Nitrate assimilation gene cluster from the heterocyst-forming cyanobacterium Anabaena sp. Strain PCC 7120

JOURNAL OF BACTERIOLOGY, 0021-9193/97/$04.0010Jan. 1997, p. 477–486 Vol. 179, No. 2 Copyright q1997, American Society for Microbiology Nitrate Assimilation Gene Cluster from the Heterocyst-Forming Cyanobacterium Anabaena sp. Strain PCC 7120 JOSE ´E. FRI ´AS, ENRIQUE FLORES, AND ANTONIA HERRERO* Instituto de Bioquı´mica Vegetal y Fotosı´ntesis, Consejo Superior de Investigaciones Cientı´ficas-Universidad de Sevilla, Seville, Spain Received 6 August 1996/Accepted 7 November 1996 A region of the genome of the filamentous, nitrogen-fixing, heterocyst-forming cyanobacterium Anabaena sp. strain PCC 7120 that contains a cluster of genes involved in nitrate assimilation has been identified. The genes nir, encoding nitrite reductase, and nrtABC, encoding elements of a nitrate permease, have been cloned. Insertion of a gene cassette into the nir-nrtA region impaired expression of narB, the nitrate reductase structural gene which together with nrtD is found downstream from nrtC in the gene cluster. This indicates that the nir-nrtABCD-narB genes are cotranscribed, thus constituting an operon. Expression of the nir operon in strain PCC 7120 is subjected to ammonium-promoted repression and takes place from an NtcA-activated promoter located 460 bp upstream from the start of the nir gene. In the absence of ammonium, cellular levels of the products of the nir operon are higher in the presence of nitrate than in the absence of combined nitrogen. Cyanobacteria are organisms belonging to the domain Bacteria (31) that are considered the inventors of oxygenic photosynthesis and the phylogenetic ancestors of chloroplasts (9). Nowadays, cyanobacteria are phototrophs that preferentially use inorganic carbon and nitrogen for growth. Nitrate and ammonium are excellent sources of nitrogen for cyanobacteria in general, and many cyanobacterial strains are also able to perform nitrogen fixation and thus to grow at the expense of atmospheric nitrogen (14). Many filamentous, nitrogen-fixing cyanobacteria develop, under conditions of aerobiosis and depletion of combined nitrogen, specialized cells called heterocysts where the machinery of nitrogen fixation is confined and can operate efficiently (47). The assimilation of nitrate takes place through three successive steps (14). First, nitrate enters the cyanobacterial cell mainly by means of an active transport system. Then, intracellular nitrate is reduced to ammonium through two sequential reactions catalyzed by nitrate reductase and nitrite reductase, respectively. Last, ammonium resulting from nitrate assimilation, as is also the case for that taken up from the external medium or resulting from nitrogen fixation, is incorporated into carbon skeletons mainly via the glutamine synthetase/ glutamate synthase cycle to generate all nitrogen-containing metabolites of the cell. In the unicellular, non-nitrogen-fixing cyanobacterium Synechococcus sp. strain PCC 7942, three genes, namely, narA, narB, and narC, that are essential for the reduction of nitrate to nitrite have been cloned (22, 23). Also, a cluster of genes that contains the genes nir (encoding nitrite reductase), nrt ABCD (encoding four components of a multicomponent transport system for nitrate and nitrite), and narB (encoding nitrate reductase) has been characterized (24–26, 32, 37, 39). It has been shown that this cluster of genes behaves as an operon (24, 27, 39). In the unicellular, non-nitrogen-fixing cyanobacterium Synechocystis sp. strain PCC 6803, the nirA gene is found ca. 400 kb apart from the nrtABCD genes (21). Information about some nitrate assimilation genes in three filamentous, non-het- erocyst-forming cyanobacteria is also available. A cluster of genes containing only nirA and nrtABC has been characterized in Phormidium laminosum (30). In Plectonema boryanum,nirA and nrtA are clustered together and might be part of an operon including some other genes as well (40). The narB gene from Oscillatoria chalybea has been isolated and sequenced (41), but no information on any other nitrate assimilation gene of this cyanobacterium is available. On the other hand, no data on nitrate assimilation genes in any heterocyst-forming cyanobacterium have been reported to date. In all cyanobacteria tested to date, nitrate assimilation is regulated through repression provoked by the presence of ammonium in the external medium that modulates synthesis of nitrate reductase, nitrite reductase, and the nitrate/nitrite transport system, as well as of glutamine synthetase (14). In Synechococcus sp. strain PCC 7942, Phormidium laminosum, and Plectonema boryanum, expression of the nir operon has been shown to be subjected to negative control by ammonium (27, 30, 40). The Synechococcus ntcA gene that encodes a global transcriptional regulator of nitrogen assimilation genes that are subjected to ammonium-promoted repression has been identified (42, 43). The NtcA protein is required for expression of the nir operon and of the glnA gene encoding glutamine synthetase (27). The ntcA gene has been shown to be widespread among cyanobacteria (16). The ntcA gene from the filamentous, heterocyst-forming cyanobacterium Anabaena sp. strain PCC 7120 has been cloned and sequenced (16, 44), and the NtcA protein has been shown to be essential for growth at the expense of both nitrate and dinitrogen (17, 45). While the presence of neither nitrate nor nitrite is required as an inducer for the expression of nitrate reductase and nitrite reductase in non-nitrogen-fixing cyanobacteria, high levels of activity of those enzymes in the nitrogen fixers are attained only when either nitrate or nitrite is available in the external medium (14). This report deals with the cloning, from the genome of Anabaena sp. strain PCC 7120, of a cluster of genes involved in nitrate assimilation, the determination of its genetic structure, and the study of the expression of genes in the cluster as well as its regulation by the nitrogen regimen imposed on the cells. MATERIALS AND METHODS Strains and growth conditions. Anabaena/Nostoc sp. (hereafter referred to as Anabaena sp.) strain PCC 7120 (36) and its heterocyst-defective derivative strain * Corresponding author. Mailing address: Instituto de Bioquı´mica Vegetal y Fotosı´ntesis, Centro de Investigaciones Cientı´ficas Isla de la Cartuja, Avda. Americo Vespucio s/n, E-41092 Seville, Spain. E-mail: [email protected]. 477 on July 25, 2017 by USE/BTCA.GENERAL UNIVERSITARIA Sevillahttp://jb.asm.org/Downloaded from EF116 (which is unable to fix dinitrogen under aerobic conditions) (46) were routinely grown photoautotrophically at 308C under white light (25 to 30 W/m 2 ) with shaking for liquid cultures. Media used for growth were BG11 (NaNO 3 as the nitrogen source) (36), BG11 0 (BG11 medium lacking nitrate), and BG11 0 NH 41 [BG11 medium lacking nitrate and supplemented with 2.5 mM NH 4 Cl and 5 mM N-tris (hydroxymethyl)methyl-2-aminoethane sulfonic acid (TES)–NaOH buffer, pH 7.5]. For growth on plates, medium solidified with separately autoclaved 1% agar (Difco) was used. When appropriate, antibiotics were added to plates at the following final concentrations: streptomycin (SM), 2 or 5 mg/ml; spectinomycin (SP), 2 or 5 mg/ml; and neomycin (NM), 30 mg/ml. In liquid cultures, antibiotic concentrations used were as follows: SM, 2 mg/ml; SP, 2mg/ml; and NM, 5 mg/ml. Strains CSE1, CSE2, CSE16, CSE17, and CSE18 were routinely grown in BG11 0 NH 41 medium supplemented with SM and SP, and strains CSE9 and CSE10 were routinely grown in BG11 0 medium supplemented with NM. For derepression experiments, cells grown in BG11 0 NH 41 medium were washed twice with BG11 0 medium, resuspended in the media indicated in each experiment, and bubbled with air at 308C in the light. Escherichia coli DH5a, HB101, and ED8654 were grown in Luria-Bertani medium at 378C. For growth on plates, medium solidified with 1.5% agar was used. When necessary, antibiotics were added at standard concentrations (2). Growth rates were estimated from the increase of protein concentration in the cultures. Protein concentration was determined by a modified Lowry procedure (28) in 0.2-ml aliquots periodically withdrawn from the cultures. The growth rate constant (m) corresponds to ln2/t d , where t d represents the doubling time. Generation of mutant strains. In vitro-generated constructs bearing a gene cassette inserted into the nitrate assimilation gene cluster of Anabaena sp. strain PCC 7120 were cloned in sacB-bearing vectors (the sacB gene determines sensitivity to sucrose and can be counterselected for in Anabaena sp., allowing positive selection for double recombinants) (5). The resulting plasmids were transferred by means of conjugation (12) to Anabaena sp. strain PCC 7120 or to strain EF116 to generate strains bearing mutations in the nitrate assimilation genomic region. For generation of strains CSE1, CSE9, CSE10, CSE16, CSE17, and CSE18, E. coli HB101 containing plasmid pCSE21aB, pCSE44B, pCSE45B, pCSE78B, pCSE81B, or pCSE88B, respectively (see Table 1), and helper plasmids pRL528 (12) and pRL591-W45 (10) was mixed with E. coli ED8654 carrying the conjugative plasmid pRL443 and thereafter with strain PCC 7120 or strain EF116. The resulting cell suspension was spread onto nitrocellulose filters (Nucleopore; REC-85) set successively atop BG11 0 NH 41 solid medium supplemented with 5% Luria-Bertani medium (incubated for 24 h), BG11 0 NH 41 solid medium (incubated for 24 h), and BG11 0 NH 41 solid medium supplemented with SM and SP or with NM (depending on the transferred gene cassette: cassette C.S3 [11] encodes resistance to SM [Sm r ] and SP [Sp r ] and cassette C.K1 [11] encodes resistance to NM [Nm r ] and kanamycin [Km r ]) and incubated until colonies showed up. Some antibiotic-resistant, exconjugant clones were grown in liquid medium supplemented with the same antibiotics. Liquid cultures were sonicated in a cleaning bath to give a mean filament length of three to four cells per filament and plated on solid BG11 0 NH 41 , antibiotic-containing medium supplemented with 5% sucrose. Double recombinants were identified as clones resistant to the antibiotic for which resistance was encoded in the inserted gene cassette, resistant to sucrose, and sensitive to the antibiotic for which a resistance determinant was present in the vector portion of the transferred plasmid and by Southern or PCR analysis. DNA isolation, Southern blot analysis, PCR analysis, and DNA sequencing. Isolation of DNA from Anabaena sp. was performed as previously described (5). For Southern blots, restriction endonuclease-digested DNA was subjected to electrophoresis in agarose gels and transferred to GeneScreen Plus membranes (Dupont) following the instructions of the manufacturer. Labelling of probes with 32 P and hybridization under low- and high-stringency conditions (used for heterologous and homologous hybridizations, respectively) were performed as described previously (16). Colony blotting and hybridization for subgenomic library screening were performed as described elsewhere (38). PCR amplification was carried out in a 50-ml reaction volume containing ca. 2 ng of genomic DNA from the cyanobacterial strain to be checked, a 0.2 mM concentration of each deoxynucleoside triphosphate, 50 pmol each of oligonucleotides nir-2 and nir-14 (see below), and5UofTaq polymerase and buffer (from Boehringer). The program used for amplification was denaturation for 2 min at 958C, annealing for TABLE 1. Plasmids and cyanobacterial strains used in this work Strain(s) or plasmid(s) Origin and relevant characteristics Source or reference(s) PCC 7120 Wild-type Anabaena/Nostoc strain 35, 36 EF116 Derivative of Anabaena sp. strain PCC 7120 unable to fix nitrogen under aerobic conditions 46 CSE1 Sm r Sp r derivative of strain EF116 unable to assimilate nitrate; C.S3 gene cassette substituting a part of the nir-nrtA gene region (see Fig. 1) This work CSE2 ntcA mutant derivative of Anabaena sp. strain PCC 7120 17 CSE9, CSE10 Nm r derivatives of strain PCC 7120; C.K1 gene cassette inserted in both orientations into the nrtA gene (see Fig. 1) This work CSE16 Sm r Sp r derivative of strain PCC 7120; C.S3 gene cassette inserted into orf136 (see Fig. 1) This work CSE17 Sm r Sp r derivative of strain PCC 7120; C.S3 gene cassette inserted into orf398 (see Fig. 1) This work CSE18 Sm r Sp r derivative of strain EF116 unable to assimilate nitrate; C.S3 gene cassette inserted into the ClaI site upstream of the nir gene (see Fig. 1) This work pBluescript SK(1) Cloning vector Stratagene pCSE2 XbaI DNA fragment of about 5.75 kb, carrying part of the nitrate assimilation gene cluster from strain PCC 7120, cloned in pBluescript SK(1) (see Fig. 1A) This work pCSE5, pCSE21 HindIII DNA fragment of about 8 kb, carrying part of the nitrate assimilation gene cluster from strain PCC 7120 (see Fig. 1A), cloned in pBluescript SK(1) or in pRL500, respectively This work pCSE21aB HindIII fragment from pCSE21 in which the 2.35-kb ClaI fragment comprising nir and part of the nrtA gene has been substituted by gene cassette C.S3 (see Fig. 1A), cloned in pRL278; used to generate mutant strain CSE1 This work pCSE26 Religated longest fragment of EcoRV-digested pCSE21 This work pCSE44B, pCSE45B HindIII fragment from pCSE5 bearing gene cassette C.K1 inserted into the EcoRV site of the nrtA gene in the same orientation as this gene (pCSE44B) or in the opposite orientation (pCSE45B) (see Fig. 1A), cloned in pRL277; used to generate mutant strains CSE9 and CSE10, respectively This work pCSE78B HindIII fragment from pCSE26, bearing gene cassette C.S3 inserted into the BglI site of orf136 (see Fig. 1A), cloned in pRL278; used to generate mutant strain CSE16 This work pCSE81B HindIII fragment from pCSE26, bearing gene cassette C.S3 inserted into the PvuII site of orf398 (see Fig. 1A), cloned in pRL278; used to generate mutant strain CSE17 This work pCSE88B HindIII fragment from pCSE26, bearing gene cassette C.S3 inserted into the ClaI site upstream of the nir gene (see Fig. 1A), cloned in pRL278; used to generate mutant strain CSE18 This work pRL277 Cloning vector containing the sacB gene from Bacillus subtilis and determinants for Sm r and Sp r 4 pRL278 Cloning vector containing the sacB gene from Bacillus subtilis and determinants for Km r and Nm r 4 pRL443 Km s derivative of conjugative plasmid RP4 12 pRL500 Positive selection vector 11 pRL528 Plasmid bearing genes encoding methylases for AvaI and AvaII sites 12 pRL591-W45 Plasmid bearing a gene encoding a methylase for AvaIII sites 10 478 FRI ´AS ET AL. J. BACTERIOL. on July 25, 2017 by USE/BTCA.GENERAL UNIVERSITARIA Sevillahttp://jb.asm.org/Downloaded from 1 min at 508C, and polymerization for 3 min at 728C. Products of amplification were visualized by electrophoresis in agarose gels stained with ethidium bromide. DNA fragments used for sequencing were generated by subcloning with restriction enzymes. Sequencing was carried out by the dideoxy chain termination method with a T7 sequencing kit and [a- 35 S]thio-dATP. For the nrtA gene and orf136 both strands were sequenced. RNA isolation and analysis. RNA from Anabaena sp. was prepared as described previously (18) by using 150 ml of cultures containing ca. 4 to 5 mgof chlorophyll/ml. The resulting RNA preparations were treated with RNase-free DNase I to eliminate contaminating DNA. For Northern blot analysis, RNA (approximately 25 mg) was subjected to electrophoresis in denaturing formaldehyde gels, transferred to GeneScreen Plus membranes, and subjected to hybridization following the manufacturer’s instructions. When oligonucleotide nir-3 (59GCGCAGCCTTCCCGCAGGG39, complementary to nucleotides 2288 to 2306 with respect to the start of the nir gene) was used as a probe, it was labelled in its 59end with polynucleotide kinase from Boehringer and [g- 32 P]ATP (5,000 Ci/mmol), and hybridization was performed at 428C as described elsewhere (2). Primer extension experiments were performed as described elsewhere (2), using 50 mg of RNA and, as a primer, oligonucleotide nir-1 (59CGCCGCCGATGTT TCACTGAAGG39, complementary to nucleotides 2344 to 2366 with respect to the nir gene), nir-2 (59GAGGCTGGCTTTGGGGG39, complementary to nucleotides 36 to 20 of the nir gene), nir-3 (see above), nir-12 (59GCTATCCAACC CAAACCTACCC39, complementary to nucleotides 47 to 26 of orf136), or nir-14 (59AGTCTAGCCTTGTTTTACCAAC39, complementary to nucleotides 234 to 255 with respect to the start of orf136). For hybridization of blots of restricted plasmid DNA (2 pmol, resolved by electrophoresis in agarose gels) with total cyanobacterial RNA, 15 mg of RNA was partially hydrolyzed by incubation in 125 mM NaOH for 40 min at 0 to 48C and labelled with T4 polynucleotide kinase (from Boehringer) and [g- 32 P]ATP (4,500 Ci/mmol) (1). Hybridization was performed as described previously (13) at 658C in a solution containing the following: Tris-HCl (pH 8), 50 mM; bovine serum albumin, 0.2%; Ficoll, 0.2%; sodium pyrophosphate, 0.1%; sodium dodecyl sulfate, 1%; NaCl, 1 M; and yeast tRNA (Boehringer), 100 mg/ml. Results were quantified with the InstantImager scanner for beta particles (Packard). Enzyme activities. Nitrate reductase (20) and nitrite reductase (19) were measured with dithionite-reduced methyl viologen as the reductant in cells made permeable with mixed alkyltrimethylammonium bromide (MTA-5 from Sigma). The amount of cells added to an enzymatic assay for nitrate reductase and nitrite reductase contained 5 and 40 mg of chlorophyll, respectively. Activity units correspond to micromoles of nitrite produced (nitrate reductase) or removed (nitrite reductase) per minute. Nitrate uptake. Nitrate uptake assays were performed according to the method of Flores et al. (15). Ammonium-grown cells (4 to 5 mg of chlorophyll/ ml) were derepressed by incubation for5hinBG11 medium (see above). Cells were then harvested by filtration, washed with 10 mM Tricine-NaOH buffer (pH 8.1), resuspended in the same buffer to 10 mg of chlorophyll/ml, and placed in air-opened conical flasks with shaking under illumination. Uptake assays were started by addition of NaNO 3 (0.1 or 17.6 mM, final concentration) after a 10-min preincubation in the presence (for uptake of 17.6 mM nitrate) or in the absence (for uptake of 0.1 mM nitrate) of 1 mM L-methionine–DL-sulfoximine. Nitrate disappearance or ammonium release was determined by estimating the concentration of the corresponding ion in the medium in aliquots of the cell suspensions after removal of the cells by filtration through Millipore HA 0.45- mm-pore-size filters. Nitrate concentration was estimated through its absorption at 210 nm in acid solution (7), and ammonium was measured with glutamate dehydrogenase (3). Nucleotide sequence accession numbers. The nucleotide sequences of nrtA (1,918 bp) and the nir upstream region (2,536 bp) reported in this paper will appear in the EMBL/GeneBank/DDBJ nucleotide sequence data libraries under accession numbers X99709 and X99708, respectively. RESULTS AND DISCUSSION Cloning of a cluster of nitrate assimilation genes. A region from the genome of Anabaena sp. strain PCC 7120 that contains a cluster of genes involved in nitrate assimilation has been cloned. To clone it, a 1.5-kb SacI DNA fragment containing part of the nir operon from the unicellular, non-nitrogen-fixing cyanobacterium Synechococcus sp. strain PCC 7942 (24) was used as a probe in heterologous hybridization with Southern FIG. 1. Genomic region of Anabaena sp. strain PCC 7120 that contains a cluster of genes involved in nitrate assimilation. (A) Genes identified by hybridization with Synechococcus probes and/or by sequencing are indicated by thick arrows that also indicate the direction of transcription. Thin lines underneath indicate the extent of some sequenced DNA fragments. Additionally, the nir upstream region from the start of the nir gene to the end of orf398 was completely sequenced. Mutant strains generated in this work, locations of the corresponding mutations, and the name of the inserted gene cassette are also presented. Thick lines followed by lowercase letters indicate the DNA fragments used as probes in Southern blot analyses shown in panel B. B, BglI; C, ClaI; D, DraI; E, EcoRV; H, HindIII; P, PvuII; S, ScaI; X, XbaI. (B) Southern blot analyses for identification of fully segregated mutant clones. Total DNA from the indicated strains was digested (for Southern blots shown from left to right) with endonuclease EcoRV, ClaI, ClaI, or ClaI and hybridized, respectively, to probes a to d shown in panel A. Sizes are shown on the left in kilobases. VOL. 179, 1997 ANABAENA NITRATE ASSIMILATION GENES 479 on July 25, 2017 by USE/BTCA.GENERAL UNIVERSITARIA Sevillahttp://jb.asm.org/Downloaded from blots of total DNA from strain PCC 7120. Hybridization was ascribed to an XbaI fragment of ca. 5.75 kb from the Anabaena genome. A subgenomic gene library from strain PCC 7120 was constructed by cloning XbaI restriction fragments of ca. 5 to 6 kb in cloning vector pBluescript SK(1). From this subgenomic library, clones exhibiting hybridization to the 1.5-kb SacI DNA fragment from the strain PCC 7942 nir operon were identified, and the plasmid contained in a positive clone was named pCSE2 (Fig. 1A and Table 1) and selected for further studies. To try to extend the cloned region, the ScaI-XbaI fragment of ca. 1.8 kb from the insert of pCSE2 was used as a probe in homologous hybridization with Southern blots of HindIII- restricted total DNA from strain PCC 7120. A ca. 8-kb HindIII-hybridizing fragment was identified and cloned in pBluescript SK(1), producing plasmid pCSE5 (Fig. 1A and Table 1). By means of heterologous hybridization using restricted plasmid pCSE2 and, as probes, internal fragments from the nir and nrtA genes from Synechococcus sp. strain PCC 7942 (not shown) and by partial sequencing (Fig. 1A), the presence in the cloned genomic region of Anabaena sp. strain PCC 7120 of genes corresponding to nir,nrtA,nrtB, and nrtC of Synechococcus sp., as well as the relative locations of those genes, was determined. Partial DNA sequence analysis indicates that the Anabaena nir-nrtABC genes encode proteins that share considerable sequence identity with those from Synechococcus. The identity ranged from 40 to 70% (amino acid sequence comparisons were made by using the program GAP contained in the Genetics Computer Group package [8]) within the regions sequenced, which included the entire nrtA gene, almost 600 bp of the nir gene, about 150 bp of the nrtB gene, and about 360 bp of the nrtC gene. Recently, Y. Cai and C. P. Wolk (6) have found that nrtD and narB are also located in this gene cluster, downstream from nrtC. Sequencing of the Anabaena genomic DNA upstream of the nir gene, cloned in pCSE5, revealed the presence of two open reading frames that would encode polypeptides of 136 (orf136) and 398 (orf398) amino acids (Fig. 1A and Table 1) (the last 85 nucleotides of orf398 are not included in pCSE5 but were sequenced from an overlapping clone [not shown]; orf398 starts with a GTG codon). The putative orf136 product shows homology to iron-sulfur proteins involved in electron transport (e.g., 30% identity to the cytochrome b 6-f complex iron-sulfur subunit precursor from Synechocystis sp. strain PCC 6803). The putative product of orf398 shows homology to proteins of the CpcE/RpcE/PecE family (e.g., 24% identity to CpcE from Synechococcus sp. strain PCC 7002) that comprises enzymes involved in the synthesis of bilins or in the chromophorilation of biliproteins. Mutants of the nir and nrtA genes. To test the involvement of the cloned gene cluster in the assimilation of nitrate in Anabaena sp. strain PCC 7120, various strains bearing mutations in the above-described gene cluster were generated. Gene cassette C.S3 encoding Sm r and Sp r (11) was inserted between the two external ClaI sites of the insert of pCSE5, leading to substitution, by gene cassette C.S3, of two ClaI DNA fragments containing the entire nir gene and part of the nrtA gene (see Fig. 1A and Materials and Methods for details). The TABLE 2. Growth rates and nitrate reductase and nitrite reductase activities of Anabaena sp. strain PCC 7120, strain EF116, and some derivative mutants in culture media with different sources of nitrogen Strain m(day 21 ) a in: Nitrate reductase b (mU/mg of protein) in: Nitrite reductase b (mU/mg of protein) in: NO 32 N 2 NH 41 NO 32 N 2 NH 41 NO 32 N 2 NH 41 nir-nrtA mutants EF116 c 0.73 ND 0.66 72.29 5.07 3.37 30.62 3.43 0 CSE1 ,0.01 ND 0.58 0 0 0 0 0 0 nrtA mutants PCC 7120 c 0.84 0.65 0.88 84.7 14.4 12.6 25.0 10.6 2.55 CSE9 0.52 0.48 0.67 82.2 11.4 12.9 26.9 9.1 0.82 CSE10 0.53 0.57 0.60 102.7 11.8 4.5 37.0 19.9 1.57 Mutants of orf136 and orf398 PCC 7120 c ND ND ND 58.9 22.0 3.0 8.5 2.7 0.1 CSE16 ND ND ND 52.8 27.8 1.6 9.1 3.9 0.1 CSE17 ND ND ND 69.1 38.3 1.9 4.1 2.7 0 nir leader region mutants EF116 c ND ND ND 61.8 15.7 2.4 9.2 5.4 0.2 CSE18 ND ND ND 0.7 0.6 0.3 0.2 0 0 a Ammonium-grown cells of the indicated strain were used to inoculate (at 0.2 mg of chlorophyll/ml) Erlenmeyer flasks containing 50 ml of medium with the indicated source of nitrogen. Cultures were incubated under standard conditions (see Materials and Methods). To estimate the growth rate, protein content was measured in aliquots picked up periodically from each culture. ND, not determined. b Ammonium-grown cells of the indicated strain were washed, resuspended in medium with the indicated source of nitrogen, and incubated as indicated in Materials and Methods for derepression experiments. Enzymatic activities were determined after5hinderepression conditions. c Parental. TABLE 3. Nitrate uptake in Anabaena sp. strain PCC 7120 and nrtA mutants a Strain Nitrate uptake at nitrate concn of: 17.6 mM b 0.1 mM c PCC 7120 203.6 544.4 CSE9 175.5 49.2 CSE10 84.0 9.5 a Ammonium-grown cells of the indicated strain were washed, resuspended in BG11 medium (17.6 mM NaNO 3 ), and incubated for5hasindicated in Materials and Methods for derepression experiments. Cells were then harvested and used for nitrate uptake assays (see Materials and Methods). Note that the rates of nitrate uptake in the presence of 17.6 and 0.1 mM NaNO 3 should not be compared with each other, since both uptake assays were carried out under different experimental conditions (see Materials and Methods). b Data are expressed as nanomoles of NH 41 (produced) per minute per milligram of chlorophyll of cells treated with L-methionine–DL-sulfoximine. c Data are expressed as nanomoles of NO 32 (disappeared) per minute per milligram of chlorophyll. 480 FRI ´AS ET AL. J. BACTERIOL. on July 25, 2017 by USE/BTCA.GENERAL UNIVERSITARIA Sevillahttp://jb.asm.org/Downloaded from C.S3-bearing insert was transferred to plasmid vector pRL278 (4) that encodes Nm r and Km r and contains the sacB gene that can be counterselected for in Anabaena sp., and the resulting plasmid (pCSE21aB) was transferred to strain EF116 by means of conjugation selecting for Sm r and Sp r encoded in the C.S3 gene cassette. Four clones that exhibited Sm r ,Sp r , resistance to sucrose, and sensitivity to NM (Nm s ) were selected. Southern analysis was performed to test for the presence of wild-type and mutant chromosomes in those clones. Results presented in Fig. 1B show that no wild-type chromosomes could be detected in one of the selected clones (named CSE1) and that in this clone the wild-type version of the nir-nrtA region (3.6-kb EcoRV fragment) had been substituted by the mutated version (7.6-kb EcoRV fragment). The ability of mutant strain CSE1 to grow using different sources of inorganic nitrogen was tested. As shown in Table 2, while strain EF116 exhibited similar growth rates with either nitrate or ammonium, strain CSE1 proved able to use ammonium but not nitrate as a nitrogen source. Nitrate reductase and nitrite reductase activities were measured in strains EF116 and CSE1 (Table 2). Whereas, as shown previously (29), strain EF116 exhibited high levels of activity of both nitrate reductase and nitrite reductase in medium containing nitrate as the sole nitrogen source and low activity levels in both ammoniumcontaining medium and medium lacking combined nitrogen, strain CSE1 lacked nitrate reductase and nitrite reductase ac- FIG. 2. Expression in Anabaena sp. strain PCC 7120, under different nitrogen regimens, of various genes of the nitrate assimilation gene cluster. (A) RNA isolated from cells grown on dinitrogen (N 2 ), nitrate (NO 32 ), or ammonium (NH 41 ) was used in Northern blot analysis using as a probe a ca. 0.75-kb DraI restriction fragment containing the N-terminal portion and 126 bp upstream of the nir gene (see fragment b in Fig. 1). (B) Northern blot analysis of total RNA isolated from cells grown on ammonium (NH 41 ) or grown on ammonium and incubated for3hinmedium containing nitrate (NO 32 ) or no combined nitrogen (N 2 ). The probes used were the same ca. 0.75-kb DraI fragment used in panel A (nir), a 642-bp ClaI restriction fragment internal to the nrtA gene (Fig. 1), a PCR-generated DNA fragment comprising nucleotides 246 to 1444 with respect to the start of orf136 and a PCR-generated DNA fragment comprising nucleotides 161 to 1454 with respect to the start of orf398 (fragments c and d in Fig. 1). Sizes are given on the side in kilobases. FIG. 3. Expression in strains EF116 and CSE1, under different nitrogen regimens, of different parts of the nitrate assimilation gene cluster. RNA isolated from cells grown on ammonium (NH 41 ) or grown on ammonium and incubated for3hinmedium containing nitrate (NO 32 ) or no combined nitrogen (N 2 ) was used in Northern blot analysis. The probes used were oligonucleotide nir-3, complementary to nucleotides 2288 to 2306 with respect to the start of the nir gene (see Materials and Methods); a ca. 0.4-kb BstNI restriction fragment internal to the nrtB gene; a ca. 0.35-kb XbaI-HindIII restriction fragment internal to the nrtC gene (Fig. 1); and a 1,564-bp EcoRI-AccI restriction fragment, excised from plasmid pRL822RM2, containing most of the narB gene and 18 bp upstream of it (6). Sizes are given on the side in kilobases. VOL. 179, 1997 ANABAENA NITRATE ASSIMILATION GENES 481 on July 25, 2017 by USE/BTCA.GENERAL UNIVERSITARIA Sevillahttp://jb.asm.org/Downloaded from tivities under any of these growth conditions. These results indicate that in Anabaena sp. strain PCC 7120 the function of the nir gene is required for the assimilation of nitrate as well as for expression of nitrite reductase (for the role of nrtA in nitrate assimilation in strain PCC 7120, see below). The fact that mutagenesis of the nir gene with a gene cassette (C.S3) bearing transcriptional terminators (34) resulted in a lack of expression of nitrate reductase points to the nitrate assimilation gene cluster behaving as an operon in this cyanobacterium. Insertional mutants of the nrtA gene were generated from Anabaena sp. strain PCC 7120 by means of conjugation of this strain with E. coli strains bearing plasmid pCSE44B or pCSE45B (see Table 1). These are Sm r Sp r , SacB-encoding plasmids whose vector portion is pRL277 (4) and whose inserts comprise that of pCSE5 modified by insertion of gene cassette C.K1 (which does not include transcriptional terminators), in either of the two orientations, into the EcoRV site located inside the nrtA gene (see Fig. 1A and Materials and Methods for details). After selection for Anabaena strains exhibiting Nm r (encoded in the C.K1 gene cassette), resistance to sucrose, and Sm s and Sp s , two clones that, in Southern analysis, did not show the presence of wild-type chromosomes (2.3-kb ClaI fragment) and showed the mutated version (3.6-kb ClaI fragment) of the nrtA gene were selected (Fig. 1B). These clones were named CSE9 and CSE10, which should bear the Nm r -encoding gene in the same orientation as the nrtA gene and in the opposite orientation, respectively. Both CSE9 and CSE10 were able to grow in media containing ammonium, nitrate, or no combined nitrogen, although at rates lower than those of parental strain PCC 7120 (Table 2). In contrast to the situation with strain PCC 7120, which develops heterocysts only in the absence of combined nitrogen, both strains CSE9 and CSE10 developed heterocysts in media supplemented with nitrate (1 or 17.6 mM). Nitrate uptake, nitrate reductase, and nitrite reductase activities were determined in mutants CSE9 and CSE10 and compared to those of parental strain PCC 7120. As shown in Table 2, both CSE9 and CSE10 exhibited nitrate reductase and nitrite reductase activities comparable to those of strain PCC 7120. As shown in Table 3, both mutants were drastically impaired in uptake of low (0.1 mM) but not of high (17.6 mM) concentrations of nitrate. These results showing that strains CSE9 and CSE10 were impaired in nitrate uptake at 0.1 mM nitrate concentration indicate that these mutants are affected in the active transport of nitrate and thus that the nrtA gene is required for active transport of nitrate in strain PCC 7120. On the other hand, the fact that strains CSE9 and CSE10 showed substantial rates of nitrate FIG. 4. Levels of expression along the nir operon of Anabaena sp. strain PCC 7120. The DNA restriction fragments from the nir operon represented in the figure by thick segments were excised with the indicated enzymes from plasmid pCSE21 (for fragments of the nir or nrt gene [see Table 1]) or pRL822RM2 (for the fragment of the narB gene [6]) and were subjected to electrophoresis on agarose gels and blotted to filters. Total RNA from ammonium-grown cells incubated for3hinmedium containing nitrate or no combined nitrogen (N 2 ) was used as a probe for hybridization (see Materials and Methods for details). The amount of radioactivity in each fragment was normalized to 1 kb (dividing by the number of kilobases of the fragment). The amount of radioactivity associated with each fragment is expressed as a percentage of the radioactivity associated with the fragment showing maximum labelling in each of the two parts of the figure (100% corresponded to different values in the experiment with RNA from nitrate-incubated cells and in that with RNA from no-combined-nitrogen-incubated cells). A, AccI; C, ClaI; E, EcoRI; H, HindIII; X, XbaI. 482 FRI ´AS ET AL. J. BACTERIOL. on July 25, 2017 by USE/BTCA.GENERAL UNIVERSITARIA Sevillahttp://jb.asm.org/Downloaded from uptake at high concentrations of nitrate indicates that, in Anabaena sp. strain PCC 7120, the nrtA gene is dispensable for the uptake of high concentrations of nitrate. As has been suggested for Synechococcus sp. strain PCC 7942 (33), nitrate could be taken up substantially in a passive way at those high concentrations of nitrate. Alternatively, a low-affinity nitrate transport system independent of the nrtA gene might be expressed in Anabaena sp. strain PCC 7120. Anyway, results in Table 3 show that strains CSE9 and CSE10 are to some extent also affected in the uptake of nitrate at 17.6 mM concentration. This, together with the fact that both CSE9 and CSE10 exhibited heterocysts when growing in nitrate-supplemented media, which is indicative of a shortage of nitrogen in the cells, points to a role of the active transport system in the total uptake of nitrate and in the growth at the expense of this nutrient not only at low but also at high concentrations of nitrate. Mutants of orf136 and orf398. To generate insertional mutants of orf136 and orf398, plasmids pCSE78B and pCSE81B, respectively, were transferred to Anabaena sp. strain PCC 7120 by means of conjugation (see Table 1 and Materials and Methods). Plasmids pCSE78B and pCSE81B were constructed by insertion, in plasmid pCSE26, of gene cassette C.S3 into the BglI site found inside orf136 and into the PvuII site located inside orf398, respectively (Fig. 1A). After isolation of Anabaena strains exhibiting Sm r and Sp r (encoded in the C.S3 gene cassette) and resistance to sucrose, one clone mutated in orf136 (strain CSE16) and one clone mutated in orf398 (strain CSE17) that in Southern analysis did not show tracks of wildtype chromosomes were selected. In both strain CSE16 and strain CSE17, the 2.5-kb ClaI fragment that in the wild-type strain comprises orf136 and orf398 was substituted by the C.S3- containing ClaI fragment of 4.5 kb (Fig. 1B). Strains CSE16 and CSE17 were able to grow using nitrate as the nitrogen source (not shown) and exhibited high levels of nitrate reductase and nitrite reductase (although in strain CSE17 nitrite reductase levels seem to be somewhat lower than in the wild-type strain) when incubated in the presence of nitrate, with both activities being repressed by ammonium, as it is the case in the wild-type strain (Table 2). Thus, at least under our laboratory growth conditions, both orf136 and orf398 seem to be dispensable for the assimilation of nitrate in Anabaena sp. strain PCC 7120. Analysis of gene expression. Expression of the Anabaena sp. strain PCC 7120 gene cluster described above was studied by means of Northern and primer extension experiments using total RNA from cells of parental and mutant strains incubated under various nitrogen regimens. Northern analyses were performed with total RNA isolated from cells of Anabaena sp. strain PCC 7120 grown on ammonium, nitrate, or dinitrogen (Fig. 2A) or grown on ammonium and either not further incubated or incubated for 3 h with nitrate or no combined nitrogen (Fig. 2B) and with RNA of strains EF116 and CSE1 grown on ammonium and either not further incubated or incubated for 3 h with nitrate or no combined nitrogen (Fig. 3). The probes used included fragments of the nir,nrtA,nrtB,nrtC, and narB genes and an oligonucleotide (oligonucleotide nir-3 [see Materials and Methods]) complementary to a transcribed (see below) DNA sequence located upstream of the coding region of the nir gene. Strong hybridization signals were obtained, with the different probes, with RNA isolated from cells of strain PCC 7120 or EF116 incubated with nitrate or with no combined nitrogen but not with RNA from cells grown on ammonium. When RNA from strain CSE1 was used, a hybridization signal was observed only when RNA isolated from cells incubated with nitrate or no combined nitrogen was probed with the oligonucleotide of the nir upstream region. The facts that similar hybridization signals were observed with RNA from strain PCC 7120 or EF116 by using probes corresponding to the nir gene and to genes downstream of it in the cluster and, principally, that insertion of C.S3 in nir-nrtA abolished expression of downstream genes (nrtB,nrtC, and narB) strongly suggest that the nir,nrtABCD, and narB genes of Anabaena sp. strain PCC 7120 behave as an operon. The RNA representing the message from the whole operon should be longer than 6 kb (the distance from the tsp [see below] to the 39end of the fragment of the nrtC gene contained in plasmid pCSE5 [Fig. 1A]). The fact that the hybridization signal detected was a smear of RNAs from 7.5 to 0.3 kb in size is probably due to low stability of the whole mRNA of the operon, as has been suggested for the nir operon mRNA of Synechococcus sp. strain PCC 7942 (27, 39). Northern experiments were also performed with probes of orf136 and orf398. Both probes hybridized to RNAs of similar sizes. This would be consistent with cotranscription of both open reading frames, whose expression seems to take place both in the presence and in the absence of ammonium, being highest in the medium containing nitrate. FIG. 5. Presumed transcription start points of nir and orf136. Primer extension experiments were performed with total RNA from the indicated strain grown on ammonium (NH 41 ) or grown on ammonium and incubated for3hin medium containing nitrate (NO 32 ) or no combined nitrogen (N 2 ). The oligonucleotides used were nir-1 (A) and nir-14 (B) (see Materials and Methods). Lanes A, C, G, and T contain a dideoxy sequencing ladder of the same DNA region, used as a size marker of the extension products. The nucleotide sequence around the end of each extension product (indicated by a horizontal arrow) is shown at the left. VOL. 179, 1997 ANABAENA NITRATE ASSIMILATION GENES 483 on July 25, 2017 by USE/BTCA.GENERAL UNIVERSITARIA Sevillahttp://jb.asm.org/Downloaded from Expression along the nir operon of Anabaena sp. strain PCC 7120 was studied by means of hybridization of filter-bound DNA from various cloned fragments of the nitrate assimilation gene cluster with 32 P-labelled total RNA from wild-type strain PCC 7120 (see Materials and Methods for details). RNA was isolated from ammonium-grown cells that had been incubated for 3 h with nitrate or with no combined nitrogen. In both cases, the strongest hybridization signal was found with the DNA fragment that contained the nir gene (Fig. 4) and the weakest hybridization signal was found with the narB-contain- ing fragment located at the 39end of the operon (about 33% of the 59-end value with RNA from nitrate-incubated cells and 19% with RNA from no-combined-nitrogen-incubated cells). Intermediate hybridization signals were observed with the DNA fragments covering the three analyzed nitrate transport genes nrtABC (65 to 85% of the 59-end value with RNA from nitrate-incubated cells and 35 to 55% with RNA from nocombined-nitrogen-incubated cells). Thus, the 59end of the mRNA of the nir operon seems to be more abundant than its 39end in cells incubated with either nitrate or no source of combined nitrogen. Transcription start points. Primer extension experiments were carried out using total RNA from Anabaena sp. strain PCC 7120 cells grown on ammonium and either not further incubated or incubated for3hinthepresence of nitrate or of no combined nitrogen. Oligonucleotides complementary to the 59end of the nir gene or to sequences upstream of it (see Materials and Methods for details) were used as primers. As shown in Fig. 5A, an extension product whose 39end corresponded to nucleotide 2460 with respect to the first nucleotide of the nir gene was obtained with oligonucleotide nir-1 and RNA from cells that had been incubated in medium containing either nitrate or no combined nitrogen but not with RNA from ammonium-grown cells. As described in the introduction, the NtcA protein is a transcriptional regulator required for the expression of ammonium-repressed genes in cyanobacteria. We have previously shown that in strain PCC 7120 expression of the nir gene requires the function of the NtcA protein, since no RNA hybridizing to a probe of the nir gene could be detected in a mutant, strain CSE2, that bears a gene cassette inserted into the ntcA gene (17). Results shown in Fig. 5A indicate that, in fact, the ammonium-regulated, presumed transcription initiation site of the nir operon was not used in the ntcA mutant, strain CSE2. The structure of the NtcA-activated promoters has been determined in the unicellular cyanobacterium Synechococcus sp. strain PCC 7942 (27). They are constituted by a TAN 3 T sequence fitting the 210 box of the E. coli s 70 consensus promoter and an NtcA-binding site including the sequence GTAN 8 TAC located ca. 22 nucleotides upstream from the TAN 3 T box. As shown in Fig. 6A, the DNA region upstream of the ammonium-regulated, presumed transcription initiation site of the nir operon indeed exhibits the structure of an NtcA-activated promoter. FIG. 6. DNA sequences upstream of the nir gene. (A) The first codon of the nir gene (whose 31 N-terminal amino acids are shown) is represented by a horizontal arrow. A putative ribosome binding site (RBS) is underlined. The position of a presumed transcription initiation site of the nir gene (tsp, underlined), as well as the putative 210 box and an NtcA-binding site, is also indicated. (B) The start of orf136 is represented by an horizontal arrow. A presumed transcription initiation site for orf136 (tsp, underlined), as well as putative 210 and 235 promoter sequences, is also indicated. Note that the nucleotide sequence shown in panel B is the antiparallel sequence of the first 280 nucleotides presented in panel A. 484 FRI ´AS ET AL. J. BACTERIOL. on July 25, 2017 by USE/BTCA.GENERAL UNIVERSITARIA Sevillahttp://jb.asm.org/Downloaded from For orf136, primer extension experiments using as a primer oligonucleotide nir-12 or nir-14 (see Materials and Methods) were carried out. An extension product whose 39end corresponded to nucleotide 2144 with respect to the first nucleotide of orf136 was obtained when oligonucleotide nir-14 was used (Fig. 5B). The template RNA was present in cells incubated with nitrate, no combined nitrogen, or ammonium, although it appeared to be more abundant in cells incubated with nitrate than with no combined nitrogen and in no-combined-nitrogen- incubated than in ammonium-grown cells. Upstream from this presumed transcription initiation site, sequences, 59TAAAA T39and 59TTCTAA39, that could conform, respectively, to the 210 and 235 boxes of the E. coli s 70 consensus promoter are found (Fig. 6B). To test the existence in the nir operon of internal promoters different from the NtcA-regulated promoter above described, one insertional mutant of the leader region of that operon was generated. Plasmid pCSE88B (Table 1) bearing gene cassette C.S3 (which carries transcriptional terminators in both orientations [34]) inserted into the ClaI restriction site located in the leader region of the nir operon (Fig. 1A) was transferred to strain EF116 by means of conjugation (see Materials and Methods). Strains exhibiting Sm r ,Sp r (encoded in the C.S3 gene cassette), and resistance to sucrose were selected. The presence in these strains of wild-type copies of the nir region, as well as their genetic structure in that region, was tested by PCR amplification (not shown). One clone (strain CSE18) that did not show tracks of wild-type chromosomes and showed evidence of insertion of gene cassette C.S3 in the leader region of the nir operon was chosen for further analysis. Strain CSE18 was unable to grow on nitrate (not shown) and exhibited negligible levels of both nitrate reductase and nitrite reductase activities in ammonium-grown as well as in nitrate- or nocombined-nitrogen-incubated cells (Table 2). The results presented are best interpreted in terms of a lack of promoter activity, at least under our experimental conditions, of DNA sequences of the nir gene cluster downstream from the ClaI restriction site where C.S3 is inserted in strain CSE18. Concluding remarks. Results presented in this work, together with those of Cai and Wolk (6), demonstrate the presence in the genome of the heterocyst-forming cyanobacterium Anabaena sp. strain PCC 7120 of a cluster of genes encoding proteins for nitrate assimilation. These genes are nir (encoding nitrite reductase), nrtABCD (encoding a nitrate permease), and narB (encoding the nitrate reductase apoenzyme). This cluster of genes is similar to that found in the unicellular cyanobacterium Synechococcus sp. strain PCC 7942, but the arrangement of nitrate assimilation genes in some other cyanobacteria is different (see the introduction). As indicated by the effects, on expression of distal genes, of insertion of gene cassettes in the 59region of the cluster, the nitrate assimilation gene cluster of strain PCC 7120 behaves as an operon. The levels of mRNA of the 59end of the cluster (the nir gene) are higher than those of the 39end (the narB gene). This could be accounted for by partial premature termination of transcription of the operon or by differential degradation of the two ends of the mRNA. Anyway, the observed lower levels of the 39end of the mRNA of the cluster are consistent with the low content of nitrate reductase protein usually found in cyanobacteria. Expression of the nir operon is subjected to ammoniumpromoted repression and requires the action of the transcriptional regulator NtcA. The presumed transcription initiation site of the nir operon is located 460 bp upstream of the start of nir, the first gene in the operon, and is preceded by an NtcA- type promoter. It can be concluded that in Anabaena sp. strain PCC 7120 expression of the nir operon upon ammonium withdrawal takes place from an NtcA-regulated promoter and thus that the nir operon comprising structural genes for nitrate and nitrite assimilation belongs to the NtcA regulon. We have repeatedly observed that expression of high nitrate reductase and nitrite reductase levels in heterocyst-forming cyanobacteria requires, in addition to an absence of ammonium, the presence of either nitrate or nitrite in the culture medium (14) (Table 2). Levels of the mRNA of the nir operon in Anabaena sp. strain PCC 7120 also seem to be higher in nitrate-supplemented media than in media lacking a source of combined nitrogen. Utilization of the nir operon tsp could be stimulated, and/or stability of the nir operon mRNA could be enhanced, by nitrate. ACKNOWLEDGMENTS This work was supported by grant BIO93-0124 from the Comisio´n Interministerial de Ciencia y Tecnologı´a of Spain. J.E.F. was the recipient of a fellowship from the Fundacio´n Ca´mara Urzaiz-Univer- sidad de Sevilla, Seville, Spain. We thank C. P. Wolk and Y. Cai for sharing information with us before publication and for plasmid pRL822RM2. REFERENCES 1. Apte, S. K., and R. Haselkorn. 1990. Cloning of salinity stress-induced genes from the salt-tolerant nitrogen-fixing cyanobacterium Anabaena torulosa. Plant Mol. Biol. 15:723–733. 2. Ausubel, F. M., R. Brent, R. E. Kingston, D. D. Moore, J. G. Seidman, J. A. Smith, and K. Struhl (ed.). 1994. Current protocols in molecular biology. Greene Publishing and Wiley Interscience, New York, N.Y. 3. Bergmeyer, H. U. 1974. Methoden der enzymatischen analyse, 2nd ed. Verlag Chemie, Weinheim, Germany. 4. Black, T. A., Y. Cai, and C. P. Wolk. 1993. Spatial expression and autoregulation of hetR, a gene involved in the control of heterocyst development in Anabaena. Mol. Microbiol. 9:77–84. 5. Cai, Y., and C. P. Wolk. 1990. Use of a conditionally lethal gene in Anabaena sp. strain PCC 7120 to select for double recombinants and to entrap insertion sequences. J. Bacteriol. 172:3138–3145. 6. Cai, Y., and C. P. Wolk. Unpublished results. 7. Cawse, P. A. 1967. The determination of nitrate in soil solution by ultraviolet spectrophotometry. Analyst 92:311–315. 8. Devereux, J. P., P. Haeberli, and O. Smithies. 1984. A comprehensive set of sequence analysis programs for the VAX. Nucleic Acids Res. 12:387–395. 9. Douglas, S. E. 1994. Chloroplast origins and evolution, p. 91–118. In D. A. Bryant (ed.), The molecular biology of cyanobacteria. Kluwer Academic Publishers, Dordrecht, The Netherlands. 10. Elhai, J., Y. Cai, and C. P. Wolk. 1994. Conduction of pEC22, a plasmid coding for MR zEcoT22I, mediated by a resident Tn3-like transposon, Tn5396. J. Bacteriol. 176:5059–5067. 11. Elhai, J., and C. P. Wolk. 1988. A versatile class of positive-selection vectors based on the nonviability of palindrome-containing plasmids that allows cloning into long polylinkers. Gene 68:119–138. 12. Elhai, J., and C. P. Wolk. 1988. Conjugal transfer of DNA to cyanobacteria. Methods Enzymol. 167:747–754. 13. Fellay, R., X. Perret, V. Viprey, W. J. Broughton, and S. Brenner. 1995. Organization of host-inducible transcripts on the symbiotic plasmid of Rhizobium sp. NGR234. Mol. Microbiol. 16:657–667. 14. Flores, E., and A. Herrero. 1994. Assimilatory nitrogen metabolism and its regulation, p. 487–517. In D. A. Bryant (ed.), The molecular biology of cyanobacteria, Kluwer Academic Publishers, Dordrecht, The Netherlands. 15. Flores, E., M. G. Guerrero, and M. Losada. 1983. Photosynthetic nature of nitrate uptake and reduction in the cyanobacterium Anacystis nidulans. Biochim. Biophys. Acta 722:408–416. 16. Frı´as, J. E., A. Me´rida, A. Herrero, J. Martı´n-Nieto, and E. Flores. 1993. General distribution of the nitrogen control gene ntcA in cyanobacteria. J. Bacteriol. 175:5710–5713. 17. Frı´as, J. E., E. Flores, and A. Herrero. 1994. Requirement of the regulatory protein NtcA for the expression of nitrogen assimilation and heterocyst development genes in the cyanobacterium Anabaena sp. PCC 7120. Mol. Microbiol. 14:823–832. 18. Golden, S. S., J. Brusslan, and R. Haselkorn. 1987. Genetic engineering of the cyanobacterial chromosome. Methods Enzymol. 153:215–231. 19. Herrero, A., and M. G. Guerrero. 1986. Regulation of nitrite reductase in the cyanobacterium Anacystis nidulans. J. Gen. Microbiol. 132:2463–2468. 20. Herrero, A., E. Flores, and M. G. Guerrero. 1985. Regulation of nitrate reductase cellular levels in the cyanobacteria Anabaena variabilis and Syn- VOL. 179, 1997 ANABAENA NITRATE ASSIMILATION GENES 485 on July 25, 2017 by USE/BTCA.GENERAL UNIVERSITARIA Sevillahttp://jb.asm.org/Downloaded from