scieee AI-readable full text Open interactive document viewer

Donor-derived IL-17A and IL-17F deficiency triggers Th1 allo-responses and increases gut leakage during acute GVHD.

Odak, Ivan,Depkat-Jakob, Alina,Beck, Maleen,Jarek, Michael,Yu, Yan,Seidler, Ursula,David, Sascha,Ganser, Arnold,Förster, Reinhold,Prinz, Immo,Koenecke, Christian

Abstract

s Metrics Comments Media Coverage Abstract Introduction Material and methods Results Discussion Supporting information Acknowledgments References Reader Comments (0) Media Coverage (0) Figures Abstract IL-17A and IL-17F cytokines are important regulators of acute graft-versus-host-disease (GVHD). However, contrary effects of these cytokines in inflammatory diseases have been reported. To investigate the effects of donor-derived IL-17A and IL-17F on GVHD, we made use of single (Il17a-/- or Il17f-/-) and double deficient (Il17af-/-) allogeneic donor CD4+ T cells. We could demonstrate that transplantation of Il17af-/- CD4+ donor T cells led to aggravated GVHD. However, this phenotype was not observed after transplantation of single, Il17a-/- or Il17f-/-, deficient CD4+ T cells, suggesting redundant effects of IL-17A and IL-17F. Moreover, Il17af-/- cell recipients showed an increase of systemic IFNγ, indicating a heightened pro-inflammatory state, as well as infiltration of IFNγ-secreting CD4+ T cells in the recipients’ intestinal tract. These recipients exhibited significant gut leakage, and markedly macrophage infiltration in the gastrointestinal epithelial layer. Moreover, we saw evidence of impaired recovery of gut epithelial cells in recipients of Il17af-/- CD4+ T cells. In this study, we show that IL-17A/F double deficiency of donor CD4+ T cells leads to accelerated GVHD and therefore highlight the importance of these cytokines. Together, IL-17 cytokines might serve as a brake to an intensified Th1 response, leading to the exacerbated gut damage in acute GVHD.

Full text

RESEARCH ARTICLE Donor-derived IL-17A and IL-17F deficiency triggers Th1 allo-responses and increases gut leakage during acute GVHD Ivan OdakID 1☯ , Alina Depkat-Jakob 1☯ , Maleen Beck 2 , Michael Jarek 3 , Yan Yu 4 , Ursula Seidler 4 , Sascha David 5 , Arnold Ganser 2 , Reinhold Fo ¨rster 1 , Immo Prinz 1☯ , Christian KoeneckeID 1,2☯ * 1Institute of Immunology, Hannover Medical School, Hannover, Germany, 2Department of Hematology, Hemostasis, Oncology and Stem-Cell Transplantation, Hannover Medical School, Hannover, Germany, 3Helmholtz Center for Infection Research, Braunschweig, Germany, 4Department of Gastroenterology, Hepatology and Endocrinology, Hannover Medical School, Hannover, Germany, 5Department of Nephrology, Hannover Medical School, Hannover, Germany ☯These authors contributed equally to this work. *[email protected] Abstract IL-17A and IL-17F cytokines are important regulators of acute graft-versus-host-disease (GVHD). However, contrary effects of these cytokines in inflammatory diseases have been reported. To investigate the effects of donor-derived IL-17A and IL-17F on GVHD, we made use of single (Il17a -/- or Il17f -/- ) and double deficient (Il17af -/- ) allogeneic donor CD4 + T cells. We could demonstrate that transplantation of Il17af -/- CD4 + donor T cells led to aggravated GVHD. However, this phenotype was not observed after transplantation of single, Il17a -/- or Il17f -/- , deficient CD4 + T cells, suggesting redundant effects of IL-17A and IL-17F. Moreover, Il17af -/- cell recipients showed an increase of systemic IFNγ, indicating a heightened proinflammatory state, as well as infiltration of IFNγ-secreting CD4 + T cells in the recipients’ intestinal tract. These recipients exhibited significant gut leakage, and markedly macrophage infiltration in the gastrointestinal epithelial layer. Moreover, we saw evidence of impaired recovery of gut epithelial cells in recipients of Il17af -/- CD4 + T cells. In this study, we show that IL-17A/F double deficiency of donor CD4 + T cells leads to accelerated GVHD and therefore highlight the importance of these cytokines. Together, IL-17 cytokines might serve as a brake to an intensified Th1 response, leading to the exacerbated gut damage in acute GVHD. Introduction Acute Graft-versus-Host disease (GVHD) is still a major cause of non-relapse-related mortality after allogeneic hematopoietic stem-cell or bone marrow transplantation (BMT) [1]. The current standard of care for higher grade GVHD is the systemic use of steroids. Further therapeutic options, especially for steroid-refractory GVHD are sparse [2]. Therefore, identification of new therapeutic targets both for prophylaxis and treatment of GVHD are needed. Allogeneic donor lymphocytes induce and orchestrate this highly inflammatory disease in the lympho-hematopoietic compartment and in GVHD target organs, respectively. In particular PLOS ONE PLOS ONE | https://doi.org/10.1371/journal.pone.0231222 April 6, 2020 1 / 16 a1111111111 a1111111111 a1111111111 a1111111111 a1111111111 OPEN ACCESS Citation: Odak I, Depkat-Jakob A, Beck M, Jarek M, Yu Y, Seidler U, et al. (2020) Donor-derived IL-17A and IL-17F deficiency triggers Th1 allo-responses and increases gut leakage during acute GVHD. PLoS ONE 15(4): e0231222. https://doi.org/ 10.1371/journal.pone.0231222 Editor: Pierre Bobe ´, Universite Paris-Sud, FRANCE Received: December 10, 2019 Accepted: March 18, 2020 Published: April 6, 2020 Copyright: ©2020 Odak et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Data Availability Statement: All relevant data are within the paper and its Supporting Information files. Funding: This work was supported by Deutsche Forschungsgemeinschaft: SFB738/A8 to C.K. and SFB900/B8 to C.K. and I.P. The funder had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. Competing interests: The authors have declared that no competing interests exist. CD4 + T cells show a high degree of plasticity in the course of the disease [3]. Functional roles for Th1, Th2 and regulatory T cells (Tregs) are well known in GVHD [4,5]. However, the exact role of IL-17 and Th17 cell responses in acute GVHD is less clear. The subset of CD4 + T cells termed Th17 cells is characterized by production of its signature cytokine IL-17A. However, the IL-17 cytokine family comprises IL-17A, IL-17B, IL-17C, IL17D, IL-17E and IL-17F, all having a similar protein structure and sharing between 62% to 88% of homology of murine to human [6]. The corresponding IL-17 receptor family consists of five members, IL-17RA, IL-17RB, IL-17RC, IL-17RD and IL-17RE. IL-17RA forms a heterodimer with IL-17RC, which together binds IL-17A dimers, IL-17F dimers, as well as IL-17A:IL17F heterodimers [7,8]. IL-17A and IL-17F share 55% homology on the amino acid level, and are syntenic both in mice and humans [9]. Both cytokines are involved in anti-fungal, bacterial and allergic immune responses [10,11]. However, despite the apparent similarities, there is evidence for distinct roles of the two cytokines in immunity [12]. Depending on the experimental model, IL-17 cytokines IL-17A and IL-17F may exert either pathogenic or protective effects, e.g. promoting respiratory allergy [11] or mediating protection in nephritis [13]. To date, Janus-head roles taken by Th17 and associated cytokines such as IL-17A and IL-22 during acute GVHD have been documented [14] In one study, IL-17A deficiency led to disease reduction [15], whereas another study showed that the absence of IL-17Asecreting cells exacerbated GVHD [16]. However, experimental setups and GVHD models differed in those studies. IL-17A is proposed to exert a protective role during gut-inflammation by limiting excessive permeability and thereby maintaining barrier integrity [17,18]. Another protective role in colitis model has been attributed to IL-17A by forcing the expression of Th1associated responses [19]. Since excessive endothelial and epithelial permeability is one of the prerequisites for acute GVHD [20], we hypothesized that donor-derived IL-17 cytokines exert a protective role in acute GVHD. In this study, we dissect the role of donor-derived IL-17A and IL-17F for endothelial and epithelial permeability in an experimental acute GVHD model using single- (Il17a -/- ,Il17f -/- ) and double-deficient (Il17af -/- ) donor T cells. Our results show a protective role of mutually redundant donor-derived IL-17 cytokines IL-17A and IL-17F. We further demonstrate that increased gut leakage and macrophage infiltration occurs when donor-derived IL-17A and IL17F are absent. Our results suggest that donor-derived IL-17 might contribute to protection of the intestinal barrier during acute GVHD. Material and methods Animals Wildtype (WT) C57BL/6 Thy1.2 (BL6, H-2K b ), BALB/c (H-2K d ), B6xDBA2 F1 (BDF1, H-2K bxd ) mice were obtained from Charles River Laboratories (Sulzfeld, Germany). B6.129P2-Il17a tm1Yiw (Il17a –/– ) mice were kindly provided by Y. Iwakura (The University of Tokyo, Bunkyō-ku, Japan) B6.129S6-Il17f tm1Awai (Il17f –/– ) mice were kindly provided by B. Becher (University of Zu¨rich, Zu¨rich, Switzerland). WT C57BL/6 Thy1.1, Il17a –/– ,Il17f –/– and Il7af -/- (C57BL/6J-Il17a/ Il17ftm1Impr) were bred at the central animal facility of Hannover Medical School under specific pathogen-free conditions. All animal experiments were carried out in accordance with institutional and governmental directives and were approved by Niedersa¨chsisches Landesamt fu¨r Verbraucherschutz und Lebensmittelsicherheit (permit number: 33.14-42502-04-11/0619 and 33.19-42502-04-14/1660). Bone marrow transplantation and GVHD induction For BMT and GVHD-induction in the C57BL/6!BALB/c model, 8–10 weeks old BALB/c recipients received lethal irradiation with 8 Gy from a Cs γ-source. Donor cells were PLOS ONE IL-17A and IL17F and acute GVHD PLOS ONE | https://doi.org/10.1371/journal.pone.0231222 April 6, 2020 2 / 16 transplanted within 24 hours after irradiation. All recipient mice received 3.0–5.0x10 6 T celldepleted bone marrow (TCD BM) C57BL/6 or BALB/c BM cells and 0.5x10 6 CD4 + T cells from C57BL/6 WT, Il17a –/– ,Il17f –/– or Il17af –/– mice. Single-cell suspensions were prepared from peripheral lymph nodes (pLN) and spleen and enriched via magnetic microbeads (MACS, CD4 + T cell isolation kit; Miltenyi Biotec, Bergisch-Gladbach, Germany). BM cells were harvested from the femurs and tibias of donor mice. BM cells were stained with biotinylated anti-CD3 (clone 17A2, homemade) and separated via streptavidin-conjugated magnetic beads (Miltenyi Biotec, Bergisch-Gladbach, Germany) in order to deplete T cells. After transplantation, mice were kept on antibiotic water (Cotrimoxazol; Ratiopharm, Ulm, Germany) until the end of the experiment. Survival, weight loss and clinical GVHD-signs of recipient mice were monitored and scored according to Cooke et al [21]. Clinical signs of acute GvHD, such as ruffled fur, weight loss (mild >10% of initial body weight; severe >25% of initial body weight), hunched back, inactivity and diarrhea, were monitored two times per day. Severity of each clinical sign was scored (no = 0; mild = 1; severe = 2) and animals with a total score of �6 were sacrificed immediately by cervical dislocation and counted as GVHD lethality. All transplanted mice were provided with moistened food to allow easier feeding and aid hydration. Hannover Medical School provided the research staff with special training in animal handling. Despite frequent monitoring, occasionally, mice were found dead without clinical signs of GVHD within the first 10 days after transplantation. This was limited to fewer than 5% of mice involved in the study and was considered as non-GVHD mortality, and those mice were excluded from the final analysis. Cell proliferation assay Proliferation of Il17af –/– or WT T cells after unspecific stimulation with CD3/CD28 beads (ThermoFisher, Schwerte, Germany) or allogeneic BM-derived DCs was determined by 3 H-Thymidine uptake as follows: 5,000 cells were incubated in a 96-well plate with 150μl RPMI medium supplemented with 10% FCS, 1% L-glutamine, 1% Pen-Strep and 0.04% gentamycine. The cells were incubated for two days in 95% humidified atmosphere by 5% CO 2 at 37˚C, before 0.8 mCi 3 H-Thymidine (Hartman) was added per well. The incorporation of radioactive thymidine was measured 16h later in a Microbeta workstation (Perkin Elmar). BrdU proliferation assay Day 20 after BMT, mice were i.p. injected with 3mg 5-Bromo-20-deoxyuridine (BrdU) (SigmaAldrich) and set on 0.8mg/ml BrdU containing water over night. After 24h, mice were sacrificed 24h and SI and colon were fixed in 4% formaline (Sigma-Aldrich) overnight and processed as described above. Detection of incorporated BrdU was performed with the BrdU InSitu Detection Kit (Cat No. 550803, BD Biosciences) according to the manufacturer’s manual. Pictures were acquired with an Olympus BX61 (Olympus, Hamburg, Germany) confocal microscope and processed with the cellSens Dimensions 1.9 software (Olympus, Hamburg, Germany). 16S DNA Illumina sequencing of stool bacteria in GVHD situation Fresh stool samples were collected from il17af –/– and WT recipients at day 14 and day 21 after BMT. Bacterial DNA was isolated using QIAamp DNA Stool Mini Kit (Qiagen) according to manufacturer’s manual. In the first PCR round, 16S V3-V4 regions were amplified by 15 PCR cycles using published primers [22]: S-D-Bact-0341F (5’-acactctttccctacacgacgctcttccgatctCCTACGGGNGGC WGCAG-3’) and S-D-Bact-0785R (5’- PLOS ONE IL-17A and IL17F and acute GVHD PLOS ONE | https://doi.org/10.1371/journal.pone.0231222 April 6, 2020 3 / 16 gtgactggagttcagacgtgtgctcttccgatctGACTACHVGGGTATCTAATCC-3’). In the second PCR with 13 cycles Illumina-adapters were added using following primers: adapter_for: (5’ aatgatacggcgaccaccgagatctacactctttccctac 3’) and adapter_rev: (5’-caagcagaagacggcatacgagatXXXXXXgtgactg-3’). The XXXXXX bases represent the MID region, each sample was coded with a distinct DNA fragment for later assignment. All PCR steps were performed with Advantage2 PCR kit (Takara). PCR products were separated with a 2% agarose gel in TAE buffer. For gel extraction, QIAquick Gel extraction kit (Quagen) was used according to manufacturer’s manual. Library concentration was adjusted and 250bp paired-end sequencing was performed on the Illumina MiSeq system following standard protocol. Quality control and adapter clipping of the sequences was done using fastq-mcf tool of ea-utils [23]. Sequencing data were processed according to the workflow listed: Paired-reads were joined using of ea-utils. Chimeras were excluded using Usearch [24] sequence analysis tool with uchime [25] command based on chimeraslayer gold 16s rRNA database (release 4.29.2010) as reference. Taxonomy assignment was performed by RDP-classifier 2.8 [26] with confidence value of 0.5. Transendothelial electrical resistance (TEndoR) Human umbilical vein endothelial cells (HUVECs) were grown to confluence in polycarbonate wells containing evaporated gold microelectrodes in series with a large gold counter connected to a phase-sensitive lock-in amplifier as described previously. TEndoR was measured using an electrical cell-substrate impedance sensing system (ECIS) (Applied BioPhysics Inc.) as described elsewhere [27]. Each condition’s endpoint resistance was divided by its starting resistance to give the normalized TEndoR. When the cells reached the resistance more than 1500 ohm, cells were treated with 10ng/ml IL-17 (Sigma-Aldrich, St-Luis, MO) and TEndoR was measured thereafter in real-time. Transepithelial resistance (TEpiR) and fluorescein permeability measurements Epithelial permeability: Caco-2Bbe cells were seeded on 0.4 μm snapwells (Corning Life Sciences, USA) at 1.5 ×104/cm 2 and grown for 14 days. TEpiR was measured daily using a EVOM2 voltohmmeter (World Precision Instruments, Sarasota, FL). On day 14, IFN-γ10ng/ ml (Sigma Aldrich, Germany) ±IL-17 (IL-17A or IL-17F 2.5ng/ml ~ 10ng/ml) (Sigma Aldrich, Germany) was added to the apical and basolateral bath every 12 hours. After 24h, both sides of the cell monolayer were incubated with TNF-α10ng/ml ±IL-17 (IL-17A or IL-17F 2.5ng/ml ~ 10ng/ml) in the continuous presence of INF-γ, and TEpiR was measured before, 2h, 4h, 8h, 12h and 24h after TNF-αaddition. Subsequently, the cell were transferred to an Ussing Chamber system (Easymount, Physiologic Instruments, CA), incubated in a buffer containing NaCl 116 mM, KH2PO4 0.4 mM, K2HPO4 2.4 mM, MgCl2 1.2 mM, CaCl2 1.2 mM, NaHCO3 24 mM, gassed with 95% O2 and 5% CO2 at 37˚C. TEER was monitored with KCl agar electrodes. 100 μMfluorescein or (FITC)-dextran-4000 was added to the apical side, and both apical and basolateral samples were collected 1 hour later and measured with a fluorometer at 520 nm (Tecan Infinite M200, Tecan, Switzerland). Fluorescein and (FITC)-dextran-4000 paracellular fluxes were presented as the ratio of the tracer in the basolateral compartment and in the apical compartment. Tracer fluxes = basolateral FITC intensity / apical FITC intensity ×100%. Data are presented as mean ±SEM, n = 3–4 samples in each condition. PLOS ONE IL-17A and IL17F and acute GVHD PLOS ONE | https://doi.org/10.1371/journal.pone.0231222 April 6, 2020 4 / 16 Data analysis and statistics Statistical analysis was performed with Prism 7 (Graph-Pad Software, Inc.). Statistical differences for the mean values are as follows: �, P�0.05; ��, P�0.01; and ���, P�0.001. Student’s t test, Mann Whitney U test or ANOVA were used for calculating statistical significance. The analysis of survival data was performed using Kaplan-Meier estimation and log-rank test. Further details on methods are available as supplementary methods and material. Results Donor IL-17A and IL-17F deficiency leads to aggravated acute GVHD To assess the effects of IL-17 produced by donor-derived Th17 cells in acute GVHD, we compared the outcome of experimental acute GVHD induced by adoptive transfer of allogeneic CD4 + T cells from wild type (WT) or Il7af -/- donors [5] using C57BL/6 donors and lethally irradiated BALB/c recipients. Phenotype of steady state CD4 + cells from Il17af -/- mice were analyzed by flow cytometry and showed no major differences compared to WT CD4 + T cells (S1 Fig). Recipients of Il17af -/- CD4 T cells showed a significant increase of GVHD severity and mortality as compared to WT controls (Fig 1A and 1B). Interestingly, recipients of Il17af -/- T cells suffered from severe diarrhea early after transplantation (Fig 1C). To verify the occurrence of Th17 cells after BMT, we analyzed IL-17 secretion of CD4 + T cells in host tissues by intracellular cytokine staining. We re-isolated donor lymphocytes from recipients’ colon, small intestine (SI) and lymph nodes 21 days after transplantation and stained for IL-17A and IL-17F. Thy1.1 was used to separate donor from remaining host CD4 + T cells that escaped elimination by conditioning. IL-17A and F secretion by CD4 T cells was evident in peripheral lymph nodes (pLN) and GVHD target organs (Fig 1D). Next, we analyzed systemic cytokine levels after GVHD initiation. We observed a marked increase of IL-6, IFNγand MCP-1 levels in Il17af -/- recipients as compared to WT-recipients at different time points after transplantation (Fig 1E). From these data we conclude that donor-derived IL-17A and IL-17F exert protective effects in the early course of GVHD. Since the IL-17 isoforms A and F both bind to the IL-17RA receptor, we checked whether either lack of IL-17A or F altered protection from acute GVHD. To that end, we made use of single Il17a -/- ,Il17f -/- and double IL-17-deficient (Il17af -/- ) CD4 + T cells. We observed that only recipients receiving Il17af -/- , but not Il17a -/- ,Il17f -/- CD4 + T cells, developed an aggravated GVHD as compared to WT controls (Fig 2A and 2B). In order to validate our experimental setup, we re-isolated donor CD4 + T cells from pLNs of recipients and stained for IL-17A and IL-17F to check for secretion of IL-17 cytokines. Indeed, we observed expression of both IL-17A and IL-17F from WT CD4 + cells, whereas Il17a -/- and Il17f -/- CD4 + T cells expressed only IL-17F and IL-17A respectively. Expectedly, Il17af -/- CD4 + T cells did neither express IL-17A nor IL-17F (Fig 2C). IL-17 deficiency of donor T cells does not alter the microbial flora after BMT The composition of the gut microbiome affects GVHD outcome [28] and it has been shown that Th17 cells have an impact on modulation of the microbiome in several experimental GVHD models [29]. Of note, bacteroidaceae species have been shown to compose the majority of the stool microbiota in patients without acute GVHD [30]. Therefore, we sequenced stool samples of Il17af -/- or WT CD4 + T cell recipients at day 14 and day 21 day after transplantation (Fig 3A and 3B). Interestingly, we found no significant difference in the overall microbiota diversity between recipients either on day 14 or day 21 post allo-BMT as assessed by Shannon indices (Fig 3C and 3D) or in prevalence of the bacteroidaceae family between groups (Fig 3E). PLOS ONE IL-17A and IL17F and acute GVHD PLOS ONE | https://doi.org/10.1371/journal.pone.0231222 April 6, 2020 5 / 16 Fig 1. Deficiency of IL-17A and IL-17F in donor CD4 + T cells leads to aggravated GVHD. BALB/c mice were lethally irradiated and transplanted with 5x10 6 TCD BM and 0.5x10 6 CD4 + T cells from BL6 WT or Il17af -/- donors. A) Survival curve of Il17af -/- and WT T cell recipients. Data are pooled from four independent experiments (Il17af -/- n = 21, WT CD4 + cells n = 22). For statistical analysis the log rank test was used. B) Clinical score. C) Percentage of diarrhea-free mice. D) FACS sorted donor Thy1.1 + CD4 + T cells were analyzed for the expression of IL-17A and IL-17F. Donor WT or Il17af -/- CD4 + T cells were isolated from BALB/c recipients from colon, SI and pLNs on day 21 after BMT. Data were collected from three independent experiments for colon and SI (WT n = 10, Il17af -/- n = 11); and two experiments pLNs (WT = 8, Il17af -/- n = 7). E) Concentrations of IL-6, MCP-1 and IFNγcytokines in the sera of WT or Il17af -/- CD4 + T cell recipients sacrificed at day 7, 14, and 21 after BMT. (day 7 WT n = 10, Il17af -/- n = 10; day 14 WT n = 11, Il17af -/- n = 12; day 21 WT n = 16, Il17af -/- n = 15). Statistical significance was determined by Student’s ttest. The bars show the mean and error bars show SEM. https://doi.org/10.1371/journal.pone.0231222.g001 PLOS ONE IL-17A and IL17F and acute GVHD PLOS ONE | https://doi.org/10.1371/journal.pone.0231222 April 6, 2020 6 / 16 Lack of donor CD4 + T cell-derived IL-17A and IL-17F results in increased intestinal leakage Recipients of Il17af -/- CD4 + T cells showed early and severe diarrhea (Fig 1C), suggesting alteration of the intestinal barrier. To test the functionality of the intestinal barrier after GVHD-initiation, we applied FITC-dextran by oral gavage to BMT-recipients [31]. Thereafter, serum FITC-Dextran concentrations were assessed at day 21 post-transplantation. We observed a significantly increased intestinal leakage in recipients of Il17af -/- CD4 + T cells (Fig 4A), indicating intestinal barrier breakdown. We tested whether IL-17 cytokines exert protective effects in vitro. For this purpose, we used ECIS to analyze the effect of IL-17 on endothelial leakage. Interestingly, we did not see any effect of either of the IL-17 cytokines in reduction of TNFαinduced leakage in such experiments (Fig 4B). Fig 2. IL-17A and IL-17F are reciprocally compensated during GVHD. BALB/c mice were lethally irradiated and transplanted with 5x10 6 TCD BM and 0.5x10 6 CD4 + T cells from BL6 WT, Il17af -/- ,Il17a -/- , or Il17f -/- donors. A) Survival curve of BL6 BL6 WT, Il17af -/- ,Il17a -/- , or Il17f -/- CD4 + T cell recipients, data were generated in two experiments (BL6 WT, Il17af -/- ,Il17a -/- n = 8, Il17f -/- n = 10) B) Clinical score. C) Expression of IL-17A and IL-17F by donor CD4 + T cells isolated from pLNs of BL6 WT, Il17af -/- Il17a -/- , or Il17f -/- CD4 + T cell recipients in experimental GVHD at day 21 after transplantation. For statistical analysis, non-parametric two-tailed T test was used. Data represent the frequency and the SD of a single experiment (n = 3 per group). �p�0.05. https://doi.org/10.1371/journal.pone.0231222.g002 PLOS ONE IL-17A and IL17F and acute GVHD PLOS ONE | https://doi.org/10.1371/journal.pone.0231222 April 6, 2020 7 / 16 There has been emerging evidence of a protective role of IL-17 in fostering gut integrity via modulation of epithelial tight junctions, albeit in a different experimental setup [32]. Therefore, we analyzed the consequences of IL-17A and IL-17F administration in an in vitro-system for gut-epithelial-leakage. To that end, we used the well-characterized Caco2BBe cell line expressing IL-17 receptor, grown as differentiated monolayer cultures on permeable filters, and measured the TEpiR as a measure for paracellular permeability. TEpiR was measured daily with an EVOM2 (Voltohmmeter, WPI), and at the end of the incubation time in an Fig 3. IL-17 A/F deficiency does not alter the microbial flora after allogeneic BMT. BALB/c mice were lethally irradiated and transplanted with 5x10 6 TCD BM and 0.5x10 6 CD4 + cells from BL6 WT or Il17af -/- donors. A-B) Representative graph of microbial flora in the feces of WT and Il17af -/- T cell recipients at A) day 14 or B) day 21 after BMT. Heat-maps of the relative abundance of bacterial species at phylogenetic level of families are presented for one representative experiment. Each column represents one sample from individual mouse. (day 14 WT n = 3, Il17af -/- n = 3; day 21 WT n = 4, Il17af -/- n = 4). C) Shannon index of diversity for all samples on the family level at day 14 and D) day 21 after BMT. E) Relative abundance of Bacteroidaceae family in the feces of WT and Il17af -/- T cell recipients at day 21 after BMT. (day 14 WT n = 10, Il17af -/- n = 10; day 21 WT n = 13, T Il17af -/- n = 14). Sequences with an abundance of less than 1% were excluded from the analysis. https://doi.org/10.1371/journal.pone.0231222.g003 PLOS ONE IL-17A and IL17F and acute GVHD PLOS ONE | https://doi.org/10.1371/journal.pone.0231222 April 6, 2020 8 / 16 Ussing chamber setup. Additionally, we assessed apical to basolateral fluorescein (FITC) fluxes. However, we saw no evidence of a protective role of IL-17A or IL-17F against TNFαinduced decrease in TEpiR (Fig 4C and 4D). While TNFαincubation resulted in a significant decrease in TEpiR, verified by TEpiR measurements in the Ussing Chamber (Fig 4E) and by an increase in FITC permeability, the pre-incubation for 24 h with IL-17A or IL-17F did not prevent the increase in epithelial permeability (Fig 4F). Lack of donor-derived IL-17A and F cells leads to increased IFNγ production of donor CD4 T cells and macrophage influx to the intestine Th1 T cells producing the proinflammatory cytokine IFNγhave been shown to be detrimental in inducing GVHD [33]. Hence, we compared the numbers of CD4 + T cells secreting IFNγin Fig 4. Recipients of Il17af -/- CD4 + cells show gut-leakiness. BALB/c mice were lethally irradiated and transplanted with 5x10 6 TCD BM and 0.5x10 6 CD4 + cells from BL6 WT or Il17af -/- donors. A) Concentration of translocated FITC-dextran in the sera of WT and Il17af -/- CD4 + T cell recipients at day 21 after BMT. (n = 6, Il17af -/- n = 4) B) Increase in transendothelial electrical resistance (TEndoR) normalized to vehicle. C) Increase in transepithelial electrical resistance (TepiR, measured daily with an EVOM2 voltohmmeter, over the days in culture after confluency. All four groups had a similar increase in TEpiR prior to the cytokine treatment. D) at day 14 post confluency, the cells were incubated with 10ng/ml interferon-γ± IL17A or IL17F, followed by 10g/ml TNF-α10ng/ml ±IL-17 (IL-17A or IL-17F 10ng/ml) 24 h later, and TEpiR was assessed at the indicated times. E) After 24h, the filters were transferred to an Ussing-chamber system, and both TEpiR, and F) FITC permeability was assessed. The values in C and D are given in % of the value treated with IFN-γand TNF-αonly. All data are pooled from two or three independent experiments. Error bars represent SEM. For statistical analysis Log-rank test was used. �p�0.05. https://doi.org/10.1371/journal.pone.0231222.g004 PLOS ONE IL-17A and IL17F and acute GVHD PLOS ONE | https://doi.org/10.1371/journal.pone.0231222 April 6, 2020 9 / 16 31. Hanash AM, Dudakov JA, Hua G, O’Connor MH, Young LF, Singer N V., et al. Interleukin-22 Protects Intestinal Stem Cells from Immune-Mediated Tissue Damage and Regulates Sensitivity to Graft versus Host Disease. Immunity [Internet]. 2012 Aug; 37(2):339–50. Available from: https://linkinghub.elsevier. com/retrieve/pii/S1074761312003317 32. Lee JS, Tato CM, Joyce-Shaikh B, Gulan F, Cayatte C, Chen Y, et al. Interleukin-23-Independent IL-17 Production Regulates Intestinal Epithelial Permeability. Immunity [Internet]. 2015; 43(4):727–38. Available from: http://dx.doi.org/10.1016/j.immuni.2015.09.003 33. Choi J, Ziga ED, Ritchey J, Collins L, Prior JL, Cooper ML, et al. IFNγR signaling mediates alloreactive T-cell trafficking and GVHD. Blood. 2012; 120(19):4093–103. https://doi.org/10.1182/blood-2012-01403196 PMID: 22972985 34. Wu C, Xue Y, Wang P, Lin L, Liu Q, Li N, et al. IFN-γPrimes Macrophage Activation by Increasing Phosphatase and Tensin Homolog via Downregulation of miR-3473b. J Immunol [Internet]. 2014; 193 (6):3036–44. Available from: http://www.jimmunol.org/lookup/doi/10.4049/jimmunol.1302379 35. Eyerich K, Dimartino V, Cavani A. IL-17 and IL-22 in immunity: Driving protection and pathology. Eur J Immunol. 2017; 47(4):607–14. https://doi.org/10.1002/eji.201646723 PMID: 28295238 36. Van der Waart AB, van der Velden WJFM, Blijlevens NM, Dolstra H. Targeting the IL17 pathway for the prevention of graft-versus-host disease. Biol Blood Marrow Transplant [Internet]. 2014; 20(6):752–9. Available from: http://dx.doi.org/10.1016/j.bbmt.2014.02.007 37. Dubin PJ, Kolls JK. Interleukin-17A and Interleukin-17F: A Tale of Two Cytokines. Immunity [Internet]. 2009; 30(1):9–11. Available from: http://dx.doi.org/10.1016/j.immuni.2008.12.010 38. Tang C, Kakuta S, Shimizu K, Kadoki M, Kamiya T, Shimazu T, et al. Suppression of IL-17F, but not of IL-17A, provides protection against colitis by inducing Treg cells through modification of the intestinal microbiota. Nat Immunol [Internet]. 2018; 19(7):755–65. Available from: http://dx.doi.org/10.1038/ s41590-018-0134-y 39. Papotto PH, Ribot JC, Silva-Santos B. IL-17 + γδ T cells as kick-starters of inflammation. Nat Immunol. 2017; 18(6):604–11. https://doi.org/10.1038/ni.3726 PMID: 28518154 40. Bernink JH, Ohne Y, Teunissen MBM, Wang J, Wu J, Krabbendam L, et al. c-Kit-positive ILC2s exhibit an ILC3-like signature that may contribute to IL-17-mediated pathologies. Nat Immunol [Internet]. 2019; Available from: http://dx.doi.org/10.1038/s41590-019-0423-0 41. Gladiator A, Wangler N, Trautwein-Weidner K, LeibundGut-Landmann S. Cutting Edge: IL-17–Secreting Innate Lymphoid Cells Are Essential for Host Defense against Fungal Infection. J Immunol. 2013; 190(2):521–5. https://doi.org/10.4049/jimmunol.1202924 PMID: 23255360 42. Burman AC, Banovic T, Kuns RD, Clouston AD, Stanley AC, Morris ES, et al. IFNγdifferentially controls the development of idiopathic pneumonia syndrome and GVHD of the gastrointestinal tract. Blood. 2007; 110(3):1064–72. https://doi.org/10.1182/blood-2006-12-063982 PMID: 17449800 43. Wang H, Asavaroengchai W, Yeap BY, Wang MG, Wang S, Sykes M, et al. Paradoxical effects of IFNγin graft-versus-host disease reflect promotion of lymphohematopoietic graft-versus-host reactions and inhibition of epithelial tissue injury. Blood. 2009; 113(15):3612–9. https://doi.org/10.1182/blood2008-07-168419 PMID: 19211507 44. Janeway Charles A Jr, Travers Paul, Walport Mark and MJS. Immunobiology: The Immune System in Health and Disease. In: 5th ed. New York: Garland Science; 2001. 45. Alexander KA, Flynn R, Lineburg KE, Kuns RD, Teal BE, Olver SD, et al. CSF-1–dependant donorderived macrophages mediate chronic graft-versus-host disease. J Clin Invest [Internet]. 2014 Oct 1; 124(10):4266–80. Available from: http://www.jci.org/articles/view/75935 46. Nishiwaki S, Nakayama T, Murata M, Nishida T, Terakura S, Saito S, et al. Dexamethasone palmitate ameliorates macrophages-rich graft-versus-host disease by inhibiting macrophage functions. PLoS One. 2014; 9(5). PLOS ONE IL-17A and IL17F and acute GVHD PLOS ONE | https://doi.org/10.1371/journal.pone.0231222 April 6, 2020 16 / 16