The global nitrogen regulator NtcA regulates transcription of the signal transducer P(II) (GlnB) and influences its phosphorylation level in response to nitrogen and carbon supplies in the cyanobacterium Synechococcus sp. strain PCC 7942

JOURNAL OF BACTERIOLOGY, 0021-9193/99/$04.0010May 1999, p. 2697–2702 Vol. 181, No. 9 Copyright © 1999, American Society for Microbiology. All Rights Reserved. The Global Nitrogen Regulator NtcA Regulates Transcription of the Signal Transducer P II (GlnB) and Influences Its Phosphorylation Level in Response to Nitrogen and Carbon Supplies in the Cyanobacterium Synechococcus sp. Strain PCC 7942 HYUN-MI LEE, 1 MARI ´AFE ´LIX VA ´ZQUEZ-BERMU ´DEZ, 2 AND NICOLE TANDEAU DE MARSAC 1 * De´partement de Biochimie et Ge´ne´tique Mole´culaire, Unite´ de Physiologie Microbienne, Institut Pasteur, 75724 Paris Cedex 15, France, 1 and Instituto de Bioquı´mica Vegetal y Fotosı´ntesis, CSIC-Universidad de Sevilla, Centro de Investigaciones Cientı´ficas Isla de la Cartuja, E-41092, Seville, Spain 2 Received 3 December 1998/Accepted 12 February 1999 The P II protein is encoded by a unique glnB gene in Synechococcus sp. strain PCC 7942. Its expression has been analyzed in the wild type and in NtcA-null mutant cells grown under different conditions of nitrogen and carbon supply. RNA-DNA hybridization experiments revealed the presence of one transcript species 680 nucleotides long, whatever the nutrient conditions tested. A second transcript species, 620 nucleotides long, absent in the NtcA null mutant, was observed in wild-type cells that were nitrogen starved for 2 h under both high and low CO 2 and in the presence of nitrate under a high CO 2 concentration. Primer extension analysis indicated that the two transcript species are generated from two tandem promoters, a s 70 Escherichia coli-type promoter and an NtcA-dependent promoter, located 120 and 53 nucleotides, respectively, from the glnB initiation codon. The NtcA-dependent promoter is up-regulated under the conditions mentioned above, while the s 70 E. coli-type promoter displays constitutive levels of transcripts in the NtcA null mutant and slightly different levels in the wild-type cells, depending on the nitrogen and carbon supplies. In general, a good correlation between the amounts of the two transcript species and that of the P II protein was observed, as revealed by immunodetection with specific antibodies. The phosphorylation level of P II in the wild type is inversely correlated with nitrogen availability and directly correlated with higher CO 2 concentration. This regulation is correspondingly less stringent in the NtcA null mutant cells. In contrast, the dephosphorylation of P II is NtcA independent. In cyanobacteria, nitrogen assimilation is a genuine photosynthetic process that requires ATP and reducing equivalents generated in the light. Both nitrate and nitrite are reduced to ammonium in the presence of photosynthetically reduced ferredoxin as the physiological electron donor. Ammonium is incorporated, through the glutamine synthetase-glutamate synthase pathway, into glutamate to yield glutamine by an ATP- dependent ligation reaction catalyzed by glutamine synthetase, and glutamate synthase transfers the amido group of glutamine to 2-oxoglutarate to regenerate glutamate in the presence of reduced ferredoxin. Nitrogen assimilation is tightly regulated in response to environmental cues. Nitrate and nitrite are taken up and reduced only in the absence of ammonium and under CO 2 fixation conditions, and the level of glutamine synthetase protein is severely reduced in the presence of ammonium (12). In the unicellular Synechococcus sp. strain PCC 7942, which does not fix molecular nitrogen, the signal transduction protein P II (the glnB gene product) is a key element in the coordination of nitrogen and carbon metabolism (15). This protein is a homotrimer of 36 kDa whose isomeric forms carry either zero, one, two, or three phosphorylated seryl residues (Ser49), depending on the carbon and nitrogen supply of the cells (13, 14), in contrast to the Escherichia coli P II , which is uridylylated at a tyrosyl residue (Tyr51) (41). The highest degree of P II phosphorylation is observed in cells incubated under a high CO 2 concentration in the presence of nitrate or under nitrogenlimiting conditions, while the protein is mainly dephosphorylated under low CO 2 in the presence of ammonium (14, 15). In vitro phosphorylation experiments revealed that both the P II kinase and phosphatase activities depend on 2-oxoglutarate and ATP but not on glutamine or glutamate (16, 23). The modification of the Synechococcus sp. strain PCC 7942 P II protein is facilitated by the binding of ATP and 2-oxoglutarate (13, 16). Since the intracellular concentration of ATP is high under physiological conditions, it has been proposed that P II primarily functions as a sensor of 2-oxoglutarate (13). This metabolite not only serves as a source of carbon skeleton for nitrogen assimilation but would also be of particular importance as a small-molecule effector in the control of this metabolic process in Synechococcus sp. strain PCC 7942. NtcA is a global nitrogen regulator that is widespread and highly conserved in cyanobacteria (12, 20). This DNA-binding protein, which belongs to the CRP family of bacterial transcriptional effectors, activates the expression of a number of genes in the absence of ammonium by recognizing the target consensus nucleotide sequence GTAN 8 TAC in their promoter regions (30). In Synechococcus sp. strain PCC 7942, NtcA positively regulates its own expression and activates the transcription of the nir operon (encoding nitrite reductase, the ABC- type permease complex, and nitrate reductase) (12, 30, 39), the nirB ntcB gene cluster (which encodes, respectively, a protein required for expression of nitrite reductase activity and a transcriptional effector of the bacterial LysR-type family that activates the nir operon in the presence of nitrite) (1, 26, 44), the glnA gene (encoding glutamine synthetase) (6, 7, 30), and the * Corresponding author. Mailing address: De´partement de Biochimie et Ge´ne´tique Mole´culaire, Unite´ de Physiologie Microbienne, Institut Pasteur, 28 rue du Docteur Roux, 75724 Paris Cedex 15, France. Phone: 33 (0)1 45 68 8415. Fax: 33 (0)1 40 61 3042. E-mail: [email protected]. 2697 on July 24, 2017 by USE/BTCA.GENERAL UNIVERSITARIA Sevillahttp://jb.asm.org/Downloaded from cynBDS operon (encoding two proteins likely to be involved in the active transport of cyanate and cyanase) (22). In the N 2 - fixing filamentous heterocystous cyanobacterium Anabaena sp. strain PCC 7120, NtcA acts as an activator for the expression of genes for the assimilation of nitrogen sources alternative to ammonium and as an activator for heterocyst development (18, 19, 49). It has also been proposed that it could behave as a repressor for the rbcL gene (encoding the large ribulose-1,5-bisphosphate carboxylase–oxygenase subunit) and the gor gene (encoding glutathione reductase) (24, 40). In the facultative photoheterotroph Synechocystis sp. strain PCC 6803, glnB appears to be regulated by both electron transport and nitrogen availability, and the increased level of glnB under nitrogen starvation might be under the control of NtcA (21). In the marine unicellular N 2 -fixing Cyanothece sp. strain BH68K, NtcA is involved in nitrogen assimilation rather than nitrogen fixation, and the expression of the ntcA gene may be under the control of the circadian rhythm (4). Analysis of the phenotype of MP2, a P II null mutant of the obligate photoautotroph Synechococcus sp. strain PCC 7942, revealed that nitrate utilization no longer depended on CO 2 fixation (15). Moreover, in contrast to the wild-type cells, in which ammonium exerts a rapid and reversible inhibition of nitrate and nitrite uptake, no inhibition was observed in this mutant. It was thus concluded that the unphosphorylated form of P II is involved in the short-term inhibition by ammonium of nitrate and nitrite uptake (27). In this mutant, the synthesis of nitrate and nitrite reductases and glutamine synthetase was still subject to control by ammonium, suggesting that there is no direct interaction between P II and the activity of NtcA in the regulation of nitrogen assimilation (15). However, other relationships between P II and NtcA were not excluded. Here we present results demonstrating that NtcA regulates P II synthesis at the transcriptional level and is required for a full control of the phosphorylation state of P II in response to nitrogen and carbon availability in Synechococcus sp. strain PCC 7942. MATERIALS AND METHODS Strains and culture conditions. Wild-type and mutant cells of Synechococcus sp. strain PCC 7942 were grown in liquid BG11 0 medium (43) containing 0.4 mM Na 2 CO 3 and supplemented with 10 mM HEPES, pH 8.0. Either NaNO 3 (17.6 mM) or NH 4 Cl (5 mM) was used as the N source. The NtcA 2 mutant, constructed by using plasmid pMAV58 according to the method of Vega-Palas et al. (48), was grown in ammonium-containing BG11 0 medium with chloramphenicol (7 mgml 21 ). Precultures grown in the presence of ammonium were incubated for 3 to 4 days (optical density at 750 nm [OD 750 ], approximately 0.6) at 30°C in air and illuminated with fluorescent lamps (OSRAM L18W/25 universal white) providing a photosynthetic photon flux density of 50 mmol m 22 s 21 measured with a LI-COR LI-185B quantum radiometer-photometer equipped with an LI-190SB quantum sensor. Experimental cultures were incubated at 35°C under the same photosynthetic photon flux density in a culture medium containing ammonium and supplemented with NaHCO 3 (10 mM) and with constant bubbling with air–3% (vol/vol) CO 2 . Cells from mid-exponential-phase cultures (OD 750 , approximately 0.4) were collected by centrifugation at 5,000 3gfor 10 min at 25°C. The cell pellets were washed twice with BG11 0 and resuspended at the same cell density in BG11 0 medium containing either ammonium, nitrate, or no nitrogen source. After2hofincubation of the cells either in air without bubbling or bubbled with air–3% (vol/vol) CO 2 , samples were collected for analysis. Nucleic acid methods. Standard methods were used for E. coli plasmid DNA isolation. Restriction endonucleases (New England Biolabs or Pharmacia) and other DNA-modifying enzymes (New England Biolabs or Amersham) were used according to the manufacturers’ recommendations. Extraction of total RNA, gel electrophoreses, blottings, and hybridizations were performed as described previously (27). DNA probes were labelled with [a- 32 P]dATP (110 TBq mmol 21 ) by using a Megaprime random-labelling kit (Amersham). A probe internal to glnB (241 bp) was obtained by PCR amplification of the corresponding fragment from plasmid pPM119 (45) with specific primers to which an EcoRI site was added at the 59extremity of the coding strand (59CGGAATTCCGTTCAAACTGGAC 39) and a BamHI site was added at the 59extremity of the complementary strand (59CGGGATCCCGTCACCAATTT CGC 39). The PCR product was cloned in the vector pTZ18R for further use in the DNA-binding assay. Plasmid DNA was extracted with the Nucleobond AX kit (Macherey-Nagel, Du¨ren, Germany). A 0.6-kb KpnI-XhoI fragment containing the rnpB gene, encoding the RNA subunit of RNase P from Synechococcus sp. strain PCC 7942 (a gift from A. Vioque [3]), was used as a probe to quantify the amount of RNA loaded and transferred to the filters and to standardize the measurements. Primer extension was performed as described by Liotenberg et al. (28) with 60 mg of total RNA and the 21-nucleotide-long primer 59GACTTCGTCCAGTT TGAACGG 39. DNA sequencing was performed by using the sequencing dideoxynucleotide chain termination method (T7 sequencing kit; Pharmacia) with 35 S-dATP (37 TBq mmol 21 ; Amersham) as the labelled nucleotide and the same primer mentioned above. The relative transcript levels were quantified by scanning photoactivatable screens on a Molecular Dynamics 445SI PhosphoImager. All quantifications, data display, and analysis were performed with Molecular Dynamics Image Quant software. Gel retardation assays. Preparation of cell extracts from E. coli DH5acon- taining the expression vector pTrc99A and from isopropyl-b-D-thiogalactopyr- anoside (IPTG)-induced cells of the NtcA-overproducing strain DH5a(pCSI26), gel retardation assays, and labelling of the probes were performed as described previously (30). The DNA probes were a 440-bp NheI-AvaI fragment of the glnB promoter region from plasmid pPM119; the PCR product corresponding to a fragment internal to the glnB gene, obtained as described above in “Nucleic acid methods”; and a 350-bp EcoRI-XhoI fragment of the glnA promoter region from pCSI38 (30). These probes were labelled with [a- 32 P]dCTP (110 TBq/mmol; Amersham). The protein-DNA complex was visualized with an Instant Imager (Packard). Quantification of the P II protein and determination of its modification state. Cell extracts were prepared from cultures grown to an OD 750 of 0.4, and aliquots corresponding to 10 mg of total protein were separated by polyacrylamide gel electrophoresis under either denaturing or nondenaturing conditions as described by Forchhammer and Tandeau de Marsac (14). The protein content of cell extracts was estimated by the method of Lowry modified as described previously (32), with bovine serum albumin as a standard. The P II protein was revealed by immunoblotting with a P II -specific antiserum in an enhanced chemoluminescence detection system (ECL kit; Amersham). Quantification was done with the National Institutes of Health Image program. RESULTS Control of glnB expression by NtcA. Examination of the nucleotide sequence of the glnB gene of Synechococcus sp. strain PCC 7942 revealed the presence of a consensus DNA- binding site for the transcriptional effector NtcA (Fig. 1) located upstream of the glnB initiation codon between nucleotides 88 and 102. Experiments were designed to analyze the conditions under which the expression of the glnB gene of Synechococcus sp. strain PCC 7942 was regulated and to determine the corresponding start sites for transcription. RNADNA hybridizations, using a probe internal to the glnB gene, and primer extension analysis were performed. Total RNA was extracted from ammonium-grown cultures of the wild type and the NtcA null mutant after transfer of the cells for2htoa medium containing either ammonium, nitrate, or no combined nitrogen and under either air or air enriched with 3% (vol/vol) CO 2 . One or two transcript species of slightly different sizes (0.68 and 0.62 kb) were observed, depending on the nutrient conditions and the strain (Fig. 2). A particularly high level of transcripts was found in the wild-type cells incubated under nitrogen limitation and a high CO 2 concentration; their abundance was low under each of the other conditions tested. Primer extension analysis revealed four extension products FIG. 1. Alignment of NtcA recognition sequences of different genes from Synechococcus sp. strain PCC 7942 (30). 2698 LEE ET AL. J. BACTERIOL. on July 24, 2017 by USE/BTCA.GENERAL UNIVERSITARIA Sevillahttp://jb.asm.org/Downloaded from (Fig. 3). Two of them, which might correspond to the transcription start points designated tsp1 and tsp2, varied in abundance with the conditions of nitrogen and carbon availability in both the wild-type and the NtcA null mutant cells. The two additional small extension products most likely result from earlier pauses caused by a GC-rich stretch starting immediately downstream from tsp2. The transcription start point tsp1, situated 120 nucleotides from the glnB initiation codon, was found with RNA from both the wild-type and NtcA null mutant cells, whatever the conditions tested. The transcript species corresponding to tsp1 was preceded on the DNA sequence by a s 70 -like promoter (210 TAAAAT; 235 TTGCCT). The second transcription start point, tsp2, localized 53 nucleotides from glnB, corresponded to extension products whose abundance increased under nitrogen limitation and high CO 2 concentration in the wild-type cells. This was accompanied by a decreased intensity of the extension products corresponding to tsp1. The transcription start point tsp2 was preceded on the DNA sequence by a 210 box, TACCAA, and a perfect consensus NtcA-binding sequence, GTAN 8 TAC (30), between nucleotides 235 and 250. No extension products corresponding to tsp2 were detectable in the RNA from the NtcA 2 mutant cells, whatever the conditions tested. These results indicated that NtcA controls the expression of the glnB gene at tsp2. Binding of NtcA to the glnB promoter region. Mobility shift assays of electrophoretically resolved DNA fragments carrying the upstream region of glnB were performed with cell extracts of an NtcA-overproducing E. coli strain. This strain harbors plasmid pCSI26, which carries the ntcA gene downstream from the synthetic IPTG-inducible promoter trc and thus overexpresses NtcA after IPTG induction (30). As a positive control, experiments were performed in parallel with the promoter region of the glnA gene (P glnA ). The DNA fragment containing the promoter region of the glnB gene (P glnB ) was retarded by the NtcA-containing extract from E. coli carrying pCSI26 but not by the extract from E. coli cells harboring pTrc99A, the vector used to construct pCSI26 (Fig. 4A). The DNA fragment corresponding to an internal part of the glnB gene did not display any mobility shift and did not compete with either P glnB or P glnA (Fig. 4A). These results confirmed that the NtcA protein might bind specifically to DNA upstream from the glnB gene. At least a 50-fold-higher concentration of the cell extract was required, however, to obtain an NtcA-promoted shift of P glnB than to obtain a shift of P glnA (Fig. 4B), and the retarded band was fuzzier, whatever the concentration of the cell extracts tested (Fig. 4A and B). Immunological detection of P II in the wild type and in an NtcA null mutant. The amount of P II protein was estimated by immunoblotting with specific P II antibodies. In general, the total amount of the protein was found to be in good correlation with the levels of the transcripts in both the wild-type and the NtcA 2 cells incubated under the different nutrient conditions tested (Fig. 5). This indicated that, in addition to a basal level of expression of the glnB gene, which is NtcA independent, there is control by NtcA that occurs at a transcriptional level. Modulation of phosphorylation levels of P II isoforms by NtcA. In the wild-type cells, the relative abundance of the four FIG. 2. RNA-DNA hybridization of total RNA from cells of wild-type Synechococcus sp. strain PCC 7942 (WT) and the NtcA-deficient mutant (NtcA 2 )in response to the nature of the nitrogen source and the availability of CO 2 . Ammonium-grown cells were transferred for2htoBG-11 0 medium containing ammonium (lanes 1), nitrate (lanes 2), or no nitrogen source (lanes 3), under either air or air–3% (vol/vol) CO 2 . The same RNA blots were hybridized with a DNA probe internal to the glnB gene encoding the P II protein and with a DNA probe of the rnpB gene encoding the RNA subunit of RNase P to provide an estimate of the RNA loading. FIG. 3. Primer extension with the glnB gene. Total RNA (60 mg) from wildtype Synechococcus sp. strain PCC 7942 (WT) and NtcA-deficient mutant (NtcA 2 ) cells was annealed with an oligonucleotide specific to the glnB gene and extended with avian myeloblastosis virus reverse transcriptase as indicated in Materials and Methods. The cells were incubated as described in the legend to Fig. 2. Lanes A, C, G, and T contain a dideoxy sequencing ladder of the same DNA region used as a size control of the extension products. The sequences around the 59ends are listed on the right. tsp1 and tsp2 are putative transcription start points. FIG. 4. Gel retardation of DNA fragments from the glnB and glnA promoter regions by cell extracts of an NtcA-overproducing E. coli strain. (A) glnA promoter region, P glnA (lanes 1 to 3), and glnB promoter region, P glnB (lanes 4 to 6), incubated with a DNA fragment internal to the glnB gene as the competitor DNA. Lanes 1 and 4, no NtcA-containing extract added; lanes 2 and 5, 5 mgof extract from cells of E. coli DH5a(pTrc99A) added; lanes 3 and 6, 5 mg of NtcA- containing extract from IPTG-induced cells of E. coli DH5a(pCSI26) added. C glnA and C glnB are complexes formed after incubation of the DNA fragments carrying P glnA and P glnB , respectively, with the NtcA-containing extracts. (B) Same conditions as in panel A, lanes 1 and 4, with various amounts (0 [2]to8.0mg) of extract from IPTG-induced cells of E. coli DH5a(pCSI26) added. FIG. 5. Immunoblot analysis of the P II protein in cells of wild-type Synechococcus sp. strain PCC 7942 (WT) and of the NtcA-deficient mutant (NtcA 2 )in response to the nature of the nitrogen source and CO 2 availability. The cells were incubated as described in the legend to Fig. 2. VOL. 181, 1999 REGULATION OF P II EXPRESSION IN SYNECHOCOCCUS SP. 2699 on July 24, 2017 by USE/BTCA.GENERAL UNIVERSITARIA Sevillahttp://jb.asm.org/Downloaded from P II isoforms, P II0 ,P II1 ,P II2 , and P II3 , which possess either zero, one, two or three phosphorylated monomers, respectively, varied with both the nitrogen supply and the concentration of CO 2 (Fig. 6). In the presence of ammonium, whatever the CO 2 level, or in the presence of nitrate under low CO 2 ,P II was mainly unphosphorylated. Three to four isoforms were observed in the presence of nitrate under high CO 2 and in nitrogen-limiting conditions under both high and low CO 2 .Inthe NtcA null mutant, whatever the availability of CO 2 ,P II remained unphosphorylated in cells incubated in the presence of ammonium, as in the wild-type cells. In contrast, only two (under high CO 2 ) to three (under low CO 2 ) isoforms were observed when the cells were incubated with nitrate or under nitrogen limitation. As expected, the same results were obtained under both nitrogen conditions, since the NtcA-defi- cient mutant is impaired in the expression of a number of genes involved in nitrogen assimilation (48). Addition of ammonium to the nitrogen-starved cells led to a complete dephosphorylation of P II in the NtcA null mutant, as in the wild type. Therefore, NtcA is not required for the dephosphorylation of P II but only for the accumulation of phosphorylated forms in response to both the nitrogen and carbon sources. DISCUSSION In this study, a role for the global nitrogen regulator NtcA in the control of the transcription of the glnB gene, which encodes the signal transduction P II protein, in response to changes in the availability of nitrogen and carbon in the environment has been demonstrated in the unicellular cyanobacterium Synechococcus sp. strain PCC 7942. At least two distinct promoter-like structures have been identified that control the expression of the unique glnB gene in Synechococcus sp. strain PCC 7942, depending on the nitrogen supply and CO 2 concentration. The first, located upstream from tsp1, is of the common s 70 E. coli type. It yields constitutive levels of glnB mRNA in both wild-type and NtcA null mutant cells. The second, located upstream from tsp2, is activated by the global nitrogen regulator NtcA. The putative NtcA-binding site from the Synechococcus glnB promoter exactly matches the consensus sequence (GTAN 8 TAC), as is the case with other genes from this organism, such as glnA,ntcA, and the nir operon (Fig. 1). However, there is obviously a different binding affinity for the glnB and the glnA promoter regions (Fig. 4). Previous in vitro studies have shown that NtcA from the filamentous heterocystous cyanobacterium Anabaena sp. strain PCC 7120 displays different affinities, depending on the target genes (40). A similar type of control could occur in Synechococcus sp. strain PCC 7942. The abundance of the NtcA-dependent transcripts is inversely correlated with the availability of nitrogen and increases with higher CO 2 concentrations (Fig. 3). This positive effect of CO 2 could be exerted by CO 2 itself or by a metabolite derived from its fixation. A corresponding decrease in the level of the transcripts that initiate at tsp1 is particularly evident in cells incubated with high CO 2 . This would result if the binding of NtcA to the tsp2 transcript species prevents the RNA polymerase from initiating transcription from the more distal tsp1 promoter region, and it is not due to a specific recognition of the tsp1 promoter region by NtcA, since no NtcA consensus sequence is present in that region. In Synechocystis sp. strain PCC 6803, nitrogen availability and electron transport have been shown to control the expression of the glnA and glnB genes (21). In this cyanobacterium, one putative promoter of the glnB gene is constitutively expressed at a very low level in the absence of nitrogen and in the presence of ammonium and/or nitrate. The other promoter is functional only in cells starved for nitrogen (21). Therefore, the glnB control system in Synechocystis sp. strain PCC 6803, as well as those of other genes (e.g., icd, encoding NADP 1 -iso- citrate dehydrogenase, and glnA and glnN, encoding glutamine synthetases I and III) (38, 42), differs from the one that operates in Synechococcus sp. strain PCC 7942 for glnA (6, 30) and glnB (Fig. 3), in which the inducible promoter is active in cells grown both in the absence of nitrogen and in the presence of nitrate. Moreover, the physical organizations of the promoter regions in these two strains differ. In contrast to Synechocystis sp. strain PCC 6803, in Synechococcus sp. strain PCC 7942 the two promoter sequences do not overlap and the constitutively expressed promoter is upstream of the nitrogen-regulated one (Fig. 7). Two types of promoters for the genes encoding P II and P II -like proteins that recognize either s 70 or a nitrogen-regu- lated RNA polymerase are commonly found in bacteria. Their physical organization and their levels of expression may vary, depending on the organism, but in most cases nitrogen control is exerted from a s 54 -dependent promoter through the NtrC protein (2, 5, 9–11, 17, 25, 29, 34, 36, 37, 46, 47, 50, 51). In this study, we did not look at the kinetics of phosphorylation and dephosphorylation of P II in the wild-type and mutant strains in response to nitrogen shifts. Therefore, we do not know whether the accumulation of the phosphorylated forms of P II depends on a kinase or a phosphatase activity. Nevertheless, the dephosphorylation of P II in the presence of ammonium appears to be NtcA independent, while the accumulation of the phosphorylated forms is at least in part NtcA dependent in Synechococcus sp. strain PCC 7942 (Fig. 6, compare lanes 3). The transcriptional activator NtcA might therefore modulate the phosphorylation state of P II in response to FIG. 6. In vivo phosphorylation of the P II protein in cells of wild-type Synechococcus sp. strain PCC 7942 (WT) and the NtcA-deficient mutant (NtcA 2 )in response to the nature of the nitrogen source and CO 2 availability. Lanes 1 to 3, the cells were incubated as described in the legend to Fig. 2. Lanes 4, cells starved for nitrogen as in lanes 3 were further incubated for 2 h following addition of ammonium to the culture medium. P II0 ,P II1 ,P II2 , and P II3 correspond to the four isoforms of the trimeric P II protein containing zero, one, two, or three phosphorylated monomers. FIG. 7. Comparison of the physical organization of the promoter regions of the glnB genes from Synechococcus sp. strain PCC 7942 and Synechocystis sp. strain PCC 6803. 2700 LEE ET AL. J. BACTERIOL. on July 24, 2017 by USE/BTCA.GENERAL UNIVERSITARIA Sevillahttp://jb.asm.org/Downloaded from the intracellular N-C balance by directly or indirectly controlling the synthesis, activity, and/or stability of the serine kinasephosphatase enzyme system, which posttranslationally modifies P II . At present, in Synechococcus sp. strain PCC 7942, we do not know whether NtcA is a single protein or a complex of one or more proteins or if it needs to be liganded to some effector(s) or posttranslationally modified to be active or to modulate its activity, depending on environmental conditions. The effect of NtcA on the activation of transcription of the glnB gene in Synechococcus sp. strain PCC 7942 and on the increased phosphorylation state of the protein could result from a higher level of expression of the corresponding ntcA gene and/or from a greater affinity of this regulator for its target sites under a high CO 2 concentration. Whether this is due to an increased electron transport activity or to the presence of a specific CO 2 fixation product(s) remains to be elucidated. The fact that the concentration of 2-oxoglutarate varies greatly in cyanobacterial cells, depending on the supply of carbon and nitrogen (8, 33, 35, 38), and that this is a very important metabolite involved in the regulation of nitrogen assimilation pathways in cyanobacteria and other prokaryotes (15, 35, 31) favors the hypothesis that this compound could play a key role in the regulatory system that coordinates the corresponding metabolic processes via P II and NtcA. ACKNOWLEDGMENTS We are grateful to M. Herdman for critical reading of the manuscript. We also thank J. Houmard, J. Gomez Ochoa de Alda, and I. Luque for helpful discussions and A. Vioque for kindly providing the plasmid containing the rnpB gene from Synechococcus sp. strain PCC 7942. This work was supported by the Institut Pasteur and the Centre National de la Recherche Scientifique (URA 1129), by grant PB 95- 1267 from the Dirrecio´n General Ensenanza Superior, and, in part, by a joint Picasso program from the Ministe`re des Affaires Etrange`res (France) and the Ministerio de Educacio´n y Ciencia (Spain). REFERENCES 1. Aichi, M., and T. Omata. 1997. Involvement of NtcB, a LysR family transcription factor, in nitrite activation of the nitrate assimilation operon in the cyanobacterium Synechococcus sp. strain PCC 7942. J. Bacteriol. 179:4671– 4675. 2. Amar, M., E. J. Patriarca, G. Manco, P. Bernard, A. Riccio, A. Lamberti, R. Defez, and M. Iaccarino. 1994. Regulation of nitrogen metabolism is altered in a glnB mutant strain of Rhizobium leguminosarum. Mol. Microbiol. 11: 685–693. 3. Banta, A. B., E. S. Haas, J. W. Brown, and N. R. Pace. 1992. Sequence of the ribonuclease P RNA gene from the cyanobacterium Anacystis nidulans. Nucleic Acids Res. 20:911. 4. Bradley, R. L., and K. J. Reddy. 1997. Cloning, sequencing, and regulation of the global nitrogen regulator gene ntcA in the unicellular diazotrophic cyanobacterium Cyanothece sp. strain BH68K. J. Bacteriol. 179:4407–4410. 5. Chiurazzi, M., and M. Iaccarino. 1990. Transcriptional analysis of the glnB- glnA region of Rhizobium leguminosarum biovar viciae. Mol. Microbiol. 4:1727–1735. 6. Cohen-Kupiec, R., M. Gurevitz, and A. Zilberstein. 1993. Expression of glnA in the cyanobacterium Synechococcus sp. strain PCC 7942 is initiated from a single nif-like promoter under various nitrogen conditions. J. Bacteriol. 175: 7727–7731. 7. Cohen-Kupiec, R., A. Zilberstein, and M. Gurevitz. 1995. Characterization of cis elements that regulate the expression of glnA in Synechococcus sp. strain PCC 7942. J. Bacteriol. 177:2222–2226. 8. Coronil, T., C. Lara, and M. G. Guerrero. 1993. Shift in carbon flow and stimulation of amino-acid turnover induced by nitrate and ammonium assimilation in Anacystis nidulans. Planta 189:461–467. 9. de Zamaroczy, M., F. Delorme, and C. Elmerich. 1990. Characterization of three different nitrogen-regulated promoter regions for the expression of glnB and glnA in Azospirillum brasilense. Mol. Gen. Genet. 224:421–430. 10. de Zamaroczy, M., A. Paquelin, and C. Elmerich. 1993. Functional organization of the glnB-glnA cluster of Azospirillum brasilense. J. Bacteriol. 175: 2507–2515. 11. de Zamaroczy, M., A. Paquelin, G. Pletre, K. Forchhammer, and C. Elmerich. 1996. Coexistence of two structurally similar but functionally different P II proteins in Azospirillum brasilense. J. Bacteriol. 178:4143–4149. 12. Flores, E., and A. Herrero. 1994. Assimilatory nitrogen metabolism and its regulation, p. 487–517. In D. A. Bryant (ed.), The molecular biology of cyanobacteria. Kluwer Academic Publishers, Dordrecht, The Netherlands. 13. Forchhammer, K., and A. Hedler. 1997. Phosphoprotein P II from cyanobacteria. Analysis of functional conservation with the P II signal-transduction protein from Escherichia coli. Eur. J. Biochem. 244:869–875. 14. Forchhammer, K., and N. Tandeau de Marsac. 1994. The P II protein in the cyanobacterium Synechococcus sp. strain PCC 7942 is modified by serine phosphorylation and signals the cellular N-status. J. Bacteriol. 176:84–91. 15. Forchhammer, K., and N. Tandeau de Marsac. 1995. Functional analysis of the phosphoprotein P II (glnB gene product) in the cyanobacterium Synechococcus sp. strain PCC 7942. J. Bacteriol. 177:2033–2040. 16. Forchhammer, K., and N. Tandeau de Marsac. 1995. Phosphorylation of the P II protein (glnB gene product) in the cyanobacterium Synechococcus sp. strain PCC 7942: analysis of in vitro kinase activity. J. Bacteriol. 177:5812– 5817. 17. Foster-Hartnett, D., and R. G. Kranz. 1994. The Rhodobacter capsulatus glnB gene is regulated by NtrC at tandem rpoN-independent promoters. J. Bacteriol. 176:5171–5176. 18. Frı´as, J. E., E. Flores, and A. Herrero. 1994. Requirement of the regulatory protein NtcA for the expression of nitrogen assimilation and heterocyst development genes in the cyanobacterium Anabaena sp. PCC 7120. Mol. Microbiol. 14:823–832. 19. Frı´as, J. E., E. Flores, and A. Herrero. 1997. Nitrate assimilation gene cluster from the heterocyst-forming cyanobacterium Anabaena sp. strain PCC 7120. J. Bacteriol. 179:477–486. 20. Frı´as, J. E., A. Me´rida, A. Herrero, J. Martı´n-Nieto, and E. Flores. 1993. General distribution of the nitrogen control gene ntcA in cyanobacteria. J. Bacteriol. 175:5710–5713. 21. Garcia-Dominguez, M., and F. J. Florencio. 1997. Nitrogen availability and electron transport control the expression of glnB gene (encoding P II protein) in the cyanobacterium Synechocystis sp. PCC 6803. Plant Mol. Biol. 35:723– 734. 22. Harano, Y., I. Suzuki, S.-I. Maeda, T. Kaneko, S. Tabata, and T. Omata. 1997. Identification and nitrogen regulation of the cyanase gene from the cyanobacteria Synechocystis sp. strain PCC 6803 and Synechococcus sp. strain PCC 7942. J. Bacteriol. 179:5744–5750. 23. Irmler, A., S. Sanner, H. Dierks, and K. Forchhammer. 1997. Dephosphorylation of the phosphoprotein P II in Synechococcus PCC 7942: identification of an ATP and 2-oxoglutarate-regulated phosphatase activity. Mol. Microbiol. 26:81–90. 24. Jiang, F., B. Mannervik, and B. Bergman. 1997. Evidence for redox regulation of the transcription factor NtcA, acting both as an activator and a repressor, in the cyanobacterium Anabaena PCC 7120. Biochem. J. 327:513– 517. 25. Johansson, M., and S. Nordlund. 1996. Transcription of the glnB and glnA genes in the photosynthetic bacterium Rhodospirillum rubrum. Microbiology 142:1265–1272. 26. Kikuchi, H., M. Aichi, I. Suzuki, and T. Omata. 1996. Positive regulation by nitrite of the nitrate assimilation operon in the cyanobacteria Synechococcus sp. strain PCC 7942 and Plectonema boryanum. J. Bacteriol. 178:5822–5825. 27. Lee, H. M., E. Flores, A. Herrero, J. Houmard, and N. Tandeau de Marsac. 1998. A role for the signal transduction protein P II in the control of nitrate/ nitrite uptake in a cyanobacterium. FEBS Lett. 427:291–295. 28. Liotenberg, S., D. Campbell, R. Rippka, J. Houmard, and N. Tandeau de Marsac. 1996. Effect of the nitrogen source on phycobiliprotein synthesis and cell reserves in a chromatically adapting filamentous cyanobacterium. Microbiology 142:611–622. 29. Liu, J., and B. Magasanik. 1993. The glnB region of the Escherichia coli chromosome. J. Bacteriol. 175:7441–7449. 30. Luque, I., E. Flores, and A. Herrero. 1994. Molecular mechanism for the operation of nitrogen control in cyanobacteria. EMBO J. 13:2862–2869. 31. Magasanik, B., and F. C. Neidhardt. 1987. Regulation of carbon and nitrogen utilization, p. 1318–1325. In F. C. Neidhardt, J. L. Ingraham, K. B. Low, B. Magasanik, M. Schaechter, and H. E. Umbarger (ed.), Escherichia coli and Salmonella typhimurium: cellular and molecular biology. American Society for Microbiology, Washington, D.C. 32. Markwell, M. A., S. M. Haas, L. L. Bieber, and N. E. Tolbert. 1978. A modification of the Lowry procedure to simplify protein determination in membrane and lipoprotein samples. Anal. Biochem. 87:206–210. 33. Marque´s, S., A. Me´rida, P. Candau, and F. J. Florencio. 1992. Light-medi- ated regulation of glutamine-synthetase activity in the unicellular cyanobacterium Synechococcus sp. PCC 6301. Planta 187:247–253. 34. Martin, G. B., M. F. Thomashow, and B. K. Chelm. 1989. Bradyrhizobium japonicum glnB, a putative nitrogen-regulatory gene, is regulated by NtrC at tandem promoters. J. Bacteriol. 171:5638–5645. 35. Me´rida, A., P. Candau, and F. J. Florencio. 1991. Regulation of glutamine synthetase activity in the unicellular cyanobacterium Synechococcus sp. strain PCC 6803 by the nitrogen source: effect of ammonium. J. Bacteriol. 173: 4095–4100. VOL. 181, 1999 REGULATION OF P II EXPRESSION IN SYNECHOCOCCUS SP. 2701 on July 24, 2017 by USE/BTCA.GENERAL UNIVERSITARIA Sevillahttp://jb.asm.org/Downloaded from 36. Michel-Reydellet, N., N. Desnoues, C. Elmerich, and P. A. Kaminski. 1997. Characterization of Azorhizobium caulinodans glnB and glnA genes: involvement of the P II protein in symbiotic nitrogen fixation. J. Bacteriol. 179:3580– 3587. 37. Moreno, S., E. J. Patriarca, M. Chiurazzi, R. Meza, R. Defez, A. Lamberti, A. Riccio, M. Iaccarino, and G. Espin. 1993. Phenotype of a Rhizobium leguminosarum ntrC mutant. Res. Microbiol.143:161–171. 38. Muro-Pastor, M. I., J. C. Reyes, and F. J. Florencio. 1996. The NADP1- isocitrate dehydrogenase gene (icd) is nitrogen regulated in cyanobacteria. J. Bacteriol. 178:4070–4076. 39. Omata, T. 1995. Structure, function and regulation of the nitrate transport system of the cyanobacterium Synechococcus sp. PCC7942. Plant Cell Physiol. 36:207–213. 40. Ramasubramanian, T. S., T. F. Wei, and J. W. Golden. 1994. Two Anabaena sp. strain PCC 7120 DNA-binding factors interact with vegetative cell- and heterocyst-specific genes. J. Bacteriol. 176:1214–1223. 41. Reitzer, L. 1996. Ammonia assimilation and the biosynthesis of glutamine, glutamate, aspartate, asparagine, L-alanine, and D-alanine, p. 391–407. In F. Neidhardt, R. Curtiss III, J. L. Ingraham, E. C. C. Lin, K. B. Low, B. Magasanik, W. S. Reznikoff, M. Riley, M. Schaechter, and H. E. Umbarger (ed.), Escherichia coli and Salmonella typhimurium: cellular and molecular biology, 2nd ed., vol. 1. American Society for Microbiology, Washington, D.C. 42. Reyes, J. C., M. I. Muro-Pastor, and F. J. Florencio. 1997. Transcription of glutamine synthetase genes (glnA and glnN) from the cyanobacterium Synechocystis sp. strain PCC 6803 is differently regulated in response to nitrogen availability. J. Bacteriol. 179:2678–2689. 43. Rippka, R., and M. Herdman. 1992. Pasteur culture collection of cyanobacterial strains in axenic culture, p. 1–103. In Catalogue & Taxonomic Handbook, vol. I. Catalogue of Strains. Institut Pasteur, Paris, France. 44. Suzuki, I., N. Horie, T. Sugiyama, and T. Omata. 1995. Identification and characterization of two nitrogen-regulated genes of the cyanobacterium Synechococcus sp. strain PCC 7942 required for maximum efficiency of nitrogen assimilation. J. Bacteriol. 177:290–296. 45. Tsinoremas, N. F., A. M. Castets, M. A. Harrison, J. F. Allen, and N. Tandeau de Marsac. 1991. Photosynthetic electron transport controls nitrogen assimilation in cyanobacteria by means of posttranslational modification of the glnB gene product. Proc. Natl. Acad. Sci. USA 88:4565–4569. 46. Van Heeswijk, W. C., B. Stegeman, S. Hoving, D. Molenaar, D. Kahn, and H. V. Westerhoff. 1995. An additional P II in Escherichia coli: a new regulatory protein in the glutamine synthetase cascade. FEMS Microbiol. Lett. 132: 153–157. 47. Van Heeswijk, W. C., S. Hoving, D. Molenaar, B. Stegeman, D. Kahn, and H. V. Westerhoff. 1996. An alternative P II protein in the regulation of glutamine synthetase in Escherichia coli. Mol. Microbiol. 21:133–146. 48. Vega-Palas, M. A., E. Flores, and A. Herrero. 1992. NtcA, a global nitrogen regulator from the cyanobacterium Synechococcus that belongs to the Crp family of bacterial regulators. Mol. Microbiol. 6:1853–1859. 49. Wei, T. F., T. S. Ramasubramanian, F. Pu, and J. W. Golden. 1993. Anabaena sp. strain PCC 7120 bifA gene encoding a sequence-specific DNA- binding protein cloned by in vivo transcriptional interference selection. J. Bacteriol. 175:4025–4035. 50. Wray, L. V., Jr., M. R. Atkinson, and S. H. Fisher. 1994. The nitrogenregulated Bacillus subtilis nrgAB operon encodes a membrane protein and a protein highly similar to the Escherichia coli glnB-encoded P II protein. J. Bacteriol. 176:108–114. 51. Zinchenko, V., Y. Churin, V. Shestopalov, and S. Shestakov. 1994. Nucleotide sequence and characterization of the Rhodobacter sphaeroides glnB and glnA genes. Microbiology 140:2143–2151. 2702 LEE ET AL. J. BACTERIOL. on July 24, 2017 by USE/BTCA.GENERAL UNIVERSITARIA Sevillahttp://jb.asm.org/Downloaded from