTTTGCAACGACACGCTAACAAAA TTATATCTGTAAAAAAACGTAATTAAAA ++ +++ ++ ++ + ++++ + ++++ 713 7.70E-06 reverse 2718626 2718653 711 6.60E-05 forward 2716530 2716557 712 4.80E-05 reverse 2718581 2718608 709 5.80E-05 reverse 2711627 2711654 710 1.70E-05 reverse 2711758 2711785 707 7.50E-05 reverse 2671921 2671948 708 3.90E-06 forward 2684117 2684144 705 5.50E-05 reverse 2648718 2648745 706 6.20E-05 reverse 2658306 2658333 703 9.00E-05 reverse 2648645 2648672 704 2.80E-05 forward 2648682 2648709 701 6.60E-05 forward 2648420 2648447 702 4.70E-06 reverse 2648604 2648631 699 3.90E-05 forward 2631693 2631720 700 1.90E-06 reverse 2639459 2639486 697 3.30E-06 reverse 2620424 2620451 698 6.20E-05 forward 2623089 2623116 696 9.00E-05 forward 2619790 2619817 Table S1 289 TAATCTTTCTTCGTTTTTACTGTGCGTT TTTTAATTACGTTTTTTTACAGATATAA + ++ ++ +++ +++++++ ++ ++ CTTTCCCCGCATTACCTTATGGATTAAA TTTTAATTACGTTTTTTTACAGATATAA ++++ +++ ++ +++++ ++++ ++ TATTATTTTTCAAAAAAAGATATTATTA TTATATCTGTAAAAAAACGTAATTAAAA ++ +++ + + ++++++++ ++++ + TAATAAAGATGAGAAGATAGCAGAAAGA TTATATCTGTAAAAAAACGTAATTAAAA +++++++ +++++++ + + + ++ + TTATCTCAACATAAAAAATACAATATTA TTATATCTGTAAAAAAACGTAATTAAAA ++++ ++ + + ++++++ + ++ + AATTTTCGCTCAACAAACTTAATTATTA TTATATCTGTAAAAAAACGTAATTAAAA ++ ++++ + ++ ++++ ++++++ + ATTTTTATTTAAGTTAAATATTTTATAA TTATATCTGTAAAAAAACGTAATTAAAA ++ +++++ +++++ +++ +++ ++ ATTTCACTCCACCGTGGCGGGATAAAAA TTATATCTGTAAAAAAACGTAATTAAAA ++ + +++ + +++ +++ ++++ TAAAAACAGGAAATAAACAATAAGAAGA TTATATCTGTAAAAAAACGTAATTAAAA +++++++ + +++++++++ + +++ + TTTATAGAATGTTAATTCCATGTAATAA TTTTAATTACGTTTTTTTACAGATATAA +++ + +++++ ++++ +++++++ TTTTAAAAAAATGCTTTCCTACAACGAA TTTTAATTACGTTTTTTTACAGATATAA ++++++ + + ++++ ++ ++ ++ TTTTAATATTGTCTTTTGTTAGTTTGTC TTTTAATTACGTTTTTTTACAGATATAA +++++++ +++ ++++ ++++++ + CCTTACTGATGTTTTTTTAATCATATAC TTTTAATTACGTTTTTTTACAGATATAA +++ + +++++++++++ +++++ ATAACACCCCAACAACCCATGAAGAAAA TTATATCTGTAAAAAAACGTAATTAAAA ++++ ++ ++ ++ +++++ +++++ TTAGTAAATTAAACAAGAACCATGATGA TTATATCTGTAAAAAAACGTAATTAAAA +++ +++ ++++ ++++++ ++++ + AAAAAACGGCGACAGCGCCGGGTGAAAA TTATATCTGTAAAAAAACGTAATTAAAA +++++++ + ++ + ++ + ++++++ TTAAATCAATAAAAACCACACCACAAAA TTATATCTGTAAAAAAACGTAATTAAAA +++++++ +++++++ + ++++ TTTTAATTCATCGTTCATGCTTTTCTCC 731 2.80E-05 forward 2788846 2788873 729 9.60E-05 reverse 2783203 2783230 730 6.60E-05 reverse 2786818 2786845 727 4.20E-05 reverse 2772284 2772311 728 5.80E-05 reverse 2780820 2780847 725 2.30E-05 forward 2767219 2767246 726 9.00E-05 forward 2770392 2770419 723 3.20E-05 forward 2758110 2758137 724 3.70E-05 forward 2760148 2760175 721 5.10E-05 reverse 2740663 2740690 722 1.90E-06 reverse 2755819 2755846 719 2.60E-05 reverse 2728506 2728533 720 4.80E-05 reverse 2730592 2730619 717 5.80E-05 reverse 2727763 2727790 718 4.80E-05 reverse 2727830 2727857 715 8.00E-05 forward 2727105 2727132 716 1.10E-05 reverse 2727683 2727710 714 9.60E-05 forward 2720903 2720930 Table S1 290 TTTTAATTACGTTTTTTTACAGATATAA ++++++++ ++ +++ + + +++ + CTTTACTACCGTTATTTCAGCGAGATCA TTTTAATTACGTTTTTTTACAGATATAA ++++ + ++++ +++++ ++ ++ + TGTTAATTATTTGTTTGCTAATTTTTAT TTTTAATTACGTTTTTTTACAGATATAA + ++++++++++ +++ + ++++++++ TGATTATTTTTTCTCCGCACACATATTT TTTTAATTACGTTTTTTTACAGATATAA + + +++ +++ + + ++++ ++++++ TGTTAATGCGTTTTTCTCACCGATTTAT TTTTAATTACGTTTTTTTACAGATATAA + +++++ ++++++++++ +++++++ TCATCTGCGCGTTTTGTCAGGGTACTTA TTTTAATTACGTTTTTTTACAGATATAA + ++ ++++++++ +++ +++ +++ TCATTATCCAGTTAATGCCTTGTTATTA TTTTAATTACGTTTTTTTACAGATATAA + + +++ +++ ++ + + +++++++ ATAAAACAACTAGTTAAAGTAATTTTTA TTATATCTGTAAAAAAACGTAATTAAAA +++++++ + +++ +++++++++ + AACGAAAGAGTAAGAAGCAGAGTTAAAA TTATATCTGTAAAAAAACGTAATTAAAA ++ +++ + ++ +++++ + ++++++ TACAAATTTTGAAAAAACTTCGGGAACA TTATATCTGTAAAAAAACGTAATTAAAA ++ +++ + +++++++++ + +++ + TTTTAACCCGGCTAACGCAGTGGAAAAT TTTTAATTACGTTTTTTTACAGATATAA ++++++ + +++ ++ ++ + ++ ++ TTACCATAACATCCTCTTGTGTGAATAA TTTTAATTACGTTTTTTTACAGATATAA ++ +++ ++ + ++++ + + +++++ TATTGTCTATGCTTTTGCGCTGATTAAC TTTTAATTACGTTTTTTTACAGATATAA + ++ +++++++++ + + ++++ + TTTTCTGTTCTTTACTACTCATGAATTT TTTTAATTACGTTTTTTTACAGATATAA +++++ + ++++ + + +++ +++++ TTTTACGTTAGCCTCTTTACTGTATAAA TTTTAATTACGTTTTTTTACAGATATAA +++++ + ++ + +++++ ++++ ++ TATGTTAAAAGAGAAAAAGAAGAAAAAA TTATATCTGTAAAAAAACGTAATTAAAA ++ +++ + +++++++++ + ++++ ATTATAAAACATAAAGATAAATAAAAAA TTATATCTGTAAAAAAACGTAATTAAAA ++ ++++ + + +++ + + + ++++ ATAATTCTCTACAATAATGGCAGTGAAA TTATATCTGTAAAAAAACGTAATTAAAA 747 9.00E-05 reverse 2838418 2838445 748 2.60E-05 reverse 2842917 2842944 745 2.30E-06 forward 2834367 2834394 746 2.30E-05 reverse 2838381 2838408 743 4.20E-05 forward 2830198 2830225 744 7.10E-05 forward 2833344 2833371 741 4.80E-05 forward 2822089 2822116 742 9.00E-05 forward 2828070 2828097 739 4.80E-05 reverse 2816751 2816778 740 4.80E-05 reverse 2819837 2819864 737 3.00E-05 forward 2813727 2813754 738 6.60E-05 reverse 2815336 2815363 735 1.60E-06 forward 2813393 2813420 736 6.60E-05 forward 2813569 2813596 733 1.90E-06 forward 2796169 2796196 734 9.10E-06 forward 2813188 2813215 731 2.80E-05 forward 2788846 2788873 732 9.60E-05 forward 2792543 2792570 Table S1 291 ++++++++ ++ ++ ++ + + + +++ TATTGTTCTGATCTGCTCACTGTTATTT TTTTAATTACGTTTTTTTACAGATATAA + ++ ++ + + +++++ +++++++ TTTTTTGAAAGTTTCTGGAAAATAAAAA TTTTAATTACGTTTTTTTACAGATATAA ++++ + ++++ + + + +++ ++ TACTAAAAGAAAAATCAACCGAGAAAAA TTATATCTGTAAAAAAACGTAATTAAAA ++ ++++ + ++++ ++ +++ ++++ ATTTTTACGGGCGAAAGTCTGGTTAACA TTATATCTGTAAAAAAACGTAATTAAAA ++ ++++ + + +++++ ++ ++++ + TTTTAACCATTTCATTTCGCTATACTCC TTTTAATTACGTTTTTTTACAGATATAA ++++++ +++++ ++++ + ++ + TGTTAATTTATTTTTTAAAATTGATGTT TTTTAATTACGTTTTTTTACAGATATAA + ++++++ ++++++ + + ++ ++ TTTTTATTCTCTTTCTTTCCAATAATAT TTTTAATTACGTTTTTTTACAGATATAA ++++ +++ + +++ +++ ++ ++++++ TTTTCATTTACCTTTCCCGCACTTAAAA TTTTAATTACGTTTTTTTACAGATATAA ++++++++ +++++ + ++ +++ ++ TAATAAAAAATTTCTTTCATTCATTTTT TTTTAATTACGTTTTTTTACAGATATAA + +++ + +++ ++++++ ++++++ TTTTTATAATGTCCGTATGGATTGTTAT TTTTAATTACGTTTTTTTACAGATATAA ++++ ++ ++++ + + +++ ++++ GAAGAACAAAAAAATCAAATTATTAAAA TTATATCTGTAAAAAAACGTAATTAAAA ++ +++ + ++++ ++++ +++++++ TATTTTTTTCTTTCTTTTCAATGTAGTT TTTTAATTACGTTTTTTTACAGATATAA + ++ ++ ++++ ++++ ++ ++ ++ AACATATCAATAATTCAAATTATGAAAA TTATATCTGTAAAAAAACGTAATTAAAA ++ +++ + +++ ++++ +++++++ TATACAGAGTAAGAAAATCTGATAATTA TTATATCTGTAAAAAAACGTAATTAAAA ++ + + +++++++++ ++++ + + GTAAATATCTAAGAAGAGGTAAAAAATG TTATATCTGTAAAAAAACGTAATTAAAA +++++++ ++++++ + ++++ ++ TAATTTAACCTTATCAACAAACTTAATA TTATATCTGTAAAAAAACGTAATTAAAA +++++++ ++ ++++ + ++++ + ATCAATATCAAAGGAAAGATCAAAAATA TTATATCTGTAAAAAAACGTAATTAAAA ++ +++++ +++ +++ ++ + ++ + 765 9.00E-05 reverse 2891600 2891627 763 5.80E-05 reverse 2889582 2889609 764 5.80E-05 reverse 2891480 2891507 761 9.00E-05 reverse 2888676 2888703 762 4.20E-05 reverse 2888904 2888931 759 5.50E-06 reverse 2885723 2885750 760 3.40E-05 forward 2886596 2886623 757 2.60E-05 forward 2879950 2879977 758 1.20E-05 forward 2884079 2884106 755 2.70E-07 forward 2878579 2878606 756 5.50E-06 forward 2879441 2879468 753 7.50E-05 forward 2870200 2870227 754 4.20E-05 forward 2878034 2878061 751 2.80E-05 reverse 2863062 2863089 752 5.50E-05 reverse 2864622 2864649 749 4.80E-05 forward 2853951 2853978 750 8.50E-05 forward 2862834 2862861 748 2.60E-05 reverse 2842917 2842944 Table S1 292 TTTCTATCTCTTCTTTTTTCTTTAATAA TTTTAATTACGTTTTTTTACAGATATAA +++ +++ +++ +++++ + +++++++ CTTCAATATTTCTTACTCGCATATTTAA TTTTAATTACGTTTTTTTACAGATATAA ++ +++ +++++++++ +++++++++ TTTTATCTATTTCAACATCATTTAAAAA TTTTAATTACGTTTTTTTACAGATATAA +++++ +++++ ++ + ++++ ++ TTATAATTAGGTTCAGACCGTCTTTAAA TTTTAATTACGTTTTTTTACAGATATAA ++ ++++++ +++ + + +++ ++ TTATCATCGAATCATTACTTTGAAAGAT TTTTAATTACGTTTTTTTACAGATATAA ++ ++++++ + ++ + + ++++ ++ TTAATATTGTTTCTATTAGTTGTAATAT TTTTAATTACGTTTTTTTACAGATATAA ++ +++++++ ++++ + +++++++ ATAGCAACTTAAGAAGAGTAAATGAACA TTATATCTGTAAAAAAACGTAATTAAAA +++ ++ ++++++ + ++++++ + ATCAATTGATATAACCAAAAAATTATAA TTATATCTGTAAAAAAACGTAATTAAAA ++ +++ +++ ++ +++ +++++ ++ GAAAATATATAACTAAAGGAAATAGAAA TTATATCTGTAAAAAAACGTAATTAAAA +++++++++++ ++++ + +++ +++ TTTTTATCGTTTCCAGGTATAGTTTTCC TTTTAATTACGTTTTTTTACAGATATAA ++++ +++++++ + +++++++++ TTTTTTCTTCACAAAAGCTGAAAATACA TTATATCTGTAAAAAAACGTAATTAAAA ++ +++++ + ++++++ ++ + + AATGAAAATGGCGAAAAGGGAGTGAAAA TTATATCTGTAAAAAAACGTAATTAAAA ++ +++ + +++++ + + ++++++ ATATAATCATTGCTAACATTAATAAAAA TTATATCTGTAAAAAAACGTAATTAAAA ++++++ ++ +++ + ++++ ++++ ATATTACTATGTATAGAGAAACAAAAAA TTATATCTGTAAAAAAACGTAATTAAAA +++++++++++ +++ + + + ++++ TTTATAACAAACAAGCAGATTATAAATA TTATATCTGTAAAAAAACGTAATTAAAA ++ ++++ + + ++ + ++ ++ ++ + TTAATAAATTACATTCAAAAAAAAAATA TTATATCTGTAAAAAAACGTAATTAAAA +++++++ ++ ++ +++ ++ ++ + ATTTAATAGGCAAAAAAAGCGAAGAATA TTATATCTGTAAAAAAACGTAATTAAAA ++ +++ + +++++++++++ +++ + 781 3.20E-05 reverse 2910781 2910808 782 1.30E-05 reverse 2915768 2915795 779 8.40E-06 reverse 2908845 2908872 780 9.60E-05 reverse 2910570 2910597 777 5.50E-05 reverse 2908380 2908407 778 4.50E-05 reverse 2908597 2908624 775 3.00E-05 forward 2896848 2896875 776 7.50E-05 reverse 2903995 2904022 773 8.00E-05 reverse 2894199 2894226 774 2.80E-05 reverse 2896324 2896351 771 2.30E-05 forward 2893795 2893822 772 6.20E-05 reverse 2894047 2894074 769 2.80E-05 forward 2892886 2892913 770 4.20E-05 forward 2893100 2893127 767 2.00E-05 forward 2892139 2892166 768 5.50E-05 forward 2892607 2892634 765 9.00E-05 reverse 2891600 2891627 766 3.90E-06 forward 2891938 2891965 Table S1 293 TTTTAAATGCACAATAAAAGTATAGATA TTATATCTGTAAAAAAACGTAATTAAAA ++ ++++++ + ++ ++++ ++ + + AACTATATAAAAATAGATCTTAGAAATA TTATATCTGTAAAAAAACGTAATTAAAA ++ ++++++ +++++ + + + ++ + TATAATCATCAAATAAAGAAAAGTAATA TTATATCTGTAAAAAAACGTAATTAAAA ++ ++++ +++++++ + ++ +++ + TTTTCCGTAATTTTACGTCTTTTAAACT TTTTAATTACGTTTTTTTACAGATATAA +++++ ++ ++++++ + + ++++ + TCTTAATTTCATTAATATGTATGTTTCT TTTTAATTACGTTTTTTTACAGATATAA + ++++++ + ++ ++ + +++ +++ + TAAATAAATGGCATAAACGAAAATGATA TTATATCTGTAAAAAAACGTAATTAAAA +++++++ + +++++++ ++ + + + AAAAATGAATGGGCAAAATAAAATATAA TTATATCTGTAAAAAAACGTAATTAAAA ++++++ +++ + ++++ ++ ++ ++ TTTTTACACCAAAGCAGAGCAATGATTA TTATATCTGTAAAAAAACGTAATTAAAA ++ ++++ +++ ++++++++++ + AAATTTCAGCACCATAAAGATAATAATA TTATATCTGTAAAAAAACGTAATTAAAA +++++++ + + + ++++ + +++ + TATGTTCGGTTAAAGCGCTCAATAAAAG TTATATCTGTAAAAAAACGTAATTAAAA ++ +++ ++ +++ ++ ++++ +++ TGAGAACAATATAAAAATGCATTTATCA TTATATCTGTAAAAAAACGTAATTAAAA + + +++ +++ +++++ +++ +++ + TATTTAAAACTAAGTGACTTTCTAAAAA TTATATCTGTAAAAAAACGTAATTAAAA ++ ++++ + ++ ++ + + ++++ TGATTTTAGCGAATGAATGTACTCATAA TTATATCTGTAAAAAAACGTAATTAAAA + ++++ + ++++ ++ +++ + + ++ TTTTTATCAGCTCTCCCACTATTATTTA TTTTAATTACGTTTTTTTACAGATATAA ++++ ++++ + + + +++++++++ TAATGCTCAAGTTCTTTTATTTTTAGAT TTTTAATTACGTTTTTTTACAGATATAA + + +++ +++ ++++++ ++++ ++ GAATAAAACGAAATAAATTAACGTAACA TTATATCTGTAAAAAAACGTAATTAAAA ++++++ +++++++ + +++ + TTTTAACTCCTGTACTTCTGTTTTAGTT TTTTAATTACGTTTTTTTACAGATATAA ++++++ + ++ + +++ ++++ ++ ATAAAAAAACGAATGAATTAAAATAAAA 799 5.50E-05 forward 2936463 2936490 800 1.40E-06 reverse 2937970 2937997 797 1.20E-05 forward 2934514 2934541 798 8.50E-05 reverse 2935789 2935816 795 3.40E-05 reverse 2931527 2931554 796 6.60E-05 forward 2932059 2932086 793 4.80E-05 reverse 2930269 2930296 794 3.00E-05 reverse 2931307 2931334 791 1.70E-05 reverse 2927714 2927741 792 8.50E-05 reverse 2928968 2928995 789 4.80E-05 reverse 2926979 2927006 790 1.10E-05 reverse 2927429 2927456 787 4.20E-05 forward 2926710 2926737 788 6.60E-05 reverse 2926880 2926907 785 6.00E-06 reverse 2924571 2924598 786 6.60E-05 forward 2926662 2926689 783 2.30E-05 reverse 2923943 2923970 784 3.70E-05 reverse 2924295 2924322 Table S1 294 TTATATCTGTAAAAAAACGTAATTAAAA +++++++ + ++++ ++ ++ +++++ TAAATAAACCGAAAGGGTATACAAAAAA TTATATCTGTAAAAAAACGTAATTAAAA +++++++ ++++ + +++ ++++ ATAATAATTATCATTCAATTAAGGAAAA TTATATCTGTAAAAAAACGTAATTAAAA ++++++++ ++ ++ +++ +++++ TATTTAGAGTATATAACATCATTTAAAA TTATATCTGTAAAAAAACGTAATTAAAA ++ +++ +++ ++++ + ++ ++++++ TTTTATTTGGTTAAGCAAAAAAATAATA TTATATCTGTAAAAAAACGTAATTAAAA ++ +++ ++ ++ +++ ++ +++ + TTCTTCCACTATAAAGAAGATGATAAGA TTATATCTGTAAAAAAACGTAATTAAAA ++ ++ + ++ +++ +++ +++ + TTTGACGTATCTAATGGTGCAATTAAAA TTATATCTGTAAAAAAACGTAATTAAAA ++ + +++ ++ + ++++++++++ ATTGATAACGAAAGGCAAGCATGAAAAA TTATATCTGTAAAAAAACGTAATTAAAA ++ +++ +++ +++++ ++++ TTTTATTTAAATGTTCCTGGACTTTTTT TTTTAATTACGTTTTTTTACAGATATAA +++++ +++ + +++ + + ++++++ TAAGTTCTGTAACATCAAATTCATATCA TTATATCTGTAAAAAAACGTAATTAAAA +++ ++++++++ + ++++ ++ + TTATAATGCATTGATTTAAAAGTAATTA TTTTAATTACGTTTTTTTACAGATATAA ++ ++++ ++ +++ + ++++++++ TATTTTATCGACAAAAAGCCTATAAATA TTATATCTGTAAAAAAACGTAATTAAAA ++ +++++ + +++++ + ++ ++ + GAAGTAATATTGGTAAACGACAGTAAAA TTATATCTGTAAAAAAACGTAATTAAAA ++ ++++++ +++++++ + +++++ TATTCAGCCTGTTTATTCACGATAAGCT TTTTAATTACGTTTTTTTACAGATATAA + ++++ + +++++++++++ +++ + TTTTCACCACTTTCACACGCGTTTCGCT TTTTAATTACGTTTTTTTACAGATATAA ++++++ ++++++ ++ + + +++ + AACTCAATACAAATCAATAAGATGAAAA TTATATCTGTAAAAAAACGTAATTAAAA ++ + ++++ ++++ ++ + ++++++++ ATAACAATTTAAAATCAGAAAGATAAAA TTATATCTGTAAAAAAACGTAATTAAAA ++++ +++ +++++ + + + +++++ TTTTTATTTCATTGTTATTTAAGAATAT TTTTAATTACGTTTTTTTACAGATATAA 817 3.40E-05 forward 3013299 3013326 815 2.40E-05 reverse 3007555 3007582 816 9.00E-05 reverse 3010399 3010426 813 2.30E-05 forward 2982623 2982650 814 6.60E-05 forward 2997744 2997771 811 8.40E-06 reverse 2970750 2970777 812 8.00E-05 reverse 2972359 2972386 809 9.00E-05 reverse 2970179 2970206 810 1.30E-05 forward 2970668 2970695 807 7.50E-05 reverse 2953666 2953693 808 7.10E-06 forward 2968065 2968092 805 6.60E-05 reverse 2952324 2952351 806 2.60E-05 reverse 2952861 2952888 803 1.10E-05 reverse 2950709 2950736 804 3.90E-05 reverse 2952105 2952132 801 2.40E-05 reverse 2938045 2938072 802 8.00E-05 reverse 2948438 2948465 800 1.40E-06 reverse 2937970 2937997 Table S1 295 ++++ +++ + ++ ++ + ++ +++++ GAAGAACTGCATAAAGCCGGAGTCAAAA TTATATCTGTAAAAAAACGTAATTAAAA ++ +++++ + +++ ++ + + ++++ TTTTGCGGGCGTTTATCTGTCTTTTTAT TTTTAATTACGTTTTTTTACAGATATAA ++++ ++++++++ + + +++++++ TTATATATAAGAATTACTACTCAAAAAA TTATATCTGTAAAAAAACGTAATTAAAA +++++++++ ++++ + ++ ++++ TTTTTATTGCTCGCTCAAGGAAATCAAA TTTTAATTACGTTTTTTTACAGATATAA ++++ +++++++ ++ + ++ ++ TAAGATACATCAATGAGAAATATGAATA TTATATCTGTAAAAAAACGTAATTAAAA +++ +++ ++ +++ ++++ +++++ + TTATATTCTTATAAACAAATAATTAAAA TTATATCTGTAAAAAAACGTAATTAAAA ++++++ ++ +++ ++++++++++++ TATTAATATAATCATTTCAGAATAAAAC TTTTAATTACGTTTTTTTACAGATATAA + +++++ + +++++ + +++ + GACATCACGGATAACAAAATAATCAAAA TTATATCTGTAAAAAAACGTAATTAAAA + ++ + + + ++ ++++++++ ++++ TTAAAATAACATCAACAAAGGGATAATA TTATATCTGTAAAAAAACGTAATTAAAA ++++++ + + ++ +++ + +++ + ATTATTTTGCAAAAAAATATAAAAATAA TTATATCTGTAAAAAAACGTAATTAAAA ++ +++ ++ +++++++ ++++ + ++ TTTTAATCCTGTTCCTGTATCGAATAAA TTTTAATTACGTTTTTTTACAGATATAA ++++++++ ++++ + +++ ++++ ++ ATTTTTGATAAACAAAACGCTATGATCA TTATATCTGTAAAAAAACGTAATTAAAA ++ +++ ++ +++++++ ++++ + TAAAAAAATTTGGGAGAATTACAGAAAA TTATATCTGTAAAAAAACGTAATTAAAA +++++++ + + + ++ ++ +++++ TTATCAGTATTTTCCTTAGCAATATAAA TTTTAATTACGTTTTTTTACAGATATAA ++ +++ ++++++ ++ ++ +++ ++ TTATAAGATTGCTTCTTCAAATTTAATC TTTTAATTACGTTTTTTTACAGATATAA ++ +++ +++++ ++++ +++++ + TATTCATCGCATCTTTCCCGGTTAATTA TTTTAATTACGTTTTTTTACAGATATAA + ++++++++ + +++ + +++++++ TTTTCATATTTTCTTCCTGCGCTTTAAA TTTTAATTACGTTTTTTTACAGATATAA +++++++ +++ +++ + + +++ ++ 833 4.70E-06 forward 3047230 3047257 834 5.10E-06 forward 3049456 3049483 831 2.10E-05 forward 3046169 3046196 832 2.80E-05 forward 3046684 3046711 829 4.80E-05 reverse 3043368 3043395 830 9.60E-05 reverse 3044506 3044533 827 1.60E-06 reverse 3041863 3041890 828 3.80E-07 forward 3042440 3042467 825 9.00E-05 reverse 3037666 3037693 826 9.60E-05 reverse 3040385 3040412 823 2.30E-08 reverse 3035606 3035633 824 2.60E-05 forward 3035764 3035791 821 2.00E-05 forward 3035000 3035027 822 1.80E-05 reverse 3035057 3035084 819 7.10E-05 forward 3032231 3032258 820 6.20E-05 reverse 3033464 3033491 817 3.40E-05 forward 3013299 3013326 818 2.30E-05 reverse 3017265 3017292 Table S1 296 TTTTTCTCCCTTTATTTTGGCAGTTTTT TTTTAATTACGTTTTTTTACAGATATAA ++++ ++ ++++ ++++ +++++ TGAACATTCAAAAAACGCCCAATGAATA TTATATCTGTAAAAAAACGTAATTAAAA + ++ + + +++++ ++ +++++++ + TTTTCATATCTTTCATGGTCAGGAAATA TTTTAATTACGTTTTTTTACAGATATAA +++++++ ++++ ++ +++ ++ ++ TCTTAATTATCCCCATAAACTCATTAAA TTTTAATTACGTTTTTTTACAGATATAA + ++++++++ + ++ ++ +++ ++ CCTTAATTAAGCCCTTATATTGTTTTTA TTTTAATTACGTTTTTTTACAGATATAA +++++++ ++ ++ +++ +++++++ AATTTAAAATAGAAGAGTACGCTTAAAA TTATATCTGTAAAAAAACGTAATTAAAA ++ ++++ +++ ++ ++ +++ ++++++ ATAAATTTGAAAAAAAATTTAATGTAGA TTATATCTGTAAAAAAACGTAATTAAAA ++++++ ++ +++++++ +++++ + + TAATCATTGTATTTTCGTATCTTAAATA TTTTAATTACGTTTTTTTACAGATATAA + +++++++ +++++ +++ ++++ ++ AGTAATCTGGAAATAGAATTATATAATA TTATATCTGTAAAAAAACGTAATTAAAA + ++++++ +++++ ++ ++ +++ + TTAAATCAACAAGAAGCAGTTCGTTAAA TTATATCTGTAAAAAAACGTAATTAAAA +++++++ + +++++ +++ + +++ TTTTTCAAACTCGTCTTTATGTTTATTC TTTTAATTACGTTTTTTTACAGATATAA ++++ ++++ + +++++ ++++++ TTTTTAATGGTCTTTTTTGTTGATATAC TTTTAATTACGTTTTTTTACAGATATAA ++++ + ++ ++++++++ + ++++++ GAAGTTAACGTAGAGGATATAAATAAAA TTATATCTGTAAAAAAACGTAATTAAAA ++ +++ +++ + ++++ +++++ TAATTATTAAATTTTCTGGAAATTCTTA TTTTAATTACGTTTTTTTACAGATATAA + + ++++ ++++++ + ++ +++ TTTTTTTCCTGTTCCTGTTCGGTTTATC TTTTAATTACGTTTTTTTACAGATATAA ++++ ++ ++++ + + + ++++ + TTATCAGCGCTTTTATACACTCATCGAA TTTTAATTACGTTTTTTTACAGATATAA ++ +++ +++++++++ +++ ++ ++ TAATCATATAACTAATTTATTAAAAAAA TTTTAATTACGTTTTTTTACAGATATAA + ++++ ++ ++++++ +++ ++ 851 3.90E-05 forward 3123045 3123072 849 9.00E-05 forward 3117188 3117215 850 3.90E-06 forward 3117908 3117935 847 7.50E-05 reverse 3109373 3109400 848 7.50E-05 forward 3114817 3114844 845 5.50E-05 forward 3106190 3106217 846 4.30E-06 forward 3108755 3108782 843 3.90E-05 reverse 3071999 3072026 844 5.80E-05 reverse 3080463 3080490 841 1.80E-05 reverse 3068430 3068457 842 1.20E-05 forward 3069078 3069105 839 1.80E-05 forward 3060962 3060989 840 1.60E-05 reverse 3062084 3062111 837 4.20E-05 forward 3054549 3054576 838 4.80E-05 forward 3055011 3055038 835 3.00E-05 forward 3051664 3051691 836 8.50E-05 reverse 3054059 3054086 834 5.10E-06 forward 3049456 3049483 Table S1 297 TATAAATAACATCAATTAAGTAAAAAAA TTTTAATTACGTTTTTTTACAGATATAA + + +++ ++ + +++ + +++ ++ TTATTCACTGGCAGGAGAAGTATAAAAA TTATATCTGTAAAAAAACGTAATTAAAA +++++ + + + ++++ ++ ++++ GTAAATTTTCATATGAAAGTGCGCAAAA TTATATCTGTAAAAAAACGTAATTAAAA +++++ + + ++ ++++++ ++++ TTTTAATTAGTTGTTTTATATAGACTTA TTTTAATTACGTTTTTTTACAGATATAA +++++++++ ++ ++++ + +++ AATTATTACGGCGAAAAATTATATAAAA TTATATCTGTAAAAAAACGTAATTAAAA ++ +++ + ++++++ ++ +++++ TTTTTTATGAAAATTAAAGTGATGATAA TTATATCTGTAAAAAAACGTAATTAAAA ++ ++++++ ++++ ++++++++++ ++ TATTAAAAGGCCTTTTTTATTTGAAAAT TTTTAATTACGTTTTTTTACAGATATAA + ++++ + +++++++++ + ++ ++ GGATTTTGATGAAAAAACTCAGTTATAA TTATATCTGTAAAAAAACGTAATTAAAA ++++ ++++++++++ ++ +++ ++ TTATAACAGGATATGGATAAGTGGAAAA TTATATCTGTAAAAAAACGTAATTAAAA +++++++ + + ++ + + + +++++ TTTTGATGATTGTCTCATGGTCATCTTT TTTTAATTACGTTTTTTTACAGATATAA ++++ ++ +++ + ++ + ++ +++ TGCACAGAGGGCAAAAACAGAATAAAAA TTATATCTGTAAAAAAACGTAATTAAAA + + + + + +++++++ +++ ++++ TGCGCTCAGCTAAAAAACGCTGTGAAAA TTATATCTGTAAAAAAACGTAATTAAAA + ++ + +++++++++ ++++++ TTTATCTATCCCTTTTTCACGTAACATA TTTTAATTACGTTTTTTTACAGATATAA +++ + + +++++++++ +++ ++ TTCATACAATCAACGAGACTGATTAAAA TTATATCTGTAAAAAAACGTAATTAAAA ++ ++++ ++ ++ +++ +++++++++ AGAAACAACACAAAAAAGGCAATAAAAA TTATATCTGTAAAAAAACGTAATTAAAA + +++ + ++++++ +++++ ++++ TTTTTATTGTCCTTTGTCGGGAATTTCT TTTTAATTACGTTTTTTTACAGATATAA ++++ +++++ ++++ ++ ++++ + ATATTTCAATGAATTAAAGCATTGATCA TTATATCTGTAAAAAAACGTAATTAAAA +++++++ ++++++ ++++++ +++ + TTAAAATTAGTTTTCTTGATTGTTTAAA 869 2.30E-05 forward 3202341 3202368 867 2.40E-05 forward 3186958 3186985 868 8.40E-06 reverse 3198856 3198883 865 1.30E-05 reverse 3174165 3174192 866 6.60E-05 reverse 3184725 3184752 863 3.00E-05 reverse 3170224 3170251 864 8.00E-05 forward 3172839 3172866 861 5.80E-05 forward 3159577 3159604 862 2.00E-05 reverse 3164236 3164263 859 3.40E-05 reverse 3148578 3148605 860 7.10E-05 reverse 3159319 3159346 857 4.20E-07 reverse 3148113 3148140 858 8.00E-05 forward 3148184 3148211 855 3.90E-05 forward 3138612 3138639 856 4.20E-05 reverse 3142114 3142141 853 2.60E-05 reverse 3136184 3136211 854 7.50E-05 reverse 3138581 3138608 852 9.60E-05 forward 3123093 3123120 Table S1 298 TATTCCTTGTTTGTCTTTACAATAAAAA TTTTAATTACGTTTTTTTACAGATATAA + +++ ++++++ + ++++++ +++ ++ TTTTTTATCCATCCTGATGTAATTAATA TTATATCTGTAAAAAAACGTAATTAAAA ++ +++++ + + ++++++++ + ATTGTAAACGGGATAAACGTTATTAAAG TTATATCTGTAAAAAAACGTAATTAAAA ++ +++ + ++++++++ ++++++ TATGACATTTAAAGACATTTGATCAAGA TTATATCTGTAAAAAAACGTAATTAAAA ++ + ++ ++++ + + ++++ ++ + TTTTAATTATGTTTTTTCATAGATATAA TTTTAATTACGTTTTTTTACAGATATAA ++++++++++++++++++++++++++++ TTATAATCGCGCTTTTTATGAGAAAGAT TTTTAATTACGTTTTTTTACAGATATAA ++ ++++++++++++++ +++++ ++ AAAAATAAAGTAGCACATTTTGTTAAAA TTATATCTGTAAAAAAACGTAATTAAAA +++++++ + ++ + + + ++++++ TTTTCATAGGGTGTCCTTGAAGTAAAAA TTTTAATTACGTTTTTTTACAGATATAA +++++++ + ++ + +++ +++++ ++ ATCATAATTGAAACAAAAATGTTAAAAA TTATATCTGTAAAAAAACGTAATTAAAA ++ +++++ +++ +++++++ + ++++ ATAAATGGCTGGAAAAAATGAATAAATG TTATATCTGTAAAAAAACGTAATTAAAA ++++++ ++ ++++++ +++ ++ ATATTTATCTAAAAACGTTATCTGAAAG TTATATCTGTAAAAAAACGTAATTAAAA ++++++++ ++++++ + +++++ TATTTATTCCCTGTCGGTGGTGTTTGAT TTTTAATTACGTTTTTTTACAGATATAA + ++ +++ + + + + ++++ ++ TTCATTCAGGTGCTAAACCCAATGAACA TTATATCTGTAAAAAAACGTAATTAAAA ++ ++++ + +++++ +++++++ + TATTATTCCCTTTTTCCTGATTTATAAA TTTTAATTACGTTTTTTTACAGATATAA + +++ ++ +++++++ + ++++ ++ GAAGATTTTTACAAAAAATCACTAAAAA TTATATCTGTAAAAAAACGTAATTAAAA ++ ++ + ++ ++++++ ++ + ++++ TTATGATTGTCTGTATTAACGAAAATTC TTTTAATTACGTTTTTTTACAGATATAA ++ + +++++ + ++++ ++ +++++ TGCATTCTGTGAGGAAATGGAGTGTATA TTATATCTGTAAAAAAACGTAATTAAAA + ++++++++++ +++ + + ++ + + 989 8.50E-05 reverse 3849340 3849367 987 8.40E-06 reverse 3843750 3843777 988 6.20E-05 forward 3848734 3848761 985 5.50E-05 reverse 3830928 3830955 986 1.70E-05 forward 3831428 3831455 983 2.40E-05 reverse 3830479 3830506 984 6.20E-05 forward 3830612 3830639 981 2.30E-05 reverse 3812979 3813006 982 5.10E-05 reverse 3826371 3826398 979 5.50E-05 reverse 3801699 3801726 980 5.20E-07 forward 3812875 3812902 977 9.30E-15 forward 3800195 3800222 978 1.40E-06 forward 3800400 3800427 975 1.60E-05 reverse 3794770 3794797 976 2.60E-05 reverse 3795752 3795779 973 5.80E-07 forward 3794641 3794668 974 1.70E-05 reverse 3794679 3794706 972 5.10E-06 forward 3793086 3793113 Table S1 305 TAATTAGTATATATAAAAATAATTGTTA TTATATCTGTAAAAAAACGTAATTAAAA ++++++ ++++ ++++++++++++ + TATTAAGAATAAATTAATATAATTAATA TTATATCTGTAAAAAAACGTAATTAAAA ++ +++ ++++++ ++ ++++++++ + TGTTAATACTCCTTTCACCCAAAAATAC TTTTAATTACGTTTTTTTACAGATATAA + +++++ + +++++ + ++ +++++ TATTTTTTTAATCTTTACAATTATTTTC TTTTAATTACGTTTTTTTACAGATATAA + ++ ++ + +++ ++ ++++++ ATAAAACGCCAACAAGATAAAATTAACA TTATATCTGTAAAAAAACGTAATTAAAA +++++++ ++ ++ + + ++++++ + TCTTAAGTTCATCAATATCCTTAAATTT TTTTAATTACGTTTTTTTACAGATATAA + ++++ + + + ++ + + +++++++ AAAAAACGCTGAAAACCACAGAAGAAAA TTATATCTGTAAAAAAACGTAATTAAAA +++++++ ++++++ + ++ +++++ TTCTTACCGTTGGTAAACGTACTGGAAA TTATATCTGTAAAAAAACGTAATTAAAA ++ ++++ ++ +++++++++ ++ +++ ATAAATATATTACGCGATGGTATTAACA TTATATCTGTAAAAAAACGTAATTAAAA ++++++++++ + + + +++++ + TTTTCAGGCAGCCTTTTTCCACAAATAT TTTTAATTACGTTTTTTTACAGATATAA ++++++ ++ +++++ ++ ++++++ TTTCACTCGATCCATCTCACATTTTTAA TTTTAATTACGTTTTTTTACAGATATAA +++ + +++ ++ ++++++++++++++ AAAATTCAACAAAGCACCAAAATAAAAA TTATATCTGTAAAAAAACGTAATTAAAA +++++++ + +++ + ++ +++ ++++ TCATGCCTGTTTGTATTTATACAATGAA TTTTAATTACGTTTTTTTACAGATATAA + + +++++ ++++++++ +++ ++ AAATCCCCATACATAAACATTATAATTA TTATATCTGTAAAAAAACGTAATTAAAA ++++ + +++ ++++++++ ++ + + TTAGAAAAACAACAAGCTACGATTATCA TTATATCTGTAAAAAAACGTAATTAAAA +++ +++ + ++ ++ +++++++ + TGTTATTCATCTTGATTTAGTTAACTTA TTTTAATTACGTTTTTTTACAGATATAA + +++ ++++ ++ +++++ +++ +++ TATTTTTATTTCTTGCTACCGTATTTAA TTTTAATTACGTTTTTTTACAGATATAA + ++ + +++++ ++ + +++++++ ATTTTTACAGTAAAAAGCAAGCACAAAA 1007 4.80E-05 reverse 3923782 3923809 1005 2.30E-05 forward 3902193 3902220 1006 8.00E-05 forward 3914086 3914113 1003 2.00E-05 reverse 3901593 3901620 1004 6.60E-05 reverse 3901999 3902026 1001 7.10E-06 reverse 3896277 3896304 1002 8.00E-05 forward 3901486 3901513 999 3.00E-06 forward 3886816 3886843 1000 9.80E-06 forward 3887023 3887050 997 4.20E-05 reverse 3878980 3879007 998 4.80E-05 reverse 3879331 3879358 995 5.10E-05 forward 3860708 3860735 996 2.60E-05 reverse 3869235 3869262 993 6.20E-05 forward 3856961 3856988 994 7.70E-06 reverse 3858715 3858742 991 3.00E-07 reverse 3849479 3849506 992 3.90E-05 forward 3856737 3856764 990 4.70E-06 reverse 3849388 3849415 Table S1 306 TTATATCTGTAAAAAAACGTAATTAAAA ++ ++++ + ++++++++ + ++++ TTTTTATATCGTTCGTGGCAATTTTGAA TTTTAATTACGTTTTTTTACAGATATAA ++++ ++ ++++ + +++++ ++ GAAAATATAGGAGTAACAGTAAATATGA TTATATCTGTAAAAAAACGTAATTAAAA ++++++++ ++++++ +++++ ++ + AACTTTATAGAAAAAGAAATGTTATAAA TTATATCTGTAAAAAAACGTAATTAAAA ++ ++++++ +++++ +++++ + +++ TAATTAAACAGTTTTCTTCAATATATTT TTTTAATTACGTTTTTTTACAGATATAA + + + ++++++++ ++++++++ TCTTCAGCCGTTCTTTTCGCAATAAGTT TTTTAATTACGTTTTTTTACAGATATAA + ++++ + ++ +++++ ++ +++ ++ TGATCAGCGTTTTTCCTTACCCTTAATA TTTTAATTACGTTTTTTTACAGATATAA + +++ +++++++ +++++ +++ ++ ATTTTTATAATAGATAACTGAAGGATAA TTATATCTGTAAAAAAACGTAATTAAAA ++ ++++++ +++ +++ ++ ++ ++ ATAGTATTATACGGTCGCGGTAGAAAAA TTATATCTGTAAAAAAACGTAATTAAAA +++ ++ ++++ + +++ + ++++ TAATAACTGAATCTTTTAATTCATAGTT TTTTAATTACGTTTTTTTACAGATATAA + +++ ++ + ++++ ++ +++ ++ TTTCAATCGCTTTCTTAGAGATATTTTC TTTTAATTACGTTTTTTTACAGATATAA +++ +++++++++ ++ + +++++++ GTTAATTAAAATAAAACCGGCATTAAAA TTATATCTGTAAAAAAACGTAATTAAAA + +++ + + ++++ ++ +++++++ TTTTTATCAATCCCATAAGCTATATTAA TTTTAATTACGTTTTTTTACAGATATAA ++++ ++++ ++ ++ + ++++++ ATATTAAATAGCAAAAATAGTAATATAA TTATATCTGTAAAAAAACGTAATTAAAA +++++++ + +++++ + + ++ ++ TTTTAATCATAAATTCAAAGAGATAATA TTATATCTGTAAAAAAACGTAATTAAAA ++ +++ ++++++ +++ + +++ + TGTTCAGCACGTTTACTTGCCTTATGAT TTTTAATTACGTTTTTTTACAGATATAA + ++++ +++++++++++ + ++++ ++ GATGAATTACTAATAAAAATGGTCAAAA TTATATCTGTAAAAAAACGTAATTAAAA + ++ ++ ++++++++++ + ++++ TTAAATTATCTAAGTCAAAATAGAAAAA TTATATCTGTAAAAAAACGTAATTAAAA 1023 4.20E-05 reverse 3945726 3945753 1024 8.00E-05 reverse 3951646 3951673 1021 3.20E-05 reverse 3940412 3940439 1022 1.10E-05 forward 3940951 3940978 1019 1.70E-05 forward 3935733 3935760 1020 3.90E-05 reverse 3936967 3936994 1017 3.20E-05 forward 3935230 3935257 1018 5.80E-05 reverse 3935276 3935303 1015 4.50E-05 reverse 3934108 3934135 1016 5.80E-05 forward 3935083 3935110 1013 4.20E-05 forward 3933077 3933104 1014 5.10E-05 reverse 3933960 3933987 1011 5.80E-05 forward 3932585 3932612 1012 4.20E-05 forward 3932863 3932890 1009 7.50E-05 reverse 3931980 3932007 1010 5.10E-05 reverse 3932044 3932071 1007 4.80E-05 reverse 3923782 3923809 1008 9.60E-05 forward 3930728 3930755 Table S1 307 ++++++ ++ +++ + ++++ AAAACCATGTTAATCAACAGGATAAATA TTATATCTGTAAAAAAACGTAATTAAAA ++++ ++++ +++ ++++ +++ ++ + TAAATCATGAGAAAAAATATCCTGATAA TTATATCTGTAAAAAAACGTAATTAAAA +++++ +++ +++++++ ++ +++ ++ ATAGAAACATTTATTCATAATATGAATA TTATATCTGTAAAAAAACGTAATTAAAA +++ +++ ++ ++ + + +++++ + TTATACCAAAGCGCAGGAAGTAGTAAAA TTATATCTGTAAAAAAACGTAATTAAAA +++++ + + + + + +++ + +++++ AATTATCTATGCATAAAAAAGGTTATTG TTATATCTGTAAAAAAACGTAATTAAAA ++ ++++++++ +++++++ + +++ AAAATAAAACAACATGACGAGGAAAAAA TTATATCTGTAAAAAAACGTAATTAAAA +++++++ + ++ + +++ + ++++ AGATATGCGTGTGTAAATTGACTGATAA TTATATCTGTAAAAAAACGTAATTAAAA + ++++ +++ +++++ + +++ ++ TATTTTTTCTTTTTTTGAAAAGTAATCA TTTTAATTACGTTTTTTTACAGATATAA + ++ ++ +++++++ + ++++++ + TTCATTGAGGAAAGAGATAAGAAGAAGA TTATATCTGTAAAAAAACGTAATTAAAA ++ +++ + +++ + + + ++ +++ + TTTTAATCCGGCTTTTTTTTGCAGTTTA TTTTAATTACGTTTTTTTACAGATATAA ++++++++ ++++++++ + + ++++ TTATAAGACGTAAACGAAAGACATAAAA TTATATCTGTAAAAAAACGTAATTAAAA ++++++ +++ +++ + +++++ ATTATCATCGGCATGGACCCGATGAATA TTATATCTGTAAAAAAACGTAATTAAAA ++ ++ ++ + ++ ++ +++++++ + AGCTATCTGGGAAAAAATGCTCAAAAAA TTATATCTGTAAAAAAACGTAATTAAAA + ++++++ +++++++ ++ ++++ TTTTTATTCAGCTATGTCGATGAACATC TTTTAATTACGTTTTTTTACAGATATAA ++++ +++ +++ + ++ +++ + TTTTATTCTTGTTCAGATATTCAACAAA TTTTAATTACGTTTTTTTACAGATATAA +++++ ++ ++++ + +++ ++ ++ TATTTTCCGCACAAAAAGGCGTGGAAAA TTATATCTGTAAAAAAACGTAATTAAAA ++ ++++ + + +++++ +++ +++++ AAATTACATCAAATGAACACAAAAAACG TTATATCTGTAAAAAAACGTAATTAAAA +++++++ ++++ +++++++ ++ 1041 6.60E-05 reverse 4071066 4071093 1039 1.40E-05 forward 4061884 4061911 1040 2.10E-05 reverse 4066817 4066844 1037 9.80E-06 reverse 4058164 4058191 1038 5.50E-05 forward 4060097 4060124 1035 7.10E-05 reverse 4055435 4055462 1036 4.20E-05 reverse 4058132 4058159 1033 4.80E-05 reverse 4028727 4028754 1034 4.70E-06 forward 4031779 4031806 1031 4.80E-05 reverse 4005279 4005306 1032 1.40E-05 forward 4020969 4020996 1029 7.10E-05 reverse 3985673 3985700 1030 7.10E-05 reverse 3986979 3987006 1027 7.10E-05 reverse 3980924 3980951 1028 6.60E-05 reverse 3981773 3981800 1025 6.20E-05 reverse 3971190 3971217 1026 3.00E-05 reverse 3980589 3980616 1024 8.00E-05 reverse 3951646 3951673 Table S1 308 TATGAATAATATGGAAAATATAACAATA TTATATCTGTAAAAAAACGTAATTAAAA ++ ++ +++ + ++++ + ++ + TTTTTCATCAACGGAAGACAAATCAAAA TTATATCTGTAAAAAAACGTAATTAAAA ++ ++ ++ + + ++++ +++ ++++ AAATCAATGTTTGAAGAAACTATTAAAA TTATATCTGTAAAAAAACGTAATTAAAA ++++ +++++ +++ ++++ +++++++ ATTAATATTTCAACAAAAATTATTAACA TTATATCTGTAAAAAAACGTAATTAAAA ++ +++++ + ++ ++++++ +++++ + ATAAAATTGCAAAAAGAAACTCAGATAA TTATATCTGTAAAAAAACGTAATTAAAA ++++++ ++ +++++ ++++ ++ ++ ATTTAACCTTTTCAACAAATAATAAAGA TTATATCTGTAAAAAAACGTAATTAAAA ++ ++++ + ++ +++++++ ++ + TAAATTACAAAAACAAAAAGACAAATAA TTATATCTGTAAAAAAACGTAATTAAAA +++++++ + +++ +++++ + + ++ TAATCATAGATTTTCCAGAAAAATAAAT TTTTAATTACGTTTTTTTACAGATATAA + ++++ + ++++ + + + +++ ++ TTTTAATTTAAAGAAAAAGCGGGAAAAA TTATATCTGTAAAAAAACGTAATTAAAA ++ +++ + +++++++++++ ++++ ATCATCGGCTAAAAAGGGGATATTAAAA TTATATCTGTAAAAAAACGTAATTAAAA ++ ++ ++++++ + + +++++++ TTTTCATCGTAAAATGGAAGAAGGATAA TTATATCTGTAAAAAAACGTAATTAAAA ++ + + ++++++ +++ ++ ++ ++ TAATTACGCGACATAAAAATCCGCAAAA TTATATCTGTAAAAAAACGTAATTAAAA +++++++ + ++++++++ ++++ TGTTAATAAATTTGTTGCTGACAATGTA TTTTAATTACGTTTTTTTACAGATATAA + +++++ + +++ ++ + + +++ ++ TTTTTTTTCTATTTTTTTTGATAAAAAT TTTTAATTACGTTTTTTTACAGATATAA ++++ ++ + +++++++ +++++ ++ TGTTGAGCACGGTCATTACCTGTTAATA TTTTAATTACGTTTTTTTACAGATATAA + ++ + ++++ + +++ + ++++ ++ CGATCTTTACATTTATTTGAGTAAATTA TTTTAATTACGTTTTTTTACAGATATAA ++ ++++ +++++++ +++++++ TTTCCATCGCTTTTTCTTATGCAGATTA TTTTAATTACGTTTTTTTACAGATATAA +++ ++++++++++++++++ + ++++ 1057 9.00E-05 forward 4105465 4105492 1058 2.50E-06 forward 4106462 4106489 1055 8.80E-07 forward 4102456 4102483 1056 9.60E-05 forward 4103097 4103124 1053 5.10E-05 reverse 4094055 4094082 1054 5.50E-05 forward 4097163 4097190 1051 2.80E-05 reverse 4088376 4088403 1052 6.20E-05 reverse 4093797 4093824 1049 9.00E-05 forward 4074689 4074716 1050 1.60E-05 reverse 4087494 4087521 1047 3.40E-05 reverse 4074207 4074234 1048 8.50E-05 reverse 4074559 4074586 1045 5.10E-06 reverse 4073367 4073394 1046 9.80E-06 reverse 4073745 4073772 1043 3.40E-05 reverse 4072642 4072669 1044 1.40E-06 reverse 4072683 4072710 1041 6.60E-05 reverse 4071066 4071093 1042 7.50E-05 reverse 4072360 4072387 Table S1 309 TGTTCAGGCTGTCTTCGCCCAGAACGAT TTTTAATTACGTTTTTTTACAGATATAA + ++++ +++ +++ + +++++ ++ TCTTCCTTTCTCTTTCGTTTGGTTATTA TTTTAATTACGTTTTTTTACAGATATAA + +++ ++ +++++++ + + +++++++ ATTGATGAAAAAAGAGACACTCAGAAAA TTATATCTGTAAAAAAACGTAATTAAAA ++ ++ + +++ + ++++ +++++ TTCGAACAAGATGCAAGAATAGACAAAA TTATATCTGTAAAAAAACGTAATTAAAA ++ +++ + + + +++++++ ++++ ATCTCCAACTGGAAAAACGATCTCAAAA TTATATCTGTAAAAAAACGTAATTAAAA ++ + + ++ +++++++ + ++++ TTTTCATTTAGCGCCTGTAGCGTAATTT TTTTAATTACGTTTTTTTACAGATATAA ++++++++ ++ + ++ +++++++ TATTTTTCACTTTGTTGCGGCGTATTTT TTTTAATTACGTTTTTTTACAGATATAA + ++ +++++++ ++ + +++++++ TTTTTTTAATGCCTGCGCCTGTTTTTTA TTTTAATTACGTTTTTTTACAGATATAA ++++ + ++++ + + + + +++++++ TAATATTTTTTCTTATACAATTTATGTA TTTTAATTACGTTTTTTTACAGATATAA + ++ ++ +++++++ ++ ++++ ++ ATCATTGCAGCAATGAAATCAAGGAAAA TTATATCTGTAAAAAAACGTAATTAAAA ++ +++ + +++ +++ +++ +++++ TATTCTTCTGGCTCTCCTGCGGAATTAA TTTTAATTACGTTTTTTTACAGATATAA + +++ ++ +++ ++ + + +++++++ TTTTACGCCTTCTCCTGCGATGATAGAA TTTTAATTACGTTTTTTTACAGATATAA +++++ + ++++ + + ++++ ++ TATTGATACCTTTAACCTCTTTTTCATA TTTTAATTACGTTTTTTTACAGATATAA + ++ ++ ++++ ++ + + +++ ++ ATAAATCCATGAGAAGAAAAAGGCAATA TTATATCTGTAAAAAAACGTAATTAAAA +++++++ +++++++ +++ + ++ + TTATATTTATTAGCGCGAATGATAATAA TTATATCTGTAAAAAAACGTAATTAAAA ++++++ +++ ++ +++++++ + ++ TCTTAATTGTTGTTTTCTACTTTAAGAA TTTTAATTACGTTTTTTTACAGATATAA + +++++++++ ++++ +++ ++++ ++ TATTCACCTGATTATTTCGCGCTAATTT TTTTAATTACGTTTTTTTACAGATATAA + ++++ + ++ ++++ + ++++++ TTTTTCTCATTTCCCTTTTTCTTATTTT 1075 5.50E-05 forward 4186610 4186637 1076 3.40E-05 forward 4193671 4193698 1073 2.80E-05 reverse 4181420 4181447 1074 3.60E-06 forward 4183049 4183076 1071 7.10E-05 forward 4180733 4180760 1072 8.40E-06 reverse 4180905 4180932 1069 5.50E-05 forward 4172061 4172088 1070 4.50E-05 forward 4173507 4173534 1067 5.80E-05 forward 4170976 4171003 1068 4.50E-05 reverse 4171837 4171864 1065 5.80E-05 forward 4157540 4157567 1066 3.40E-05 forward 4163125 4163152 1063 7.10E-05 reverse 4141722 4141749 1064 7.70E-06 forward 4143487 4143514 1061 3.70E-05 reverse 4121066 4121093 1062 9.60E-05 reverse 4130252 4130279 1059 7.10E-05 forward 4116518 4116545 1060 2.40E-05 forward 4120965 4120992 Table S1 310 TTTTAATTACGTTTTTTTACAGATATAA ++++ ++++++ +++ + +++++++ TTTTCATTCTGTGGCGTCAAAGTACGAT TTTTAATTACGTTTTTTTACAGATATAA ++++++++ +++ +++ ++++ ++ AAATCAAACGGTAAAGAAGTGGTTATTA TTATATCTGTAAAAAAACGTAATTAAAA ++++ ++ + +++ +++++ +++ + TTTTGCGCCAGTTTATGTATACGAAATT TTTTAATTACGTTTTTTTACAGATATAA ++++ + ++++++ ++++ ++ ++ TGTTAACCATCCGAATTTGCGTATTGAA TTTTAATTACGTTTTTTTACAGATATAA + ++++ +++ + ++++ + ++++ ++ TGTATTGCGTGTAATAAATTAAGTAATA TTATATCTGTAAAAAAACGTAATTAAAA + +++ +++ ++ +++ +++ +++ + TGTTAAAAAGGTTTCCCCAGAATTTAAA TTTTAATTACGTTTTTTTACAGATATAA + ++++ + ++++ + ++ + +++ ++ TATTTTGTGTTAAAAAAATGCAAATAAA TTATATCTGTAAAAAAACGTAATTAAAA ++ +++ +++ +++++++ + +++ ATCGTCGGCAAAATAAACGCAAAGAATA TTATATCTGTAAAAAAACGTAATTAAAA ++ + ++++++++++++ +++ + TTTAAATTTCCTCTTGTCAGGCAAAAAT TTTTAATTACGTTTTTTTACAGATATAA +++ ++++ + + ++ +++ +++ ++ TTTTTCTCCTTCTACTGCCCACATTGTT TTTTAATTACGTTTTTTTACAGATATAA ++++ ++ ++++ + + ++ +++ ++ TTTTAATCTCTTCTATCTGTATATCTTT TTTTAATTACGTTTTTTTACAGATATAA ++++++++ +++ +++ + +++++ +++ AATTCCCTATGTAAAGAATGAAAAAAAA TTATATCTGTAAAAAAACGTAATTAAAA ++ + +++++ +++ ++ ++ ++++ TAATAATCGCGTCGATATAGCTATCAAT TTTTAATTACGTTTTTTTACAGATATAA + +++++++++ ++ ++ +++ ++ TATTATCTGCGCCAGTGCAGGTAAATAA TTTTAATTACGTTTTTTTACAGATATAA + +++ +++++ + ++ +++++++ GTTTTCCTGCTGAAGAACGCCATTAATA TTATATCTGTAAAAAAACGTAATTAAAA + ++ +++ ++ +++++ +++++ + TTTTGATGACGTCTTTGAACCAGTCGTA TTTTAATTACGTTTTTTTACAGATATAA ++++ ++ ++++ +++ ++ + ++ CTTTGACTGTATGTATGTACAGTTTATA TTTTAATTACGTTTTTTTACAGATATAA 1093 2.40E-05 forward 4262866 4262893 1091 8.00E-05 reverse 4244792 4244819 1092 9.00E-05 forward 4250966 4250993 1089 6.60E-05 forward 4243304 4243331 1090 5.10E-05 forward 4243337 4243364 1087 3.40E-07 forward 4226299 4226326 1088 1.10E-05 reverse 4230427 4230454 1085 3.40E-05 forward 4217263 4217290 1086 3.90E-05 forward 4225766 4225793 1083 5.10E-05 reverse 4213100 4213127 1084 8.00E-05 reverse 4217211 4217238 1081 1.70E-05 reverse 4207523 4207550 1082 7.10E-05 forward 4208126 4208153 1079 3.40E-05 forward 4206305 4206332 1080 7.10E-05 forward 4207174 4207201 1077 2.00E-05 forward 4198919 4198946 1078 6.20E-05 reverse 4200632 4200659 1076 3.40E-05 forward 4193671 4193698 Table S1 311 +++ + +++ + +++ ++++++++ ++ ATCAACCAGTTGAAGGATGGGAATAAAA TTATATCTGTAAAAAAACGTAATTAAAA ++ ++ + ++ ++ + + ++ +++++ TTATATGGTTAAAAGAAAGTGAACAATA TTATATCTGTAAAAAAACGTAATTAAAA ++++++ +++++ +++++++ ++ + GTAAATATCTGCCTGGAGATTATTATAA TTATATCTGTAAAAAAACGTAATTAAAA +++++++ ++ + + ++ ++++ ++ TATTTCATTATAATTAACATTATCAATA TTATATCTGTAAAAAAACGTAATTAAAA ++ ++ ++ +++ +++++ ++ ++ + AAATATACAAAAGGCAATTAAATGAAAA TTATATCTGTAAAAAAACGTAATTAAAA +++++++ + +++ ++ ++++++++ AATATTATACCCAGGAAAACTATAAAGA TTATATCTGTAAAAAAACGTAATTAAAA ++ ++++++ + +++++ ++ ++ + ATAAAATTACGCGATAACGCCAATAAAA TTATATCTGTAAAAAAACGTAATTAAAA ++++++ ++ + ++ +++++ + +++++ TTTGTTTTCTAAAATACCTTCATCATAA TTATATCTGTAAAAAAACGTAATTAAAA ++ ++ + +++++ + + + ++ + ++ TAATTATTTGGTTGTTTTATTTGTATTT TTTTAATTACGTTTTTTTACAGATATAA + + +++ +++ ++++++ + +++++ TGTTGATGGTGTTTTGATTTTTATTTTA TTTTAATTACGTTTTTTTACAGATATAA + ++ ++ +++++++ + + +++++++ TTTCATTTATTTTATTTTGCTTTTTGAA TTTTAATTACGTTTTTTTACAGATATAA +++ + +++++++ ++++ + ++++ ++ TAATCATTATCCCTGTTTATTATTTATT TTTTAATTACGTTTTTTTACAGATATAA + +++++++ + + +++++ +++ ++ TTTTCAGCGGATGCCGTAACGTTTATAA TTTTAATTACGTTTTTTTACAGATATAA ++++++ ++ + + ++ +++++++ TCTTATTGATTCTTATCCCGGTTTAAAA TTTTAATTACGTTTTTTTACAGATATAA + +++ + ++++++++ + ++++ ++ AAAAATATGTGAAATCGATCAAAAGATA TTATATCTGTAAAAAAACGTAATTAAAA ++++++++++++++ ++ +++ + + TTATTTTTTTATTTTTCAATAATTTGAA TTTTAATTACGTTTTTTTACAGATATAA ++ + ++ + +++++ +++ +++ ++ TTTTGAACAATTTCTTTTTCAAAAAACA TTTTAATTACGTTTTTTTACAGATATAA ++++ + ++ +++ ++++ ++ +++ + 1109 7.50E-05 forward 4303716 4303743 1110 6.60E-05 forward 4304868 4304895 1107 6.60E-05 forward 4296805 4296832 1108 4.20E-05 reverse 4296854 4296881 1105 7.50E-05 forward 4284671 4284698 1106 6.20E-05 forward 4287835 4287862 1103 2.60E-05 forward 4283811 4283838 1104 5.10E-06 forward 4283854 4283881 1101 3.40E-05 reverse 4283578 4283605 1102 3.70E-05 forward 4283710 4283737 1099 8.00E-05 reverse 4272315 4272342 1100 5.50E-06 reverse 4272901 4272928 1097 7.50E-05 reverse 4271675 4271702 1098 1.80E-05 reverse 4271738 4271765 1095 3.60E-06 reverse 4269423 4269450 1096 5.80E-05 reverse 4271349 4271376 1093 2.40E-05 forward 4262866 4262893 1094 7.50E-05 reverse 4265154 4265181 Table S1 312 TGATTTGTGTGCAGAACATTTATAAAAG TTATATCTGTAAAAAAACGTAATTAAAA + ++++ ++++ + ++ + + ++ +++ AAAAAAATGGCAAGACACAGCATTAAAA TTATATCTGTAAAAAAACGTAATTAAAA +++++++++ ++ + +++ +++++++ TTCGAAGTCCACAAAAAGATTGTAATAA TTATATCTGTAAAAAAACGTAATTAAAA ++ ++ + + +++++ ++ + + ++ TGTTAACACTTTTAAGTTATTGAATGAA TTTTAATTACGTTTTTTTACAGATATAA + ++++ ++++ + ++++ ++++ ++ TTTTACTTTTACTATCTCGCTTTATTTT TTTTAATTACGTTTTTTTACAGATATAA +++++ ++ + ++ ++++ + +++++++ TATTATCGATAAAATGAATGTATATTAA TTATATCTGTAAAAAAACGTAATTAAAA ++ ++++ ++++++ ++ ++ ++ TTTATCGGAGATGAAAAAACATTTAAAA TTATATCTGTAAAAAAACGTAATTAAAA ++ ++ + + +++++++++ ++++++ TTTTCATCCATTGCTTCCTTGATATTTT TTTTAATTACGTTTTTTTACAGATATAA ++++++++ ++ ++ + + ++++++ TATTTATCCCTTGTTTTCCATAGAAAAT TTTTAATTACGTTTTTTTACAGATATAA + ++ +++ +++ +++++ ++ ++ ATAGATGTTTACAACACAACAAATAATA TTATATCTGTAAAAAAACGTAATTAAAA +++ ++ + ++ ++ + +++++ +++ + TAAAATGCAGACAGAAATATATTGAAAA TTATATCTGTAAAAAAACGTAATTAAAA ++++++ + + + +++ +++ ++++++ TATTACTCACCTGTTTTTATACATAAAA TTTTAATTACGTTTTTTTACAGATATAA + +++ ++++ + ++++++++ +++ ++ TTTAAATTTCCTCTTGTCAGGCAAAAAT TTTTAATTACGTTTTTTTACAGATATAA +++ ++++ + + ++ +++ +++ ++ TATTAACAGCTTCTTCTTTAGATAATTT TTTTAATTACGTTTTTTTACAGATATAA + ++++ ++++ +++++ ++++++ GTATCACTGAATATGAAAAAGATGAAAA TTATATCTGTAAAAAAACGTAATTAAAA +++ ++++ + ++ ++++ ++++++++ TTTTTATTGTTTCTATCGTTATATATAC TTTTAATTACGTTTTTTTACAGATATAA ++++ +++++++ +++ ++++++++ TTTTCATGACTCTTGTTTCTCGTATTAT TTTTAATTACGTTTTTTTACAGATATAA +++++++ ++++++ +++ + +++++++ 1127 2.80E-06 forward 4395943 4395970 1125 1.60E-05 reverse 4392995 4393022 1126 2.40E-05 forward 4395741 4395768 1123 3.40E-05 forward 4372227 4372254 1124 4.50E-05 forward 4380159 4380186 1121 7.70E-06 reverse 4356593 4356620 1122 4.20E-07 forward 4366821 4366848 1119 2.10E-05 forward 4336720 4336747 1120 5.80E-05 reverse 4339915 4339942 1117 4.80E-05 reverse 4330167 4330194 1118 6.60E-05 forward 4334929 4334956 1115 6.00E-06 forward 4328301 4328328 1116 8.00E-05 reverse 4330131 4330158 1113 5.10E-05 reverse 4317807 4317834 1114 1.80E-05 forward 4318377 4318404 1111 4.20E-05 reverse 4304970 4304997 1112 3.60E-06 reverse 4308532 4308559 1110 6.60E-05 forward 4304868 4304895 Table S1 313 CTTTGTTTGCTCTTATTACAGGAATTAT TTTTAATTACGTTTTTTTACAGATATAA +++ +++++++++++ +++++++ ATATATCTTGATGCTGATATGATTATCA TTATATCTGTAAAAAAACGTAATTAAAA ++++++++ + + + +++++++ + CAATAATCATGCTATTGAATACATAAAA TTTTAATTACGTTTTTTTACAGATATAA ++++++++++ ++ +++ +++ ++ ATCTCTGCTTAAGTAAGGAAAATAAAAA TTATATCTGTAAAAAAACGTAATTAAAA ++ + + ++++++++ + +++ ++++ CTTCTTTCACATTTTCTTCTATATAGAA TTTTAATTACGTTTTTTTACAGATATAA ++ ++++ +++++++ ++++++ ++ TCTTCACTCCTTTTTTGCTTACTTCTAT TTTTAATTACGTTTTTTTACAGATATAA + ++++ + +++++++ + ++ ++ +++ TTATCAATAGGTTAATGCATAATTAAAT TTTTAATTACGTTTTTTTACAGATATAA ++ +++ ++ +++ ++ ++++ +++ ++ TTTCAACTCCGTTTATTGCCGGTTATTT TTTTAATTACGTTTTTTTACAGATATAA +++ ++ + ++++++++ + +++++++ AATTTATCGCAAGTGAGCTTCAGGAAAA TTATATCTGTAAAAAAACGTAATTAAAA ++ +++ + ++++ +++ + + +++++ AACTTCACCGATAATAACGTCATCAAAA TTATATCTGTAAAAAAACGTAATTAAAA ++ ++ + + ++ +++++ ++ ++++ TTTTCATAAATTCATCCCACACATTTTT TTTTAATTACGTTTTTTTACAGATATAA +++++++ + ++ ++ ++++ ++++++ TGTTCATATGGTTATCGAAGTTTTATTA TTTTAATTACGTTTTTTTACAGATATAA + +++++ +++ ++ + +++++++ TGTAATTTATTTGTTTATAATGTTATTA TTTTAATTACGTTTTTTTACAGATATAA + + + ++++++ +++ ++ +++++++ TTTTAATGATTGTTTTGTCTTTTATATT TTTTAATTACGTTTTTTTACAGATATAA +++++++ +++ ++++ + + ++++ ++ CCATAATCCAGTTTTTTTCTGTTTTTTT TTTTAATTACGTTTTTTTACAGATATAA +++++ ++++++++ + +++++++ TAATCTCCTTTAGAGAAAAAAGTTAAAA TTATATCTGTAAAAAAACGTAATTAAAA ++++ ++ + +++ ++++ + ++++++ TATATATTTTTTTAATTTATAATTAAAT TTTTAATTACGTTTTTTTACAGATATAA + + +++ ++++ +++++++ +++ ++ TATTGATTTTATTTGTTTGTTAATTAAA 1145 7.10E-06 forward 4463366 4463393 1143 1.60E-05 reverse 4457413 4457440 1144 2.00E-05 forward 4459129 4459156 1141 7.70E-06 forward 4440111 4440138 1142 5.10E-05 forward 4440249 4440276 1139 3.20E-05 forward 4440014 4440041 1140 1.80E-05 forward 4440057 4440084 1137 2.60E-05 reverse 4436455 4436482 1138 1.60E-06 forward 4439542 4439569 1135 1.80E-05 forward 4426672 4426699 1136 4.20E-05 reverse 4433522 4433549 1133 1.70E-05 forward 4421973 4422000 1134 4.20E-05 forward 4423173 4423200 1131 3.40E-05 reverse 4409723 4409750 1132 8.00E-05 forward 4414644 4414671 1129 8.50E-05 reverse 4397338 4397365 1130 9.60E-05 forward 4397701 4397728 1128 6.20E-05 forward 4396453 4396480 Table S1 314 TCTTGCTTCTGGTTTTATGAGTAACTAT TTTTAATTACGTTTTTTTACAGATATAA + ++ ++ ++ ++++ + +++ +++ TATATTTTTAAAAATAAAACAAGGATAA TTATATCTGTAAAAAAACGTAATTAAAA ++ +++ + ++++ +++++++ ++ ++ TTATATTTCTTTGCGCTCATTGTTAATA TTTTAATTACGTTTTTTTACAGATATAA ++ ++ ++ +++ +++++ ++++ ++ GGAAATCAGTAAAAAAGAGAAATCATAA TTATATCTGTAAAAAAACGTAATTAAAA +++++ +++++++++++ +++ + ++ TGAGAAACAAGAAAAGACGTAAAGAAAA TTATATCTGTAAAAAAACGTAATTAAAA + + +++ + +++++ ++++++ +++++ TTTTATACGCACCGACAAGCGATTTTAA TTATATCTGTAAAAAAACGTAATTAAAA ++ ++++ + + + ++++++++ ++ TTTTCAGAATATGTTGTTATGTTTAAAT TTTTAATTACGTTTTTTTACAGATATAA ++++++ ++ + ++ ++++ ++++ ++ TTTTCCTTACCTTTATTAAGCCGTCATT TTTTAATTACGTTTTTTTACAGATATAA +++++ ++++ ++++++ + + ++ TTTTAATACCACCAGCGCCTGGGAATAT TTTTAATTACGTTTTTTTACAGATATAA +++++++ + + + + + + +++++ TTATTATCTGCTGATTTTTTATTTTTAA TTTTAATTACGTTTTTTTACAGATATAA ++ + +++ + ++++ +++++++++ TGATTATTTTCTTATTAAACATATTAAT TTTTAATTACGTTTTTTTACAGATATAA + + +++ + ++ ++ +++++++ ++ TGTTGCCTGATTCTATTCGCTGAAAAAT TTTTAATTACGTTTTTTTACAGATATAA + ++ ++ ++ +++++ + ++++ ++ AAAGATAGCCATATAAAATAAAATATTA TTATATCTGTAAAAAAACGTAATTAAAA +++ +++ + ++++++ ++ ++ + TCTATATTGCTTTATTTTTAATAATATA TTTTAATTACGTTTTTTTACAGATATAA + + ++++++++ ++++ +++++ ++ AAATTATCCTAAATAAACAGTAGGATAA TTATATCTGTAAAAAAACGTAATTAAAA ++++++ ++++++++++ + ++ ++ Table S4: H-NS and predicted LeuO binding site overlap H-NS LPM ChIP-chip SL1344 start coordinate H-NS LPM ChIP-chip SL1344 end coordinate LeuO predicted site SL1344 start coordinate LeuO predicted site SL1344 end coordinate 9626 11625 11314 11341 9626 11625 11360 11387 14251 18625 14835 14862 14251 18625 14883 14910 14251 18625 15780 15807 14251 18625 17741 17768 1263 3.00E-06 reverse 4877100 4877127 1261 5.50E-05 reverse 4874009 4874036 1262 8.00E-05 forward 4874271 4874298 1259 7.10E-05 forward 4873953 4873980 1260 1.40E-05 forward 4873981 4874008 1257 8.50E-05 forward 4857150 4857177 1258 5.50E-05 forward 4872364 4872391 1255 4.30E-06 forward 4851927 4851954 1256 5.80E-05 forward 4853015 4853042 1253 2.80E-06 reverse 4830621 4830648 1254 6.20E-05 reverse 4836166 4836193 1251 2.00E-05 forward 4826620 4826647 1252 3.30E-06 reverse 4830382 4830409 1249 9.00E-05 forward 4826498 4826525 1250 3.20E-05 reverse 4826578 4826605 1248 1.90E-06 reverse 4822739 4822766 Table S1 321 22501 26250 23495 23522 22501 26250 24448 24475 22501 26250 25002 25029 31751 40875 32563 32590 31751 40875 34251 34278 31751 40875 34492 34519 31751 40875 34644 34671 31751 40875 34748 34775 31751 40875 35029 35056 31751 40875 35321 35348 31751 40875 37150 37177 31751 40875 38751 38778 31751 40875 39603 39630 31751 40875 39981 40008 42251 46000 43693 43720 50751 52750 51893 51920 50751 52750 52074 52101 61251 63625 63479 63506 67626 69375 68259 68286 67626 69375 68489 68516 74626 75375 74998 75025 80001 81375 80478 80505 82001 83500 82567 82594 87751 89375 88273 88300 87751 89375 88420 88447 93251 98750 93812 93839 93251 98750 94478 94505 93251 98750 97965 97992 115376 117750 115465 115492 115376 117750 116446 116473 115376 117750 116494 116521 133501 136250 134270 134297 139126 140250 139455 139482 188126 190125 188692 188719 188126 190125 188769 188796 188126 190125 188814 188841 188126 190125 189520 189547 202126 203000 202140 202167 202126 203000 202375 202402 207751 211250 208918 208945 229501 232250 229690 229717 229501 232250 230127 230154 229501 232250 230156 230183 229501 232250 230253 230280 229501 232250 230327 230354 229501 232250 230596 230623 248001 248875 248299 248326 315626 319375 316802 316829 315626 319375 316842 316869 315626 319375 317391 317418 315626 319375 318279 318306 322501 324375 323684 323711 328751 330500 329573 329600 328751 330500 329617 329644 328751 330500 329681 329708 335501 343000 339516 339543 335501 343000 339739 339766 335501 343000 339775 339802 335501 343000 340768 340795 335501 343000 341197 341224 335501 343000 341570 341597 364001 366000 365501 365528 364001 366000 365536 365563 370251 373125 372043 372070 376501 380750 377290 377317 376501 380750 377986 378013 376501 380750 378265 378292 382751 392125 383315 383342 382751 392125 386070 386097 382751 392125 388880 388907 382751 392125 389212 389239 382751 392125 390601 390628 382751 392125 391288 391315 Table S1 322 382751 392125 391680 391707 402876 406500 405158 405185 406876 408875 407899 407926 406876 408875 407959 407986 406876 408875 408213 408240 414501 416125 415119 415146 414501 416125 415329 415356 423876 426125 424382 424409 427251 429125 428269 428296 427251 429125 428613 428640 435626 438125 436407 436434 435626 438125 437609 437636 452376 452625 452435 452462 489126 493375 490857 490884 489126 493375 491540 491567 489126 493375 492176 492203 497126 498875 497858 497885 497126 498875 497928 497955 525626 529250 526785 526812 525626 529250 527459 527486 552876 554500 554019 554046 569126 569750 569100 569127 578126 588250 582067 582094 578126 588250 586136 586163 578126 588250 587364 587391 578126 588250 587925 587952 598626 599125 598837 598864 608251 618750 610203 610230 608251 618750 610331 610358 608251 618750 610739 610766 608251 618750 610911 610938 608251 618750 612546 612573 608251 618750 614575 614602 608251 618750 615345 615372 608251 618750 617321 617348 608251 618750 617910 617937 630501 633500 631146 631173 630501 633500 631301 631328 648376 650500 648915 648942 648376 650500 649452 649479 666126 669375 667481 667508 666126 669375 667606 667633 666126 669375 668528 668555 672126 673875 672528 672555 686376 688250 686411 686438 686376 688250 687197 687224 686376 688250 687297 687324 689001 689625 689111 689138 690626 692750 691439 691466 690626 692750 691594 691621 690626 692750 691711 691738 690626 692750 692244 692271 690626 692750 692297 692324 695876 697750 696546 696573 711376 716000 711694 711721 711376 716000 714337 714364 711376 716000 715955 715982 723001 724250 723514 723541 723001 724250 723879 723906 764376 766375 765083 765110 764376 766375 765642 765669 773376 774375 773710 773737 780126 781750 781021 781048 780126 781750 781723 781750 782876 794000 784258 784285 782876 794000 784606 784633 782876 794000 785595 785622 782876 794000 786033 786060 782876 794000 786654 786681 782876 794000 787364 787391 782876 794000 788226 788253 782876 794000 788281 788308 782876 794000 788517 788544 Table S1 323 782876 794000 789231 789258 782876 794000 789962 789989 782876 794000 790003 790030 782876 794000 790066 790093 782876 794000 790142 790169 782876 794000 790748 790775 782876 794000 790782 790809 782876 794000 790854 790881 782876 794000 791090 791117 782876 794000 791448 791475 782876 794000 792053 792080 782876 794000 792379 792406 782876 794000 793467 793494 807001 809500 808355 808382 807001 809500 808510 808537 807001 809500 808550 808577 807001 809500 808606 808633 822251 829625 824152 824179 822251 829625 825509 825536 822251 829625 827612 827639 822251 829625 828086 828113 892876 893625 893138 893165 905501 908375 906213 906240 905501 908375 908040 908067 924501 933625 925284 925311 924501 933625 926703 926730 924501 933625 927283 927310 924501 933625 928058 928085 924501 933625 929349 929376 924501 933625 931126 931153 924501 933625 931816 931843 924501 933625 932112 932139 943001 944625 943704 943731 953001 956375 953524 953551 953001 956375 953572 953599 953001 956375 954141 954168 974126 975500 975100 975127 1005876 1012250 1011293 1011320 1005876 1012250 1011511 1011538 1014376 1015875 1014996 1015023 1020251 1021000 1020617 1020644 1047251 1048375 1047440 1047467 1047251 1048375 1047630 1047657 1047251 1048375 1047719 1047746 1047251 1048375 1047954 1047981 1049376 1053875 1050388 1050415 1049376 1053875 1051167 1051194 1049376 1053875 1052308 1052335 1060001 1061750 1061029 1061056 1060001 1061750 1061254 1061281 1060001 1061750 1061620 1061647 1064876 1067000 1065466 1065493 1067876 1072125 1070255 1070282 1067876 1072125 1071208 1071235 1094876 1101500 1099283 1099310 1094876 1101500 1099341 1099368 1094876 1101500 1099553 1099580 1094876 1101500 1099652 1099679 1094876 1101500 1099745 1099772 1094876 1101500 1100048 1100075 1094876 1101500 1100323 1100350 1107501 1108000 1107642 1107669 1131126 1139875 1131271 1131298 1131126 1139875 1132525 1132552 1131126 1139875 1133129 1133156 1131126 1139875 1133223 1133250 1131126 1139875 1133934 1133961 1131126 1139875 1133998 1134025 1131126 1139875 1137677 1137704 1153251 1155625 1153713 1153740 1153251 1155625 1154511 1154538 1161876 1163000 1162291 1162318 1167751 1168875 1168055 1168082 Table S1 324 1169501 1171875 1170154 1170181 1172251 1180125 1173950 1173977 1172251 1180125 1175477 1175504 1172251 1180125 1175684 1175711 1172251 1180125 1176346 1176373 1172251 1180125 1176719 1176746 1172251 1180125 1176927 1176954 1172251 1180125 1177076 1177103 1183876 1189375 1183939 1183966 1183876 1189375 1186272 1186299 1183876 1189375 1186733 1186760 1183876 1189375 1186810 1186837 1183876 1189375 1187341 1187368 1183876 1189375 1188220 1188247 1201251 1205125 1202227 1202254 1201251 1205125 1204176 1204203 1253126 1253625 1253444 1253471 1265501 1268250 1266996 1267023 1281876 1296625 1282708 1282735 1281876 1296625 1282978 1283005 1281876 1296625 1283665 1283692 1281876 1296625 1284066 1284093 1281876 1296625 1284548 1284575 1281876 1296625 1285682 1285709 1281876 1296625 1285933 1285960 1281876 1296625 1286897 1286924 1281876 1296625 1289112 1289139 1281876 1296625 1290318 1290345 1281876 1296625 1291270 1291297 1281876 1296625 1292595 1292622 1301626 1311625 1303401 1303428 1301626 1311625 1306481 1306508 1301626 1311625 1306592 1306619 1301626 1311625 1307846 1307873 1301626 1311625 1308984 1309011 1314751 1318000 1315401 1315428 1314751 1318000 1315787 1315814 1314751 1318000 1316122 1316149 1314751 1318000 1316151 1316178 1336876 1337375 1337235 1337262 1338626 1339250 1338839 1338866 1347501 1353375 1348985 1349012 1347501 1353375 1349644 1349671 1347501 1353375 1351950 1351977 1362751 1369375 1362912 1362939 1362751 1369375 1362954 1362981 1362751 1369375 1365366 1365393 1362751 1369375 1366010 1366037 1362751 1369375 1367168 1367195 1362751 1369375 1367244 1367271 1362751 1369375 1367625 1367652 1362751 1369375 1367903 1367930 1362751 1369375 1368154 1368181 1383751 1385125 1384052 1384079 1383751 1385125 1384310 1384337 1383751 1385125 1384488 1384515 1390251 1402500 1390495 1390522 1390251 1402500 1392298 1392325 1390251 1402500 1399372 1399399 1390251 1402500 1401527 1401554 1390251 1402500 1401663 1401690 1407251 1409500 1408474 1408501 1416251 1417250 1416514 1416541 1416251 1417250 1416544 1416571 1416251 1417250 1416748 1416775 1419376 1423750 1421269 1421296 1419376 1423750 1421517 1421544 1419376 1423750 1422124 1422151 1432126 1441625 1436365 1436392 1432126 1441625 1436641 1436668 1442126 1453000 1442124 1442151 1442126 1453000 1444359 1444386 1442126 1453000 1446368 1446395 Table S1 325 1442126 1453000 1448447 1448474 1453501 1459375 1455515 1455542 1453501 1459375 1456889 1456916 1453501 1459375 1456992 1457019 1453501 1459375 1457732 1457759 1453501 1459375 1457898 1457925 1466126 1468750 1467242 1467269 1466126 1468750 1467603 1467630 1466126 1468750 1467968 1467995 1472001 1472500 1472243 1472270 1491876 1493500 1492813 1492840 1506126 1509625 1507651 1507678 1506126 1509625 1507954 1507981 1515751 1518000 1517233 1517260 1520751 1521250 1520899 1520926 1540751 1543125 1541324 1541351 1540751 1543125 1542443 1542470 1548001 1553125 1550111 1550138 1548001 1553125 1550149 1550176 1548001 1553125 1550973 1551000 1548001 1553125 1552113 1552140 1553751 1555875 1554121 1554148 1560876 1565375 1562892 1562919 1560876 1565375 1564453 1564480 1571126 1579625 1571187 1571214 1571126 1579625 1571983 1572010 1571126 1579625 1572168 1572195 1571126 1579625 1574526 1574553 1581001 1589500 1581519 1581546 1581001 1589500 1581955 1581982 1581001 1589500 1582383 1582410 1581001 1589500 1583596 1583623 1581001 1589500 1587322 1587349 1581001 1589500 1588025 1588052 1599751 1603250 1599923 1599950 1599751 1603250 1600446 1600473 1599751 1603250 1600734 1600761 1599751 1603250 1601747 1601774 1610126 1612750 1611574 1611601 1615626 1617000 1615938 1615965 1632126 1634625 1633045 1633072 1632126 1634625 1633563 1633590 1632126 1634625 1633880 1633907 1646876 1650875 1647217 1647244 1646876 1650875 1648815 1648842 1646876 1650875 1649104 1649131 1646876 1650875 1649253 1649280 1646876 1650875 1649866 1649893 1664251 1667125 1666144 1666171 1674876 1688000 1676412 1676439 1674876 1688000 1677206 1677233 1674876 1688000 1678017 1678044 1674876 1688000 1679975 1680002 1674876 1688000 1680112 1680139 1674876 1688000 1681326 1681353 1674876 1688000 1681951 1681978 1674876 1688000 1683642 1683669 1674876 1688000 1684272 1684299 1674876 1688000 1684887 1684914 1674876 1688000 1686492 1686519 1708126 1715250 1709073 1709100 1708126 1715250 1711116 1711143 1708126 1715250 1712014 1712041 1715626 1724250 1721119 1721146 1715626 1724250 1722202 1722229 1725751 1727500 1726494 1726521 1725751 1727500 1726603 1726630 1728501 1730375 1729285 1729312 1736751 1738250 1737230 1737257 1745751 1749500 1746594 1746621 1745751 1749500 1746636 1746663 1745751 1749500 1748406 1748433 1755001 1757750 1755424 1755451 Table S1 326 1781751 1788000 1782273 1782300 1781751 1788000 1782345 1782372 1795501 1800000 1798404 1798431 1795501 1800000 1798475 1798502 1795501 1800000 1798694 1798721 1795501 1800000 1798740 1798767 1795501 1800000 1799460 1799487 1795501 1800000 1799628 1799655 1825251 1827250 1825917 1825944 1825251 1827250 1826006 1826033 1839126 1841875 1840255 1840282 1839126 1841875 1840312 1840339 1839126 1841875 1840614 1840641 1839126 1841875 1841348 1841375 1870251 1871500 1870598 1870625 1888626 1890125 1889402 1889429 1893001 1896750 1893871 1893898 1893001 1896750 1895092 1895119 1908001 1914625 1909447 1909474 1908001 1914625 1910342 1910369 1908001 1914625 1910751 1910778 1908001 1914625 1911072 1911099 1908001 1914625 1913036 1913063 1908001 1914625 1913510 1913537 1915251 1923875 1916160 1916187 1915251 1923875 1916981 1917008 1915251 1923875 1920612 1920639 1915251 1923875 1922591 1922618 1915251 1923875 1922630 1922657 1948001 1951000 1948446 1948473 1979501 1980875 1980036 1980063 1983751 1985375 1984427 1984454 1985626 1988125 1986837 1986864 1985626 1988125 1986871 1986898 1995876 1998875 1996532 1996559 1995876 1998875 1996575 1996602 2003126 2004875 2004198 2004225 2012376 2014125 2012977 2013004 2024001 2026250 2024633 2024660 2024001 2026250 2024725 2024752 2024001 2026250 2025230 2025257 2024001 2026250 2025277 2025304 2024001 2026250 2025524 2025551 2034251 2037875 2034907 2034934 2034251 2037875 2034984 2035011 2034251 2037875 2035015 2035042 2039251 2043875 2039823 2039850 2039251 2043875 2039873 2039900 2039251 2043875 2040308 2040335 2039251 2043875 2041404 2041431 2039251 2043875 2041507 2041534 2063876 2065250 2064863 2064890 2077001 2080625 2077083 2077110 2077001 2080625 2080009 2080036 2083376 2088375 2085300 2085327 2111376 2115125 2113107 2113134 2138251 2141000 2139311 2139338 2138251 2141000 2139575 2139602 2141501 2142500 2141909 2141936 2155126 2157750 2156833 2156860 2155126 2157750 2156991 2157018 2158001 2179000 2158596 2158623 2158001 2179000 2158624 2158651 2158001 2179000 2159175 2159202 2158001 2179000 2161978 2162005 2158001 2179000 2162366 2162393 2158001 2179000 2164063 2164090 2158001 2179000 2164484 2164511 2158001 2179000 2164619 2164646 2158001 2179000 2164737 2164764 2158001 2179000 2165132 2165159 2158001 2179000 2165545 2165572 2158001 2179000 2165599 2165626 Table S1 327 2158001 2179000 2166241 2166268 2158001 2179000 2166304 2166331 2158001 2179000 2166572 2166599 2158001 2179000 2166637 2166664 2158001 2179000 2167307 2167334 2158001 2179000 2167389 2167416 2158001 2179000 2167960 2167987 2158001 2179000 2172792 2172819 2158001 2179000 2175260 2175287 2158001 2179000 2175888 2175915 2158001 2179000 2177559 2177586 2180876 2182500 2181760 2181787 2191126 2194250 2191656 2191683 2228626 2232125 2229220 2229247 2228626 2232125 2230147 2230174 2228626 2232125 2230190 2230217 2228626 2232125 2230661 2230688 2239751 2246875 2241517 2241544 2239751 2246875 2244359 2244386 2239751 2246875 2246107 2246134 2249251 2251500 2250594 2250621 2267751 2269000 2268123 2268150 2278251 2281125 2278880 2278907 2278251 2281125 2278986 2279013 2291126 2294125 2291953 2291980 2291126 2294125 2291990 2292017 2291126 2294125 2292270 2292297 2306126 2308500 2306106 2306133 2306126 2308500 2307603 2307630 2308751 2309625 2309158 2309185 2329126 2333625 2331319 2331346 2340751 2342250 2341572 2341599 2342626 2344875 2343717 2343744 2342626 2344875 2344030 2344057 2363876 2365500 2364487 2364514 2374001 2378500 2375372 2375399 2374001 2378500 2377133 2377160 2374001 2378500 2377233 2377260 2374001 2378500 2377323 2377350 2374001 2378500 2377691 2377718 2383251 2386500 2384013 2384040 2391876 2394250 2392367 2392394 2391876 2394250 2393254 2393281 2400376 2402125 2401413 2401440 2438376 2440250 2439106 2439133 2438376 2440250 2439571 2439598 2453251 2455125 2454242 2454269 2453251 2455125 2454316 2454343 2453251 2455125 2454375 2454402 2466751 2470125 2467421 2467448 2466751 2470125 2467596 2467623 2483626 2486875 2484096 2484123 2483626 2486875 2485689 2485716 2509126 2514000 2509537 2509564 2509126 2514000 2511913 2511940 2525376 2527000 2526479 2526506 2525376 2527000 2526930 2526957 2530376 2534625 2531198 2531225 2530376 2534625 2533601 2533628 2530376 2534625 2533790 2533817 2575501 2577750 2576657 2576684 2575501 2577750 2576787 2576814 2584876 2587250 2585312 2585339 2594126 2595625 2594967 2594994 2616126 2620500 2618703 2618730 2616126 2620500 2619790 2619817 2616126 2620500 2620424 2620451 2631001 2632625 2631693 2631720 2647751 2649625 2648420 2648447 2647751 2649625 2648604 2648631 2647751 2649625 2648645 2648672 2647751 2649625 2648682 2648709 2647751 2649625 2648718 2648745 Table S1 328 2671126 2672875 2671921 2671948 2683376 2685125 2684117 2684144 2716001 2720000 2716530 2716557 2716001 2720000 2718581 2718608 2716001 2720000 2718626 2718653 2726126 2733125 2727105 2727132 2726126 2733125 2727683 2727710 2726126 2733125 2727763 2727790 2726126 2733125 2727830 2727857 2726126 2733125 2728506 2728533 2726126 2733125 2730592 2730619 2755501 2757125 2755819 2755846 2757376 2760875 2758110 2758137 2757376 2760875 2760148 2760175 2768501 2770750 2770392 2770419 2812501 2815375 2813188 2813215 2812501 2815375 2813393 2813420 2812501 2815375 2813569 2813596 2812501 2815375 2813727 2813754 2812501 2815375 2815336 2815363 2816251 2817125 2816751 2816778 2818751 2820000 2819837 2819864 2837626 2839375 2838381 2838408 2837626 2839375 2838418 2838445 2862501 2865625 2862834 2862861 2862501 2865625 2863062 2863089 2862501 2865625 2864622 2864649 2876751 2881250 2878034 2878061 2876751 2881250 2878579 2878606 2876751 2881250 2879441 2879468 2876751 2881250 2879950 2879977 2883501 2886250 2884079 2884106 2883501 2886250 2885723 2885750 2887126 2894750 2888676 2888703 2887126 2894750 2888904 2888931 2887126 2894750 2889582 2889609 2887126 2894750 2891480 2891507 2887126 2894750 2891600 2891627 2887126 2894750 2891938 2891965 2887126 2894750 2892139 2892166 2887126 2894750 2892607 2892634 2887126 2894750 2892886 2892913 2887126 2894750 2893100 2893127 2887126 2894750 2893795 2893822 2887126 2894750 2894047 2894074 2887126 2894750 2894199 2894226 2902376 2906000 2903995 2904022 2908126 2911625 2908380 2908407 2908126 2911625 2908597 2908624 2908126 2911625 2908845 2908872 2908126 2911625 2910570 2910597 2908126 2911625 2910781 2910808 2914376 2917125 2915768 2915795 2923376 2933625 2923943 2923970 2923376 2933625 2924295 2924322 2923376 2933625 2924571 2924598 2923376 2933625 2926662 2926689 2923376 2933625 2926710 2926737 2923376 2933625 2926880 2926907 2923376 2933625 2926979 2927006 2923376 2933625 2927429 2927456 2923376 2933625 2927714 2927741 2923376 2933625 2928968 2928995 2923376 2933625 2930269 2930296 2923376 2933625 2931307 2931334 2923376 2933625 2931527 2931554 2923376 2933625 2932059 2932086 2934251 2939250 2934514 2934541 2934251 2939250 2935789 2935816 2934251 2939250 2936463 2936490 2934251 2939250 2937970 2937997 2934251 2939250 2938045 2938072 2946126 2954625 2948438 2948465 Table S1 329 2946126 2954625 2950709 2950736 2946126 2954625 2952105 2952132 2946126 2954625 2952324 2952351 2946126 2954625 2952861 2952888 2946126 2954625 2953666 2953693 2965626 2972000 2968065 2968092 2965626 2972000 2970179 2970206 2965626 2972000 2970668 2970695 2965626 2972000 2970750 2970777 3031751 3052625 3032231 3032258 3031751 3052625 3033464 3033491 3031751 3052625 3035000 3035027 3031751 3052625 3035057 3035084 3031751 3052625 3035606 3035633 3031751 3052625 3035764 3035791 3031751 3052625 3037666 3037693 3031751 3052625 3040385 3040412 3031751 3052625 3041863 3041890 3031751 3052625 3042440 3042467 3031751 3052625 3043368 3043395 3031751 3052625 3044506 3044533 3031751 3052625 3046169 3046196 3031751 3052625 3046684 3046711 3031751 3052625 3047230 3047257 3031751 3052625 3049456 3049483 3031751 3052625 3051664 3051691 3052876 3072875 3054059 3054086 3052876 3072875 3054549 3054576 3052876 3072875 3055011 3055038 3052876 3072875 3060962 3060989 3052876 3072875 3062084 3062111 3052876 3072875 3068430 3068457 3052876 3072875 3069078 3069105 3052876 3072875 3071999 3072026 3107626 3110750 3108755 3108782 3107626 3110750 3109373 3109400 3114501 3115875 3114817 3114844 3117376 3118500 3117908 3117935 3122376 3124375 3123045 3123072 3122376 3124375 3123093 3123120 3147501 3149500 3148113 3148140 3147501 3149500 3148184 3148211 3147501 3149500 3148578 3148605 3158876 3160875 3159319 3159346 3158876 3160875 3159577 3159604 3184251 3184750 3184725 3184752 3198376 3200000 3198856 3198883 3212626 3216625 3215064 3215091 3212626 3216625 3215249 3215276 3231126 3233375 3231610 3231637 3231126 3233375 3232480 3232507 3231126 3233375 3232592 3232619 3249001 3250625 3249029 3249056 3261626 3265750 3262140 3262167 3261626 3265750 3262950 3262977 3261626 3265750 3264018 3264045 3287126 3287625 3287339 3287366 3295751 3300875 3295976 3296003 3295751 3300875 3299380 3299407 3295751 3300875 3300043 3300070 3303501 3309625 3304640 3304667 3311876 3316375 3312499 3312526 3311876 3316375 3312563 3312590 3311876 3316375 3312636 3312663 3311876 3316375 3312676 3312703 3320501 3323500 3321582 3321609 3320501 3323500 3322434 3322461 3320501 3323500 3322524 3322551 3336376 3339500 3336801 3336828 3336376 3339500 3338216 3338243 3344501 3344750 3344581 3344608 3348376 3350250 3349480 3349507 3374376 3378250 3375032 3375059 Table S1 330