The RNAi Machinery in the Fungus Fusarium fujikuroi Is Not Very Active in Synthetic Medium and Is Related to Transposable Elements

Citation: Pardo-Medina, J.; Dahlmann, T.A.; Nowrousian, M.; Limón, M.C.; Avalos, J. The RNAi Machinery in the Fungus Fusarium fujikuroi Is Not Very Active in Synthetic Medium and Is Related to Transposable Elements. Non-Coding RNA 2024,10, 31. https://doi.org/ 10.3390/ncrna10030031 Academic Editor: Gunter Meister Received: 5 March 2024 Revised: 2 May 2024 Accepted: 10 May 2024 Published: 16 May 2024 Copyright: © 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https:// creativecommons.org/licenses/by/ 4.0/). non-coding RNA Article The RNAi Machinery in the Fungus Fusarium fujikuroi Is Not Very Active in Synthetic Medium and Is Related to Transposable Elements Javier Pardo-Medina 1, Tim A. Dahlmann 2, Minou Nowrousian 2, M. Carmen Limón1,* and Javier Avalos 1,* 1 Departamento de Genética, Facultad de Biología, Universidad de Sevilla, 41012 Seville, Spain; [email protected] 2Department of Molecular and Cellular Botany, Ruhr-University Bochum, ND 7/176 Universitätsstr. 150, 44780 Bochum, Germany; [email protected]-uni-bochum.de (T.A.D.); [email protected] (M.N.) *Correspondence: [email protected] (M.C.L.); [email protected] (J.A.) Abstract: Small RNAS (sRNAs) participate in regulatory RNA interference (RNAi) mechanisms in a wide range of eukaryotic organisms, including fungi. The fungus Fusarium fujikuroi, a model for the study of secondary metabolism, contains a complete set of genes for RNAi pathways. We have analyzed by high-throughput sequencing the content of sRNAs in total RNA samples of F. fujikuroi grown in synthetic medium in the dark or after 1 h of illumination, using libraries below 150 nt, covering sRNAs and their precursors. For comparison, a parallel analysis with Fusarium oxysporum was carried out. The sRNA reads showed a higher proportion of 5 ′ uracil in the RNA samples of the expected sizes in both species, indicating the occurrence of genuine sRNAs, and putative miRNA-like sRNAs (milRNAS) were identified with prediction software. F. fujikuroi carries at least one transcriptionally expressed Ty1/copia-like retrotransposable element, in which sRNAs were found in both sense and antisense DNA strands, while in F. oxysporum skippy-like elements also show sRNA formation. The finding of sRNA in these mobile elements indicates an active sRNA-based RNAi pathway. Targeted deletion of dcl2, the only F. fujikuroi Dicer gene with significant expression under the conditions tested, did not produce appreciable phenotypic or transcriptomic alterations. Keywords: sRNA; RNA interference; Fusarium fujikuroi;Fusarium oxysporum; high-throughput sequencing; transposable elements; Dicer gene 1. Introduction Small non-coding RNAs (sRNAs) play very diverse regulatory roles in most biological systems, often interfering with the expression of other genes, a phenomenon known generically as RNA interference (RNAi). Among them, microRNAs (miRNAs) stand out as a large family of sRNAs with conserved regulatory functions in eukaryotes [1], usually involved in the suppression of gene expression through sequence-specific messenger RNA degradation, translational repression, or transcriptional inhibition [ 2 ]. RNA co-suppression was initially described in plants [ 3 ], but fungi have played an important role since the pioneering discovery of quelling in Neurospora crassa [ 4 ], and the subsequent finding of other RNAi mechanisms mediated by sRNAs in this and other fungi [5,6]. Fungal RNAi pathways show considerable plasticity and have evolved to regulate very diverse cell activities [ 7 ]. In most cases, they share the core components, which are conserved in other kingdoms. Fungal sRNAs derive from double-strand RNA precursors which are recognized and processed by a Dicer-like RNase III. These sRNA duplexes, typically 20–25 nt, are subsequently incorporated into an Argonaute (Ago) protein. Ago functions as an sRNA-guided endonuclease, recognizing target mRNAs or DNA loci by sequence complementarity with the incorporated sRNA, usually involved in tran-scriptional Non-Coding RNA 2024,10, 31. https://doi.org/10.3390/ncrna10030031 https://www.mdpi.com/journal/ncrna Non-Coding RNA 2024,10, 31 2 of 18 or post-transcriptional gene silencing. In some cases, an RNA-dependent RNA polymerase (RdRP) generates a double-stranded RNA (dsRNA) from a single-stranded RNA by de novo primer-independent second-strand synthesis using sRNAs as primers. The resulting RNA molecules can be complementary to target mRNAs, which act as inducers or amplifiers of the RNAi signal [ 2 ]. These core components of the pathway are present in most fungal phyla but there are relevant exceptions, such as the subphylum Saccharomycotina [ 8 ]. Fungal RNAi-related sRNAs can be divided into two main subclasses according to their biological role: protective sRNAs and regulatory sRNAs [6]. Those in the first group are involved in genome defense, which is probably the original evolutionary function of RNAi systems. These sRNAs include those involved in the phenomenon known as “quelling” in N. crassa, the first RNAi process described in fungi, which silences highly homologous repetitive elements in the genome [ 4 , 9 ]. Repetitive DNA sequences, whether exogenous, such as transgenes, or endogenous, such as fungal transposable elements and ribosomal genes (rDNA), are potential sources of genome instability. The post-transcriptional gene silencing of target genes is caused by the binding of double-stranded small interfering RNAs (siRNAs) to an Ago protein that forms the RNA-induced silencing complex (RISC), which in turn recognizes and degrades target mRNAs [ 10 , 11 ]. Other defense responses occur specifically during the sexual cycle, such as meiotic silencing by unpaired DNA (MSUD) in N. crassa [ 12 ] or the sex-induced silencing (SIS) in Cryptococcus neoformans [ 13 ]. MSUD has been also described in Gibberella zeae [ 14 ]. Other defense sRNAs act as antivirals that function as an innate immune system in fungi, such as those studied in Cryphonectria parasitica and Fusarium graminearum [ 15 ]. Primary sRNAs found in Schizosaccharomyces pombe, which govern the formation of heterochromatin in centromeric regions and appear to play an essential role in the evolution of the centromere, are also related to repetitive sequences [16]. Regulatory sRNAs, basically distributed in small interfering RNAs (siRNAs) and microRNAs (miRNAs), make up a vast network in plants and animals that plays a fundamental role in the control of gene expression [ 1 ]. Their discovery in fungi started with miRNAs and other regulatory sRNAs in N. crassa [ 17 ] and Mucor circinelloides [ 18 ]. Those of N. crassa, termed miRNA-like small RNAs (milRNAs), are subdivided into four classes depending on the RNAi components required for their biogenesis [ 6 ] and are derived from single-strand RNA precursors that form a typical hairpin structure. Its dsRNA region is processed to generate two complementary sRNAs; one of them is predominantly conserved, while the other is degraded. Typically, milRNAs present a strong bias for uracil bases at their 5 ′ termini [ 17 ]. milRNAs have been described in a wide variety of fungi, are not highly conserved, and their precursors may differ in their origin and processing [ 1 , 19 ]. milRNAs have not yet been identified in M. circinelloides and related fungi, but this species accumulates a wide variety of sRNA molecules generated by canonical and non-canonical RNAi pathways. The genesis of siRNAs is Dicer-dependent, most of them derived from exons (ex-siRNAs), while RdRP-dependent degraded RNAs (rdRNAs) are Dicer-independent and are generated by an RdRP, and correspond to the non-random degradation products of specific mRNA molecules capable of controlling mRNA levels [2,20]. Examples of sRNAs, including milRNAs and ex-siRNAs, have been found in Fusarium or close species. milRNAs such as those discovered in N. crassa have been described in T. reesei [21], F. oxysporum [22], and F. graminerarum [23]. In Trichoderma atroviride, a fungus with industrial and agronomic applications, the deletion of the different genes that encode Ago, Dicer, and RdRP produces aberrant conidia and vegetative growth [ 24 ]. Different components of the RNAi machinery are also involved in the formation of sexual spores after mating in F. graminearum [ 23 ], as well as in conidiation, virulence, and deoxynivalenol production [ 25 ]. In addition, a specific milRNA was found to regulate biotin synthesis [ 26 ] in this species. In F. oxysporum, a widely used model of phytopathogenesis, one of the Ago proteins has been described to be involved in virulence [27]. Our group focuses on the regulatory mechanisms of secondary metabolism in the gibberellin-producing fungus Fusarium fujikuroi, known for its complex secondary Non-Coding RNA 2024,10, 31 3 of 18 metabolism [ 28 ]. Previous data in other Fusarium/Gibberella species, and the presence in Fusarium genomes of genes of machinery involved in miRNAs processing, suggest the involvement of sRNAs in regulatory processes in this fungus. The aim of this work is to study the presence of sRNAs in F. fujikuroi by global sequencing analysis and its comparison in a parallel study with F. oxysporum. The results indicate the presence of sRNAs but do not support a relevant regulatory role under the culture conditions investigated, except for the presumed attenuation of the activity of some transposable elements. In further support, we deleted the only Dicer gene that showed appreciable expression under the same culture conditions, resulting in no detectable phenotypic or transcriptomic alterations. 2. Results 2.1. Small RNA Machinery in F. fujikuroi As a first step to study the existence of miRNAs in F. fujikuroi, the occurrence of genes for the expected enzymatic machinery in its genome was analyzed. The orthologous genes of the corresponding proteins described in N. crassa were used as reference. The genes qde-2 [ 4 , 9 ], a member of the Argonaute family, dcl-1 and dcl-2, members of the RNAse III family, and qde-1, an RdRP, were used as input to perform BLAST searches for orthologs in the F. fujikuroi genome. As a result, ten genes were found: three genes belonging to the Argonaute family, FFUJ_00855,FFUJ_06303, and FFUJ_06580, denominated ago1,ago2, and ago3; two RNAse III genes, FFUJ_08936 and FFUJ_09877, named dcl1 and dcl2; and five genes corresponding to RdRPs, FFUJ_01792,FFUJ_03509,FFUJ_03638,FFUJ_07230, and FFUJ_14261, in turn rdr1–5. Subsequently, their sequences were analyzed using the PFAM protein domain database [29] and the results are depicted in Figure 1. Non-Coding RNA 2024, 10, x FOR PEER REVIEW 3 of 19 Our group focuses on the regulatory mechanisms of secondary metabolism in the gibberellin-producing fungus Fusarium fujikuroi, known for its complex secondary metabolism [28]. Previous data in other Fusarium/Gibberella species, and the presence in Fusarium genomes of genes of machinery involved in miRNAs processing, suggest the involvement of sRNAs in regulatory processes in this fungus. The aim of this work is to study the presence of sRNAs in F. fujikuroi by global sequencing analysis and its comparison in a parallel study with F. oxysporum. The results indicate the presence of sRNAs but do not support a relevant regulatory role under the culture conditions investigated, except for the presumed attenuation of the activity of some transposable elements. In further support, we deleted the only Dicer gene that showed appreciable expression under the same culture conditions, resulting in no detectable phenotypic or transcriptomic alterations. 2. Results 2.1. Small RNA Machinery in F. fujikuroi As a first step to study the existence of miRNAs in F. fujikuroi, the occurrence of genes for the expected enzymatic machinery in its genome was analyzed. The orthologous genes of the corresponding proteins described in N. crassa were used as reference. The genes qde-2 [4,9], a member of the Argonaute family, dcl-1 and dcl-2, members of the RNAse III family, and qde-1, an RdRP, were used as input to perform BLAST searches for orthologs in the F. fujikuroi genome. As a result, ten genes were found: three genes belonging to the Argonaute family, FFUJ_00855, FFUJ_06303, and FFUJ_06580, denominated ago1, ago2, and ago3; two RNAse III genes, FFUJ_08936 and FFUJ_09877, named dcl1 and dcl2; and five genes corresponding to RdRPs, FFUJ_01792, FFUJ_03509, FFUJ_03638, FFUJ_07230, and FFUJ_14261, in turn rdr1–5. Subsequently, their sequences were analyzed using the PFAM protein domain database [29] and the results are depicted in Figure 1. Figure 1. Protein domains of the potential components of the RNAi machinery in F. fujikuroi. The gray bars correspond to the complete sequence of the predicted protein and expected numbers of amino acids (aa) are indicated on the right. Domains represented as colored boxes are: DUF1785 (green, domain of unknown function); PAZ (red, Piwi/Argonaute /Zwille); PIWI (blue); ResIII (dark blue, type III restriction enzyme res subunits); HelC (clear blue, conserved C-terminal helicase domain); Dicer dimer (purple, Dicer dimerization domain); RNAse III (yellow, ribonuclease domain III); DEAD (pale green, domain of the DEAD-like helicase superfamily); DSRM (pink, doublestranded RNA binding motif); RdRP (green, RNA-dependent RNA polymerase); AAA (orange, AAA domain, from ATPase associated with various cellular activities). The three Ago proteins of F. fujikuroi have all the known domains of the Argonaute family (DUF1785, PAZ, and Piwi). The two Dicer proteins also have typical features of the Figure 1. Protein domains of the potential components of the RNAi machinery in F. fujikuroi. The gray bars correspond to the complete sequence of the predicted protein and expected numbers of amino acids (aa) are indicated on the right. Domains represented as colored boxes are: DUF1785 (green, domain of unknown function); PAZ (red, Piwi/Argonaute/Zwille); PIWI (blue); ResIII (dark blue, type III restriction enzyme res subunits); HelC (clear blue, conserved C-terminal helicase domain); Dicer dimer (purple, Dicer dimerization domain); RNAse III (yellow, ribonuclease domain III); DEAD (pale green, domain of the DEAD-like helicase superfamily); DSRM (pink, double-stranded RNA binding motif); RdRP (green, RNA-dependent RNA polymerase); AAA (orange, AAA domain, from ATPase associated with various cellular activities). Non-Coding RNA 2024,10, 31 4 of 18 The three Ago proteins of F. fujikuroi have all the known domains of the Argonaute family (DUF1785, PAZ, and Piwi). The two Dicer proteins also have typical features of the RNAse III family. The five putative RdRPs have their characteristic domain; it is worth noting that FFUJ_03638 also presents ATPase domains. The presence of complete machinery led us to perform a global analysis of the presence of small RNAs in F. fujikuroi. To verify its prevalence in Fusarium, taking advantage of the previous availability of total RNA samples, the analysis was extended to F. oxysporum. 2.2. Sequencing and Characterization of Small RNAs in F. fujikuroi and F. oxysporum Total RNA samples of wild-type strains of F. fujikuroi and F. oxysporum from a previous transcriptomic analysis [ 30 ] were used to search for sRNA. Mycelia grown for 3 days in darkness were illuminated for 1 h or kept in darkness. Therefore, the RNA extraction method and quality parameters were as previously described. Illumination for 1 h was chosen because it was the maximum response time to the upregulation of photoinduced gene mRNAs previously investigated in both fungi [ 31 , 32 ]. RNAs from two samples of each condition with a size below 150 nt, covering sRNAs and their precursors, were used to construct the sRNA libraries. To find all miRNA-like RNAs, total reads of samples of each species from both culture conditions were merged into a single file. The sRNAs were mapped to the genome of the respective species so that reads that occurred several times within the dataset were collapsed to a single entry and their read count was added to the fasta header, decreasing file size without losing information. The alignment results of the collapsed reads are shown in Supplementary Table S1. As an additional benefit of using collapsed reads, the overestimation of over-represented reads, such as those originating from tRNAs and rRNAs, is decreased (Supplementary Table S2). However, while redundant reads showed only a small proportion in the merged reads of F. fujikuroi (8.5%), they were predominant in F. oxysporum (82.5%), indicating that an over-represented amount of rRNAs and tRNAs was incorporated during the preparation of the F. oxysporum library. This was checked by mapping the F. fujikuroi and F. oxysporum reads to the tRNA and rRNA sequences, which allowed the discarding of the tRNA- and rRNA-derived repetitive sequences (details in Section 4.3). Dicer-like RNases III process many fungal sRNAs, such as siRNAs and the majority of milRNAs. It was shown that sRNAs processed by Dicer-like endonucleases show a strong preference for a size of 19 to 22 nt and a 5 ′ uracil [ 17 , 33 , 34 ]. Thus, size distribution and 5 ′ nucleotide preference analyses of mapped total and collapsed sRNA reads were performed (Figure 2a,b). To elucidate the existence of ‘true’ sRNAs, the proportion of the four nucleotides at the first position was analyzed for the collapsed reads (Figure 2c). The results showed an increased proportion of 5 ′ uracil in the expected sizes RNA samples for both species. 2.3. Origin of sRNAs in F. fujikuroi and F. oxysporum The increased amount of sRNAs starting with uracil is consistent with the presence of small interfering RNAs (siRNAs). Functional RNAi machinery was described in F. graminearum [ 35 ]; therefore, it may also be present in F. fujikuroi and F. oxysporum. If sRNA originates from double-stranded RNAs, which are produced by RNA-dependent RNA polymerases as a counter-reaction to retrotransposons or to other endogenous transcripts, we should be able to identify transcribed loci that produce sRNAs from both DNA strands. Non-Coding RNA 2024,10, 31 5 of 18 Non-Coding RNA 2024, 10, x FOR PEER REVIEW 5 of 19 Figure 2. Characterization of mapped sRNAs. (a) Size distribution of all mapped reads within the merged datasets of F. fujikuroi and F. oxysporum. (b) Size distribution of all collapsed reads within the merged datasets of both fungi. A peak at 19–22 nt was observed in F. fujikuroi, while a second peak was present between 28 and 35 nt in both fungi. The peak at 19–22 nt is typical for Dicerprocessed small RNAs. (c) Size distribution and 5′ nucleotide preference of sRNAs in F. fujikuroi and F. oxysporum. sRNAs with a size of 19 to 23 nt predominantly started with a 5′ uracil (up to 45.8% in F. fujikuroi and 40.5% in F. oxysporum), while sRNAs of other sizes showed balanced proportions for each of the four nucleotides. The peak between 19 and 23 nt was higher in F. fujikuroi than in F. oxysporum. 2.3. Origin of sRNAs in F. fujikuroi and F. oxysporum The increased amount of sRNAs starting with uracil is consistent with the presence of small interfering RNAs (siRNAs). Functional RNAi machinery was described in F. graminearum [35]; therefore, it may also be present in F. fujikuroi and F. oxysporum. If sRNA originates from double-stranded RNAs, which are produced by RNA-dependent RNA polymerases as a counter-reaction to retrotransposons or to other endogenous transcripts, we should be able to identify transcribed loci that produce sRNAs from both DNA strands. The amounts of sRNAs originated either from different parts of a gene or from multiple copy genes (rRNA and tRNA) were very similar in F. fujikuroi and F. oxysporum (Figure 3). Only the numbers of collapsed reads (x ≥ 10) mapping on the sense and antisense strands at coding sequences (CDS) (marked by red in Supplementary Table S3) varied strongly in the datasets. Interestingly, in F. fujikuroi the number of collapsed reads (x ≥ 10) mapping to CDS loci was significantly higher compared to those in F. oxysporum. This Figure 2. Characterization of mapped sRNAs. (a) Size distribution of all mapped reads within the merged datasets of F. fujikuroi and F. oxysporum. (b) Size distribution of all collapsed reads within the merged datasets of both fungi. A peak at 19–22 nt was observed in F. fujikuroi, while a second peak was present between 28 and 35 nt in both fungi. The peak at 19–22 nt is typical for Dicer-processed small RNAs. (c) Size distribution and 5 ′ nucleotide preference of sRNAs in F. fujikuroi and F. oxysporum. sRNAs with a size of 19 to 23 nt predominantly started with a 5 ′ uracil (up to 45.8% in F. fujikuroi and 40.5% in F. oxysporum), while sRNAs of other sizes showed balanced proportions for each of the four nucleotides. The peak between 19 and 23 nt was higher in F. fujikuroi than in F. oxysporum. The amounts of sRNAs originated either from different parts of a gene or from multiple copy genes (rRNA and tRNA) were very similar in F. fujikuroi and F. oxysporum (Figure 3). Only the numbers of collapsed reads (x ≥ 10) mapping on the sense and antisense strands at coding sequences (CDS) (marked by red in Supplementary Table S3) varied strongly in the datasets. Interestingly, in F. fujikuroi the number of collapsed reads (x ≥ 10) mapping to CDS loci was significantly higher compared to those in F. oxysporum. This agrees with the findings of the length and nucleotide distribution of the collapsed reads (Figure 2). It must be noted that the high number of collapsed reads mapping to CDS loci in both fungi could also be due to nonspecific mRNA-degradation. Non-Coding RNA 2024,10, 31 6 of 18 Non-Coding RNA 2024, 10, x FOR PEER REVIEW 6 of 19 agrees with the findings of the length and nucleotide distribution of the collapsed reads (Figure 2). It must be noted that the high number of collapsed reads mapping to CDS loci in both fungi could also be due to nonspecific mRNA-degradation. Figure 3. Origin of total and collapsed reads (x ≥ 10) in F. fujikuroi and F. oxysporum. CDS: coding sequence. 2.4. sRNAs Related to Transposable Elements Transposable elements are often posttranscriptionally silenced. BLAST analyses of sequences from the transposable elements skippy, Ty1/copia, and impala from F. oxysporum, HobS from F. fujikuroi, and MAGGY from Magnaporthe grisea were used to identify siRNAs that could be generated in response to these mobile genetic elements. The corresponding annotated proteins and genomic sequences were used for blastp and tblastx analyses, and the results are displayed in Table 1. Table 1. Putative transposable elements detected in F. fujikuroi and F. oxysporum genomes. Transposable Element F. fujikuroi F. oxysporum Gene ID Identity (%) E-value Gene ID Identity (%) E-value HobS FFUJ_04535 100 0 FOXG_15494 39.09 9 × 10 −142 FFUJ_02576 100 0 FOXG_12541 25.94 6 × 10 −65 FFUJ_04521 96.24 0 FOXG_15105 26.89 4 × 10 −57 FFUJ_05678 96.24 0 FOXG_06872 43.48 8 × 10 −49 FFUJ_05881 100 0 FOXG_16138 43.48 1 ×10 −48 Impala FFUJ_07491 87.35 0 chr14: 1236756-1237727 1 89.56 0 chrV: 2117840-2118331 1 29.09 7 × 10 −13 chr14: 1117562-1116699 1 87.84 0 - - - chr14: 121747-121423 1 87.80 1 × 10 −103 - - - chr1: 6134797-6136077 1 82.54 0.0 - - - chr15: 1546451-1545171 1 82.54 0.0 Ty1/copia FFUJ_08062 31.08 7 × 10 −66 chr3: 342220-343926 1 98.42 0.0 FFUJ_13355 2 31.08 7 × 10 −66 chr3: 415150-416856 1 98.42 0.0 FFUJ_00408 31.08 1 × 10 −65 chr3: 982302-984008 1 98.42 0.0 FFUJ_14407 30.59 3 × 10 −65 chr3: 3405691-3403985 1 98.42 0.0 - - - FOXG_14142 43.42 6 × 10 −62 Skippy chrIV: 3140654-3142846 1 53.08 0 chr5: 4489311- 4493195 1,2 97.99 0 Figure 3. Originoftotalandcollapsedreads(x ≥ 10)inF. fujikuroi andF. oxysporum. CDS:codingsequence. 2.4. sRNAs Related to Transposable Elements Transposable elements are often posttranscriptionally silenced. BLAST analyses of sequences from the transposable elements skippy, Ty1/copia, and impala from F. oxysporum, HobS from F. fujikuroi, and MAGGY from Magnaporthe grisea were used to identify siRNAs that could be generated in response to these mobile genetic elements. The corresponding annotated proteins and genomic sequences were used for blastp and tblastx analyses, and the results are displayed in Table 1. Table 1. Putative transposable elements detected in F. fujikuroi and F. oxysporum genomes. Transposable Element F. fujikuroi F. oxysporum Gene ID Identity (%) E-Value Gene ID Identity (%) E-Value HobS FFUJ_04535 100 0 FOXG_15494 39.09 9×10−142 FFUJ_02576 100 0 FOXG_12541 25.94 6×10−65 FFUJ_04521 96.24 0 FOXG_15105 26.89 4×10−57 FFUJ_05678 96.24 0 FOXG_06872 43.48 8×10−49 FFUJ_05881 100 0 FOXG_16138 43.48 1×10−48 Impala FFUJ_07491 87.35 0 chr14: 1236756-1237727 189.56 0 chrV: 2117840-2118331 129.09 7×10−13 chr14: 1117562-1116699 187.84 0 - - - chr14: 121747-121423 187.80 1×10−103 - - - chr1: 6134797-6136077 182.54 0.0 - - - chr15: 1546451-1545171 182.54 0.0 Ty1/copia FFUJ_08062 31.08 7×10−66 chr3: 342220-343926 198.42 0.0 FFUJ_13355 231.08 7×10−66 chr3: 415150-416856 198.42 0.0 FFUJ_00408 31.08 1×10−65 chr3: 982302-984008 198.42 0.0 FFUJ_14407 30.59 3×10−65 chr3: 3405691-3403985 198.42 0.0 - - - FOXG_14142 43.42 6×10−62 Skippy chrIV: 3140654-3142846 153.08 0 chr5: 4489311-4493195 1,2 97.99 0 chrVI: 3662701-3660476 152.96 0 DS231747: 67362-63478 197.99 0 chrIII: 4890426-4892675 149.47 0 chr14: 1418859-1422395 197.71 0 chrX: 887601-889802 152.04 0 FOXG_17761 36.73 2×10−137 FFUJ_00160 25.77 6×10−68 FOXG_17760 40.37 9×10−133 MAGGY chrX: 4392-6848 37.61 4×10−134 FOXG_17760 68.33 0.0 FFUJ_00160 26.67 3×10−78 FOXG_17761 66.33 0.0 1Unpredicted in the genome annotation. 2Transposable elements shown in Figure 4. Non-Coding RNA 2024,10, 31 7 of 18 Non-Coding RNA 2024, 10, x FOR PEER REVIEW 7 of 19 chrVI: 3662701-3660476 1 52.96 0 DS231747: 67362-63478 1 97.99 0 chrIII: 4890426-4892675 1 49.47 0 chr14: 1418859-1422395 1 97.71 0 chrX: 887601-889802 1 52.04 0 FOXG_17761 36.73 2 × 10 −137 FFUJ_00160 25.77 6 × 10 −68 FOXG_17760 40.37 9 × 10 −133 MAGGY chrX: 4392-6848 37.61 4 × 10 −134 FOXG_17760 68.33 0.0 FFUJ_00160 26.67 3 × 10 −78 FOXG_17761 66.33 0.0 1 Unpredicted in the genome annotation. 2 Transposable elements shown in Figure 4. Both Fusarium species contain transposable elements in their genomes, but this does not mean that they are active. F. fujikuroi carries at least one transcriptionally expressed copy of a Ty1/copia-like element, which is surrounded by two genes that encode uncharacterized proteins. In all three loci, most especially in the retrotransposon sequence, sRNAs were present in their sense and antisense DNA strands, a clear indication of an active siRNA-based RNAi pathway (Figure 4a). In F. oxysporum, only skippy-like elements seemed to be slightly expressed in the growth conditions studied and could be silenced by RNAi. A nonannotated example is shown in Figure 4b. Figure 4. Accumulation of sRNAs in retrotransposons. (a) In the copia in F. fujikuroi. (b) In the skippy retrotransposon in F. oxysporum. Samtools representation of small RNA mapping results under dark and light. Read counts of forward and reverse strands are shown. Differences in read counts for F. fujikuroi and F. oxysporum can be explained by weaker expression and/or lower total read counts in F. oxysporum. 2.5. Differentially Expressed sRNA-Producing Loci under Dark and Light To find sense and antisense sRNAs that can be differentially synthesized during growth in darkness and after illumination, each sample was aligned separately with the reference genome. The read counts for each dataset were calculated with the R script Figure 4. Accumulation of sRNAs in retrotransposons. (a) In the copia in F. fujikuroi. (b) In the skippy retrotransposon in F. oxysporum. Samtools representation of small RNA mapping results under dark and light. Read counts of forward and reverse strands are shown. Differences in read counts for F. fujikuroi and F. oxysporum can be explained by weaker expression and/or lower total read counts in F. oxysporum. Both Fusarium species contain transposable elements in their genomes, but this does not mean that they are active. F. fujikuroi carries at least one transcriptionally expressed copy of a Ty1/copia-like element, which is surrounded by two genes that encode uncharacterized proteins. In all three loci, most especially in the retrotransposon sequence, sRNAs were present in their sense and antisense DNA strands, a clear indication of an active siRNA- based RNAi pathway (Figure 4a). In F. oxysporum, only skippy-like elements seemed to be slightly expressed in the growth conditions studied and could be silenced by RNAi. A nonannotated example is shown in Figure 4b. 2.5. Differentially Expressed sRNA-Producing Loci under Dark and Light To find sense and antisense sRNAs that can be differentially synthesized during growth in darkness and after illumination, each sample was aligned separately with the reference genome. The read counts for each dataset were calculated with the R script summarizeOverlaps, which is part of the Bioconductor GenomicAlignments package. After normalization, the features that showed the differential formation of small RNAs were calculated with DESeq2 (adjusted p-value < 0.1). The sense strand was used as a control for the impact of altered conditions on gene expression. In the comparison of dark vs. light samples in F. fujikuroi, 18 genes were found to differentially form sRNAs under both conditions (Supplementary Table S4). Because of the absence of antisense sRNAs, these strand-specific sRNAs are very likely derived from the unspecific degradation of single-stranded mRNA. In fact, these genes were among the Non-Coding RNA 2024,10, 31 8 of 18 most light-induced in the original mRNA data [ 30 ]. Using the same analysis of sRNAs that originate from the antisense strand, either by transcription of the antisense loci or by formation of double-stranded RNAs by RdRPs, no sRNA-producing loci were found showing the differential expression of sRNA under the tested conditions. Plots of the log-fold change (FC) of the F. fujikuroi genes and their sRNA average expression are shown in Figure 5. Non-Coding RNA 2024, 10, x FOR PEER REVIEW 8 of 19 summarizeOverlaps, which is part of the Bioconductor GenomicAlignments package. After normalization, the features that showed the differential formation of small RNAs were calculated with DESeq2 (adjusted p-value < 0.1). The sense strand was used as a control for the impact of altered conditions on gene expression. In the comparison of dark vs. light samples in F. fujikuroi, 18 genes were found to differentially form sRNAs under both conditions (Supplementary Table S4). Because of the absence of antisense sRNAs, these strand-specific sRNAs are very likely derived from the unspecific degradation of single-stranded mRNA. In fact, these genes were among the most light-induced in the original mRNA data [30]. Using the same analysis of sRNAs that originate from the antisense strand, either by transcription of the antisense loci or by formation of double-stranded RNAs by RdRPs, no sRNA-producing loci were found showing the differential expression of sRNA under the tested conditions. Plots of the logfold change (FC) of the F. fujikuroi genes and their sRNA average expression are shown in Figure 5. Figure 5. Log-fold change and sRNA mean expression of sRNA-producing protein-encoding genes of F. fujikuroi and F. oxysporum. sRNAs generated in the sense and antisense orientation to the corresponding genomic features are indicated. Genes that show differential formation of sRNAs in dark vs. light are highlighted by red dots. The same calculation was also performed for F. oxysporum. No differentially expressed sRNA-producing loci were found in the sense or antisense strand that matched the criteria of log2 ± 1 and the adjusted p value < 0.1. Plots of the log2 fold change in genes from F. oxysporum and their sRNA mean expression are shown in Figure 5. 2.6. Prediction of milRNAs by miRDeep2 As a more stringent method for the detection of genuine milRNAS, we applied the miRDeep2 algorithm. As a result, very few de novo predicted putative miRNA-like RNAs were detected, most of them with a low miRDeep2 score (<5) or without showing the characteristic precursor formation, known from fungal milRNAs. In comparison with previous studies in fungi, only a few predicted milRNAs seemed “true” products of Figure 5. Log-fold change and sRNA mean expression of sRNA-producing protein-encoding genes of F. fujikuroi and F. oxysporum. sRNAs generated in the sense and antisense orientation to the corresponding genomic features are indicated. Genes that show differential formation of sRNAs in dark vs. light are highlighted by red dots. The same calculation was also performed for F. oxysporum. No differentially expressed sRNA-producing loci were found in the sense or antisense strand that matched the criteria of log2 ± 1 and the adjusted pvalue < 0.1. Plots of the log2 fold change in genes from F. oxysporum and their sRNA mean expression are shown in Figure 5. 2.6. Prediction of milRNAs by miRDeep2 As a more stringent method for the detection of genuine milRNAS, we applied the miRDeep2 algorithm. As a result, very few de novo predicted putative miRNA-like RNAs were detected, most of them with a low miRDeep2 score (<5) or without showing the characteristic precursor formation, known from fungal milRNAs. In comparison with previous studies in fungi, only a few predicted milRNAs seemed “true” products of microRNA- like Dicer-dependent processing. Putative milRNAs from F. fujikuroi are described in Supplementary Table S5 and Table 2. Non-Coding RNA 2024,10, 31 9 of 18 Table 2. Features and genomic locations of precursor transcription sites for the de novo predicted milRNAs in the merged F. fujikuroi sRNA dataset. ID Score Read Count Mature milRNA 5′-3′Sequence Physical Location 1 Genetic Location Gene Function #1 1.3 ×10134 UGGGACGAGGACAAGGCUGAA Chr VII 1735744 FFUJ_08557 ORF Antisense orientation Uncharacterized protein #2 3.8 14 UCACCGUUAGACCAUUACAG Chr VII 2455572 FFUJ_08366 promoter 451 pb upstream SC 2 Sense orientation Uncharacterized protein #3 2.7 5 GUCCUGGAGGCACUUGA Chr VII 1512406 FFUJ_08631 ORF Sense orientation Related to hydrolase #4 2.3 2 GGCGCGAGAAGAGAUCGAGGAUC Chr VII 868943 FFUJ_02416 ORF Sense orientation Related to nitrate reductase #5 2.1 3 AGCCCAAUCCUUGUGCCACU Chr II 1257164 FFUJ_04898 ORF Antisense orientation SRP40-Suppressor of mutant AC40 of RNA polymerase I and III #6 1.9 3 AGAGGAAUCGACGAUGUGACU Chr I 3119036 FFUJ_01140 promoter 652 bp upstream from SC 2 Antisense orientation Uncharacterized protein #7 1.5 68 UGCAGAGCUUAUUCUAUCCC Chr III 2168980 FFUJ_02787 promoter 2117 bp upstream from SC 2 Sense orientation Uncharacterized protein #8 1.5 330 UUAGGGUUAGGGUUAGGGUUA Chr X 2543622 Subtelomeric region No gene #9 1.4 2 UCCGAGCGCCAUGGUUGAUGAGA Chr VII 2396236 FFUJ_08382 ORF Antisense orientation Uncharacterized protein #10 0.6 25 UUCCACUACCUAUGGUCGUAU Chr II 2372098 EFFFUG00000000016 ORF Antisense orientation #11 0 5 UCGACAACCUCGUCUGCCUC Chr IV 1640658 FFUJ_13515 ORF Antisense orientation Probable acetolactate synthase small subunit precursor 1Chromosome and base position in the genomic sequence. 2SC: start codon. The locations of the putative milRNA sequences usually coincide with the ORFs or promoter regions of annotated genes (Supplementary Figure S1a), which could be regulatory targets. Most of these genes have low expression levels (Supplementary Figure S1b), making it unlikely, in the case of the same transcriptional orientation, that they are mRNA degradation products. Moreover, some of them (milRNAs #1, 5, 6, 9, 10, and 11, Table 2) are transcribed antisense to the associated gene, suggesting that the corresponding milRNAs could bind to the corresponding mRNAs and interfere with their function. A striking case is that of potential milRNA #8, particularly abundant and located in a subtelomeric region at more than 3 kb from the 3 ′ end of the closest gene. The sequence of the 21 bases of this putative milRNA contains 3.5 copies of the UUAGGG telomeric DNA repeat, suggesting a regulatory role in telomere elongation in this fungus. Notably, such repeats are absent in the rest of the precursor RNA sequence, strongly pointing to a telomeric-related function for this milRNA. To identify possible regulatory targets for the potential milRNAs described in Table 2, excluding the putative telomere-related #8 milRNA, their sequences were subjected to BLAST analysis against the genome of Fusarium fujikuroi IMI58289. Except the original locus, no targets corresponding to the complete sequence of any of the 10 milRNAs were found, but in some cases coincidences were found that exceeded what could be explained by chance. Attention was paid to those with an e-value lower than 1, which are described in Table 3. They include sense and antisense targets. One of them (#8) is mostly coincident with an internal ribosomal RNA sequence, suggesting a possible role in its regulation by pairing. Another (#7) exhibits considerable antisense orientation identity with the genes for three of the putative transposable elements described in Table 1, which could be inactivated by the binding of this milRNA to mRNA encoded by these genes. Non-Coding RNA 2024,10, 31 16 of 18 Supplementary Materials: The following supporting information can be downloaded at: https:// www.mdpi.com/article/10.3390/ncrna10030031/s1, Figure S1: Expression at the genomic locations of the predicted milRNAs in the F. fujikuroi genome; Figure S2: Phenotypic characterization of ∆ dcl2 transformants; Figure S3: Dispersion and distribution graphs of RNA-seq samples from the wild-type strain and dcl2 mutant; Figure S4: Effect of dcl2 deletion on transcript levels (RPKM) in the dark for the nine FFUJ_ genes in whose ORFs or putative promoter sequences the milRNAs shown in Table 2are encoded; Figure S5: Effect of dcl2 deletion on transcript levels (RPKM) in the dark of the putative milRNAs target FFUJ_ genes described in Table 3(A) and of the annotated FFUJ_ genes for transposable elements described in Table 1(B); Figure S6: Molecular analysis of the deletion of the dcl2 gene in the F. fujikuroi wild-type strain; Table S1: Mapping results of sRNA sequencing; Table S2: Reads mapping to predicted ribosomal DNA; Table S3: Origin of sRNAs in Fusarium; Table S4: Formation of small RNAs within genomic features in sense orientation (dark vs. light); Table S5: De novo predicted miRNA-like RNAs in the merged sRNA dataset of F. fujikuroi; Table S6: Basic characteristics of the sequenced samples and yield of the readings; Table S7: Summary of the sequencing characteristics of each RNA-seq sample; Table S8: Primer sets used for PCR experiments. Author Contributions: Conceptualization, M.C.L. and J.A.; formal analysis, J.P.-M., M.N. and T.A.D.; investigation, J.P.-M.; writing—original draft preparation, J.A.; writing—review and editing, M.C.L. and J.A.; funding acquisition, M.C.L. and J.A. All authors have read and agreed to the published version of the manuscript. Funding: This research was supported by Grant PID2022-140414NB-I00 funded by MICIU/AEI/ 10.13039/501100011033 and by ERDF/EU. Institutional Review Board Statement: Not applicable. Informed Consent Statement: Not applicable. Data Availability Statement: All sequencing files are available in the GEO repository under accession numbers GSE53159 (RNA-seq on the effect of dcl2 deletion) and GSE253160 (RNA-seq data for small RNAs). Acknowledgments: We thank for supplementary support to grants 2018-101902-B-I00 from Ministerio de Ciencia e Innovación (MCIN)/Agencia Estatal de Investigación (AEI), and P10-CTS-6638 from Plan Andaluz de Investigación, Desarrollo e Innovación, Junta de Andalucía. We are grateful to the technical staff of LifeSequencing S.L. for their helpful support in the sequencing projects. Conflicts of Interest: The authors declare no conflicts of interest. References 1. Carthew, R.W.; Sontheimer, E.J. Origins and Mechanisms of miRNAs and siRNAs. Cell 2009,136, 642–655. [CrossRef] [PubMed] 2. Torres-Martínez, S.; Ruiz-Vázquez, R.M. The RNAi Universe in Fungi: A Varied Landscape of Small RNAs and Biological Functions. Annu. Rev. Microbiol. 2017,71, 371–391. [CrossRef] [PubMed] 3. Napoli, C.; Lemieux, C.; Jorgensen, R. Introduction of a Chimeric Chalcone Synthase Gene into Petunia Results in Reversible Co-Suppression of Homologous Genes in Trans. Plant Cell 1990,2, 279–289. [CrossRef] [PubMed] 4. Cogoni, C.; Macino, G. Isolation of Quelling-Defective (qde) Mutants Impaired in Posttranscriptional Transgene-Induced Gene Silencing in Neurospora crassa.Proc. Natl. Acad. Sci. USA 1997,94, 10233–10238. [CrossRef] [PubMed] 5. Villalobos-Escobedo, J.M.; Herrera-Estrella, A.; Carreras-Villaseñor, N. The Interaction of Fungi with the Environment Orchestrated by RNAi. Mycologia 2016,108, 556–571. [CrossRef] [PubMed] 6. Nicolás, F.E.; Murcia, L.; Navarro, E.; Cánovas-Márquez, J.T.; Garre, V. Small RNAs in Fungi. In Genetics and Biotechnology; Benz, J.P., Schipper, K., Eds.; Springer International Publishing: Cham, Switzerland, 2020; pp. 105–122, ISBN 978-3-030-49923-5. 7. Lax, C.; Tahiri, G.; Patiño-Medina, J.A.; Cánovas-Márquez, J.T.; Pérez-Ruiz, J.A.; Osorio-Concepción, M.; Navarro, E.; Calo, S. The Evolutionary Significance of RNAi in the Fungal Kingdom. Int. J. Mol. Sci. 2020,21, 9348. [CrossRef] [PubMed] 8. Billmyre, R.B.; Calo, S.; Feretzaki, M.; Wang, X.; Heitman, J. RNAi Function, Diversity, and Loss in the Fungal Kingdom. Chromosome Res. Int. J. Mol. Supramol. Evol. Asp. Chromosome Biol. 2013,21, 561–572. [CrossRef] [PubMed] 9. Catalanotto, C.; Azzalin, G.; Macino, G.; Cogoni, C. Involvement of Small RNAs and Role of the qde Genes in the Gene Silencing Pathway in Neurospora.Genes Dev. 2002,16, 790–795. [CrossRef] [PubMed] 10. Pickford, A.S.; Cogoni, C. RNA-Mediated Gene Silencing. Cell. Mol. Life Sci. CMLS 2003,60, 871–882. [CrossRef] 11. Treiber, T.; Treiber, N.; Meister, G. Regulation of microRNA Biogenesis and Its Crosstalk with Other Cellular Pathways. Nat. Rev. Mol. Cell Biol. 2019,20, 5–20. [CrossRef] Non-Coding RNA 2024,10, 31 17 of 18 12. Shiu, P.K.T.; Metzenberg, R.L. Meiotic Silencing by Unpaired DNA: Properties, Regulation and Suppression. Genetics 2002,161, 1483–1495. [CrossRef] [PubMed] 13. Wang, X.; Hsueh, Y.-P.; Li, W.; Floyd, A.; Skalsky, R.; Heitman, J. Sex-Induced Silencing Defends the Genome of Cryptococcus neoformans via RNAi. Genes Dev. 2010,24, 2566–2582. [CrossRef] [PubMed] 14. Son, H.; Min, K.; Lee, J.; Raju, N.B.; Lee, Y.-W. Meiotic Silencing in the Homothallic Fungus Gibberella zeae.Fungal Biol. 2011,115, 1290–1302. [CrossRef] 15. Yu, J.; Lee, K.-M.; Cho, W.K.; Park, J.Y.; Kim, K.-H. Differential Contribution of RNA Interference Components in Response to Distinct Fusarium graminearum Virus Infections. J. Virol. 2018,92, e01756-17. [CrossRef] 16. Halic, M.; Moazed, D. Dicer-Independent Primal RNAs Trigger RNAi and Heterochromatin Formation. Cell 2010,140, 504–516. [CrossRef] 17. Lee, H.-C.; Li, L.; Gu, W.; Xue, Z.; Crosthwaite, S.K.; Pertsemlidis, A.; Lewis, Z.A.; Freitag, M.; Selker, E.U.; Mello, C.C.; et al. Diverse Pathways Generate microRNA-like RNAs and Dicer-Independent Small Interfering RNAs in Fungi. Mol. Cell 2010,38, 803–814. [CrossRef] [PubMed] 18. Nicolás, F.E.; Moxon, S.; de Haro, J.P.; Calo, S.; Grigoriev, I.V.; Torres-Martínez, S.; Moulton, V.; Ruiz-Vázquez, R.M.; Dalmay, T. Endogenous Short RNAs Generated by Dicer 2 and RNA-Dependent RNA Polymerase 1 Regulate mRNAs in the Basal Fungus Mucor circinelloides.Nucleic Acids Res. 2010,38, 5535–5541. [CrossRef] 19. Yang, Q.; Li, L.; Xue, Z.; Ye, Q.; Zhang, L.; Li, S.; Liu, Y. Transcription of the Major Neurospora crassa microRNA-like Small RNAs Relies on RNA Polymerase III. PLoS Genet. 2013,9, e1003227. [CrossRef] 20. Trieu, T.A.; Navarro-Mendoza, M.I.; Pérez-Arques, C.; Sanchis, M.; Capilla, J.; Navarro-Rodriguez, P.; Lopez-Fernandez, L.; Torres- Martínez, S.; Garre, V.; Ruiz-Vázquez, R.M.; et al. RNAi-Based Functional Genomics Identifies New Virulence Determinants in Mucormycosis. PLoS Pathog. 2017,13, e1006150. [CrossRef] 21. Kang, K.; Zhong, J.; Jiang, L.; Liu, G.; Gou, C.Y.; Wu, Q.; Wang, Y.; Luo, J.; Gou, D. Identification of microRNA-Like RNAs in the Filamentous Fungus Trichoderma reesei by Solexa Sequencing. PLoS ONE 2013,8, e76288. [CrossRef] 22. Chen, R.; Jiang, N.; Jiang, Q.; Sun, X.; Wang, Y.; Zhang, H.; Hu, Z. Exploring microRNA-like Small RNAs in the Filamentous Fungus Fusarium oxysporum.PLoS ONE 2014,9, e104956. [CrossRef] [PubMed] 23. Son, H.; Park, A.R.; Lim, J.Y.; Shin, C.; Lee, Y.-W. Genome-Wide Exonic Small Interference RNA-Mediated Gene Silencing Regulates Sexual Reproduction in the Homothallic Fungus Fusarium graminearum.PLoS Genet. 2017,13, e1006595. [CrossRef] [PubMed] 24. Carreras-Villaseñor, N.; Esquivel-Naranjo, E.U.; Villalobos-Escobedo, J.M.; Abreu-Goodger, C.; Herrera-Estrella, A. The RNAi Machinery Regulates Growth and Development in the Filamentous Fungus Trichoderma atroviride.Mol. Microbiol. 2013,89, 96–112. [CrossRef] [PubMed] 25. Gaffar, F.Y.; Imani, J.; Karlovsky, P.; Koch, A.; Kogel, K.-H. Different Components of the RNA Interference Machinery Are Required for Conidiation, Ascosporogenesis, Virulence, Deoxynivalenol Production, and Fungal Inhibition by Exogenous Double-Stranded RNA in the Head Blight Pathogen Fusarium graminearum.Front. Microbiol. 2019,10, 1662. [CrossRef] [PubMed] 26. Guo, M.-W.; Yang, P.; Zhang, J.-B.; Liu, G.; Yuan, Q.-S.; He, W.-J.; Nian, J.-N.; Yi, S.-Y.; Huang, T.; Liao, Y.-C. Expression of microRNA-like RNA-2 (Fgmil-2) and bioH1 from a Single Transcript in Fusarium graminearum Are Inversely Correlated to Regulate Biotin Synthesis during Vegetative Growth and Host Infection. Mol. Plant Pathol. 2019,20, 1574–1581. [CrossRef] [PubMed] 27. Jo, S.-M.; Ayukawa, Y.; Yun, S.-H.; Komatsu, K.; Arie, T. A Putative RNA Silencing Component Protein FoQde-2 Is Involved in Virulence of the Tomato Wilt Fungus Fusarium oxysporum f. Sp. lycopersici. J. Gen. Plant Pathol. 2018,84, 395–398. [CrossRef] 28. Janevska, S.; Tudzynski, B. Secondary Metabolism in Fusarium Fujikuroi: Strategies to Unravel the Function of Biosynthetic Pathways. Appl. Microbiol. Biotechnol. 2018,102, 615–630. [CrossRef] [PubMed] 29. Finn, R.D.; Bateman, A.; Clements, J.; Coggill, P.; Eberhardt, R.Y.; Eddy, S.R.; Heger, A.; Hetherington, K.; Holm, L.; Mistry, J.; et al. Pfam: The Protein Families Database. Nucleic Acids Res. 2014,42, D222–D230. [CrossRef] 30. Ruger-Herreros, M.; Parra-Rivero, O.; Pardo-Medina, J.; Romero-Campero, F.J.; Limón, M.C.; Avalos, J. Comparative Transcriptomic Analysis Unveils Interactions between the Regulatory CarS Protein and Light Response in Fusarium.BMC Genom. 2019, 20, 67. [CrossRef] 31. Pardo-Medina, J.; Gutiérrez, G.; Limón, M.C.; Avalos, J. Impact of the White Collar Photoreceptor WcoA on the Fusarium fujikuroi Transcriptome. Front. Microbiol. 2021,11, 619474. [CrossRef] 32. Pardo-Medina, J.; Limón, M.C.; Avalos, J. Fusarium Photoreceptors. J. Fungi 2023,9, 319. [CrossRef] [PubMed] 33. Zhou, J.; Fu, Y.; Xie, J.; Li, B.; Jiang, D.; Li, G.; Cheng, J. Identification of microRNA-like RNAs in a Plant Pathogenic Fungus Sclerotinia sclerotiorum by High-Throughput Sequencing. Mol. Genet. Genom. MGG 2012,287, 275–282. [CrossRef] [PubMed] 34. Dahlmann, T.A.; Kück, U. Dicer-Dependent Biogenesis of Small RNAs and Evidence for microRNA-like RNAs in the Penicillin Producing Fungus Penicillium chrysogenum.PLoS ONE 2015,10, e0125989. [CrossRef] 35. Chen, Y.; Gao, Q.; Huang, M.; Liu, Y.; Liu, Z.; Liu, X.; Ma, Z. Characterization of RNA Silencing Components in the Plant Pathogenic Fungus Fusarium graminearum.Sci. Rep. 2015,5, 12500. [CrossRef] [PubMed] 36. Love, M.I.; Huber, W.; Anders, S. Moderated Estimation of Fold Change and Dispersion for RNA-Seq Data with DESeq2. Genome Biol. 2014,15, 550. [CrossRef] [PubMed] Non-Coding RNA 2024,10, 31 18 of 18 37. Werner, B.T.; Koch, A.; Šeˇci´c, E.; Engelhardt, J.; Jelonek, L.; Steinbrenner, J.; Kogel, K.-H. Fusarium graminearum DICER-like- Dependent sRNAs Are Required for the Suppression of Host Immune Genes and Full Virulence. PLoS ONE 2021,16, e0252365. [CrossRef] [PubMed] 38. Ji, H.-M.; Mao, H.-Y.; Li, S.-J.; Feng, T.; Zhang, Z.-Y.; Cheng, L.; Luo, S.-J.; Borkovich, K.A.; Ouyang, S.-Q. Fol-milR1, a Pathogenicity Factor of Fusarium oxysporum, Confers Tomato Wilt Disease Resistance by Impairing Host Immune Responses. New Phytol. 2021, 232, 705–718. [CrossRef] [PubMed] 39. Li, M.; Xie, L.; Wang, M.; Lin, Y.; Zhong, J.; Zhang, Y.; Zeng, J.; Kong, G.; Xi, P.; Li, H.; et al. FoQDE2-Dependent milRNA Promotes Fusarium oxysporum f. Sp. Cubense Virulence by Silencing a Glycosyl Hydrolase Coding Gene Expression. PLoS Pathog. 2022, 18, e1010157. [CrossRef] [PubMed] 40. Lee, H.-C.; Chang, S.-S.; Choudhary, S.; Aalto, A.P.; Maiti, M.; Bamford, D.H.; Liu, Y. qiRNA Is a New Type of Small Interfering RNA Induced by DNA Damage. Nature 2009,459, 274–277. [CrossRef] 41. Hammond, T.M.; Keller, N.P. RNA Silencing in Aspergillus nidulans Is Independent of RNA-Dependent RNA Polymerases. Genetics 2005,169, 607–617. [CrossRef] 42. Hu, Z.; Parekh, U.; Maruta, N.; Trusov, Y.; Botella, J.R. Down-Regulation of Fusarium oxysporum Endogenous Genes by Host- Delivered RNA Interference Enhances Disease Resistance. Front. Chem. 2015,3, 1. [CrossRef] [PubMed] 43. Meng, H.; Wang, Z.; Wang, Y.; Zhu, H.; Huang, B. Dicer and Argonaute Genes Involved in RNA Interference in the Entomopathogenic Fungus Metarhizium robertsii.Appl. Environ. Microbiol. 2017,83, e03230-16. [CrossRef] [PubMed] 44. Wang, M.; Weiberg, A.; Dellota, E.; Yamane, D.; Jin, H. Botrytis Small RNA Bc-siR37 Suppresses Plant Defense Genes by Cross-Kingdom RNAi. RNA Biol. 2017,14, 421–428. [CrossRef] [PubMed] 45. Cai, Q.; He, B.; Weiberg, A.; Buck, A.H.; Jin, H. Small RNAs and Extracellular Vesicles: New Mechanisms of Cross-Species Communication and Innovative Tools for Disease Control. PLoS Pathog. 2019,15, e1008090. [CrossRef] [PubMed] 46. Jian, J.; Liang, X. One Small RNA of Fusarium graminearum Targets and Silences CEBiP Gene in Common Wheat. Microorganisms 2019,7, 425. [CrossRef] [PubMed] 47. Qu, Q.; Liu, N.; Su, Q.; Liu, X.; Jia, H.; Liu, Y.; Sun, M.; Cao, Z.; Dong, J. MicroRNAs Involved in the Trans-Kingdom Gene Regulation in the Interaction of Maize Kernels and Fusarium verticillioides.Int. J. Biol. Macromol. 2023,242, 125046. [CrossRef] 48. Marente, J.; Ortega, P.; Pardo-Medina, J.; Avalos, J.; Limón, M.C. Modulation of Activity of a Carotenoid Pathway through the Use of the TET-on Regulatory System: Application in the Fungus Fusarium fujikuroi. In Plant and Food Carotenoids: Methods and Protocols; Rodríguez-Concepción, M., Welsch, R., Eds.; Methods in Molecular Biology; Springer US: New York, NY, USA, 2020; pp. 343–360, ISBN 978-1-4939-9952-1. 49. Colot, H.V.; Park, G.; Turner, G.E.; Ringelberg, C.; Crew, C.M.; Litvinkova, L.; Weiss, R.L.; Borkovich, K.A.; Dunlap, J.C. A High-Throughput Gene Knockout Procedure for Neurospora Reveals Functions for Multiple Transcription Factors. Proc. Natl. Acad. Sci. USA 2006,103, 10352–10357. [CrossRef] [PubMed] 50. Sambrook, J.; Russell, D.W. Molecular Cloning: A Laboratory Manual; Cold Spring Harbor Laboratory Press: New York, NY, USA, 2001. 51. Metzker, M.L. Sequencing Technologies—The next Generation. Nat. Rev. Genet. 2010,11, 31–46. [CrossRef] 52. Dobin, A.; Davis, C.A.; Schlesinger, F.; Drenkow, J.; Zaleski, C.; Jha, S.; Batut, P.; Chaisson, M.; Gingeras, T.R. STAR: Ultrafast Universal RNA-Seq Aligner. Bioinformatics 2013,29, 15–21. [CrossRef] Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.