Culturomics-based genomics sheds light on the ecology of the new haloarchaeal genus Halosegnis

Depósito de investigación de la Universidad de Sevilla https://idus.us.es/ “This is the peer reviewed version of the following article: Durán-Viseras, A., Andrei, A.-Ş., Vera-Gargallo, B., Ghai, R., Sánchez-Porro, C. and Ventosa, A. (2021), Culturomics-based genomics sheds light on the ecology of the new haloarchaeal genus Halosegnis. Environ Microbiol, 23: 3418-3434, which has been published in final form at https://doi.org/10.1111/1462-2920.15082 . This article may be used for non-commercial purposes in accordance with Wiley Terms and Conditions for Use of Self-Archived Versions. This article may not be enhanced, enriched or otherwise transformed into a derivative work, without express permission from Wiley or by statutory rights under applicable legislation. Copyright notices must not be removed, obscured or modified. The article must be linked to Wiley’s version of record on Wiley Online Library and any embedding, framing or otherwise making available the article or pages thereof by third parties from platforms, services and websites other than Wiley Online Library must be prohibited." 1 1 Culturomics-based genomics sheds light on the ecology of the new haloarchaeal 2 genus Halosegnis 3 Ana Durán-Viseras1, Adrian-Ştefan Andrei2, Blanca Vera-Gargallo1, Rohit Ghai2, Cristina 4 Sánchez-Porro1 and Antonio Ventosa1* 5 6 1Department of Microbiology and Parasitology, Faculty of Pharmacy, University of 7 Sevilla, 41012 Sevilla, Spain. 8 2Department of Aquatic Microbial Ecology, Institute of Hydrobiology, Biology Centre of 9 the Czech Academy of Sciences, 370 05 České Budějovice, Czech Republic. 10 11 *For correspondence: Antonio Ventosa. Address: Department of Microbiology and 12 Parasitology, Faculty of Pharmacy, University of Sevilla, 41012 Sevilla, Spain. Tel: +34 13 954556765. Fax: +34 954628162. E-mail address: [email protected] 14 15 Running title: Culturing elusive haloarchaea from salterns 16 17 2 Originality-Significance statement 18 Recent metagenomic studies in hypersaline habitats have shown that besides the well-known 19 archaeal and bacterial microorganisms available in pure culture, there are new groups that have 20 not previously been isolated under laboratory conditions and for which their basic physiological, 21 ecological and biotechnological features are unknown. Here we describe the isolation, genomic 22 characteristics, ecological distribution and taxonomic description of four new haloarchaeal 23 isolates that constitute a new genus with two different species, for which we propose the new 24 names Halosegnis longus gen. nov., sp. nov. and Halosegnis rubeus gen. nov., sp. nov. This 25 archaeal genus is widely distributed in hypersaline habitats and may play an important role in 26 intermediate salinities, where it is relatively abundant. 27 28 Summary 29 The development of culture-independent techniques has revolutioned our understanding of 30 microbial ecology, especially through the illustration of the vast gap between the 31 environmentally abundant microbial diversity and that accessible through cultivation. 32 However, culture-based approaches are not only crucial for understanding the evolutionary, 33 metabolic and ecological milieu of microbial diversity, but also for the development of novel 34 biotechnological applications. In this study, we used a culturomics-based approach in order to 35 isolate novel microbial taxa from hypersaline environments (i.e. Isla Cristina and Isla Bacuta 36 salterns in Huelva, Spain). We managed to obtain axenic cultures of four haloarchaeal strains 37 that belong to a new haloarchaeal genus, and to obtain their genomic sequences. The 38 phylogenomic and phylogenetic analyses (together with AAI, ANI and digital DDH indices) 39 showed that the isolates constitute two new species, for which we propose the names 40 Halosegnis longus sp. nov. and Halosegnis rubeus sp. nov. The genomic-based metabolic 41 3 reconstructions indicated that members of this new haloarchaeal genus have 42 photoheterotrophic aerobic lifestyle with a typical salt-in signature. 16S rRNA gene sequence 43 reads abundance profiles and genomic recruitment analyses revealed that the Halosegnis 44 genus has a worldwide geographical distribution, reaching high abundance (up to 8 %) in 45 habitats with intermediate salinities. 46 47 Keywords: Haloarchaea, culturomics, comparative genomic analyses, hypersaline 48 environment, Halosegnis longus sp. nov., Halosegnis rubeus sp. nov. 49 50 Introduction 51 During the last decades the development of culture-independent techniques has revolutionized 52 the field of microbial ecology, leading to the realization that there is a huge gap between the 53 microbial diversity present in the environment and the number of colony-forming units obtained 54 by plate-culturing (Staley and Konoptka, 1985). However, culture isolation remains the most 55 reliable method for a more complete characterization of a given microorganism and to obtain 56 definitive information about its phylogenetic, metabolic and ecological relevance as well as its 57 biotechnological potential (Gutleben et al., 2018). Thus, culturing remains essential and 58 improvements in culturing techniques are needed (Vartoukian et al., 2010). The approach called 59 culturomics, that uses multiple culture conditions and new protocols, has made possible to 60 increase the repertoire of microorganisms isolated from different habitats (Lagier et al., 2016). 61 Recent improvements in culturing techniques allowed the isolation of several abundant 62 microorganisms present in natural environments. For instance, in marine ecosystems, 63 microorganisms belonging to the genera Alteromonas and Vibrio are easily isolated in pure 64 culture by using standard cultivation techniques (Eilers et al., 2000); however, Pelagibacter 65 4 ubique, the most abundant marine heterotrophic bacterium, is not able to grow under these 66 conditions, and different culture techniques were employed for its isolation (Rappé et al., 2002). 67 In hypersaline environments several hundreds of halophilic bacterial and archaeal species have 68 been described as a result of the extensive isolation campaigns carried out. We have intimate 69 knowledge of some dominant microorganisms in part, at least, because they are readily 70 cultivated (Cray et al., 2013). However, some of the most abundant microbes from hypersaline 71 habitats proved difficult to isolate and many others still remain uncultured. Haloquadratum 72 walsbyi (Burns et al., 2007), Spiribacter (Leon et al., 2014) or Nanohaloarchaea (Hamm et al., 73 2019) are few examples of abundant microorganisms in hypersaline environments (Ghai et al., 74 2011; Narasingarao et al., 2012; Podell et al., 2013; Ventosa et al., 2014; 2015; Huby et al., 2020), 75 slow growing and extremely fastidious to isolate and characterize. More recently, improvements 76 in isolation procedures have permitted the isolation of new groups of haloarchaea, members of 77 the genus Halonotius, that perform a Black Queen fuction in the environment due to their 78 widespread abundance and their capability of vitamin B12 biosynthesis (Durán-Viseras et al., 79 2019a). 80 Here, we report the characteristics of a new abundant haloarchaeal genus, comprising two 81 species, isolated based on improvements in media design and new procedures for halophilic 82 microorganisms. In order to obtain insights into the phylogeny, metabolic plasticity and 83 ecological features of this new group, the genomes of the four newly isolated strains were 84 sequenced and compared. Genomic analyses reveal that strains belonging to this new genus are 85 characterized by a photoheterotrophic life style with a typical aerobic electron transport chain 86 and haloarchaeal proton pumps. Genome-based metabolic reconstructions showed that the 87 new taxa posses the complete biosynthetic pathway for the 4-aminobutanoic acid (GABA), 88 pinpointing towards potential biotechnological applications. 89 5 Results and discussion 90 Isolation, phylogeny and relatedness indices of the new isolates 91 With the main purpose of isolating new groups of halophilic archaea abundant in hypersaline 92 environments, and to provide light to the vast microbial diversity that still remains uncultured, 93 an extensive and laborious haloarchaeal strain isolation campaign was carried out between 94 September 2014 and June 2016 in different salterns located in Southwest coast of Spain. A wide 95 variety of media with different nutrient composition and salinities, as well as distinct culture 96 conditions were used. As a result, more than 2000 strains were isolated and after successive 97 subcultivations obtained in pure culture. To identify phylogenetically these strains, their 16S 98 rRNA gene was amplified and sequenced. From the total isolates and according to their low 16S 99 rRNA gene sequence similarity percentages with previously described haloarchaea (Table S1), 100 far below the threshold accepted value for genus delineation (Tindall et al., 2010; Yarza et al., 101 2014), four strains (designated F12-1T, F17-44T, F18-79 and F19-13) were selected for further 102 studies and their genome was sequenced. 103 A phylogenomic tree based on the concatenated alignment of a total of 299 core orthologous 104 genes between these four new strains and previously described species of the order 105 Halobacteriales, was constructed (Fig. 1). Tree reconstruction clearly shows the placement of 106 these new isolates in a separate monophyletic cluster, distantly related to the genus 107 Natronomonas and to other genera from the order Halobacteriales, supported by high 108 bootstrap values (Fig. 1), and suggesting the placement of these new isolates in a new genus 109 within the order Halobacteriales. Additionally, within this cluster, strains F17-44T, F18-79 and 110 F19-13 grouped together and separate from strain F12-1T, also reinforced by high bootstrap 111 values (Fig. 1), which supports the existence of two different species within this genus. This 112 phylogeny is in accordance with those previously obtained by 16S rRNA and rpoB´ genes 113 sequence comparisons (Figs. S1A and S1B). 114 6 On the other hand, to confirm their condition of new genus and species, the genomic 115 parameters average amino acid identity (AAI) (Klappenbach et al., 2007; Konstantinidis et al., 116 2017), average nucleotide identity (ANI) (Konstantinidis and Tiedje, 2004; Richter and Rosselló-117 Móra, 2009) and digital DNA-DNA hybridization (DDH) (Stackebrandt and Goebel, 1994; Auch et 118 al., 2010) were determined. AAI values for strains F12-1T, F17-44T, F18-79 and F19-13 and the 119 most related Natronomonas moolapensis 8.8.11T and Natronomonas pharaonis DSM 2160T 120 were in all cases lower than 65 %, confirming their condition of new genus (Fig. S2), while values 121 within the isolates were much higher than this cut-off, indicating that all four strains belong to 122 the same genus (Fig. S2). Along similar lines, ANI and in silico DDH values were below 95 % and 123 70 %, respectively, for strain F12-1T in comparison with strains F17-44T, F18-79 and F19-13, and 124 higher than these percentages between these three later strains (Fig. S2 and Table S2), 125 confirming their condition of two different species within the new genus. Moreover, the 126 genomes of strains F17-44T, F18-79 and F19-13 also showed a high level of synteny (> 85 % 127 similarity and 50 bp alignments) (Fig. 2), but lower synteny was obtained between strains F12-1T 128 and F17-44T at the same percentage of similarity (Fig. 2), which additionally support their 129 condition of two different taxa. 130 All these results clearly support the placement of strains F12-1T, F17-44T, F18-79 and F19-13 131 within a new genus with two new different species of the order Halobacteriales, for which we 132 propose the names Halosegnis gen. nov., Halosegnis longus sp. nov. and Halosegnis rubeus sp. 133 nov., whose taxonomic descriptions are detailed later. We also propose the classification of this 134 new genus on the family Haloarculaceae, on the basis of its closest phylogenomic relationship 135 with the genus Natronomonas and other related genera belonging to this family, as well as, on 136 their closer AAI values (60.6-61.2 %). 137 7 General features of the new sequenced genomes 138 With the purpose of obtaining insights into the evolution, genomics and metabolic plasticity of 139 this new haloarchaeal group, the sequenced genomes of the four isolates were compared with 140 available genomes of previously described species of the order Halobacteriales and a complete 141 comparative genomic study was carried out. 142 Some general features of the sequenced genomes are summarized in Table 1. The size of the 143 genomes among members of the novel lineage ranged from 2.4 to 2.5 Mb and the DNA G+C 144 content from 64.7 to 66.0 mol%. It is remarkable that their genome sizes are among the smallest 145 within the order Halobacteriales (average 3.5 Mb), and only after Halobacterium salinarum 146 NRC-1T (2.1 Mb), whereas their G+C content is on the range described for this order. The number 147 of protein coding genes ranged from 2,977 to 2,595, while the number of tRNAs from 44 to 46. 148 Only a single ribosomal RNA operon per genome was identified for the new isolates. 149 In order to compare in more detail the genomic features of members of the novel taxa, circular 150 DNA plots of sequenced genomes were performed. Representations show various genomic 151 islands in the GC content for all genomes (Fig. 3A-D). The genome representation of strain 152 F12-1T, initially assembled in 3 contigs, indicates that the genome consists of a single 153 chromosome (2.5 Mb) with two plasmids (0.2 and 0.1 Mb, respectively), which is supported by 154 a clearly low GC content observed for contigs 2 and 3 (Fig. 3A), contrasting with that obtained 155 for contig 1 and for the other three genomes. Consistently, no recognizable synteny is evident 156 between these two contigs and the genome of strain F17-44T (Fig. 2), and additionally, other 157 genomic data such as the percentage of hypothetical proteins in each contig (27 %, 60 % and 158 88 % in contigs 1, 2 and 3, respectively) support this condition. Similarly, the contigs 5 and 6 159 from the genome of strain F17-44T also share similar features with those contigs, peaks of low 160 GC content and the complete absence of synteny (Figs. 2 and 3B), even considering the high 161 phylogenetic similarity of this strain with strains F18-79 and F19-13 (Figs. 1 and S2). These results 162 8 also indicate the presence of a single chromosome (2.4 Mb) and two plasmids (0.2 and 0.1 Mb) 163 in the genome of this archaeon. 164 Moreover, DNA replication origin in the sequenced genomes was also studied. Archaea present 165 either a single or multiple origin(s) replication sites, the replicator-initiator system structure is 166 conserved along the domain, characterized by an initiator gene (cdc6), high content of adenine 167 and thymine residues and several conserved repeated motifs (ORBs) (Leonard and Méchali, 168 2013; Wu et al., 2014). The estimation of the GC skew parameter in strains F12-1T and F18-79 169 clearly exhibits a bimodal distribution along the two genomes with a maximum single peak at 170 around 1.13 and 0.7 Mb, respectively (Figs. 3A and 3C). In addition, the presence of two cdc6 171 genes for each genome and two different origin recognition boxes (ORBs) (Table S3) for strain 172 F12-1T and one for strain F18-79 adjacent to those peaks (Fig. 3E and 3F), supports the 173 hypothesis of a single replication origin for both genomes. Comparison of both clusters resulted 174 almost identical (Figs. 3E and 3F). 175 Additionally, strain F12-1T also possesses one complete CRISPR-Cas system with cas cluster type 176 IB and 34 spacers, while strains F17-44T, F18-79 and F19-13 present CRISPR sequences but not 177 detectable cas genes, which could suggests lack of functionality. 178 Ecological insights 179 To assess the abundance and global distribution of the novel taxa along hypersaline 180 environments, 16S rRNA reads-based abundance estimations were performed in a total of 18 181 habitats (with contrasting salinities) (Table S4). Furthermore, genomic fragment recruitments 182 against the above-mentioned datasets was also carried out. 183 Based on 16S rRNA reads abundance, representatives of the new genus Halosegnis were present 184 in a large number of studied metagenomes, specially in habitats with intermediate salinities 185 (from 18 % to 27 %), comprising up to 8 % of the prokaryotic community in Chula Vista saltern 186 (California, USA) (27 % total salts) and up to 4 % in Isla Cristina saltern (Spain) (21 % total salts) 187 15 a complete comparative genomic analysis of these novel taxa, confirming their widely 336 geographical distribution and abundance in different hypersaline systems, especially at 337 intermediate salinities. Genome-scale metabolic reconstruction revealed a heterotrophic 338 lifestyle and the complete ɣ-aminobutyric acid (GABA) biosynthesis pathway for these strains, 339 suggesting for possible biotechnological applications. Moreover, osmoregulation studies in 340 strains of the new genus show a salt-in signature for these isolates based on their acidic 341 proteome and their acidic amino acids frequency predominance. Finally, haloarchaeal proton-342 pumps rhodopsins, green spectrum absorbing were also identified. 343 Description of Halosegnis gen. nov. 344 Halosegnis (Ha.lo.seg´nis. Gr. masc. n. hals, halos salt; L. masc. adj. segnis slow; N.L. masc. n. 345 Halosegnis a slow salt [growing] organism) 346 Cells are non-motile rods producing red to pink pigmented colonies. Extremely halophilic and 347 strictly aerobic. Heterotrophic. Catalase positive but oxidase negative. The major polar lipids are 348 biphosphatidylglycerol (BPG), phosphatidylglycerol (PG), phosphatidylglycerol phosphate 349 methyl ester (PGP-Me), phosphatidylglycerol sulfate (PGS), one glycolipid chromatographycally 350 identical to sulfated mannosyl glucosyl diether (S-DGD-1), sulfated triglycosyl diphytanyl 351 archaeol ester linked to phosphatidic acid (S-TGD-1-PA) and sulfated tetraglycosyl diether (S-352 TeGD). Members of this genus are widely distributed in hypersaline aquatic habitats, specially 353 at intermediate salinities. 354 The type species is Halosegnis rubeus. The DNA G+C content ranged from 64.7 to 66.0 mol% 355 (genome). Phylogenetically affiliated to the family Haloarculaceae, order Halobacteriales and 356 distantly related to species of the genus Natronomonas (≤ 93.4 % similarity on the basis of 357 16S rRNA sequence analyses). Recommended three letters abbreviation: Hsg. 358 16 Description of Halosegnis longus sp. nov. 359 Halosegnis longus (lon´gus. L. masc. adj. longus long) 360 Cells are non-motile rods (5-10 x 0.2-0.4 µm) (Fig. S8A). Colonies are circular, entire, light-red-361 pigmented with a diameter of 0.5 mm on R2A25 medium after 15 days of incubation at 37 °C. 362 Growth occurs optimally at 20 % (w/v) NaCl, pH 7.5 and 37 °C. The growing rate for this strain is 363 0.0064 h-1 in optimum conditions. Not able to grow under anaerobic conditions in the presence 364 of arginine, KNO3 or DMSO. Negative for nitrate and nitrite reduction. Indol is not produced and 365 urea test is negative. The DNA G+C content is 66.0 mol% (genome). It possess a salt-in 366 osmoregulatory strategy and green-absorbing haloarchaea proton-pumps. Other features are 367 detailed in the genus description and in Table S5. 368 The type strain is F12-1T (= CECT 9685T = CCM 8889T = IBRC-M 11246T = JCM 33317T), isolated 369 from a water sample from a pond from Isla Cristina saltern (Huelva, Spain). 370 The GenBank/EMBL/DDBJ accession number for the 16S rRNA and rpoB´ gene sequences of 371 Halosegnis longus F12-1T are MH424598 and MH454088, respectively, and that of the complete 372 genome is QKNW00000000. 373 Description of Halosegnis rubeus sp. nov. 374 Halosegnis rubeus (ru´be.us. L. masc. adj. rubeus red) 375 Cells are non-motile rods (0.5-3 x 0.2-0.7 µm) (Fig. S8B). Colonies are circular, entire, red-376 pigmented with a diameter of 0.3-1 mm on R2A25 medium after 15 days of incubation at 37 °C. 377 Growth occurs optimally at 25 % (w/v) NaCl, pH 7.5 and 37 °C. The growing rate is 0.0038 h-1 in 378 optimum conditions. Not able to grow under anaerobic conditions in the presence of arginine, 379 KNO3 or DMSO. Negative for nitrate and nitrite reduction. Indol is not produced and urea test is 380 negative. The DNA G+C content of the species ranged from 64.7 to 65.1 mol% (genome). It 381 17 possess a salt-in osmoregulatory strategy and green-absorbing haloarchaea proton-pumps. 382 Other features are detailed in the genus description and in Table S5. 383 The type strain is F17-44T (=CECT 9385T = CCM 8890T = JCM 33319T), isolated from a water 384 sample from a pond from Isla Bacuta saltern (Huelva, Spain). The DNA G+C content of the type 385 strain is 65.1 mol% (genome). Strains F18-79 and F19-13 are additional strains of this species. 386 The GenBank/EMBL/DDBJ accession number for the 16S rRNA and rpoB´ gene sequences of 387 Halosegnis rubeus F17-44T are MH422499 and MH428007, respectively, and that of the 388 complete genome is QJOW00000000. 389 Experimental procedures 390 Isolation´s sources of haloarchaeal strains 391 An extensive sampling campaign was performed between September 2014 and June 2016, in 392 different salterns located in Southwest coast of Spain, Isla Cristina saltern (37° 12´ N 7° 19´ W) 393 and Isla Bacuta saltern (37° 15´ N 6° 58´ W), with the main purpose of isolating new haloarchaeal 394 groups that might represent abundant microbes in hypersaline habitats. Samples were diluted, 395 plated and incubated at 37 °C for up to 10 weeks. Distinct composition media with different 396 salinities (from 15 % to 25 % total salts) were tested: R2A medium (Difco), media supplemented 397 with pyruvate (0.5 %) or glycerol (0.1 %), newly designed media using filtered saline water from 398 the salterns ponds, etc. 399 From the total amount of isolates, and after successive cultivations, four haloarchaeal strains, 400 designated F12-1T, F17-44T, F18-79 and F19-13, were obtained in pure culture. While strain 401 F12-1T was isolated from a pond brine sample (310 g/L and pH 7.4) from Isla Cristina saltern, 402 strains F17-44T, F18-79 and F19-13 were isolated from different ponds brine samples (190, 270 403 and 190 g/L and pH 7.8, 7.5 and 7.8, respectively) from Isla Bacuta saltern. Strain F12-1T was 404 isolated using a new designed medium prepared by filtering saline water from a pond (280 g/L), 405 18 and with 0.005 g/L of yeast extract added as nutrient source, while strains F17-44T, F18-79 and 406 F19-13 were isolated in R2A medium (Difco) supplemented with the following salt mixture (g/L): 407 NaCl, 195; MgCl2.6H2O, 32.5; MgSO4.7H2O, 50.8; CaCl2, 0.83; KCl, 5.0; NaHCO3, 0.21; NaBr, 0.58 408 (designated as R2A25). The pH of both media was adjusted to 7.5 and they were solidified with 409 2 % (w/v) purified agar (Oxoid) when necessary. To standarize culture conditions, all strains were 410 routinely grown in R2A25 medium and for long time preservation, cultures were maintained at 411 -80 °C in this medium containing 40 % (v/v) glycerol. 412 DNA extraction, purification and sequencing 413 Genomic DNA was extracted, purified and quantified following the methodology described by 414 Durán-Viseras et al. (2019a). The 16S rRNA and rpoB’ genes were amplified by PCR with the 415 universal primers ArchF and ArchR (Arahal et al., 1996; DeLong, 1992), and the primers designed 416 by Fullmer et al. (2014), respectively. The PCR products and the draft genome sequences were 417 performed by StabVida (Oeiras, Portugal) using the Sanger method and the lllumina Hiseq 4000 418 platform (150 bp paired-end sequencing reads), respectively. 419 Phylogenetic analyses 420 16S rRNA and rpoB’ gene sequences were aligned using ChromasPro v1.5 (Technelysium Pty 421 Ltd). The 16S rRNA gene phylogenetic tree reconstruction was performed with the ARB software 422 package (Ludwig et al., 2004) and rpoB´ tree reconstruction with MEGA 6.0 software (Tamura et 423 al., 2013). A bootstrap analysis (1000 replicates) was performed to evaluate the robustness of 424 the phylogenetic trees (Felsenstein, 1985). 425 For the phylogenomic tree construction a set of 299 conserved proteins were identified using 426 the COG database (Tatusov et al., 2001). The sequences of these proteins were further aligned 427 using Kalign software (with default parameters) (Lassmann and Sonhammer, 2005) and trimmed 428 by trimAL (--gappyout) (Capella-Gutiérrez et al., 2009). A maximum-likelihood tree was 429 19 constructed with FastTree2 (Price et al., 2010) using a JTT + CAT model, a gamma approximation, 430 and 100 bootstrap replicates. 431 Additional 16S rRNA and rpoB´ gene sequences and genomes used for phylogenetic and genomic 432 comparisons were obtained from the GenBank database and their strain designations and 433 accession numbers are shown in Figs. S1A, S1B, 1 and Table S7. 434 Genome assembly, annotation and comparative genomics 435 Illumina reads of isolates F12-1T, F17-44T, F18-79 and F19-13 were preprocessed using a 436 combination of software tools implemented in the BBMap project (Bushnell, 2016). A total of 437 12 350 752, 12 653 318, 12 326 728 and 18 081 362 reads were generated for strains F12-1T, 438 F17-44T, F18-79 and F19-13, respectively. 439 Assembly of the generated quality-checked paired-end Illumina reads of strains F12-1T, F17-44T, 440 F18-79 and F19-13, was carried out by using Spades (v3.12.0) (Bankevich et al., 2012) in 3, 12, 441 10 and 16 contigs, respectively. To assess the assembly quality and G+C content QUAST v2.3 442 (Gurevich et al., 2013) was employed. Genome completeness, contamination and strain 443 heterogeneity were estimated using CheckM v1.0.5 (Parks et al., 2015). Annotation of genome 444 sequences was made with Prokka (Seemann, 2014). To assign KO identifiers (K numbers) to 445 orthologous genes present in the genomes, BlastKOALA (Aziz et al., 2008) was used. KO numbers 446 assigned to each individual genome were mapped to the KEGG pathways and KEGG modules to 447 perform the metabolic pathways reconstructions. Additionally, jackhmmer (Finn et al., 2015), 448 CDD (Marchler-Bauer et al., 2015) and Phobius (Kall et al., 2007) were used for the analyses of 449 selected proteins. 450 In order to visualize the main characteristics of the sequenced genomes, circular DNA plots and 451 linear genes representation were constructed using R v.3.6.1. and the package circlize v.0.4.6. 452 (Gu et al., 2014) and genoPlotR v.0.8.9. (Guy et al., 2010), respectively. The analysis of genomic 453 20 synteny was performed with Easyfig v.2.2.3 (Sullivan et al., 2011). To look for the presence of 454 CRISPR/Cas systems, CRISPRCasFinder (Couvin et al., 2018) was employed. 455 Average Amino acid Identity (AAI) and Average Nucleotide Identity (ANI) were calculated as 456 previously described by Konstantinidis and Tiedje (2005a, 2005b), respectively; and digital DDH 457 values with the Genome-to-Genome Distance Calculator (GGDC) website (Meier-Kolthoff et al., 458 2013) using formula 2 (Auch et al., 2010). 459 Isoelectric points of predicted proteins were computed using the iep program implemented in 460 the EMBOSS package (Rice et al., 2000), and amino acid frequencies were determined using 461 pepstats (Rice et al., 2000). 462 Estimation of abundance of Euryarchaeota and the new isolates 463 To search for putative RNA sequences in preprocessed Illumina reads from public metagenomes, 464 UBLAST (Edgar, 2010) was used against the non-redundant SILVA (Pruesse et al., 2007) 465 SSURef_NR99_132 database, that was clustered at 85 % sequence identity by UCLUST (Edgar, 466 2010). SSU-ALIGN was used to screen putative 16S rRNA sequences (e-value < 1e-5) that were 467 identified. BLASTN (Altschul et al., 1990) was performed for comparison of resulting bona fide 468 16S rRNA sequences (e-value <1e-5) against the curated SILVA (Pruesse et al., 2007) 469 SSURef_NR99_132 database. Environmental abundance of the phylum Euryarchaeota and the 470 four new isolates were calculated according to the sequences assigned by matches with identity 471 ≥ 80 % and alignment length ≥90 bp. 472 Fragment recruitment 473 Fragment recruitments against environmental metagenomic datasets (Table S4) were 474 performed for the genomes of the four isolates (F12-1T, F17-44T, F18-79 and F19-13) to evaluate 475 the presence of haloarchaeal strains related at species level. The contigs of each genome 476 (F12-1T, F17-44T, F18-79 and F19-13) were concatenated and the rRNA gene sequences present 477 21 were masked, in order to avoid analysis bias. Afterward, blastn (with the cut-offs: alignment 478 length ≥ 30 nt, identity > 95 %, E value < = 1e-5) was performed for the alignment of the studied 479 genomes against the metagenomic quality-filtered shotgun reads (Table S4). 480 Rhodopsins analyses 481 To check the presence of rhodopsin sequences, hmmsearch (Eddy, 2011) and a profile hidden 482 Markov model (HMM) of the bacteriorhodopsin-like protein family (Pfam accession: PF01036) 483 was used. Alignment of highly similar identified sequences and a curated database of a collection 484 of type-1 rhodopsin was performed by using MAFFT with the L-INS-i accuracy model. FastTree2 485 (Price et al., 2010) was employed to construct the maximum-likelihood tree with 100 bootstrap 486 replicates. 487 Determination of phenotypic and chemotaxonomic characteristics 488 Phenotypic characterization was carried out following the minimal standards defined for the 489 taxonomic description of novel taxa of the class Halobacteria (Oren et al., 1997) and the 490 methodology previously described by Durán-Viseras et al. (2019b). 491 For chemotaxonomic analyses, strains F12-1T, F17-44T, F18-79 and F19-13 were cultured for up 492 to 14 days in R2A25 medium at 37 °C. From the obtained biomass, lipids were extracted 493 according to the methodology described by Corcelli and Lobasso (2006). Polar lipids were 494 analysed by one-dimensional High Performance Thin Layer Chromatography (HPTLC) on Merck 495 silica gel plate crystal back and eluted in the solvent system chloroform/methanol/90 % acetic 496 acid (65:4:35) (Angelini et al., 2012) . To detect all polar lipids, the plate was sprayed with sulfuric 497 acid 5 % (v/v) in water and charred by heating at 160 °C. Halobacterium salinarum DSM 3754T, 498 Natronomonas pharaonis CECT 4578T, Natronomonas moolapensis CECT 7526T and Halorubrum 499 saccharovorum DSM 1137T were used as reference species for polar lipids characterization. 500 22 References 501 Altschul, S. F., Gish, W., Miller, W., Myers, E. W., and Lipman, D. J. (1990). Basic local alignment 502 search tool. J Mol Biol 215: 403–410. doi:10.1016/S0022-2836(05)80360-2. 503 Anderson, I., Scheuner, C., Göker, M., Mavromatis, K., Hooper, S. D., Porat, I., et al. (2011). Novel 504 insights into the diversity of catabolic metabolism from ten haloarchaeal genomes. PLoS One 6: 505 e20237. doi:10.1371/journal.pone.0020237. 506 Angelini, R., Corral, P., Lopalco, P., Ventosa, A., and Corcelli, A. (2012). Novel ether lipid 507 cardiolipins in archaeal membranes of extreme haloalkaliphiles. Biochim Biophys Acta - 508 Biomembr 1818: 1365–1373. doi:10.1016/j.bbamem.2012.02.014. 509 Arahal, D. R., Dewhirst, F. E., Paster, B. J., Volcani, B. E., and Ventosa, A. (1996). Phylogenetic 510 analyses of some extremely halophilic archaea isolated from Dead Sea water, determined on 511 the basis of their 16S rRNA sequences. Appl Environ Microbiol 62: 3779–3786. 512 Auch, A. F., Klenk, H.-P., and Göker, M. (2010). Standard operating procedure for calculating 513 genome-to-genome distances based on high-scoring segment pairs. Stand Genomic Sci 2: 514 142-148. doi:10.4056/sigs.541628. 515 Aziz, R. K., Bartels, D., Best, A. A., DeJongh, M., Disz, T., Edwards, R. A., et al. (2008). The RAST 516 Server: Rapid Annotations using Subsystems Technology. BMC Genomics 9: 75. 517 doi:10.1186/1471-2164-9-75. 518 Bankevich, A., Nurk, S., Antipov, D., Gurevich, A. A., Dvorkin, M., Kulikov, A. S., et al. (2012). 519 SPAdes: a new genome assembly algorithm and its applications to single-cell sequencing. 520 J Comput Biol 19: 455-477. doi:10.1089/cmb.2012.0021. 521 Bivin, D. B., and Stoeckenius, W. (1986). Photoactive retinal pigments in haloalkaliphilic bacteria. 522 Microbiology 132: 2167–2177. doi:10.1099/00221287-132-8-2167. 523 23 Bogomolni, R. A., and Spudich, J. L. (1982). Identification of a third rhodopsin-like pigment in 524 phototactic Halobacterium halobium. Proc Natl Acad Sci U.S.A. 79: 6250–6254. 525 doi:10.1073/pnas.79.20.6250. 526 Bolhuis, H., Palm, P., Wende, A., Falb, M., Rampp, M., Rodriguez-Valera, F., et al. (2006). The 527 genome of the square archaeon Haloquadratum walsbyi: life at the limits of water activity. BMC 528 Genomics 7: 169. doi:10.1186/1471-2164-7-169. 529 Bräsen, C., Esser, D., Rauch, B., and Siebers, B. (2014). Carbohydrate metabolism in Archaea: 530 current insights into unusual enzymes and pathways and their regulation. Microbiol Mol Biol Rev 531 78: 89–175. doi:10.1128/MMBR.00041-13. 532 Burns, D.G., Janssen, P.H., Itoh, T., Kamekura, M., Li, Z., Jensen, G., et al. (2007). Haloquadratum 533 walsbyi gen. nov., sp. nov., the square haloarchaeon of Walsby, isolated from saltern 534 crystallizers in Australia and Spain. Int J Syst Evol Microbiol 57: 387–392. doi: 535 10.1099/ijs.0.64690-0. 536 Burns, D. G., Janssen, P. H., Itoh, T., Minegishi, H., Usami, R., Kamekura, M., et al. (2010). 537 Natronomonas moolapensis sp. nov., non-alkaliphilic isolates recovered from a solar saltern 538 crystallizer pond, and emended description of the genus Natronomonas. Int J Syst Evol Microbiol 539 60: 1173–1176. doi:10.1099/ijs.0.010132-0. 540 Bushnell, B. (2016). BBMap project. Walnut Creek, CA, U.S.A. 541 Cao, J., Barbosa, J. M., Singh, N. K., and Locy, R. D. (2013). GABA shunt mediates thermotolerance 542 in Saccharomyces cerevisiae by reducing reactive oxygen production. Yeast 30: 129–144. 543 doi:10.1002/yea.2948. 544 Capella-Gutiérrez, S., Silla-Martínez, J.M., Gabaldón, T. (2009). trimAl: a tool for automated 545 alignment trimming in large-scale phylogenetic analyses. Bioinformatics 25: 1972–1973. 546 doi:10.1093/bioinformatics/btp348. 547 24 Coleman, S. T., Fang, T. K., Rovinsky, S. A., Turano, F. J., and Moye-Rowley, W. S. (2001). 548 Expression of a glutamate decarboxylase homologue is required for normal oxidative stress 549 tolerance in Saccharomyces cerevisiae. J Biol Chem 276: 244-250. doi:10.1074/jbc.M00710320550 0. 551 Corcelli, A., and Lobasso, S. (2006). Characterization of lipids of halophilic archaea. Methods 552 Microbiol 25: 585–613. doi:10.1016/S0580-9517(08)70028-X. 553 Couvin, D., Bernheim, A., Toffano-Nioche, C., Touchon, M., Michalik, J., Néron, B., et al. (2018). 554 CRISPRCasFinder, an update of CRISRFinder, includes a portable version, enhanced performance 555 and integrates search for Cas proteins. Nucleic Acids Res 46: W246–W251. 556 doi:10.1093/nar/gky425. 557 Cray, J. A., Bell, A. N., Bhaganna, P., Mswaka, A. Y., Timson, D. J., and Hallsworth, J. E. (2013). 558 The biology of habitat dominance; can microbes behave as weeds? Microb Biotechnol 6: 453-559 492. doi:10.1111/1751-7915.12027. 560 DeLong, E. F. (1992). Archaea in coastal marine environments. Proc Natl Acad Sci U.S.A. 89: 561 5685–5689. doi:10.1073/PNAS.89.12.5685. 562 Durán-Viseras, A., Andrei, A.-S., Ghai, R., Sánchez-Porro, C., and Ventosa, A. (2019a). New 563 Halonotius species provide genomics-based insights into cobalamin synthesis in haloarchaea. 564 Front Microbiol 10: 1928. https://www.frontiersin.org/article/10.3389/fmicb.2019.01928. 565 Durán-Viseras, A., Ventosa, A., and Sánchez-Porro, C. (2019b). Halonotius aquaticus sp. nov., a 566 new haloarchaeon isolated from a marine saltern. Int J Syst Evol Microbiol 69: 1306-1312. 567 doi:10.1099/ijsem.0.003309. 568 Duschl, A., Lanyi, J. K., and Zimányi, L. (1990). Properties and photochemistry of a halorhodopsin 569 from the haloalkalophile, Natronobacterium pharaonis. J Biol Chem 265: 1261–1267. 570 http://www.ncbi.nlm.nih.gov/pubmed/2104838. 571 31 Paul, S., Bag, S. K., Das, S., Harvill, E. T., and Dutta, C. (2008). Molecular signature of hypersaline 713 adaptation: insights from genome and proteome composition of halophilic prokaryotes. 714 Genome Biol 9: R70. doi:10.1186/gb-2008-9-4-r70. 715 Plominsky, A.M., Delherbe, N., Ugalde, J.A., Allen, E.E., Blanchet, M., Ikeda, P., et al. (2014). 716 Metagenome sequencing of the microbial community of a solar saltern crystallizer pond at 717 Cahuil Lagoon, Chile. Genome Announc 2: pii: e01172-14. doi: 10.1128/genomeA.01172-14. 718 Podell, S., Ugalde, J. a., Narasingarao, P., Banfield, J. F., Heidelberg, K. B., and Allen, E. E. (2013). 719 Assembly-driven community genomics of a hypersaline microbial ecosystem. PLoS One 8: 720 e61692. doi:10.1371/journal.pone.0061692. 721 Podell, S., Emerson, J.B., Jones, C.M., Ugalde, J.A., Welch, S., Heidelberg, K.B., et al. (2014) 722 Seasonal fluctuations in ionic concentrations drive microbial succession in a hypersaline lake 723 community. ISME J 8: 979–990. 724 Price, M. N., Dehal, P. S., and Arkin, A. P. (2010). FastTree 2 – Approximately maximum-likelihood 725 trees for large alignments. PLoS One 5: e9490. doi:10.1371/journal.pone.0009490. 726 Pruesse, E., Quast, C., Knittel, K., Fuchs, B. M., Ludwig, W., Peplies, J., et al. (2007). SILVA: a 727 comprehensive online resource for quality checked and aligned ribosomal RNA sequence data 728 compatible with ARB. Nucleic Acids Res 35: 7188–7196. doi:10.1093/nar/gkm864. 729 Rappé, M. S., Connon, S. A., Vergin, K. L., and Giovannoni, S. J. (2002). Cultivation of the 730 ubiquitous SAR11 marine bacterioplankton clade. Nature 418: 630-633. doi:10.1038/nature00731 917. 732 Rice, P., Longden, L., and Bleasby, A. (2000). EMBOSS: The European Molecular Biology Open 733 Software Suite. Trends Genet 16: 276-277. doi:10.1016/S0168-9525(00)02024-2. 734 32 Richter, M., and Rosselló-Móra, R. (2009). Shifting the genomic gold standard for the 735 prokaryotic species definition. Proc Natl Acad Sci U.S.A. 106: 19126-19131. doi:10.1073/pnas.0736 906412106. 737 Rodriguez-Brito, B., Li, L., Wegley, L., Furlan, M., Angly, F., Breitbart, M., et al. (2010). Viral and 738 microbial community dynamics in four aquatic environments. ISME J 4: 739-751. 739 doi:10.1038/ismej.2010.1. 740 Schobert, B., and Lanyi, J. K. (1982). Halorhodopsin is a light-driven chloride pump. J Biol Chem 741 257: 10306–10313. 742 Seemann, T. (2014). Prokka: rapid prokaryotic genome annotation. Bioinformatics 30: 743 2068-2069. doi:10.1093/bioinformatics/btu153. 744 Sharma, A. K., Walsh, D. A., Bapteste, E., Rodriguez-Valera, F., Ford Doolittle, W., and Papke, R. 745 T. (2007). Evolution of rhodopsin ion pumps in haloarchaea. BMC Evol Biol 7: 79. 746 doi:10.1186/1471-2148-7-79. 747 Shelp, B. J., Bown, A. W., and McLean, M. D. (1999). Metabolism and functions of gamma-748 aminobutyric acid. Trends Plant Sci 4: 446–452. doi:10.1016/S1360-1385(99)01486-7. 749 Siragusa, S., De Angelis, M., Di Cagno, R., Rizzello, C. G., Coda, R., and Gobbetti, M. (2007). 750 Synthesis of aminobutyric acid by lactic acid bacteria isolated from a variety of Italian cheeses. 751 Appl Environ Microbiol 73: 7283–7290. doi:10.1128/AEM.01064-07. 752 Stackebrandt, E., and Goebel, B. M. (1994). Taxonomic note: a place for DNA-DNA reassociation 753 and 16S rRNA sequence analysis in the present species definition in bacteriology. Int J Syst Evol 754 Microbiol 44: 846–849. doi:10.1099/00207713-44-4-846. 755 Staley, J. T., and Konopka, A. (1985). Measurement of in situ activities of nonphotosynthetic 756 microorganisms in aquatic and terrestrial habitats. Annu Rev Microbiol 39: 321-346. doi:10.114757 6/annurev.mi.39.100185.001541. 758 33 Stevenson, A., Cray, J. A., Williams, J. P., Santos, R., Sahay, R., Neuenenkirchen, N., et al. (2015). 759 Is there a common water-activity limit for the three domains of life? ISME J 9: 1333-1351. 760 doi:10.1038/ismej.2014.219. 761 Sullivan, M. J., Petty, N. K., and Beatson, S. A. (2011). Easyfig: a genome comparison visualizer. 762 Bioinformatics 27: 1009–1010. doi:10.1093/bioinformatics/btr039. 763 Takahashi, T., Tomioka, H., Kamo, N., and Kobatake, Y. (1985). A photosystem other than PS370 764 also mediates the negative phototaxis of Halobacterium halobium. FEMS Microbiol Lett 28: 161–765 164. doi:10.1111/j.1574-6968.1985.tb00784.x. 766 Tamura, K., Stecher, G., Peterson, D., Filipski, A., and Kumar, S. (2013). MEGA6: Molecular 767 Evolutionary Genetics Analysis version 6.0. Mol Biol Evol 30: 2725-2729. doi:10.1093/molbev/768 mst197. 769 Tatusov, R.L., Natale, D.A., Garkavtsev, I.V., Tatusova, T.A., Shankavaram, U.T., Rao, B.S., et al. 770 (2001). The COG database: new developments in phylogenetic classification of proteins from 771 complete genomes. Nucleic Acids Res 29: 22–28. doi: 10.1093/nar/29.1.22. 772 Vartoukian, S. R., Palmer, R. M., and Wade, W. G. (2010). Strategies for culture of ‘unculturable’ 773 bacteria. FEMS Microbiol Lett 309: 1–7. doi:10.1111/j.1574-6968.2010.02000.x. 774 Ventosa, A., Fernández, A.B., León, M.J., Sánchez-Porro, C., and Rodríguez-Valera, F. (2014). The 775 Santa Pola saltern as a model for studying the microbiota of hypersaline environments. 776 Extremophiles 18: 811-824. doi:10.1007/s00792-014-0681-6. 777 Ventosa, A., de la Haba, R.R., Sánchez-Porro, C., and Papke, R.T. (2015). Microbial diversity of 778 hypersaline environments : a metagenomic approach. Curr Opin Microbiol 25: 80-87. doi:10.10779 16/j.mib.2015.05.002 780 34 Verchère, A., Ou, W. L., Ploier, B., Morizumi, T., Goren, M. A., Bütikofer, P., et al. (2017). 781 Light-independent phospholipid scramblase activity of bacteriorhodopsin from Halobacterium 782 salinarum. Sci Rep 7: 9255. doi:10.1038/s41598-017-09835-5. 783 Verhees, C. H., Kengen, S. W. M., Tuininga, J. E., Schut, G. J., Adams, M. W. W., de Vos, W. M., et 784 al. (2003). The unique features of glycolytic pathways in Archaea. Biochem J 375: 231–246. 785 doi:10.1042/bj20021472. 786 Wu, Z., Liu, J., Yang, H., and Xiang, H. (2014). DNA replication origins in archaea. Front Microbiol 787 5: 179. doi:10.3389/fmicb.2014.00179 788 789 790 791 35 Acknowledgements 792 We wish to thank A. Oren for his helpful advice on the nomenclature of the new taxa and K.N. 793 Timmis for his valuable comments. This study was supported by projects from Spanish Ministry 794 of Economy and Competitiveness (MINECO) (Project CGL2017-83385-P) and from Junta de 795 Andalucía (BIO-213; US-1263771), both with FEDER funds. ADV was recipient of a predoctoral 796 fellowship (FPU) from the Spanish Ministery of Education, Culture and Sports. R.G. was 797 supported by the research grant 17-04828 S (Grant Agency of the Czech Republic). A.-S.A. was 798 supported by the research grants: 17-04828 S (Grant Agency of the Czech Republic) and 799 MSM200961801 (Academy of Sciences of the Czech Republic). 800 801 Conflict of interest 802 The authors declare that there are no conflicts of interest. 803 804 Ethical statement 805 No experimental work with animals or human has been carried out in this study. 806 807 36 Legends to figures 808 Figure. 1. Maximum-likelihood phylogenomic tree based on the alignment of 299 shared 809 orthologous genes, obtained from the genome of all the species included in the tree whose 810 sequence accession numbers are shown in parentheses. Bar, 0.1 substitution per nucleotide 811 position. Red circles highlight Bootstrap/UFBootstrap values lower than 50, the yellow ones 812 between 50 and 80 and green color is used to depict values higher than 80. The trees were 813 rooted using the DPANN representatives Candidatus Nanosalinarum J07AB56 and Candidatus 814 Nanosalina J07AB43. 815 Figure 2. Alignment and genomic comparison of strains F12-1T, F17-44T, F18-79 and F19-13 816 genomes. Comparison made with BLASTN with 50 bp alignment length and > 85% similarity. 817 Similarity values are represented by the color key histograms on the bottom panels. 818 Figure 3. Circular DNA plots of the sequenced genomes. A) Strain F12-1T, B) strain F17-44T, C) 819 strain F18-79 and D) strain F19-13. Circles denote from the outside to inside: contigs 820 representation where numbers indicate the size in kb; in the second line in black, tRNAs are 821 represented while rRNAs in the third; G+C content (light green, above average; salmon, below 822 average); GC skew (blue, above average; red, below average); coverage (green, above average; 823 violet, below average). For G+C content, GC skew and coverage a window size of 1000 bp was 824 used. Red square indicates the cluster of genes amplified in figures E) strain F12-1T and F) strain 825 F18-79. 826 Figure 4. Percentage of rRNA sequences related to Euryarchaeota and the four new strains 827 recovered from 18 shotgun metagenomes. The metagenomic datasets are ordered by salinity 828 gradient. 829 Abbreviations: G - Metagenome from lake Meyghan (Iran), 5 % (w/v) total salts (ERS1455389); 830 ChVmed – Metagenome from Chula Vista saltern (California, EEUU), 12 % (w/v) total salts 831 (4440425); SS13 – Metagenome from Santa Pola solar saltern (Alicante, Spain), 13 % (w/v) total 832 salts (SRX328504); R – Metagenome from lake Meyghan (Iran), 18 % (w/v) total salts 833 (ERS1455390); Kebrit-DUI – Metagenome from deep-sea brine pool of the Kebrit Deep (Red Sea), 834 18.2 % (w/v) total salts (3300006156); Kebrit-DLI – Metagenome from deep-sea brine pool of 835 the Kebrit Deep (Red Sea), 18.2 % (w/v) total salts (3300006157); SS19 – Metagenome from 836 Santa Pola solar saltern (Alicante, Spain), 19 % (w/v) total salts (SRX090228); IC21 – Metagenome 837 from Isla Cristina solar saltern (Huelva, Spain), 21 % (w/v) total salts (SRX352042); ChVhigh1 – 838 Metagenome from Chula Vista saltern (California, EEUU), 27 % (w/v) total salts (4440430); 839 ChVhigh2 – Metagenome from Chula Vista saltern (California, EEUU), 27 % (w/v) total salts 840 (4440429); ChVhigh4 – Metagenome from Chula Vista saltern (California, EEUU), 27 % (w/v) 841 total salts (4440438); Tyrrell 0.1 – Metagenome from Lake Tyrrell (Victoria, Australia), 29 % (w/v) 842 total salts (SRR5637210); Tyrrell 0.8 – Metagenome from Lake Tyrrell (Victoria, Australia), 29 % 843 (w/v) total salts (SRR5637211); S7 – Metagenome from Fara Fund hypersaline meromictic lake, 844 30 % (w/v) total salts (SRR8921445); W - Metagenome from lake Meyghan (Iran), 30 % (w/v) 845 total salts (ERS1455391); SS33 – Metagenome from Santa Pola solar saltern (Alicante, Spain), 33 846 % (w/v) total salts (SRX347883); Cahuill – Metagenome from Cahuil lagoon (Chile), 34 % (w/v) 847 total salts (SRX680116); SS37 – Metagenome from Santa Pola solar saltern (Alicante, Spain), 37 848 % (w/v) total salts (SRX090229). 849 Figure 5. Recruitment plots of the new strains. A) – D) Recruitment plots of strain F12-1T against 850 different hypersaline habitats, ordered by salinity gradient. E) – H) Recruitment plots of strain 851 37 F17-44T against different hypersaline habitats, ordered by salinity gradient. In each panel the Y 852 axis represents the identity percentage and X axis represents the genome length. A restrictive 853 cut-off 95 % of nucleotide identity in at least 30 bp of the metagenomic read was used. The black 854 dashed line shows the threshold for presence of same species (95 % identity). 855 Abbreviations: R – Metagenome from lake Meyghan (Iran), 18 % (w/v) total salts (ERS1455390); 856 SS19 – Metagenome from Santa Pola solar saltern (Alicante, Spain), 19 % (w/v) total salts 857 (SRX090228); IC21 – Metagenome from Isla Cristina solar saltern (Huelva, Spain), 21 % (w/v) 858 total salts (SRX352042); ChVhigh1 – Metagenome from Chula Vista saltern (California, EEUU), 27 859 % (w/v) total salts (4440430). 860 Figure 6. Metabolic reconstruction of the newly isolates 861 The green box highlights glycolysis (Embden-Meyerhof-Parnas). The blue depicts the 862 tricarboxylic acid cycle (TCA); pink color corresponds to isoprenoid biosynthesis: C5 isoprenoid 863 (dark) and C10-C20 isoprenoid (light). The violet box corresponds to glyoxylate cycle and orange 864 to the urea. The green panel depicts the 4-aminobutanoate (GABA) biosynthesis pathway. 865 Transparency was used to show the inferred components of the complex III of electron transport 866 chain. Grey is used for genes not present in the studied genomes. Abbreviations: BCAA – 867 branched-chain amino acid, HMP – hydroxymethylpyrimidine and TCA – tricarboxylic acid cycle. 868 Supplementary Figure. 1. Phylogenetic analysis. A) Maximum-likelihood phylogenetic tree 869 based on the 16S rRNA gene sequences. Bar, 0.01 substitutions per nucleotide position. B) 870 Maximum-likelihood phylogenetic tree based on amino acid sequences of the rpoB´ genes. Bar, 871 0.1 substitution per nucleotide position. 872 Sequence accession numbers are shown in parentheses. Red circles highlight 873 Bootstrap/UFBootstrap values lower than 50, the yellow ones between 50 and 80 and green 874 color is used to depict values higher than 80. DPANN representatives Candidatus Nanosalinarum 875 J07AB56 and Candidatus Nanosalina J07AB43 were used as outgroup. 876 Supplementary Figure 2. Hierarchical clustering relationships between isolated strains genomes 877 (F12-1T, F17-44T, F18-79 and F19-13), Natronomonas moolapensis 8.8.11T and Natronomonas 878 pharaonis DSM 2160T genomes. Average Nucleotide Identities (ANI) and Amino Acid Identities 879 (AAI), calculated as indicated on experimental procedures by the comparison of the genomes, 880 are represented by a heat map matrix, where similarity values are represented by the color key 881 histogram on the upper panel. 882 Supplementary Figure 3. Recruitment plots of strain F12-1T against different metagenomic 883 datasets. 884 A-N) Recruitment plots of strains F12-1T against different metagenomic datasets ordered by 885 salinity gradient. In each panel the Y axis represents the identity percentage and X axis 886 represents the genome length. A restrictive cut-off 95 % of nucleotide identity in at least 30 bp 887 of the metagenomic read was used. The black dashed line shows the threshold for presence of 888 same species (95 % identity). 889 Abbreviations: G - Metagenome from lake Meyghan (Iran), 5 % (w/v) total salts (ERS1455389); 890 ChVmed – Metagenome from Chula Vista saltern (California, EEUU), 12 % (w/v) total salts 891 (4440425); SS13 – Metagenome from Santa Pola solar saltern (Alicante, Spain), 13 % (w/v) total 892 salts (SRX328504); Kebrit-DUI – Metagenome from deep-sea brine pool of the Kebrit Deep (Red 893 Sea), 18.2 % (w/v) total salts (3300006156); Kebrit-DLI – Metagenome from deep-sea brine pool 894 38 of the Kebrit Deep (Red Sea), 18.2 % (w/v) total salts (3300006157); ChVhigh2 – Metagenome 895 from Chula Vista saltern (California, EEUU), 27 % (w/v) total salts (4440429); ChVhigh4 – 896 Metagenome from Chula Vista saltern (California, EEUU), 27 % (w/v) total salts (4440438); 897 Tyrrell 0.1 – Metagenome from Lake Tyrrell (Victoria, Australia), 29 % (w/v) total salts 898 (SRR5637210); Tyrrell 0.8 – Metagenome from Lake Tyrrell (Victoria, Australia), 29 % (w/v) total 899 salts (SRR5637211); S7 – Metagenome from Fara Fund hypersaline meromictic lake, 30 % (w/v) 900 total salts (SRR8921445); W - Metagenome from lake Meyghan (Iran), 30 % (w/v) total salts 901 (ERS1455391); SS33 – Metagenome from Santa Pola solar saltern (Alicante, Spain), 33 % (w/v) 902 total salts (SRX347883); Cahuill – Metagenome from Cahuil lagoon (Chile), 34 % (w/v) total salts 903 (SRX680116); SS37 – Metagenome from Santa Pola solar saltern (Alicante, Spain), 37 % (w/v) 904 total salts (SRX090229). 905 Supplementary Figure 4. Recruitment plots of strain F17-44T against different metagenomic 906 datasets. 907 A-N) Recruitment plots of strains F17-44T against different metagenomic datasets ordered by 908 salinity gradient. In each panel the Y axis represents the identity percentage and X axis 909 represents the genome length. A restrictive cut-off 95 % of nucleotide identity in at least 30 bp 910 of the metagenomic read was used. The black dashed line shows the threshold for presence of 911 same species (95 % identity). 912 Abbreviations: G - Metagenome from lake Meyghan (Iran), 5 % (w/v) total salts (ERS1455389); 913 ChVmed – Metagenome from Chula Vista saltern (California, EEUU), 12 % (w/v) total salts 914 (4440425); SS13 – Metagenome from Santa Pola solar saltern (Alicante, Spain), 13 % (w/v) total 915 salts (SRX328504); Kebrit-DUI – Metagenome from deep-sea brine pool of the Kebrit Deep (Red 916 Sea), 18.2 % (w/v) total salts (3300006156); Kebrit-DLI – Metagenome from deep-sea brine pool 917 of the Kebrit Deep (Red Sea), 18.2 % (w/v) total salts (3300006157); ChVhigh2 – Metagenome 918 from Chula Vista saltern (California, EEUU), 27 % (w/v) total salts (4440429); ChVhigh4 – 919 Metagenome from Chula Vista saltern (California, EEUU), 27 % (w/v) total salts (4440438); 920 Tyrrell 0.1 – Metagenome from Lake Tyrrell (Victoria, Australia), 29 % (w/v) total salts 921 (SRR5637210); Tyrrell 0.8 – Metagenome from Lake Tyrrell (Victoria, Australia), 29 % (w/v) total 922 salts (SRR5637211); S7 – Metagenome from Fara Fund hypersaline meromictic lake, 30 % (w/v) 923 total salts (SRR8921445); W - Metagenome from lake Meyghan (Iran), 30 % (w/v) total salts 924 (ERS1455391); SS33 – Metagenome from Santa Pola solar saltern (Alicante, Spain), 33 % (w/v) 925 total salts (SRX347883); Cahuill – Metagenome from Cahuil lagoon (Chile), 34 % (w/v) total salts 926 (SRX680116); SS37 – Metagenome from Santa Pola solar saltern (Alicante, Spain), 37 % (w/v) 927 total salts (SRX090229). 928 Supplementary Figure 5. A) Comparison of isoelectric point of predicted proteins for the four 929 new strains and other prokaryotic species, computed for each translated genome and shown as 930 a percentage of distribution. B) Frequency of amino acids of the predicted proteins for the four 931 new strains and other prokaryotic species, computed for each translated genome. 932 Supplementary Figure 6. A) Alignment comparison of rhodopsin protein sequence from the four 933 new strains and other haloarchaea. Sequences corresponding to the four new strains are 934 highlighted in boldface. The pink box shows the position 199 of the rhodopsin alignment. The 935 leucine (L) variant absorbs maximally in the green spectrum. B) Maximum-likelihood 936 phylogenetic tree constructed using 220 rhodopsins sequences. Boxes were used to highlight 937 rhodopsin sequences belonging to the new isolates and Natronomonas (see box at bottom right 938 side of the figure). Bootstrap values on nodes are indicated by colored circles. Red circles show 939 39 values lower than 50, the yellow ones between 50 and 80; green color is used to depict values 940 higher than 80. 941 Supplementary Figure 7. Comparison of the polar lipids profile between strains F12-1T, F17-44T, 942 F18-79 and F19-13 and some other haloarchaeal species by High Performance Thin Layer 943 Chromatography (HPTLC). The plate was revealed with sulfuric acid 5 % (v/v) in water, followed 944 charred by heating at 160 °C. Lanes: 1, Halobacterium salinarum DSM 3754T; 2, strain F17-44T; 945 3, strain F12-1T; 4, strain F18-79; 5, strain F19-13; 6, Natronomonas moolapensis CECT 7526T; 7, 946 Natronomonas pharaonis CECT 4578T; 8, Halorubrum saccharovorum DSM 1137T 947 Abbreviations: BPG, biphosphatidylglycerol; PG, phosphatidylglycerol; PGP-Me, 948 phosphatidylglycerol phosphate methyl ester; PGS, phosphatidylglycerol sulfate; S-DGD-1, 949 sulfated diglycosil diether; S-TGD-1-PA, glycocardiolipin (sulfated triglycosyl diphytanyl archaeol 950 ester linked to phosphatidic acid); S-TeGD, sulfated tetraglycosil diether. 951 Supplementary Figure 8. A) Phase-contrast photomicrograph of cells of Halosegnis longus sp. 952 nov. F12-1T cultured in liquid medium under optimal conditions. Scale bar, 10 μm. B) Phase-953 contrast photomicrograph of cells of Halosegnis rubeus sp. nov. F17-44T cultured in liquid 954 medium under optimal conditions. Scale bar, 10 μm. 955 40 Table 1. Characteristics of sequenced genomes of the four new isolates 956 Feature Strain F12-1T Strain F17-44T Strain F18-79 Strain F19-13 Size (Mb) 2.5 2.4 2.4 2.4 Contigs 1 10 10 16 Completeness (%) 99.6 99.5 99.5 99.5 G+C (mol%) 66.0 65.1 64.7 64.8 N50 (bp) 2451061 553928 520506 373060 Protein coding genes 2977 2808 2595 2607 rRNA 3 3 3 3 tRNA 45 46 44 44 Accession number QKNW00000000 QJOW00000000 QKKZ00000000 QMDY00000000 957 80 - 100 50 - 80 < 50 Bootstraps T Halorientalis regularis IBRC-M 10760 rrnB (jgi. 1084694) T Halorientalis regularis TNN28 rrnA (GQ282621) T Halapricum salinum CBA1105 (KF314042) T Halorhabdus utahensis DSM 12940 (AF071880) T Halovenus aranensis EB27 (HQ197980) T Halosimplex carlsbadense 2.9.1 (AB072815) T Haloarcula vallismortis CGMCC1.2048 rrnB (EF645688) T Halomicroarcula pellucida BNERC31 rrnB (AB766180) T Haloarcula vallismortis CGMCC1.2048 rrnA (EF645687) T Halomicroarcula pellucida BNERC31 rrnA (AB766179) T Halomicrobium mukohataei JCM 9738 (EF645690) F18−79 (MH424603) F19−13 (MH424602) T F17−44 (MH422499) T F12−1 (MH424598) T Natronomonas moolapensis 8.8.11 (NR_102519) T Natronomonas pharaonis DSM 2160 (NR_074179) T Natronomonas gomsonensis SA3 (JF950943) T Halobacterium salinarum DSM 33754 (AJ496185) T Halarchaeum acidiphilum MH1-52-1 (AB371717) T Salarchaeum japonicum YSM-79 (NR_112809) T Halomarina oriensis KeC-11 (AB519798) T Salinirubrum litoreum XD46 (JQ237118) T Haloarchaeobius iranensis EB21 rrnA (NR_118118) T Haloarchaeobius iranensis EB21 rrnA (NR_118119) T Halorubellus salinus GX3 (NR_117949) T Haladaptatus paucihalophilus DX253 (DQ344973) T Halorussus rarus TBN4 (NR_117277) T Halalkalicoccus tibetensis DS12 (AF435112) T Halococcus morrhuae DSM 1307 (D11106) T Natronoarchaeum mannanilyticum YSM-123 (AB501361) 0.01 T Salarchaeum japonicum YSM-79 (AB550269) T Halarchaeum acidiphilum JCM 16109 (AB550268) T Halobacterium salinarum JCM 8978 (AB477150) T Halorubellus litoreus GX26 (JN164653) T Haloarchaeobius iranensis IBRC-M 10013 (KF921088) T Halorussus rarus JCM 16429 (AB810022) T Halalkalicoccus tibetensis JCM11890 (AB477141) T Natronoarchaeum mannanilyticum YSM-123 (JN164656) T Halomicrobium mukohataei JCM 9738 (AB477172) T Halomarina oriensis JCM 16495 (KJ870934) T Salinirubrum litoreum XD46 (KF316330) T Haladaptatus paucihalophilus JCM 13897 (AB477139) T Halococcus morrhuae JCM 8876 (HQ149484) T Halovenus aranensis CGMCC 1.11001 (KJ534550) T Natronomonas gomsonensis SA3 (KF051183) T Natronomonas pharaonis ATCC 35678 (AJ809526) T Natronomonas moolapensis JCM 14361 (LC382257) T F12−1 (MH454088) F18−79 (MH454089) T F17−44 (MH428007) F19−13 (MH561741) T Halomicroarcula pellucida BNERC31 (AB771578) T Haloarcula vallismortis JCM 8877 (AB477148) T Halapricum salinum CBA1105 (KJ364599) T Halorhabdus utahensis JCM 11049 (AB477175) T Halosimplex carlsbadense JCM 11222 (AB477192) 0.1 T Halorientalis regularis TNN28 (KF434758) 80 - 100 50 - 80 < 50 Bootstraps 60 70 80 90 100 % Identity 00.5 1.0 01.5 2.0 2.5 Genome Length (Mb) 60 70 80 90 100 % Identity 00.5 1.0 01.5 2.0 2.5 Genome Length (Mb) 60 70 80 90 100 % Identity 00.5 1.0 01.5 2.0 2.5 Genome Length (Mb) 60 70 80 90 100 % Identity 00.5 1.0 01.5 2.0 2.5 Genome Length (Mb) 60 70 80 90 100 % Identity 00.5 1.0 01.5 2.0 2.5 Genome Length (Mb) 60 70 80 90 100 % Identity 00.5 1.0 01.5 2.0 2.5 Genome Length (Mb) T F12-1 in G AA T F12-1 in ChVmed B T F12-1 in SS13 C T F12-1 in Kebrit-DUI D T F12-1 in Kebrit-DLI F 60 70 80 90 100 % Identity 00.5 1.0 01.5 2.0 2.5 Genome Length (Mb) T F12-1 in ChVhigh2 60 70 80 90 100 % Identity 00.5 1.0 01.5 2.0 2.5 Genome Length (Mb) E T F12-1 in Tyrrell_0.1 T F12-1 in Tyrrell_0.8 I 60 70 80 90 100 % Identity 00.5 1.0 01.5 2.0 2.5 Genome Length (Mb) T F12-1 in S7 J T F12-1 in Cahuill M 60 70 80 90 100 % Identity 00.5 1.0 01.5 2.0 2.5 Genome Length (Mb) H 60 70 80 90 100 % Identity 00.5 1.0 01.5 2.0 2.5 Genome Length (Mb) T F12-1 in W K 60 70 80 90 100 % Identity 00.5 1.0 01.5 2.0 2.5 Genome Length (Mb) 60 70 80 90 100 % Identity 00.5 1.0 01.5 2.0 2.5 Genome Length (Mb) T F12-1 in SS33 L T F12-1 in SS37 T F12-1 in ChVhigh4 N 60 70 80 90 100 % Identity 00.5 1.0 01.5 2.0 2.5 Genome Length (Mb) 60 70 80 90 100 % Identity 00.5 1.0 01.5 2.0 2.5 Genome Length (Mb) G 60 70 80 90 100 % Identity 00.5 1.0 01.5 2.0 2.5 Genome Length (Mb) 60 70 80 90 100 % Identity 00.5 1.0 01.5 2.0 2.5 Genome Length (Mb) 60 70 80 90 100 % Identity 00.5 1.0 01.5 2.0 2.5 Genome Length (Mb) 60 70 80 90 100 % Identity 00.5 1.0 01.5 2.0 2.5 Genome Length (Mb) T F17-44 in G AA 60 70 80 90 100 % Identity 00.5 1.0 01.5 2.0 2.5 Genome Length (Mb) 60 70 80 90 100 % Identity 00.5 1.0 01.5 2.0 2.5 Genome Length (Mb) T F17-44 in ChVmed B 60 70 80 90 100 % Identity 00.5 1.0 01.5 2.0 2.5 Genome Length (Mb) 60 70 80 90 100 % Identity 00.5 1.0 01.5 2.0 2.5 Genome Length (Mb) T F17-44 in SS13 C 60 70 80 90 100 % Identity 00.5 1.0 01.5 2.0 2.5 Genome Length (Mb) 60 70 80 90 100 % Identity 00.5 1.0 01.5 2.0 2.5 Genome Length (Mb) T F17-44 in Kebrit-DUI D T F17-44 in Kebrit-DLI F T F17-44 in ChVhigh2 60 70 80 90 100 % Identity 00.5 1.0 01.5 2.0 2.5 Genome Length (Mb) 60 70 80 90 100 % Identity 00.5 1.0 01.5 2.0 2.5 Genome Length (Mb) E T F17-44 in Tyrrell_0.1 60 70 80 90 100 % Identity 00.5 1.0 01.5 2.0 2.5 Genome Length (Mb) 60 70 80 90 100 % Identity 00.5 1.0 01.5 2.0 2.5 Genome Length (Mb) T F17-44 in Tyrrell_0.8 I T F17-44 in S7 60 70 80 90 100 % Identity 00.5 1.0 01.5 2.0 2.5 Genome Length (Mb) 60 70 80 90 100 % Identity 00.5 1.0 01.5 2.0 2.5 Genome Length (Mb) 60 70 80 90 100 % Identity 00.5 1.0 01.5 2.0 2.5 Genome Length (Mb) 60 70 80 90 100 % Identity 00.5 1.0 01.5 2.0 2.5 Genome Length (Mb) H T F17-44 in W K 60 70 80 90 100 % Identity 00.5 1.0 01.5 2.0 2.5 Genome Length (Mb) 60 70 80 90 100 % Identity 00.5 1.0 01.5 2.0 2.5 Genome Length (Mb) 60 70 80 90 100 % Identity 00.5 1.0 01.5 2.0 2.5 Genome Length (Mb) 60 70 80 90 100 % Identity 00.5 1.0 01.5 2.0 2.5 Genome Length (Mb) T F17-44 in SS33 L 60 70 80 90 100 % Identity 00.5 1.0 01.5 2.0 2.5 Genome Length (Mb) 60 70 80 90 100 % Identity 00.5 1.0 01.5 2.0 2.5 Genome Length (Mb) J 60 70 80 90 100 % Identity 00.5 1.0 01.5 2.0 2.5 Genome Length (Mb) 60 70 80 90 100 % Identity 00.5 1.0 01.5 2.0 2.5 Genome Length (Mb) T F17-44 in Cahuill M T F17-44 in SS37 N 60 70 80 90 100 % Identity 00.5 1.0 01.5 2.0 2.5 Genome Length (Mb) 60 70 80 90 100 % Identity 00.5 1.0 01.5 2.0 2.5 Genome Length (Mb) G T F17-44 in ChVhigh4 Supplementary Table 1. Origin recognition boxes (ORBs) identified for genomes of strains F12- 1T and F18-79 Genomic position (nt) Sequence Length (pb) p-value ORB1 F12-1T 1128943-1128965 1129107-1129129 CGACGCCCTTATACGTAACAGG 22 7.35E-12 ORB2 F12-1T 1129017-1129036 1129100-1129119 TCCAATCCGACGCCCTTAT 19 1.76E-10 ORB1 F18-79 689558-689580 689641-689660 CCAATCCGACGCCCTTATACGT 22 3.00E-12 Supplementary Table 2. Metagenomic datasets from hypersaline habitats used in this study Database Name Habitat Salinity (% NaCl) Accesion number Reference G Lake 5 ERS1455389 Naghoni et al. (2017) ChVmed Saltern 12 4440425.3 Rodríguez-Brito et al. (2010) SS13 Saltern 13 SRX328504 Fernández et al. (2014a) R Lake 18 ERS1455390 Naghoni et al. (2017) Kebrit DUI Deep-sea brine pool 18.2 3300006156 Ngugi et al. (2015) Kebrit DLI Deep-sea brine pool 18.2 3300006157 Ngugi et al. (2015) SS19 Saltern 19 SRX090228 Ghai et al. (2011) IC21 Saltern 21 SRX352042 Fernández et al. (2014b) ChVhigh1 Saltern 27 4440430.3 Rodríguez-Brito et al. (2010) ChVhigh2 Saltern 27 4440429.3 Rodríguez-Brito et al. (2010) ChVhigh4 Saltern 27 4440438.3 Rodríguez-Brito et al. (2010) Tyrrell 0.1 Lake 29 SRR5637210 Podell et al. (2014) Tyrrell 0.8 Lake 29 SRR5637211 Podell et al. (2014) S7 Lake 30 SRR8921445 Unpublished W Lake 30 ERS1455391 Naghoni et al. (2017) SS33 Saltern 33 SRX347883 Fernández et al. (2014a) Cahuill Lagoon 34 SRX680116 Plominsky et al. (2014) SS37 Saltern 37 SRX090229 Ghai et al. (2011) Supplementary Table 3. Differential phenotypic features of strains F12-1T, F17-44T, F18-79 and F19-13. All strains were unable to grow under anaerobic conditions in the presence of arginine, KNO3 or DMSO. All strains were catalase positive and oxidase negative and unable to reduce nitrate and nitrite. Voges Proskauer and urea test were negative for all strains. Indol was not produced by any studied strain. Aesculin and starch are not hydrolized. Acid is produced for all strains from D-xylose, but not from glycerol, dulcitol, D-galactose, lactose, D-maltose, D-melezitose, D-raffinose, sucrose, D-trehalose and L-xylitol. D- arabinose, D-celobiose, D-glucose, lactose, D-manose, ribose, sucrose, D-trehalose, D-xylose, salicin, xylitol, benzoate, citrate, valerate, hypurate and malate were not used for any strain as sole carbon and energy source. L-methionine and isoleucine were not used for any strain as sole carbon, nitrogen and energy source. All data are from this study. +, positive; -, negative; w, weakly positive. Lines: 1, strain F12-1T; 2, strain F7-44T; 3, strain F18-79; 4, strain F19-13. Characteristics 1 2 3 4 Cell morphology Rods Rods Rods Rods Cell motility - - - - Cell size (µm) 5-10 x 0.2-0.4 0.5-1.5 x 0.2-0.3 1-2 x 0.4-0.7 1-3 x 0.3-0.6 Colony pigmentation Light red Red Red Red Colony size (mm) 0.5 0.5 0.3 1 NaCl (%/ w/v) range 15-25 15-30 10-30 15-25 NaCl (%/ w/v) optimum 25 25 25-30 25 Temperature range for growth (°C) 25-45 30-50 30-50 30-50 Optimum temperature for growth (°C) 37 37 37 37 pH range 6-8.5 6.5-8.5 7-8 6-7.5 pH optimum 7.5 7.5 7 7.5 Methyl Red Test w - - + Gelatin hidrolysis - - - + Production of acids from carbohydrates: D-Amygdalin - - w - D,L-Arabinose - + w w Arbutin - - w - L-Citrulline - - w w D-Fructose - - + + D-Glucose w w - - D-Mannitol - - + - Sorbitol - - w - Utilization as sole carbon and energy source: Fructose + - - - D-Galactose - - - + Maltose + + + - D-Melibiose - - + + L-Raffinose + - - - D-Melezitose - + - - Butanol - - - + Dulcitol - - + + Ethanol - - + - Glycerol - + + - D-Mannitol - + + - D-Sorbitol - - - + Methanol - + - +