Papel de la helicasa UAP56/DDX39B y otros factores asociados al metabolismo del ARN en la integridad del genoma

Papel de la helicasa UAP56/DDX39B y otros factores asociados al metabolismo del ARN en la integridad del genoma Carmen Pérez Calero Tesis doctoral Universidad de Sevilla 2019 2 Papel de la helicasa UAP56/DDX39B y otros factores asociados al metabolismo del ARN en la integridad del genoma Trabajo realizado en el Departamento de Genética, Facultad de Biología, y en el departamento de Biología del Genoma, CABIMER, de la Universidad de Sevilla, para optar al grado de doctora en la Universidad de Sevilla por la licenciada Carmen Pérez Calero. Sevilla, 2019 La doctoranda, El director de tesis, Carmen Pérez Calero Andrés Aguilera López 3 4 TABLE OF CONTENTS RESUMEN ....................................................................................... 12 INTRODUCTION.............................................................................. 16 1. GENOME INSTABILITY ......................................................................................... 18 1.1. DNA damage response ............................................................................................ 19 1.2. Replication ................................................................................................................. 19 1.3. Transcription-associated genome instability ...................................................... 20 1.4. Transcription-replication conflicts ........................................................................ 21 2. RNA METABOLISM AND GENOME STABILITY ............................................... 24 2.1. Transcription and RNA processing ....................................................................... 24 2.2. THO/TREX as a paradigm of the connection between RNA metabolism and genome integrity ..................................................................................................................... 27 2.3. DEAD-box RNA helicases and genome integrity ................................................ 29 3. R LOOPS AS A SOURCE OF GENOME INSTABILITY..................................... 34 3.1. R loops as a cellular regulators ............................................................................. 35 3.2. R loops as genomic threats ................................................................................... 36 3.3. Mechanisms and elements involved in R loop prevention ....................... 40 3.4. Techniques to detect R loop accumulation ......................................................... 44 4. EPITHELIAL-MESENCHYMAL TRANSITION AND THE TRANSCRIPTION FACTOR SNAIL1 ............................................................................................................ 45 4.1. Epithelial-Mesenchymal transition ........................................................................ 45 4.2. SNAIL1 ........................................................................................................................ 47 OBJECTIVES .................................................................................. 50 MATERIALS AND METHODS ........................................................ 54 1. GROWTH MEDIA AND CONDITIONS ................................................................. 56 1.1. Bacteria cell culture .................................................................................................. 56 1.2. Human cell culture .................................................................................................... 56 2. ANTIBIOTICS, DRUGS, INHIBITORS, ENZYMES AND ANTIBODIES .................... 56 2.1 Antibiotics .................................................................................................................. 56 2.2 Drugs and inhibitors ................................................................................................. 57 2.3. Enzymes and antibodies ......................................................................................... 57 3. HUMAN CELL LINES ............................................................................................. 60 4. PLASMIDS............................................................................................................... 60 5. BACTERIAL TRANSFORMATION AND HUMAN CELLS TRANSFECTION .. 61 5.1. Bacterial transformation .......................................................................................... 61 5.2. Human cells transfection ......................................................................................... 61 6. IN VITRO ANALYSIS ............................................................................................. 63 6.1. Purification of UAP56 wild-type and mutant proteins ........................................ 63 6.2. Nucleic acid unwinding assays .............................................................................. 64 5 7. PROTEIN-PROTEIN INTERACTION METHODS ................................................ 66 7.1. Co-immunoprecipitation (Co-IP) ............................................................................ 66 7.2. Proximity ligation Assay (PLA) .............................................................................. 66 8. CELL CYCLE ANALYSIS IN HUMAN CELLS .................................................... 67 8.1. FACS analysis ........................................................................................................... 67 9. IMMUNOFLUORESCENCE ................................................................................... 67 10. GENOME INSTABILITY ANALYSIS ................................................................ 69 10.1. Analysis of γH2AX foci ............................................................................................ 69 10.2. Single cell gel electrophoresis (Comet assay) .................................................... 69 10.3. RNA-DNA hybrids detection ................................................................................... 71 11. REPLICATION ANALYSIS ................................................................................ 72 11.1. Analysis of FANCD2 foci ......................................................................................... 72 11.2. Single DNA fiber analysis in human cells (DNA combing) ................................ 72 12. MICROSCOPY IMAGES ACQUISITION, DATA ANALYSIS AND STADISTICAL ANALYSIS ............................................................................................. 74 12.1. Fluorescence microscopy ....................................................................................... 74 12.2. Data analysis ............................................................................................................. 74 12.3. Statistical analysis .................................................................................................... 75 13. POLYMERASE CHAIN REACTION (PCR) ANALYSIS ................................. 76 13.1. Quantitative PCR analysis ....................................................................................... 76 14. PROTEIN ANALYSIS ......................................................................................... 77 14.1. Human cells protein extraction .............................................................................. 77 14.2. SDS-PAGE .................................................................................................................. 78 14.3. Western Blot analysis .............................................................................................. 78 14.4. Non-fluorescence WB .............................................................................................. 78 14.5. Fluorescent WB ......................................................................................................... 79 15. GENOME WIDE EXPERIMENTS ...................................................................... 79 15.1. RNA-seq ...................................................................................................................... 79 15.2. Chromatin immunoprecipitation (ChIP) assay (ChIP-seq) ................................ 80 15.3. DNA-RNA immunoprecipitation followed by high-throughput DNA sequencing (DRIP-seq) .......................................................................................................... 81 15.4. RNA-DNA immunoprecipitation followed by cDNA conversion couple to high throughput sequencing (DRIPc-seq) .................................................................................. 81 16. GENOME WIDE DATA ANALYSIS .................................................................. 82 16.1. RNA-seq ...................................................................................................................... 82 16.2. ChIP-seq ..................................................................................................................... 82 16.3. DRIP-seq and DRIPc-seq ......................................................................................... 83 REFERENCES................................................................................. 85 6 INDEX OF FIGURES INTRODUCTION Figure I1. Transcription-associated genome instability. ................................... 23 Figure I2. Co-transcriptional assembly of the mRNPs. .................................... 27 Figure I3. DDX5/Dbp2 functions as a RNP chaperone. ................................... 31 Figure I4. Human UAP56 structure. ................................................................. 32 Figure I5. Role of UAP56 in transcription and nuclear export. ......................... 33 Figure I6. R loop structure................................................................................ 34 Figure I7. R loop-mediated genome instability. ................................................ 40 Figure I8. Action to prevent or resolve R loop accumulation. ........................... 43 Figure I9. Multiple factors involved in R loop-mediated T-R conflicts. .............. 44 Figure I10. Principal traits during epithelial-mesenchymal transition. ............... 47 Figure I11. Structure of Snail1. ........................................................................ 48 MATERIALS AND METHODS Figure M1. DNA combing measurements. ....................................................... 75 INDEX OF TABLES Table M1. Primary antibodies used in this study .............................................. 58 Table M2. Secondary antibodies used in this study ......................................... 59 Table M3. Cell lines used in this study ............................................................. 60 Table M4. Plasmids used in this study ............................................................. 60 Table M5. siRNAs used in this study ................................................................ 61 Table M6. Oligonucleotides for unwinding assays used in this study ............... 65 Table M7. DNA primers used in this study ....................................................... 76 7 ABBREVIATIONS A Alanine AID Activation-Induced cytidine Deaminase AREX Alternative mRNA Export complex AS Alternative splicing ATM Ataxia Telangiectasia Mutated ATP Adenosine triphosphate ATRIP ATR Interacting Protein A.U. Arbitrary Units bp base pairs BRCA Breast Cancer BrdU Bromodeoxyuridine CBC Cap-Binding Complex CBP Cap-Binding Protein CDC25 Cell Division Cycle 25 cDNA complementary DNA ChIP Chromatin Immunoprecipitation ChIP-seq Chromatin Immunoprecipitation-sequencing CIN Chromosome Instability CldU Cloro-deoxyuridine CNVs Copy Number Variants Co-IP Co-immunoprecipitation CTD Carboxyl-Terminal Domain DDR DNA Damage Response DDX DEAD box DNA Deoxyribonucleic Acid DNase Deoxyribonuclease dNTP Deoxyribonucleotide triphosphate DRIP RNA-DNA immunoprecipitation DRIP-seq RNA-DNA immunoprecipitation-sequencing DRIPc-seq RNA-DNA immunoprecipitation followed by cDNA conversionsequencing 8 dsRNA Double-stranded RNA E Glutamic acid EGFP Enhanced Green Fluorescent Protein EJC Exon Junction Complex EMT Epithelial-mesenchymal transition GCR Gross chromosomal rearrangements FA Fanconi Anemia FACS Fluorescence-Activated Cell Sorting FACT Facilitates Chromatin Transcription G+C Guanine and Cytosine GFP Green Fluorescence Protein H3S10-P Histone H3 Phosphorylation at serine 10 HBD Hybrid-binding domain HDAC Histone Deacetylase hnRNP heterogeneous nuclear Ribonucleoprotein HR Homologous recombination HU Hydroxyurea IdU Iodo-deoxyuridine IF Immunofluorescence Ig Immunoglobulin K Lysine Kb Kilobases KDa Kilodalton lncRNA long non-coding RNA LOH Loss Of Heterozygosity MCM Mini chromosome maintenance mESC mouse embryonic stem cells MRN Mre11-Rad50-Nbs1 mRNA messenger RNA mRNP messenger Ribonucleoprotein particle NES Nuclear export signal NHEJ Non-homologous end joining 15 16 INTRODUCTION 17 INTRODUCTION 18 1. GENOME INSTABILITY Cells are able to maintain order in a disordered world due to a large extent to the genetic information encompassed in the genome and stored in form of DNA molecule. Since the prime objective for cells is to faithfully transmit this genetic material in each cell division to its offspring, cells have developed a wide variety of highly regulated coordinated processes to guarantee genome stability. However, DNA is constantly assaulted by endogenous and environmental agents that might propitiate genome changes. This paradoxical situation drives to genetic variability, which although can have detrimental consequences, is also the basis for evolution (Aguilera and Gomez-Gonzalez, 2008). Thereby, genome instability can be a source of genetic diversity as is the case of immunoglobulin diversification. Nonetheless, under certain circumstances such as the ones that affect a proper DNA repair and/or replication, genome alterations can compromise genome integrity leading to an increased genome instability, which is a hallmark of aging, hereditary genetic diseases and cancer-related disorders (Gaillard and Aguilera, 2016; Negrini et al., 2010). Such changes in the genome can be the consequence of lesions in the DNA generated by different sources of DNA damage, including endogenous metabolites from cellular processes like transcription or replication, and exogenous sources, such as external genotoxic agents. Indeed, DNA can undergo distinct type of lesions that cover abasic sites, bases mismatch, DNA adducts, inter- and intra-strand crosslinks, single-stranded DNA (ssDNA) gaps and double-strand breaks (DSBs). Therefore, genome instability comprises different form of mutations from point mutations to microsatellite contractions and expansions and chromosomal changes, such as chromosome instability (CIN), gross chromosomal rearrangements (GCRs), copy number variants (CNVs), loss of heterozygosity (LOH) and hyper-recombination (Aguilera and Garcia-Muse, 2013). To counteract this threat to genome integrity, cells have evolved several systems based on the sensing and repair of DNA damages and coupling to the Tesis doctoral-Carmen Pérez Calero 19 cell cycle to warrant proper cell proliferation or, alternatively apoptosis, which are collectively termed DNA Damage Response (DDR) (Gaillard and Aguilera, 2016). 1.1. DNA damage response The DNA damage response (DDR) is based on a complex signally network that detects DNA damage and replication stress and orchestrates DNA repair and cell cycle progression in order to counteract DNA damage. This system comprises a wide variety of DNA repair mechanisms, given the diversity of DNA-lesion types. The DDR signaling cascades are triggered by the recognition of specific DNA lesions by sensor proteins such as the MRN (Mre11 Rad50 Nb1) sensor complex that detects DSBs and RPA (replication protein A). These proteins signal the accumulation of ssDNA generated during replication stress, which are sensed by the ataxia telangiectasia mutated (Tel1/ATM) and ataxia telangiectasia and Rad3 related (Mec1/ATR) via its partner protein ATRIP (ATR-interacting partner) (as named in yeast/humans), respectively. Afterwards, ATM/ATR phosphorylates various proteins that trigger cell cycle progression arrest in coordination with DNA repair pathways to preserve genome integrity (Sulli et al., 2012). Among them, there are important mediators such as the histone variant H2AX, p53-binding protein (53BP1) or BRCA1. The DDR signaling can be spread from the damage locus thanks to the phosphorylation of the histone variant H2AX on Ser139 (known as γH2AX) by ATM/ATR or the activation of the downstream kinases including the checkpoint kinases 1 and 2 (Chk1/CHK1 and Rad53/CHK2) phosphorylated by ATR and ATM, respectively. Finally, all these complex signaling pathways converge on downstream effectors such as p53 and the cell division cycle 25 (CDC25) phosphatases. At the end, cells have different alternatives: cell cycle can be arrested to permit DNA repair before proliferation and cell cycle resumption or, if the DNA damage is persistent or irreparable, cell apoptosis and senescence pathways can be activated (Sulli et al., 2012). 1.2. Replication DNA replication is essential for genome duplication, and then, for transmission of genetic information to the offspring. Each time a cell divides, only once during S INTRODUCTION 20 phase, billions of nucleotides must be accurately copied in coordination with cell cycle. For this purpose, replisomes are required to maintain an accurate rate through the chromatinized DNA template and overcome different impediments such as DNA lesions, torsional stress, non-B DNA structures or the transcription machinery itself that can hamper replication fork (RF) progression (Gaillard et al., 2015; Gomez-Gonzalez and Aguilera, 2019). However, these obstacles can alter the proper function of the replisome leading to replication stress, which in turn could drive to persistent RF stalling and then to, the collapse of the replication machinery causing replisome disassembly, ssDNA gaps and DNA breaks threatening genetic integrity (Aguilera and Garcia-Muse, 2013; Aguilera and Gomez-Gonzalez, 2008; Kim and Jinks-Robertson, 2012). To counteract this situation, cells have evolved refined mitotic and S phase checkpoint pathways that ensure DNA integrity and chromosome transmission (Gaillard et al., 2015). 1.3. Transcription-associated genome instability Gene expression encompasses different processes from transcription to the proper processing of the messenger RNA (mRNA), export and translation of that RNA into a protein in the cytoplasm (Gaillard et al., 2013). During transcription the two DNA strands separate locally within the RNA polymerase (RNAP) to form the transcription bubble in which the RNAP uses one of the DNA strands as template (transcribed strand) to generate a complementary RNA chain, forming an RNA-DNA hybrid. Meanwhile, the non-transcribed strand remains unpaired as ssDNA. Furthermore, transcription generates DNA topological changes and even chromatin remodeling changes required to permit the movement of the transcription machinery through the DNA (Selth et al., 2010). Numerous studies from the last decades have revealed that transcription represent also a source of DNA variability. Since any DNA lesions or secondary structure with the potential to stall a DNA polymerase, could also block an RNA polymerase, transcription has been found to be responsible for high levels of mutation (Transcriptionassociated mutation, TAM) and recombination (Transcription-associated recombination, TAR) (Gaillard and Aguilera, 2016). Tesis doctoral-Carmen Pérez Calero 21 Genome instability associated with transcription can be adduced to several factors. For instance, the transient exposure of a ssDNA after the RNAPII passage increase its vulnerability toward mutagenic agents (Figure I1A). This is consistent with previous reports showing a synergistic effect between the transcriptional stated of a DNA regions and its susceptibility to DNA damaging agents (Garcia-Rubio et al., 2003). Moreover, during this process the DNA is also subjected to topological changes that nucleic acids must accomplish to allow the movement of the transcription machinery, which leads to positive and negative supercoiling ahead and behind the RNAPII, respectively. Such changes can facilitate the transient formation of the ssDNA. This stretched ssDNA could be damaged (Bermejo et al., 2009), but it can also facilitate the appearance of non- B structures such as RNA-DNA hybrids (known as R loops when formed outside the transcription bubble), hairpins, triplex DNA or G-quadruplexes (Figure I1B), among others. All such structures that could lead to genome instability due to its potential to block the replisome (Aguilera and Garcia-Muse, 2013; Gaillard and Aguilera, 2016; Kim and Jinks-Robertson, 2012). In other cases, the RNA itself can facilitate aberrant structures such as RNA-DNA hybrids or R loops. For instance, if the nascent mRNA is not properly packaged into a messenger ribonucleoprotein particle (mRNP), as in the case of mRNA biogenesis mutant, it can invade the DNA duplex (Huertas and Aguilera, 2003)(Figure I1B). However, the mechanisms of TAR are not completely understood. Since homologous recombination (HR) is the main pathway responsible for repair of DNA breaks occurring preferentially during replication, mounting evidence suggest that TAR is the consequence of transcriptionreplication collisions which can cause RF collapse (Aguilera, 2002; Gaillard and Aguilera, 2013; Garcia-Muse and Aguilera, 2016). 1.4. Transcription-replication conflicts Since transcription and replication are crucial for cell survival and proliferation and they use the same DNA as a template, collisions between both machineries are unavoidable when both encounter each other at the same DNA region in INTRODUCTION 22 certain occasions in prokaryotes and eukaryotes (Gomez-Gonzalez and Aguilera, 2019). These two processes are significantly different: whereas the RNA polymerase embraces both DNA strands during transcription, the replicative machinery uses two DNA polymerases embracing each one each ssDNA. Furthermore, while several RNA polymerases can simultaneously transcribe the same gene, replisomes always move alone once per cell cycle. Additionally, in prokaryotes the fact that DNA replication and transcription exhibit different rates (Helmrich et al., 2013) make these conflicts to occur often (Merrikh et al., 2012). Therefore, how the replisome advance along the double-stranded DNA despite the presence of the transcription machinery becomes an abiding question. Moreover, as mentioned above, RNA polymerases are considered one of the main impediments to the progression of the RFs (Bermejo et al., 2012; Deshpande and Newlon, 1996; Liu and Alberts, 1995). And of utmost importance, these encounters are prone to occur at transcribed sites driven by different RNAPs (Gaillard et al., 2013; Gottipati et al., 2008; Prado and Aguilera, 2005) representing a common issue for both prokaryotes and eukaryotes (Helmrich et al., 2011; Prado and Aguilera, 2005). In any case, these collisions that compromise genome integrity not always require a physical contact between both machineries. Given that both processes modify topology, chromatin organization and structure of the DNA, different mechanism have arose by which transcription compromise genome integrity in a replication-mediated manner (Gomez-Gonzalez and Aguilera, 2019). Even though transcription-replication conflicts can be co-directional or head-on, regardless the directionality of the conflict, replisomes are impeded to progress through an RNA polymerase. However, experimental evidence suggests that head-on collisions are more deleterious (Figure I1C) (Prado and Aguilera, 2005). Tesis doctoral-Carmen Pérez Calero 23 Figure I1. Transcription-associated genome instability. Transcription could compromise genome integrity by itself. (A) Local positive supercoiling ahead the RNAPII and negative supercoiling behind it make the DNA more vulnerable to damage. (B) Non B-structures such as R loops can emerge when the nascent RNA hybridizes with the template DNA. Under circumstances with high level of R loops, as is the case of mRNP biogenesis mutants such as THO, the displaced ssDNA is more vulnerable to damage by genotoxins or nucleases. (C) Transcription-replication collisions as a result of replication progression caused by the RNA polymerase. If these encounters are head-on (if both machineries progress in the opposite direction), they are more deleterious than when they are co-directional (both machineries advance in the same direction). MCM, minichromosome maintenance complex; DNA pol, DNA polymerase. Figure adapted from (Gaillard et al., 2013). Cells have evolved different strategies to minimize the harmful impact of such collisions. In bacteria, highly transcribed and essential genes are orientated co-directionally with replication to avoid head-on collisions (Brewer, 1988). In the human genome, this co-orientation bias is also present (Petryk et al., 2016). However, the considerable complexity of eukaryotic genomes demand further solutions. For instance, in budding yeast a RFB downstream of rDNA loci prevents head-on collisions with the RNA polymerase I by blocking RF (Linskens and Huberman, 1988). In general, transcription and replication in eukaryotic cells have some spatial and temporal separation but some highly expressed genes are transcribed during the S-phase (Wei et al., 1998). Interestingly, those INTRODUCTION 24 mechanisms and factors that contribute to eliminate the RNAPII stalling also help to suppress the consequences of these encounters. This is the case of the RECQL5 DNA helicase, which decreases the elongation rate of the RNAPII preventing its stalling (Saponaro et al., 2014). 2. RNA METABOLISM AND GENOME STABILITY 2.1. Transcription and RNA processing In eukaryotic gene expression, the nascent pre-mRNA undergoes maturation by processing factors and protein-packaging lead to an export-competent mRNP particle apt to its translation in the cytoplasm. These mRNA processing steps comprise 5′-capping, splicing and 3′-end processing. During these events, numerous RBPs are loaded co-transcriptionally to the nascent RNA. The processing steps and mRNP export are interlinked and they influence one another’s specificity and efficiency but them are also tightly linked to transcription. This fact allows the regulation of the process at different steps during transcription and makes the composition of the mRNP a dynamic process (Bentley, 2014; Proudfoot et al., 2002). The first processing step that occurs when the RNA emerge from the RNAPII is the addition of a cap structure to the 5’ end of all the mRNAs by capping enzymes that binds to the phosphorylated Carboxy-Terminal Domain (CTD) of the RNPII largest subunit. This initial structure is then recognized by the Cap Binding Complex (CBC) (Figure I2). This first step initiates in the assembly of the mRNP and is believed to play a major role in the stabilization of the mRNA and required for further processes that occur on the mRNA molecule (splicing, transcription termination export, nuclear mRNA decay, translation, non-sense- mediated decay and decapping) (Aguilera, 2005a; Gonatopoulos-Pournatzis and Cowling, 2014; Proudfoot et al., 2002) Splicing is also an important step to which pre-mRNAs are subjected in order to obtain a mature mRNP. The pre-mRNA is spliced by different splicing factors that eliminate introns and join the remaining exons to obtain the mature Tesis doctoral-Carmen Pérez Calero 31 of mRNAs for degradation (Geissler et al., 2013; Lykke-Andersen and Jensen, 2015), and of microRNA processing, which are non-coding RNAs that target mRNAs for silencing (Gregory et al., 2004; Ha and Kim, 2014), and they also are involved in ribosome biogenesis (Saporita et al., 2011). DDX5 also acts as a transcriptional co-factor to activate transcription, as is the case of MyoD (Caretti et al., 2006), Snail1 (Carter et al., 2010) or p53 (Bates et al., 2005). (Figure I3). Finally, recent reports have also uncovered broader effects of DDX5 in glucose metabolism and carcinogenesis (Mazurek et al., 2014; Xing et al., 2017) through the regulation of gene expression. The importance of DDX5 in tumor development is also provided by the fact that its overexpression is well established in breast cancer (Wortham et al., 2009). Therefore, it has been proposed that the multiple roles in which DDX5/Dbp2 is found to intervene are dictated by the wide range of RNA targets acted on by DDX5/Dbp2 (Xing et al., 2019). Figure I3. DDX5/Dbp2 functions as a RNP chaperone. DDX5/Dbp2 (orange circle, “DEAD”) participates as a RNP chaperone in multiple processes such as alternative splicing, the regulation of lncRNA activities, mRNA export, miRNA processing, nonsense mediated decay (NMD) and ribosome biogenesis. Adapted from (Xing et al., 2019). INTRODUCTION 32 2.3.2. The helicase UAP56/DDX39B: a key player in mRNP biogenesis The DEAD-box helicase UAP56/Sub2 is a conserved RNA-dependent ATPase and ATP-dependent RNA helicase discovered through its interaction with the human splicing factor U2AF65 (Fleckner et al., 1997). Human UAP56 comprises the minimal helicase core with two canonical RecA-like helicase domains connected with a flexible liner (Figure I4). The N-terminal domain contains the conserved helicase motifs IV, motifs Q, I, Ia, GG, Ib, II, and III, whereas the C- terminal domain contains helicase motifs IV, QXXR, V, and VI. (Shi et al., 2004; Zhao et al., 2004). Structures of several DEAD/H-box proteins and other helicases have shown that Lys in motif I (GKT) interacts with the phosphate group of ATP and is important for ATP binding (Sengoku et al., 2006; Shi et al., 2004). The Glu in motif II (DEAD) has been postulated to be the key catalytic residue that activates a water molecule to hydrolyze ATP in DEXD/H-box proteins and other helicases (Cordin et al., 2006; Sengoku et al., 2006). Figure I4. Human UAP56 structure. Picture represents both N-terminal and C-terminal domain joined by the flexible linker (black line). Conserved helicase motifs are mapped on the structure in different colors. Adapted from (Zhao et al., 2004) Specifically, UAP56 plays a role in splicing by facilitating the unwinding of U4/U6 snRNA duplex and it is also required for the first ATP-dependent spliceosome assembly step (Fleckner et al., 1997; Shen et al., 2008). UAP56 is also essential for the export of the majority of mRNAs from the nucleus to cytoplasm in D. melanogaster, S. cerevisiae, C. elegans and human (Herold et al., 2003; Kapadia et al., 2006; Luo et al., 2001; MacMorris et al., 2003). It recruits the mRNA export factor ALY to the intron-containing and intron-less pre-mRNAs. Tesis doctoral-Carmen Pérez Calero 33 In the first case, UAP56 remains as part of the exon junction complex (EJC) and couples splicing and mRNA export. In the second scenario, UAP56 and ALY together with the THO complex participate in the export of bulk mRNAs through the interaction with the NXF1 complex linking the nascent mRNA to its export factors, which allow translocation to the NPC (Strasser et al., 2002). UAP56/Sub2 is not an integral part of THO (Chavez et al., 2000; Pena et al., 2012) (Figure I5). However, it displays an important role in the assembly of the TREX complex by mediating the ATP-dependent interaction of CIP29, Aly, PDIP3 and ZC11A with THO complex (Dufu et al., 2010; Folco et al., 2012; Sugiura et al., 2007). The TREX components Aly and Chtop stimulate the UAP56 helicase activity and are recruited to mRNAs by UAP56 (Chang et al., 2013). UAP56/Sub2 is the most abundant protein of the THO/TREX complex (Heath et al., 2016). Interestingly, an additional UAP56-related helicase called URH49/DDX39A is also present in humans (Pryor et al., 2004). This protein shares 90% amino acid sequence homology with UAP56. Both proteins, UAP56 and URH49, are able to complement Sub2 deletion and interact with the Yra1 adaptor in yeast. However, URH49 has been found to bind preferentially to CIP29 (yeast Tho1) in what it is believed to be a novel complex called AREX (alternative mRNA export complex) (Yamazaki et al., 2010). Figure I5. Role of UAP56 in transcription and nuclear export. During transcription, the THO complex associates with the RNAPII travelling along the entire transcribed region. UAP56 and Aly associate with the 3’-end of the gene forming the active TREX complex. Thanks to the UAP56 helicase activity, different proteins could be transferred to the mRNAs. Afterwards, the Tap-p15 heterodimer recognizes the mRNAs through Aly facilitating the formation of an export competent mRNP. Finally during or after release from genes locus, mRNPs can be subject to more rearrangements prior its translocation through the nucleopores and its following translation in the cytoplasm. INTRODUCTION 34 In yeast, Sub2 is involved in multiple stages of mRNA maturation and its inactivation leads to non-productive spliceosome assembly (Kistler and Guthrie, 2001; Libri et al., 2001), decreased polyadenylation efficiency and mRNA instability (Rougemaille et al., 2008; Saguez et al., 2008). Therefore, this RNA helicase seems to play a chaperone role in the process of assembly of the mRNP (Saguez et al., 2013). In addition, Sub2 also plays a role in the maintenance of genome instability since mutations of SUB2 lead to hyper-recombination phenotype, whereas Sub2 overexpression partially suppresses the growth-defect and hyper-recombination phenotypes associated to the hpr1∆ mutants of the THO complex (Jimeno et al., 2002). In human cells, UAP56 depletion leads to mRNA export defects and a strong genomic instability phenotype (Dominguez- Sanchez et al., 2011). Altogether, these findings suggest a double role of UAP56/DDX39B in mRNP biogenesis/export and the maintenance of genome, as it seems to be also the case of THO. 3. R LOOPS AS A SOURCE OF GENOME INSTABILITY Co-transcriptional R loops represent one of the elements that contributes to exacerbate the negative impact of transcription and transcription-replication conflicts on genome integrity. These three-stranded-structures are the result of the hybridization of the nascent RNA with the transcribed DNA strand, leading the complementary strand as ssDNA (“thread-back” model). (Figure I6). Figure I6. R loop structure. R loops are the resulting structures formed by a RNA-DNA hybrid and the displaced ssDNA. Tesis doctoral-Carmen Pérez Calero 35 3.1. R loops as a cellular regulators RNA-DNA hybrids occur naturally during transcription and replication. Despite their well-known localization at the active site of the RNA polymerase at the transcription bubble or during lagging-strand synthesis (Aguilera and Garcia- Muse, 2012), they have also found around DSB sites regulating the strand resection process (Ohle et al., 2016). Similarly, reports have widely described transient programmed R-loops with a role in different physiological processes such as E. coli plasmid replication (Kogoma, 1997), mitochondrial DNA replication (Xu and Clayton, 1996), or immunoglobulin (Ig) class-switch recombination in the B-cells (Yu et al., 2003). Strikingly, recent reports have also shown the implications of R loops in suppression of chromosome instability through R loop-driven ATR pathway that acts at centromeres and promotes faithful chromosome segregation (Kabeche et al., 2018). R loops are formed in multiple regions of the eukaryotic genomes, such as the ones transcribed by RNA polymerases I, II and III (El Hage et al., 2010; Tran et al., 2017). Furthermore, at RNAPII-transcribed genes, genome-wide approaches have provided evidence showing that the R loops are preferentially found at promoters of genes enriched in CpG island showing a strong GC skew (Chen et al., 2017; Dumelie and Jaffrey, 2017; Ginno et al., 2012; Nadel et al., 2015; Sanz et al., 2016). At promoters, it has been shown that R loops may assist transcription by suppressing DNA methylation (Ginno et al., 2012; Grunseich et al., 2018) and by influencing the binding of chromatin remodelers. On one hand, in mouse embryonic stem cells (mESCs) R loops inhibit repressive chromatinmodifying enzymes and recruit activating chromatin-remodeling complexes such as Tip60-p400 to favor differentiation genes (Chen et al., 2015). On the other hand, R-loops can impede transcription-factor binding as occurred in the case of the human vimentin gene (Boque-Sastre et al., 2015). This dual situation may reflect the capacity of R loops in regulating gene expression through multiple context-dependent mechanism (Crossley et al., 2019). INTRODUCTION 36 Importantly, R loops have also been found to be enriched at the 3’ end of some mammalian genes where they are supposed to mediate efficient transcription termination (Skourti-Stathaki et al., 2011). R loops can hamper transcription and it could be used as an initial pause signal to slow down RNAPII that would facilitate the co-transcriptional splicing process or the correct termination and polyadenylation of the nascent mRNA (Proudfoot, 2016; Wahba et al., 2016). Thus, these findings suggest that R loops might play regulatory roles such as the control of the gene expression through epigenetic mechanisms or by transcriptional interference (Chan et al., 2014; Ginno et al., 2012; Wahba et al., 2016). Importantly, despite their important regulatory roles, they can also hinder RF progression and may also occur when R loops interfere with productive transcription. 3.2. R loops as genomic threats 3.2.1. Structural R loop-mediated genome instability Given its structure and effects, R loops constitute a putative threat to genome stability. As said above, the formation of a RNA-DNA hybrid and the concomitant displacement of the ssDNA drive to a major exposure the DNA strand, which is more mutagenic than dsDNA. This could lead to SSBs, that if remaining unrepaired might block RF progression and could lead to DSB formation (Figure I7A). The ssDNA can be object of the action of different mutagenic agents or DNA-modifying enzymes, as it is the case of the human activation-induced cytidine deaminase (AID) (Figure I7A), which participates in immunoglobulin class switching recombination and somatic hypermutation in mammalian activated B cells (Chaudhuri and Alt, 2004). However, the action of AID is not restricted to such genes and it could act over other transcribed genes, particularly when R loops accumulate at high levels, as it occurs in THO yeast mutants (Gomez-Gonzalez and Aguilera, 2007). In addition, R loops can also promote hypermutation by non-canonical replication that arises when the R loop is used as a primer, as described in E. coli (Kogoma, 1997) or in the rDNA region of yeast deprived of Top1 and RNase H enzymes (Stuckey et al., 2015). Furthermore, the ssDNA is also more predisposed to generate non-B DNA structures which could Tesis doctoral-Carmen Pérez Calero 37 also be an impediment for the replisome (Aguilera, 2002). Due to this fact, an increase in R loops would lead to a hypermutation phenotype. R loops can also alter transcription. Excessive pausing, arrest or backtracking of RNP can lead to transcription stress (Saponaro et al., 2014).Hybridization between the nascent RNA and the DNA template strand within an R loop could destabilize the transcription complex, that could render the RNAP prone to blockage at randomly-occurring weak pausing/termination mode. Indeed, R loops have been shown to become obstacles for RNA polymerase progression in vitro (Tous and Aguilera, 2007) and in vivo (Bonnet et al., 2017; Lang et al., 2017) Although it is not clear whether problems with transcription derive from a RNAP stalled with the R loop or whether the R loop by itself act as a barrier to upstream polymerases. 3.2.2. R loops and replication stress Since the most prevalent source of R loop-dependent DNA damage seems to take place during S phase (Gan et al., 2011; Wellinger et al., 2006), R loops are supposed to exacerbate transcription-replication conflicts. There is a large body of work that has provided a mechanistic connection between recombination and replication-stress induced by R loops. The DSB repair factor and tumor suppressor BRCA2 and other members of the Fanconi Anemia pathway, which act at RF, have been shown to suppress R loops to prevent damage arising from these conflicts (Bhatia et al., 2014; Garcia-Rubio et al., 2015; Hatchi et al., 2015; Schwab et al., 2015). Indeed, reports indicate that head-on conflicts are more deleterious than codirectional encounters (Prado and Aguilera, 2005). Accordingly, recent studies show that R loop levels are also affected by the orientation of the conflict (Hamperl et al., 2017; Lang et al., 2017). This suggests that head-on formed R loops blocked replication and can result in DNA breaks and in the end, genome instability and chromosome fragility (Figure I7B) (Aguilera and Garcia-Muse, 2012; Zeman and Cimprich, 2014). Evidence from yeast to human cells corroborate this idea. RF progression defects are detected in several R loop-accumulating cells by different techniques as 2D-gel INTRODUCTION 38 electrophoresis, DNA combing or the recruitment of the Rrm3 DNA helicase (Gomez-Gonzalez et al., 2011; Herrera-Moyano et al., 2014; Salas-Armenteros et al., 2017; Tuduri et al., 2009; Wellinger et al., 2006). From the mechanistic point of view, these differences between codirectional and head-on R loop might be based on the fact that RNAP can remain attached to the template, impeding the access of the replicative helicases to the R loop at head-on collisions. Conversely, in co-directional conflicts the replisome itself may unwind hybrids. However, the mechanism by which R loops block RF is still unclear. On one hand, RNA-DNA hybrids can retain the RNAP or recruit proteins that constitute a barrier. On the other hand, R loops can promote positive superhelicity accumulation between head-on transcription-replication conflicts or even it could be possible that the impediment is not the RNA-DNA hybrid by itself but the compacted chromatin structure induced by it (Castellano-Pozo et al., 2013; Garcia-Pichardo et al., 2017; Rondon and Aguilera, 2019) . 3.2.3. Chromatin modifications Recent finding suggests that epigenetic mechanisms can act to regulate R loop homeostasis. Chromatin acetylation has been proposed to influence the R loop formation. A hyper-acetylated state of the chromatin could lead to a more opened and relaxed structure that would theoretically facilitate the probability of R loop generation. In human cells, it has been shown that depletion of the histone deacetylase mSin3a complex or the acetyltransferase MOF leads to an accumulation of R loops and genome instability (Salas-Armenteros et al., 2017; Singh et al., 2018). In addition, the treatment with histone deacetylase inhibitors such as trichostatin A (TSA) boosted a major acetylated state of the chromatin and R loop accumulation (Salas-Armenteros et al., 2017). However, the accumulation of aberrant R loops is linked to heterochromatin and chromatin condensation marks in yeast, C. elegans and human cells. Specifically, depletion of the THO complex or the helicase SETX/Sen1 triggers an accumulation of histone H3 serine 10 phosphorylation Tesis doctoral-Carmen Pérez Calero 39 (H3S10-P) in yeast and human cells, a mark of chromatin condensation (Castellano-Pozo et al., 2013). Given that replisomes have difficulties to advance through a condensed chromatin (Castellano-Pozo et al., 2012b; Castellano-Pozo et al., 2013; El Achkar et al., 2005), it is logical to speculate about the role of chromatin condensation as a cause of RF stalling and genome instability mediated by R loops (Figure I7C) (Castellano-Pozo et al., 2013). Another piece of evidence linking chromatin with R loops is the FACT complex, necessary for the proper DNA replication and whose deprivation leads to an increase in R loops and genomic instability in yeast and human cells (Herrera-Moyano et al., 2014). Interestingly, recent studies in yeast have identified specific histone mutants that accumulate R loops without compromising genome integrity. This fact suggests that R loops may not generate DNA damage by themselves. Instead, it would require a subsequent chromatin-remodeling step connected to chromatin compaction that includes H3S10-P to cause genome instability (Garcia-Pichardo et al., 2017). Subsequent studies have also shown the H3S10-P accumulation at centromeres together with R loops and ATR, supporting the link between R loops and H3S10-P in these regions (Kabeche et al., 2018). INTRODUCTION 40 Figure I7. R loop-mediated genome instability. R loops by themselves constitute a major source of genome instability. (A) R loop formation implies an increase in the exposition of the ssDNA, which is more sensible to suffer assaults from genotoxins or enzymatic activities such as AID. This could lead to DNA lesions such as base damage (red star) or ssDNA gaps, which can hamper RF progression leading to genome instability. (B) R loops by themselves could constitute an impediment for replication facilitating transcription-replication collisions. (C) Chromatin compaction after R loop formation could also hamper replication. Definitely, R loops could constitute a major barrier for RF progression and lead to fork stalling, subsequently fork collapse and breakage, leading to genome instability. Adapted from (Gaillard and Aguilera, 2016). 3.3. Mechanisms and elements involved in R loop prevention As we previously indicated, R loops can occur naturally in cells. They are regularly generated over a large part of the genome (Chedin, 2016). Consequently, R loop homeostasis need to be regulated. For this purpose, cells have evolved different protection mechanisms and factors to overcome the R- loop formation and mitigate their harmful effect if deregulated (Santos-Pereira and Aguilera, 2015; Skourti-Stathaki and Proudfoot, 2014). In general, these factors are classified in two categories: those that prevent R loops formation (topoisomerases and mRNP biogenesis) and those which remove R loops once formed (ribonucleases, helicases and others). Tesis doctoral-Carmen Pérez Calero 47 Figure I10. Principal traits during epithelial-mesenchymal transition. During this process cells undertake different events to accomplish the entire EMT course. Image also shows the main epithelial and mesenchymal markers. Adapted from (Aroeira et al., 2007). 4.2. SNAIL1 Snail1 is a conserved zinc-finger transcription factor. Its C-terminal domain contains four zinc fingers of the C2H2 type that bind to the E-box motif 5′- CANNTG-3′ or 5’-CAGGTG-3’ in target gene promoters. The divergent N- terminal region is involved in the repressive activity and is essential for the interaction with several co-repressor complexes such as mSin3A, Ajuba LIM proteins or the Polycomb repressive complex 2 (Wang et al., 2013). Lastly, the central part of the protein comprises a nuclear export signal (NES), a destruction box domain and a serine-proline rich region, involved in the stability and subcellular location of the protein (Figure I11). Importantly, Snail1 has been purposed as a prototype inductor of EMT. It is fast induced by citokynes or stress conditions activating EMT and it is able to bind and repress the expression of E-cadherin and other epithelial genes and activate the expression of other mesenchymal genes. Given its relevance in this process, Snail1 expression and function are regulated at multiple levels from gene transcription to protein modifications, affecting its interaction with specific cofactors including TGFb, NOTCH, WT or NF-kB (Thiery and Sleeman, 2006). INTRODUCTION 48 Figure I11. Structure of Snail1. Snail1 contains an N-terminal SNAG domain, which interacts with different co-repressors and epigenetic remodeling complexes and the C-terminal zinc finger domain for DNA binding. The serine-rich domain, the destruction box and the nuclear export sequence (NES) are involved in the stability and subcellular location of the protein. Adapted from (Peinado et al., 2007) Research in the last decade has revealed a connection between Snail1 and the co-repressor interactor LOXL2 in regulating major satellite transcription and heterochromatin reorganization during EMT. Upon the binding of Snail1 and LOXL2 to pericentromeric regions, HP1a is released from heterochromatin with a down-regulation of major satellite transcription, enabling chromatin reorganization and acquisition of mesenchymal traits. Notably, the histonemodifying enzyme LOXL2 replaces the active mark from histone H3 (H3K4me3) by a deaminated lysine generating the variant H3K4ox. Given that a particular chromatin state can influence the DDR response (Burgess and Misteli, 2015; Goodarzi et al., 2008), recent findings have suggested a connection between LOXL2 and the activation of the DDR pathway in the absence of any detectable DNA lesions in specific breast cancer cell lines. It has been proposed that the lack of LOXL2 and the reduction of H2K4ox levels modify the regulation of chromatin condensation (leading to decondensation) and trigger DDR (Cebria- Costa et al., 2019). 49 50 OBJECTIVES 51 OBJECTIVES 52 The main goal of this thesis is to determine the implication of UAP56 and Snail1 in genome integrity and their mechanisms of action. For this purpose, we addressed the following specific objectives: 1. To define the role of UAP56 in the maintenance of genome integrity, with the aim of obtaining new insights into the molecular mechanism of this factor to prevent genome instability. 2. To assay the contribution of UAP56 to genome stability all over the genome and evaluate its significance in comparison with the helicase DDX5. 3. To explore the possible implication of Snail1 as a novel factor involved in R loop-mediated genome instability. 53 54 MATERIALS AND METHODS 55 MATERIALS AND METHODS 56 1. GROWTH MEDIA AND CONDITIONS 1.1. Bacteria cell culture Bacteria were cultured at 37ºC in LB rich medium and supplemented with 100 µg/ml ampicillin or 25 µg/ml kanamycin when it was necessary for plasmid transfection. LB: 0.5% yeast extract, 1% bacto-tryptone, 1% NaCl (and 2% agar for solid medium). 1.2. Human cell culture HeLa (ECACC, 93021013) and HEK-293T cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM; GIBCO, USA) supplemented with 10% heatinactivated fetal bovine serum (SIGMA Aldrich, Germany), 2 mM L-glutamine and 1% antibiotic-antimycotic (Biowest, France). K562 (ATCC, CCL-243) cells were cultured in Iscove's Modified Dulbecco's medium (IMDM; GIBCO) supplemented with 10% heat-inactivated fetal bovine serum (Sigma Aldrich) and 1% antibioticantimycotic (Biowest). Cells were maintained at 37ºC and 5% CO2. 2. ANTIBIOTICS, DRUGS, INHIBITORS, ENZYMES AND ANTIBODIES 2.1 Antibiotics - Ampicillin (SIGMA): b-lactam antibiotic that inhibits cell wall synthesis in Echerichia coli. Used for plasmid selection in E. coli (Use: 100 µg/ml). - Kanamycin (SIGMA): aminoglycoside antibiotic that inhibits cell growth by inducing mistranslation and inhibiting translocation during protein synthesis in E.coli. Used for plasmid selection in E.coli (Use: 25 µg/ml). - Penicillin, streptomycin and amphotericin B (Biowest): penicillin inhibits bacterial cell wall synthesis (Use: 60 µg/ml). Streptomycin inhibits prokaryote protein synthesis by preventing the transition from initiation complex to chainelongating ribosome and causes miscoding (Use: 100 µg/ml). Amphotericin B is used to prevent growth of bacteria, yeast and fungi in human cell culture since it interferes with fungal membrane permeability (Use: 0.25 µg/ml). Tesis doctoral-Carmen Pérez Calero 63 Each mixture was incubated at RT for 5 min, mixed and incubated for 5 min at RT. Transfection solution was added carefully drop by drop to the cell culture. • For plasmid transfection using Lipofectamine 3000 (Invitrogen), cells were transfected at 80% confluence. 24 hours before transfection cell were cultured in antibiotic-free medium (2 ml for 6-well plates). Transfection in a well of a 6-well plate was performed using the following protocol: - Mixture A (final volume 100 µl): 2 µg DNA and 4 µl of Enhancer Reagent in Opti-MEM (Gibco) - Mixture B (final volume 100 µl): 4 µl Lipofectamine 2000 in Opti-MEM. Each mixture was incubated at RT for 5 min, mixed and incubated for 5 min at RT. Transfection solution was added carefully drop by drop to the cell culture. 6. IN VITRO ANALYSIS These experiments were performed in collaboration with Patrick Sung lab in Yale University. 6.1. Purification of UAP56 wild-type and mutant proteins The cDNAs that encode the wild type, K95A and E197A variants of UAP56 were introduced into the pGEX-KG vector to add an N-terminal GST tag to these proteins. The resulting UAP56 expression plasmids were introduced into E. coli BL21:DE3 Rosetta cells, which were grown at 37°C to OD600 = 0.8, and protein expression was induced by the addition of 0.2 mM IPTG and incubation at 16°C for 16 h. Cells were harvested by centrifugation and all the subsequent steps were carried out at 0-4°C. For lysate preparation, a cell pellet (20 g, from 4 L of culture) was suspended in 100 ml K buffer with 300 mM KCl and 5 μg/ml each of the protease inhibitors aprotinin, chymostatin, leupeptin and pepstatin, and then subject to sonication (three 1 min pulses). The crude cell lysate was clarified by ultracentrifugation (100,000Xg for 90 min) and then mixed gently with 2 ml of Glutathione Sepharose 4B resin (GE) for 1.5 h. The resin was washed sequentially with 50 ml K buffer containing 1 M KCl, 50 ml K buffer containing 300 MATERIALS AND METHODS 64 mM KCl, 20 ml K buffer containing 300 mM KCl and 1 mM ATP, 20 ml K buffer containing 300 mM KCl and 5 mM MgCl2, and 2 x 50 ml K buffer containing 300 mM KCl. UAP56 was eluted with 12 ml K buffer containing 300 mM KCl and 10 mM reduced glutathione and concentrated to 1 ml (Amicon 10K concentrator, Millipore). The GST tag was cleaved by incubating the concentrated protein pool with 100 µg of thrombin for 12 h. The reaction mixture was diluted with 2 ml of K buffer and applied onto to a 1-ml Mono Q column (GE), which was washed with 5 ml K buffer plus 150 mM KCl and then developed with a 25-ml linear gradient from 150 to 650 mM KCl. The peak of UAP56, eluting at ~350 mM KCl, was collected, concentrated to 0.5 ml, and fractionated in a Superdex 200 gel filtration column (24 ml, GE) in K buffer containing 300 mM KCl. Fractions containing highly purified UAP56 (1 mg protein) were pooled, concentrated to 1 mg/ml, and stored in small aliquots at -80°C. The UAP56 K95A and E197A mutants were purified using the same procedure with a similar yield. K buffer: 20 mM KH2PO4, pH 7.4, 10% glycerol, 0.5 mM EDTA, 0.01% Igepal, 1 mM DTT. 6.2. Nucleic acid unwinding assays RNA-RNA duplexes, without or with a 5’ or 3’ overhang, were prepared as described (Shen et al., 2007). RNA-DNA hybrids without and with a 5’ or 3’ overhang and DNA-DNA duplex with a 5’ overhang were prepared by annealing oligonucleotides (with one of the oligonucleotides being labeled with 32P) listed in Table M6. In the unwinding reaction, UAP56 (wild type or mutant at the indicated concentration) was incubated with 5 nM substrate in reaction buffer (1) and 100 nM of “trap” RNA or DNA (unlabeled version of the oligonucleotide that was labeled in the substrate) at 37°C (for the RNA-RNA substrates) or 30°C (for the RNA-DNA substrates) for 30 min or the indicated time. Reaction mixtures were deproteinized by treatment with SDS (0.1%) and proteinase K (0.5 mg/ml) for 10 min at 37°C and then resolved in 15% polyacrylamide gels in TAE buffer at 4°C. Gels were dried and subject to phosphorimaging analysis. Tesis doctoral-Carmen Pérez Calero 65 The 5’ RNA-DNA flap structure that resembles a branch migratable R-loop structure was constructed as described (Schwab et al., 2015). UAP56 (wild type or mutant at the indicated concentration) was incubated with the substrate in reaction buffer (2) at 30°C for 20 min. Reaction mixtures were deproteinized before being resolved in 7% polyacrylamide gels in TAE buffer at 4°C and analyzed, as above. Reaction buffer (1): 35 mM Tris-Cl, pH 7.5, 1 mM DTT, 3 mM ATP, 2 mM MgCl2, 60 mM KCl. Reaction buffer (2): 25 mM Hepes, pH 6.5, 1 mM DTT, 2 mM ATP, 2 mM MgCl2, 60 mM KCl. TAE buffer: 40 mM Tris, 20 mM Acetate acid and 1 mM EDTA. Table M6. Oligonucleotides for unwinding assays used in this study Oligo Name RNA or DNA Length Sequence R13 RNA 13 5’GCUUUACGGUGCU3’ R13C RNA 13 5’AGCACCGUAAAGC3’ R23-5’ RNA 23 5’AAAACAAAAUAGCACCGUAAAGC3’ R23-3’ RNA 23 5’GCUUUACGGUGCUUAAAACAAAA3’ D13 DNA 13 5’GCTTTACGGTGCT3’ D13C DNA 13 5’AGCACCGTAAAGC3’ D23-5’ DNA 23 5’ AAAACAAAATAGCACCGTAAAGC3’ XX1 DNA 60 5’ACGCTGCCGAATTCTACCAGTGCCTTGCTAGGACA TCTTTGCCCACCTGCAGGTTCACCC3’ XX2 DNA 60 5’GGGTGAACCTGCAGGTGGGCAAAGATGTCCCAGC AAGGCACTGGTAGAATTCGGCAGCGT3’ R5’F RNA 30 5’GGGUGAACCUGCAGGUGGGCAAAGAUGUCC3’ MATERIALS AND METHODS 66 7. PROTEIN-PROTEIN INTERACTION METHODS 7.1. Co-immunoprecipitation (Co-IP) Whole-cell extracts from a 10 cm petri dish of HEK293T cells at 80% confluence were obtained by lysing cells in 200 µl lysis buffer during 30 min on ice with occasionally gently pipetting up and down. The lysate was centrifuged 10 min at 16,000 g. For each immunoprecipitation, 50 µl Dynabeads Protein A (Invitrogen) were washed twice in 1 ml PBS-0.5%BSA and 5 µg antibody was bound to the beads in 200 µl PBS-0.5% BSA, 4h at 4 ºC. 20 and 180 µl od the lysate were diluted with 180 µl of dilution buffer (to obtain a 0.25% (vol/vol) final concentration of NP-40) and incubated with beads-antibody complexes for 2h at 4 ºC. The same amount of lysate was incubated with beads (without antibody) and was used as a control. Then, beads were washed twice in PBS, four times with wash buffer and bound proteins were eluted by boiling the beads for 10 min 25 µl of 2X Laemmli loading buffer. Finally the result was visualized by Western blot. Lysis buffer: 10 mM Tris-HCl pH 7.5, 150 mM NaCl, 0.5 mM EDTA pH 8, 0.5% (vol/vol) NP-40, 1 mM PMSF, and protease inhibitor cocktail. Dilution buffer: 10 mM Tris-HCl pH 7.5, 150 mM NaCl, 0.5 mM EDTA pH 8, 1 mM PMSF, and protease inhibitor cocktail. Wash buffer: 10 mM Tris-HCl pH 7.5, 150 mM NaCl, 0.5 mM EDTA pH 8, 0.2% (vol/vol) NP-40, 1 mM PMSF, and protease inhibitor cocktail. 7.2. Proximity ligation Assay (PLA) For detection of protein-protein interactions in situ, PLA was performed following manufacturer’s instruction with reagents from Duolink In Situ Starter Kit (Olink Biosciences). Cells were cultured on glass coverslips and fixed in suitable conditions compatible with the two primary antibodies to be used (see Materials and methods 7). Coverslips were blocked with PBS-3% BSA for 1h at RT, incubated with primary antibodies diluted in PBS-3%BSA for 2h at RT (for antibodies dilution see Table M1), washed three times in 5 ml PBS for 5 min and incubated with PLA probes for 1 h at 37 °C. After two washed in 5 ml wash buffer A for 5 min, ligation reaction was performed for 30 min at 37 °C. Then, cells were Tesis doctoral-Carmen Pérez Calero 67 washed twice in 5 ml wash buffer A, incubated with the amplification reaction for 100 min at 37 °C in darkness, washed twice in 5 ml buffer B for 10 min and once in 5 ml 0.01X wash buffer B for 1 min. Finally, coverslips were dried in darkness, mounted with mounting medium with DAPI and images were acquired in a fluorescence microscope. For negative controls, everything was performed identically, except that only one of the primary antibodies was added. For each coverslip: - PLA probes (40 μl): 8 μl PLA probe anti-Mouse MINUS, 8 μl PLA probe anti- Rabbit PLUS, 24 μl PBS-3% BSA. - Ligation reaction (40 μl): 8 μl of 5X Buffer ligase, 1 μl Ligase, 31 μl MQ H2O. - Amplification reaction (40 μl): 8 μl of 5X Buffer amplification, 0.5 μl Polymerase, 31.5 μl MQ H2O. PLA probes, buffers, enzymes and mounting media are provided in the Duolink In Situ Red Starter Kit. 8. CELL CYCLE ANALYSIS IN HUMAN CELLS 8.1. FACS analysis After siRNA transfection for 72h, HeLa cells were harvested with trypsin, washed twice with cold PBS and centrifuged (3000 rpm 5 min). Pellet was resuspended in 300 μl cold PBS and cells were fixed by adding 700 ul cold 96% ethanol drop by drop and stored at -20 ºC. Before cell cycle analysis and sorting, cells were incubated with Propidium Iodide (50 μg/ml) and treated for RNA degradation with RNase A (250 μg/ml). After that, cells were examined by flow cytometry (FACSCalibur; BD). Three population of cells were analyzed based on their DNA content (1n=haploid or 2n=diploid DNA content of the genome). 9. IMMUNOFLUORESCENCE Cell were cultured on glass coverslips and, if needed, transfected as indicated in Matherial and Methods 5.2. Cells were fixed in formaldehyde or methanol and selected target molecules were visualized in a fluorescence microscope after the MATERIALS AND METHODS 68 incubation with the corresponding primary antibodies and with the subsequent fluorophore-conjugated secondary antibodies. Type of cell fixation used: - Formaldehyde fixation: cells were fixed in 2% formaldehyde in PBS for 20 min or 4% formaldehyde in PBS for 10 min and permeabilized with 70% ethanol for 5 min at -20 ºC, 5 min at 4 ºC and washed twice in PBS. This fixation was used for immunofluorescence with γH2AX, pFLAG and H3Ser10P antibodies. - Triton-Formaldehyde fixation: Cells were pre-permeabilized with cold 0.1% triton in PBS on ice for 1 min and then fixed in formaldehyde as previously described. This fixation was used for immunofluorescence with UAP56, pFLAG, SIN3 - Methanol fixation: Cells were fixed in cold absolute methanol for 7 min at -20 °C and washed twice in PBS. This fixation was used for immunofluorescence with S9.6 and nucleolin antibodies. Immunofluorescence: Blocking, incubation with primary and secondary antibodies, DAPI staining and mounting conditions. Cells were blocking using 3% bovine serum albumin (BSA) in PBS. Then, primary antibodies were diluted in 3% BSA in PBS for 1h at RT. For antibody dilutions see Table M1. Afterwards, cells were washed three times in PBS for 5 min. Secondary antibodies conjugated with Alexa Fluor diluted (1:500) in 3% BSA in PBS were also incubated for 1h at RT. Finally, coverslips were washed twice in PBS before and after the staining of the DNA with 1 μg/ml DAPI (2-(4- Amidinophenyl)-6-indolecarbamidine dihydrochloride) for 5 min. At the end, coverslips were washed in water and a drop of ProLong Gold Antifade reagent (Thermo) was used for mounting. For S9.6 and nucleolin immunofluorescence see Materials and Methods 8.3. Tesis doctoral-Carmen Pérez Calero 69 Detection of cells in S phase by immunofluorescence: When necessary, detection of cells in S phase by immunofluorescence was performed by EdU detection using a Click-iT EdU Imaging Kit (Invitrogen) following manufacturer’s instructions. To perform this assay, cells were culture on glass coverslips and then, the modified thymidine analogue EdU (5-ethynyl-2'-deoxyuridine) is added for 20 min to the cell culture in order to be incorporated into DNA during active synthesis before its fixation. Afterwards, cells were fixed, cells were washed twice with 1 ml of 3% BSA in PBS, permeabilized with 1 ml of 0.5% Triton X-100 in PBS for 20 min at RT and washed again twice in 1 ml of 3% BSA in PBS. Finally cells were incubated with 50 μl/coverslip of Click-iT reaction cocktail (43 μl of 1X Click-iT reaction buffer, 2 μl of 100 mM CuSO4, 0.12 μl of Alexa Fluor azide, 5 μl of 1X reaction buffer additive) for 30 min at RT in darkness and washed once with 1 ml in 3% BSA. 10. GENOME INSTABILITY ANALYSIS 10.1. Analysis of γH2AX foci Cells were culture on glass coverslips and transfected with siRNA as indicated in Materials and Methods 5.2., fixed in 2% formaldehyde and immunofluorescence was performed with mouse monoclonal anti-γH2AX (JBW301, 05-636 Millipore) or mouse monoclonal antiγH2AX (2F3, 613402 Biolegend) (see Materials and Methods 7 and Table M1). More than 100 cells from each experiment were analyzed (see Materials and Methods 10). 10.2. Single cell gel electrophoresis (Comet assay) Comet assay was performed using a commercial kit (Trevigen, Gaithersburg, MD,USA) following the manufacturer’s protocol, 48 h after siRNA transfection. When it is indicated, 50 μM cordycepin was added to the culture 4 hours before the experiment. MATERIALS AND METHODS 70 10.2.1. Alkaline comet assay Cells were collected using accutase, washed and resuspended in ice cold 1X PBS, combined with low melting agarose, immobilized on CometSlides (30 min at 4 °C, until agarose is solidified) and lysed for 30 min at 4 °C. Then, DNA was unwound and denatured in freshly prepared alkaline unwinding solution pH>13 for 30 min at RT and electrophoresis was performed in prechilled alkaline electrophoresis solution pH>13 at 21 V for 30 min. Next, slides were immersed twice in dH2O for 5 min each, then in 70% ethanol for 5 min and dried at RT. DNA was stained with SYBR Green at 4 °C for 5 min. Alkaline unwinding solution/Alkaline electrophoresis solution pH>13: 200 mM NaOH, 1 mM EDTA. 10.2.2. Neutral comet assay Cells were collected and immobilized on CometSlides as previously described. Cells were lysed for 1h at 4 ºC and immersed in prechilled 1X neutral electrophoresis buffer at 21V for 45 min and then immersed in DNA precipitation solution for 30 min at RT. Finally, slides were immersed in 70% ethanol for 30 min at RT and dried. DNA was stained with SYBER Green at 4 ºC for 30 min. 10X Neutral electrophoresis buffer (500 ml): 60.57 g Tris Base and 204.12 g of sodium acetate dissolved in H2O. Adjust to pH=9.0 with glacial acetic acid. 1X stock was obtained by diluting the 10X stock in dH2O. DNA precipitation solution: 1 M NH4Ac in 70% ethanol. For γH2AX foci and comet assays analyses at least three independent experiments were performed. More than 100 cells were scored in each experiment (see Materials and Methods 10). Tesis doctoral-Carmen Pérez Calero 71 10.3. RNA-DNA hybrids detection 10.3.1. RNA-DNA immunoprecipitation (DRIP-qPCR) DRIP assays were performed by immunoprecipitating DNA–RNA hybrids using the S9.6 antibody from gently extracted and enzymatically digested DNA, treated or not with RNase H (New England Biolabs, USA) in vitro as described (Herrera- Moyano et al, 2014; Garcia-Rubio et al, 2015). After 72 h of siRNA transfection, pellet from a 6-cm plate of HeLa cells was collected using accutase, washed in PBS and resuspended in 800 μl of TE. Afterwards, 20.75 μl SDS 20% and 2.5 μl proteinase K (20 mg/ml) were added and pellet was incubated at 37 °C overnight. DNA was extracted gently with phenol-chloroform in phase lock tubes (VWR, USA). Precipitated DNA was spooled on a glass rod, washed 2 times with 70% EtOH, resuspended gently in TE and digested overnight with 50 U of HindIII, EcoRI, BsrGI, XbaI and SspI and 2mM spermidine. For the negative control, half of the DNA was treated with 3 µl RNase H overnight. 5 µg of the digested DNA were bound to 10 µl of S9.6 antibody (1mg/ml) in 500 µl 1X binding buffer in TE, overnight at 4ºC. DNA-antibody complexes were immunoprecipitated using Dynabeads Protein A (Invitrogen) during 2h at 4ºC and washed 3 times with 1X binding buffer. DNA was eluted in 180 μl elution buffer, treated 45 min with 7 µl proteinase K at 55ºC and cleaned with the NucleoSpin Gel and PCR Clean-up (Macherey-Nagel, USA). Quantitative PCR of immunoprecipitated DNA fragments and input DNA was performed on a 7500 Fast & 7500 Real-Time PCR System SYBR qPCR Mix (Applied Biosystems, Thermo Fisher) with the primers listed in Table M7. 10X Binding buffer: 100 mM NaPO4 pH 7.0, 1.4 M NaCl, 0.5% triton X-100. Elution buffer: 50 mM Tris pH 8.0, 10 mM EDTA, 0.5% SDS. DRIP quantification and normalization: Input and immunoprecipitated (IP) were eluted in 150 μl of double-distilled H2O. 4 μl of IP were used for qPCR. The relative abundance of RNA-DNA hybrid immunoprecipitated in each region was normalized to Input signal obtained. MATERIALS AND METHODS 72 10.3.2. S9.6 immunofluorescence Cells were cultured on glass coverslips and fixed in methanol (see Materials and Methods 7). For S9.6 and nucleolin immunofluorescence, coverslips were blocked in 2% BSA in PBS overnight at 4°C and incubated with S9.6 mouse (1:500) and anti-nucleolin rabbit (1:1000, Abcam) or pFLAG (1:1000) primary antibodies diluted in 2% BSA. Then, coverslips were washed three times in PBS, and then incubated with secondary antibody Alexa Fluor 594 and 488 diluted in 2% BSA in PBS (1:1000) for 1 hour at RT. Finally, they were washed, DAPI staining and mounting as described above. More than 100 cells from each experiment were scored (see Materials and Methods 10). 11. REPLICATION ANALYSIS 11.1. Analysis of FANCD2 foci Cells were cultured on glass coverslips, pre-permeabilized with 0.25% Triton X- 100 in PBS for 1 minute on ice and then fixed with 2% formaldehyde in PBS. After blocking with 3% BSA in PBS, cells were incubated with primary antibodies FANCD2 (1:100 dilution) and RNase H1 (1:400) diluted in 3% BSA in PBS. Afterwards, coverslips were washed three times in PBS and incubated with secondary antibodies conjugated with Alexa 488 and Alexa 546 (1:1000). Finally, coverslips were washed, DAPI staining and mounting as described above. More than 100 cells from each experiment were scored (see Materials and Methods 10). In pre-permeabilized cells the overexpressed RNase H1 stained only nucleus and nucleoli because the rest of the protein had been washed out. 11.2. Single DNA fiber analysis in human cells (DNA combing) DNA combing was performed as previously described (Michalet et al., 1997). Cells were transfected with siRNA and with the empty pcDNA3 plasmid or the pcDNA3 RNase H1 plasmid for 48 h, as indicated in Matherial and Methods 5.2. Iodo-deoxyuridine (IdU) and Cloro-deoxyuridine (CldU) labels were added for 20 min each. Subsequently, cells were harvested using accutase, resuspended in cold PBS and embedded in 1% low melting agarose plugs in PBS. Plugs were Tesis doctoral-Carmen Pérez Calero 79 antibodies conjugated with the horseradish peroxidase for 1h hour and washed again. Finally, SuperSignalR West Pico (Pierce) was used for chemiluminescence detection. Blocking Buffer solution: 1% Blocking reagent (Roche), 0.05% Tween 20, 0.05 M Tris-HCl pH 7.5. A stock of 10% Blocking reagent was previously prepared dissolving 10 g of blocking reagent in 100 ml maleic buffer (0.1 M Maleic acid, 0.15 M NaCl, pH 7.5 M adjusted with NaOH and autoclaved) with heat (50-60 °C) and shake. Wash solution: 1X TBS – 0.1% Tween 20. 14.5. Fluorescent WB A PVDF membrane with low fluorescence background (Inmobilon-FL, Millipore) was used. This membrane was first activated in methanol for 15 s and equilibrated in transfer buffer before continuing. Commercial Odyssey Blocking Buffer (LI-COR Biosciences) was used to block the membrane for 1 hat RT or o/n at 4 °C. Primary antibody was prepared (for appropriate dilution see Table M1) in blocking buffer -0.1% Tween 20 and incubated for 2 h. Three washes of 10 min were performed with 1X TBS - 0.1% Tween 20 followed by incubation of 1 h with IRDye secondary antibodies. Finally, membranes where washed again 3 times, rinsed in 1X TBS and immediately scanned or left drying. Image acquisition was performed in an Odyssey CLx Imager (LI-COR Biosciences). 15. GENOME WIDE EXPERIMENTS 15.1. RNA-seq Total RNA was isolated from K562 cells transfected with siC or siUAP56 siRNA for 72 h with an RNeasy Mini kit (Qiagen). Then, total RNA-seq was performed after ribosomal RNA depletion applying the TruSeq Stranded Total RNA library and sequenced on the platform NextSEq500 (Illumina). MATERIALS AND METHODS 80 15.2. Chromatin immunoprecipitation (ChIP) assay (ChIP-seq) K562 cells were crosslinked for 10 min with formaldehyde at a final concentration of 1%, resuspended in 2.5 ml of cell lysis buffer, then centrifuged and 1 ml of nuclei lysis buffer was added. Chromatin was sonicated on the maximum intensity setting, with fifteen pulses of 30s on and 30s off in Bioruptor (Diagenode), to obtain approx. 400 bp fragments. Samples were diluted up to 1300 μl with IP buffer. 100 μl and 1200 μl of diluted chromatin were used for input and immunoprecipitation, respectively. 30 μl of Dynabeads Protein A (Invitrogen) per sample was incubated overnight at 4 ºC with 4 μg of UAP56 antibody. A negative control the corresponding IgG was used to calculate the background signal. Then, Dynabeads-antibody complexes were added to the samples used for immunoprecipitation for 2h at 4 ºC and washed once with wash buffer 1, once with wash buffer 2, once with wash buffer 3 and twice with 1X TE. Input and immunoprecipitate were then un-crosslinked in TE -1% SDS and treated with proteinase K. DNA was isolated using NucleoSpin Gel and PCR Clean-up kit (Macherey-Nagel) and used to build the libraries using the ThruPLEX DNA-Seq 6S kit (Rubicon Genomics) according to manufacturer’s instructions and then sequenced on the Illumina platform NextSEq500. Cell lysis buffer: 5 mM PIPES pH 8, 85 mM KCl, 0.5% NP-40, 1 mM PMSF and protease inhibitor cocktail). Nuclei lysis buffer: 1% SDS, 10 mM EDTA, 50 mM Tris-HCl pH 8, 1 mM PMSF and protease inhibitor cocktail. IP buffer: 0.01% SDS, 1.1% Triton X-100, 1.2 mM EDTA, 16.7 mM Tris-HCl pH 8, 167 mM NaCl. Wash buffer 1: 0.1% SDS, 1% Triton X-100, 2 mM EDTA, 20 mM Tris-HCl pH 8, 150 mM NaCl. Wash buffer 2: 0.1% SDS, 1% Triton X-100, 2 mM EDTA, 20 mM Tris-HCl pH 8, 500 mM NaCl. Wash buffer 3: 0.25 M LiCl, 1% NP-40, 1% sodium deoxycholate, 1 mM EDTA, 10 mM Tris-HCl pH 8. Tesis doctoral-Carmen Pérez Calero 81 15.3. DNA-RNA immunoprecipitation followed by high-throughput DNA sequencing (DRIP-seq) DRIP-seq was performed as previously described (Sanz & Chedin, 2019) with minor modifications of the DRIP-qPCR (see Materials and Methods 8.3). Basically, genomic DNA was digested overnight with 30 U of HindIII, EcoRI, BsrGI, XbaI and SspI and 2mM spermidine. For the negative control, 10 µg of the digested DNA were treated with 4 µl RNase H (New England Biolabs) for 6 h at 37 ºC. Five immunoprecipitation were performed, in each one 8 µg of the digested DNA were bound to 20 µl of S9.6 antibody (1mg/ml) in 500 µl 1X binding buffer in TE, overnight at 4ºC. DNA-antibody complexes were immunoprecipitated using Dynabeads Protein A (Invitrogen) during 2h at 4ºC and washed 3 times with 1X binding buffer. DNA was eluted in 300 μl elution buffer, treated 45 min with 7 µl proteinase K at 55ºC and phenol-chloroform purified. Finally, DNA was resuspended in 10 µl of RNase-free water, with a total volume of 50 µl. Finally, the DNA was sonicated and checked on a 2100 Agilent Bioanalyzer. Afterwards, this DNA was used to build the libraries using the ThruPLEX DNA-Seq 6S kit (Rubicon Genomics) according to manufacturer’s instruction and sequenced on an Illumina NextSeq500 platform. 15.4. RNA-DNA immunoprecipitation followed by cDNA conversion couple to high throughput sequencing (DRIPc-seq) DRIPc-seq was performed essentially as described (Sanz & Chedin, 2019) and described in Materials and Methods 11.3. Briefly, after DRIP, the eluted DNA from five immunoprecipitations of each sample was treated with 6 U of DNase I (New England BioLabs) for 45 min at 37°C to degrade all DNA. The resulting RNA was subjected to libraries construction using the TruSeq Stranded Total RNA protocol (Illumina) from the fragmentation step. The quality of the libraries was checked on a 2100 Agilent Bioanalyzer prior to sequencing on an Illumina NextSeq500 platform. MATERIALS AND METHODS 82 16. GENOME WIDE DATA ANALYSIS 16.1. RNA-seq Sequenced paired-ends reads were subjected to quality control pipeline using the FASTQ Toolkit v.1.0.0 software (Illumina) and then mapped to the human reference genome hg38 canonical using HISAT2 (Kim et al., 2019). Reads mapping to mitochondrial chromosome and duplicated reads were discarded using SAMtools (Li et al., 2009) for our purposes. After the obtainment of BAM files, counts per peak were established using FeatureCounts and RPKM normalized. For genes in which expression changes are detected (|linear fold change| > 1.5), siC Log2expression and Log2(siUAP56/siC) was compared and represented for genes longer than 5 Kb. 16.2. ChIP-seq Sequenced paired-ends reads were subjected to quality control pipeline using the FASTQ Toolkit v.1.0.0 software (Illumina) and then mapped to the human reference genome hg38 canonical using using BWA-MEM (Li et al., 2009). Reads mapping to mitochondrial chromosome and duplicated reads were discarded using SAMtools (Li et al., 2009) for our purposes. BAM files were further analyzed with deepTools Bamcompare from deepTool2 package (Ramirez et al., 2016) for track generation. The results were visualized with the Integrative Genomics Viewer (IGV), developed and maintained by The Broad Institute and the Regents of the University of California and UC San Diego. Peak calling was performed using MACS2 package (Zhang et al., 2008) selecting those whose enrichment signal over the input had a p-value < 0.01. As well, selected peaks were annotated to genes using ChIPseeker (Yu et al., 2015) and genes retrieved from Ensembl release 94 2018 (Zerbino et al., 2018). For our purposes, only genes with more than 5 Kb were analyzed, considering promoter as -2/+5 Kb from TSS and downstream as -2/+5 Kb from TES. Tesis doctoral-Carmen Pérez Calero 83 16.3. DRIP-seq and DRIPc-seq Sequenced paired-ends reads were subjected to quality control pipeline using the FASTQ Toolkit v.1.0.0 software (Illumina) and then mapped to the human reference genome hg38 canonical using using BWA-MEM (Li et al., 2009). Reads mapping to mitochondrial chromosome and duplicated reads were discarded using SAMtools (Li et al., 2009) for our purposes. Additionally, For DRIPc-seq, reads were separated into minus and plus strand using the same tool. BAM files were further analyzed with deepTool2 package (Ramirez et al., 2016) for track generation setting a window bien size of 10 nt and a smooth value of 40. The results were visualized with the Integrative Genomics Viewer (IGV), developed and maintained by The Broad Institute and the Regents of the University of California and UC San Diego. Peak calling on DRIP-seq and DRIPc-seq was performed using MACS2 package (Zhang et al., 2008). Then, number of counts per peak was calculated using FeatureCounts and RPKM normalized. For analysis, significant DRIPc peaks (q-value < 0.01) in siUAP56 depleted cells were established selecting those peaks whose DRIPc signal fold change was higher than 1.5X respect to the siC control cells. Afterwards, peaks were annotated to genes using ChIPseeker (Yu et al., 2015) and genes retrieved from Ensembl release 94 2018 (Zerbino et al., 2018). For our purposes, only genes with more than 5 Kb were analyzed, considering promoter as -2/+5 Kb from TSS and downstream as -2/+5 Kb from TES. Gene metaplots were obtained using deepTools computematrix and plotheatmap. Venn diagrams were created using Biovenn (Hulsen et al., 2008). - Statistical tests Statistical tests (Mann-Whitney U-test and Pearson’s correlation were calculated using GraphPad Prism software. Hypergeometric tests were calculated using R scripts. In general, a P-value < 0.05 was considered as statistically significant. 84 85 REFERENCES 86 Tesis doctoral-Carmen Pérez Calero 87 Aguilera, A. (2002). The connection between transcription and genomic instability. EMBO J 21, 195-201. Aguilera, A. (2005a). Cotranscriptional mRNP assembly: from the DNA to the nuclear pore. Curr Opin Cell Biol 17, 242-250. Aguilera, A. (2005b). mRNA processing and genomic instability. Nat Struct Mol Biol 12, 737-738. Aguilera, A., and Garcia-Muse, T. (2012). R loops: from transcription byproducts to threats to genome stability. Mol Cell 46, 115-124. Aguilera, A., and Garcia-Muse, T. (2013). Causes of genome instability. Annu Rev Genet 47, 1-32. Aguilera, A., and Gomez-Gonzalez, B. (2008). Genome instability: a mechanistic view of its causes and consequences. Nat Rev Genet 9, 204-217. Aguilera, A., and Klein, H.L. (1990). HPR1, a novel yeast gene that prevents intrachromosomal excision recombination, shows carboxy-terminal homology to the Saccharomyces cerevisiae TOP1 gene. Mol Cell Biol 10, 1439-1451. Alexander, R.D., Innocente, S.A., Barrass, J.D., and Beggs, J.D. (2010). Splicingdependent RNA polymerase pausing in yeast. Mol Cell 40, 582-593. Alzu, A., Bermejo, R., Begnis, M., Lucca, C., Piccini, D., Carotenuto, W., Saponaro, M., Brambati, A., Cocito, A., Foiani, M., et al. (2012). Senataxin associates with replication forks to protect fork integrity across RNA- polymerase-II-transcribed genes. Cell 151, 835-846. Aroeira, L.S., Aguilera, A., Sanchez-Tomero, J.A., Bajo, M.A., del Peso, G., Jimenez-Heffernan, J.A., Selgas, R., and Lopez-Cabrera, M. (2007). Epithelial to mesenchymal transition and peritoneal membrane failure in peritoneal dialysis patients: pathologic significance and potential therapeutic interventions. J Am Soc Nephrol 18, 2004-2013. Ayyanathan, K., Peng, H., Hou, Z., Fredericks, W.J., Goyal, R.K., Langer, E.M., Longmore, G.D., and Rauscher, F.J., 3rd (2007). The Ajuba LIM domain protein is a corepressor for SNAG domain mediated repression and participates in nucleocytoplasmic Shuttling. Cancer Res 67, 9097-9106. Barrallo-Gimeno, A., and Nieto, M.A. (2005). The Snail genes as inducers of cell movement and survival: implications in development and cancer. Development 132, 3151-3161. Bates, G.J., Nicol, S.M., Wilson, B.J., Jacobs, A.M., Bourdon, J.C., Wardrop, J., Gregory, D.J., Lane, D.P., Perkins, N.D., and Fuller-Pace, F.V. (2005). The DEAD box protein p68: a novel transcriptional coactivator of the p53 tumour suppressor. EMBO J 24, 543-553. REFERENCES 88 Batlle, E., Sancho, E., Franci, C., Dominguez, D., Monfar, M., Baulida, J., and Garcia De Herreros, A. (2000). The transcription factor snail is a repressor of E-cadherin gene expression in epithelial tumour cells. Nat Cell Biol 2, 84-89. Bentley, D.L. (2014). Coupling mRNA processing with transcription in time and space. Nat Rev Genet 15, 163-175. Bermejo, R., Capra, T., Gonzalez-Huici, V., Fachinetti, D., Cocito, A., Natoli, G., Katou, Y., Mori, H., Kurokawa, K., Shirahige, K., et al. (2009). Genomeorganizing factors Top2 and Hmo1 prevent chromosome fragility at sites of S phase transcription. Cell 138, 870-884. Bermejo, R., Lai, M.S., and Foiani, M. (2012). Preventing replication stress to maintain genome stability: resolving conflicts between replication and transcription. Mol Cell 45, 710-718. Bernstein, E., and Allis, C.D. (2005). RNA meets chromatin. Genes Dev 19, 1635- 1655. Beyes, S., Andrieux, G., Schrempp, M., Aicher, D., Wenzel, J., Anton-Garcia, P., Boerries, M., and Hecht, A. (2019). Genome-wide mapping of DNA- binding sites identifies stemness-related genes as directly repressed targets of SNAIL1 in colorectal cancer cells. Oncogene. Bhatia, V., Barroso, S.I., Garcia-Rubio, M.L., Tumini, E., Herrera-Moyano, E., and Aguilera, A. (2014). BRCA2 prevents R-loop accumulation and associates with TREX-2 mRNA export factor PCID2. Nature 511, 362-365. Bonnet, A., Grosso, A.R., Elkaoutari, A., Coleno, E., Presle, A., Sridhara, S.C., Janbon, G., Geli, V., de Almeida, S.F., and Palancade, B. (2017). Introns Protect Eukaryotic Genomes from Transcription-Associated Genetic Instability. Mol Cell 67, 608-621 e606. Boque-Sastre, R., Soler, M., Oliveira-Mateos, C., Portela, A., Moutinho, C., Sayols, S., Villanueva, A., Esteller, M., and Guil, S. (2015). Head-to-head antisense transcription and R-loop formation promotes transcriptional activation. Proc Natl Acad Sci U S A 112, 5785-5790. Brewer, B.J. (1988). When polymerases collide: replication and the transcriptional organization of the E. coli chromosome. Cell 53, 679-686. Burgess, R.C., and Misteli, T. (2015). Not All DDRs Are Created Equal: Non- Canonical DNA Damage Responses. Cell 162, 944-947. Cai, W., Xiong Chen, Z., Rane, G., Satendra Singh, S., Choo, Z., Wang, C., Yuan, Y., Zea Tan, T., Arfuso, F., Yap, C.T., et al. (2017). Wanted DEAD/H or Alive: Helicases Winding Up in Cancers. J Natl Cancer Inst 109. Tesis doctoral-Carmen Pérez Calero 95 Huertas, P., and Aguilera, A. (2003). Cotranscriptionally formed DNA:RNA hybrids mediate transcription elongation impairment and transcriptionassociated recombination. Mol Cell 12, 711-721. Hulsen, T., de Vlieg, J., and Alkema, W. (2008). BioVenn - a web application for the comparison and visualization of biological lists using area-proportional Venn diagrams. BMC Genomics 9, 488. Iacovoni, J.S., Caron, P., Lassadi, I., Nicolas, E., Massip, L., Trouche, D., and Legube, G. (2010). High-resolution profiling of gammaH2AX around DNA double strand breaks in the mammalian genome. EMBO J 29, 1446-1457. Iggo, R.D., Jamieson, D.J., MacNeill, S.A., Southgate, J., McPheat, J., and Lane, D.P. (1991). p68 RNA helicase: identification of a nucleolar form and cloning of related genes containing a conserved intron in yeasts. Mol Cell Biol 11, 1326-1333. Izquierdo, J.M., and Valcarcel, J. (2006). A simple principle to explain the evolution of pre-mRNA splicing. Genes Dev 20, 1679-1684. Jarmoskaite, I., and Russell, R. (2014). RNA helicase proteins as chaperones and remodelers. Annu Rev Biochem 83, 697-725. Jensen, T.H., Boulay, J., Rosbash, M., and Libri, D. (2001). The DECD box putative ATPase Sub2p is an early mRNA export factor. Curr Biol 11, 1711-1715. Jimeno, S., Rondon, A.G., Luna, R., and Aguilera, A. (2002). The yeast THO complex and mRNA export factors link RNA metabolism with transcription and genome instability. EMBO J 21, 3526-3535. Kabeche, L., Nguyen, H.D., Buisson, R., and Zou, L. (2018). A mitosis-specific and R loop-driven ATR pathway promotes faithful chromosome segregation. Science 359, 108-114. Kapadia, F., Pryor, A., Chang, T.H., and Johnson, L.F. (2006). Nuclear localization of poly(A)+ mRNA following siRNA reduction of expression of the mammalian RNA helicases UAP56 and URH49. Gene 384, 37-44. Katahira, J., Ishikawa, H., Tsujimura, K., Kurono, S., and Hieda, M. (2019). Human THO coordinates transcription termination and subsequent transcript release from the HSP70 locus. Genes Cells 24, 272-283. Kim, D., Paggi, J.M., Park, C., Bennett, C., and Salzberg, S.L. (2019). Graphbased genome alignment and genotyping with HISAT2 and HISAT- genotype. Nat Biotechnol 37, 907-915. Kim, N., and Jinks-Robertson, S. (2012). Transcription as a source of genome instability. Nat Rev Genet 13, 204-214. REFERENCES 96 Kistler, A.L., and Guthrie, C. (2001). Deletion of MUD2, the yeast homolog of U2AF65, can bypass the requirement for sub2, an essential spliceosomal ATPase. Genes Dev 15, 42-49. Kogoma, T. (1997). Stable DNA replication: interplay between DNA replication, homologous recombination, and transcription. Microbiol Mol Biol Rev 61, 212-238. Kohler, A., and Hurt, E. (2007). Exporting RNA from the nucleus to the cytoplasm. Nat Rev Mol Cell Biol 8, 761-773. Kornblihtt, A.R., de la Mata, M., Fededa, J.P., Munoz, M.J., and Nogues, G. (2004). Multiple links between transcription and splicing. RNA 10, 1489- 1498. Kornblihtt, A.R., Schor, I.E., Allo, M., Dujardin, G., Petrillo, E., and Munoz, M.J. (2013). Alternative splicing: a pivotal step between eukaryotic transcription and translation. Nat Rev Mol Cell Biol 14, 153-165. Kota, K.P., Wagner, S.R., Huerta, E., Underwood, J.M., and Nickerson, J.A. (2008). Binding of ATP to UAP56 is necessary for mRNA export. J Cell Sci 121, 1526-1537. Kothari, A.N., Mi, Z., Zapf, M., and Kuo, P.C. (2014). Novel clinical therapeutics targeting the epithelial to mesenchymal transition. Clin Transl Med 3, 35. Laemmli, U.K. (1970). Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227, 680-685. Lamm, G.M., Nicol, S.M., Fuller-Pace, F.V., and Lamond, A.I. (1996). p72: a human nuclear DEAD box protein highly related to p68. Nucleic Acids Res 24, 3739-3747. Lane, D.P., and Hoeffler, W.K. (1980). SV40 large T shares an antigenic determinant with a cellular protein of molecular weight 68,000. Nature 288, 167-170. Lang, K.S., Hall, A.N., Merrikh, C.N., Ragheb, M., Tabakh, H., Pollock, A.J., Woodward, J.J., Dreifus, J.E., and Merrikh, H. (2017). Replication- Transcription Conflicts Generate R-Loops that Orchestrate Bacterial Stress Survival and Pathogenesis. Cell 170, 787-799 e718. Li, H., Handsaker, B., Wysoker, A., Fennell, T., Ruan, J., Homer, N., Marth, G., Abecasis, G., Durbin, R., and Genome Project Data Processing, S. (2009). The Sequence Alignment/Map format and SAMtools. Bioinformatics 25, 2078-2079. Li, L., Germain, D.R., Poon, H.Y., Hildebrandt, M.R., Monckton, E.A., McDonald, D., Hendzel, M.J., and Godbout, R. (2016). DEAD Box 1 Facilitates Tesis doctoral-Carmen Pérez Calero 97 Removal of RNA and Homologous Recombination at DNA Double-Strand Breaks. Mol Cell Biol 36, 2794-2810. Li, X., and Manley, J.L. (2005). Inactivation of the SR protein splicing factor ASF/SF2 results in genomic instability. Cell 122, 365-378. Libri, D., Dower, K., Boulay, J., Thomsen, R., Rosbash, M., and Jensen, T.H. (2002). Interactions between mRNA export commitment, 3'-end quality control, and nuclear degradation. Mol Cell Biol 22, 8254-8266. Libri, D., Graziani, N., Saguez, C., and Boulay, J. (2001). Multiple roles for the yeast SUB2/yUAP56 gene in splicing. Genes Dev 15, 36-41. Linder, P., and Jankowsky, E. (2011). From unwinding to clamping - the DEAD box RNA helicase family. Nat Rev Mol Cell Biol 12, 505-516. Linskens, M.H., and Huberman, J.A. (1988). Organization of replication of ribosomal DNA in Saccharomyces cerevisiae. Mol Cell Biol 8, 4927-4935. Liu, B., and Alberts, B.M. (1995). Head-on collision between a DNA replication apparatus and RNA polymerase transcription complex. Science 267, 1131-1137. Luna, R., Jimeno, S., Marin, M., Huertas, P., Garcia-Rubio, M., and Aguilera, A. (2005). Interdependence between transcription and mRNP processing and export, and its impact on genetic stability. Mol Cell 18, 711-722. Luna, R., Rondon, A.G., and Aguilera, A. (2012). New clues to understand the role of THO and other functionally related factors in mRNP biogenesis. Biochim Biophys Acta 1819, 514-520. Luo, M.L., Zhou, Z., Magni, K., Christoforides, C., Rappsilber, J., Mann, M., and Reed, R. (2001). Pre-mRNA splicing and mRNA export linked by direct interactions between UAP56 and Aly. Nature 413, 644-647. Lykke-Andersen, S., and Jensen, T.H. (2015). Nonsense-mediated mRNA decay: an intricate machinery that shapes transcriptomes. Nat Rev Mol Cell Biol 16, 665-677. Ma, W.K., Cloutier, S.C., and Tran, E.J. (2013). The DEAD-box protein Dbp2 functions with the RNA-binding protein Yra1 to promote mRNP assembly. J Mol Biol 425, 3824-3838. Ma, W.K., Paudel, B.P., Xing, Z., Sabath, I.G., Rueda, D., and Tran, E.J. (2016). Recruitment, Duplex Unwinding and Protein-Mediated Inhibition of the Dead-Box RNA Helicase Dbp2 at Actively Transcribed Chromatin. J Mol Biol 428, 1091-1106. MacMorris, M., Brocker, C., and Blumenthal, T. (2003). UAP56 levels affect viability and mRNA export in Caenorhabditis elegans. RNA 9, 847-857. REFERENCES 98 Mani, S.A., Guo, W., Liao, M.J., Eaton, E.N., Ayyanan, A., Zhou, A.Y., Brooks, M., Reinhard, F., Zhang, C.C., Shipitsin, M., et al. (2008). The epithelialmesenchymal transition generates cells with properties of stem cells. Cell 133, 704-715. Maniatis, T., and Reed, R. (2002). An extensive network of coupling among gene expression machines. Nature 416, 499-506. Manzo, S.G., Hartono, S.R., Sanz, L.A., Marinello, J., De Biasi, S., Cossarizza, A., Capranico, G., and Chedin, F. (2018). DNA Topoisomerase I differentially modulates R-loops across the human genome. Genome Biol 19, 100. Masuda, S., Das, R., Cheng, H., Hurt, E., Dorman, N., and Reed, R. (2005). Recruitment of the human TREX complex to mRNA during splicing. Genes Dev 19, 1512-1517. Maturi, V., Moren, A., Enroth, S., Heldin, C.H., and Moustakas, A. (2018). Genomewide binding of transcription factor Snail1 in triple-negative breast cancer cells. Mol Oncol 12, 1153-1174. Mazurek, A., Park, Y., Miething, C., Wilkinson, J.E., Gillis, J., Lowe, S.W., Vakoc, C.R., and Stillman, B. (2014). Acquired dependence of acute myeloid leukemia on the DEAD-box RNA helicase DDX5. Cell Rep 7, 1887-1899. McDonald, O.G., Wu, H., Timp, W., Doi, A., and Feinberg, A.P. (2011). Genomescale epigenetic reprogramming during epithelial-to-mesenchymal transition. Nat Struct Mol Biol 18, 867-874. Merrikh, H., Zhang, Y., Grossman, A.D., and Wang, J.D. (2012). Replicationtranscription conflicts in bacteria. Nat Rev Microbiol 10, 449-458. Mersaoui, S.Y., Yu, Z., Coulombe, Y., Karam, M., Busatto, F.F., Masson, J.Y., and Richard, S. (2019). Arginine methylation of the DDX5 helicase RGG/RG motif by PRMT5 regulates resolution of RNA:DNA hybrids. EMBO J 38, e100986. Michalet, X., Ekong, R., Fougerousse, F., Rousseaux, S., Schurra, C., Hornigold, N., van Slegtenhorst, M., Wolfe, J., Povey, S., Beckmann, J.S., et al. (1997). Dynamic molecular combing: stretching the whole human genome for high-resolution studies. Science 277, 1518-1523. Millanes-Romero, A., Herranz, N., Perrera, V., Iturbide, A., Loubat-Casanovas, J., Gil, J., Jenuwein, T., Garcia de Herreros, A., and Peiro, S. (2013). Regulation of heterochromatin transcription by Snail1/LOXL2 during epithelial-to-mesenchymal transition. Mol Cell 52, 746-757. Millevoi, S., and Vagner, S. (2010). Molecular mechanisms of eukaryotic premRNA 3' end processing regulation. Nucleic Acids Res 38, 2757-2774. Tesis doctoral-Carmen Pérez Calero 99 Mischo, H.E., Chun, Y., Harlen, K.M., Smalec, B.M., Dhir, S., Churchman, L.S., and Buratowski, S. (2018). Cell-Cycle Modulation of Transcription Termination Factor Sen1. Mol Cell 70, 312-326 e317. Mischo, H.E., Gomez-Gonzalez, B., Grzechnik, P., Rondon, A.G., Wei, W., Steinmetz, L., Aguilera, A., and Proudfoot, N.J. (2011). Yeast Sen1 helicase protects the genome from transcription-associated instability. Mol Cell 41, 21-32. Muller-McNicoll, M., and Neugebauer, K.M. (2013). How cells get the message: dynamic assembly and function of mRNA-protein complexes. Nat Rev Genet 14, 275-287. Nadel, J., Athanasiadou, R., Lemetre, C., Wijetunga, N.A., P, O.B., Sato, H., Zhang, Z., Jeddeloh, J., Montagna, C., Golden, A., et al. (2015). RNA:DNA hybrids in the human genome have distinctive nucleotide characteristics, chromatin composition, and transcriptional relationships. Epigenetics Chromatin 8, 46. Nakama, M., Kawakami, K., Kajitani, T., Urano, T., and Murakami, Y. (2012). DNA-RNA hybrid formation mediates RNAi-directed heterochromatin formation. Genes Cells 17, 218-233. Negrini, S., Gorgoulis, V.G., and Halazonetis, T.D. (2010). Genomic instability-- an evolving hallmark of cancer. Nat Rev Mol Cell Biol 11, 220-228. Nieto, M.A., Huang, R.Y., Jackson, R.A., and Thiery, J.P. (2016). Emt: 2016. Cell 166, 21-45. Nowotny, M., Cerritelli, S.M., Ghirlando, R., Gaidamakov, S.A., Crouch, R.J., and Yang, W. (2008). Specific recognition of RNA/DNA hybrid and enhancement of human RNase H1 activity by HBD. EMBO J 27, 1172- 1181. Ohle, C., Tesorero, R., Schermann, G., Dobrev, N., Sinning, I., and Fischer, T. (2016). Transient RNA-DNA Hybrids Are Required for Efficient Double- Strand Break Repair. Cell 167, 1001-1013 e1007. Paulsen, R.D., Soni, D.V., Wollman, R., Hahn, A.T., Yee, M.C., Guan, A., Hesley, J.A., Miller, S.C., Cromwell, E.F., Solow-Cordero, D.E., et al. (2009). A genome-wide siRNA screen reveals diverse cellular processes and pathways that mediate genome stability. Mol Cell 35, 228-239. Pefanis, E., Wang, J., Rothschild, G., Lim, J., Kazadi, D., Sun, J., Federation, A., Chao, J., Elliott, O., Liu, Z.P., et al. (2015). RNA exosome-regulated long non-coding RNA transcription controls super-enhancer activity. Cell 161, 774-789. REFERENCES 100 Peinado, H., Ballestar, E., Esteller, M., and Cano, A. (2004). Snail mediates E- cadherin repression by the recruitment of the Sin3A/histone deacetylase 1 (HDAC1)/HDAC2 complex. Mol Cell Biol 24, 306-319. Peinado, H., Del Carmen Iglesias-de la Cruz, M., Olmeda, D., Csiszar, K., Fong, K.S., Vega, S., Nieto, M.A., Cano, A., and Portillo, F. (2005). A molecular role for lysyl oxidase-like 2 enzyme in snail regulation and tumor progression. EMBO J 24, 3446-3458. Peinado, H., Olmeda, D., and Cano, A. (2007). Snail, Zeb and bHLH factors in tumour progression: an alliance against the epithelial phenotype? Nat Rev Cancer 7, 415-428. Pena, A., Gewartowski, K., Mroczek, S., Cuellar, J., Szykowska, A., Prokop, A., Czarnocki-Cieciura, M., Piwowarski, J., Tous, C., Aguilera, A., et al. (2012). Architecture and nucleic acids recognition mechanism of the THO complex, an mRNP assembly factor. EMBO J 31, 1605-1616. Petryk, N., Kahli, M., d'Aubenton-Carafa, Y., Jaszczyszyn, Y., Shen, Y., Silvain, M., Thermes, C., Chen, C.L., and Hyrien, O. (2016). Replication landscape of the human genome. Nat Commun 7, 10208. Phillips, D.D., Garboczi, D.N., Singh, K., Hu, Z., Leppla, S.H., and Leysath, C.E. (2013). The sub-nanomolar binding of DNA-RNA hybrids by the singlechain Fv fragment of antibody S9.6. J Mol Recognit 26, 376-381. Piruat, J.I., and Aguilera, A. (1998). A novel yeast gene, THO2, is involved in RNA pol II transcription and provides new evidence for transcriptional elongation-associated recombination. EMBO J 17, 4859-4872. Powell, W.T., Coulson, R.L., Gonzales, M.L., Crary, F.K., Wong, S.S., Adams, S., Ach, R.A., Tsang, P., Yamada, N.A., Yasui, D.H., et al. (2013). R-loop formation at Snord116 mediates topotecan inhibition of Ube3a-antisense and allele-specific chromatin decondensation. Proc Natl Acad Sci U S A 110, 13938-13943. Prado, F., and Aguilera, A. (2005). Impairment of replication fork progression mediates RNA polII transcription-associated recombination. EMBO J 24, 1267-1276. Proudfoot, N.J. (2016). Transcriptional termination in mammals: Stopping the RNA polymerase II juggernaut. Science 352, aad9926. Proudfoot, N.J., Furger, A., and Dye, M.J. (2002). Integrating mRNA processing with transcription. Cell 108, 501-512. Pryor, A., Tung, L., Yang, Z., Kapadia, F., Chang, T.H., and Johnson, L.F. (2004). Growth-regulated expression and G0-specific turnover of the mRNA that encodes URH49, a mammalian DExH/D box protein that is highly related to the mRNA export protein UAP56. Nucleic Acids Res 32, 1857-1865. Tesis doctoral-Carmen Pérez Calero 101 Putnam, A.A., and Jankowsky, E. (2013). DEAD-box helicases as integrators of RNA, nucleotide and protein binding. Biochim Biophys Acta 1829, 884- 893. Ramirez, F., Ryan, D.P., Gruning, B., Bhardwaj, V., Kilpert, F., Richter, A.S., Heyne, S., Dundar, F., and Manke, T. (2016). deepTools2: a next generation web server for deep-sequencing data analysis. Nucleic Acids Res 44, W160-165. Reed, R., and Cheng, H. (2005). TREX, SR proteins and export of mRNA. Curr Opin Cell Biol 17, 269-273. Reed, R., and Hurt, E. (2002). A conserved mRNA export machinery coupled to pre-mRNA splicing. Cell 108, 523-531. Rondon, A.G., and Aguilera, A. (2019). What causes an RNA-DNA hybrid to compromise genome integrity? DNA Repair (Amst) 81, 102660. Rondon, A.G., Jimeno, S., and Aguilera, A. (2010). The interface between transcription and mRNP export: from THO to THSC/TREX-2. Biochim Biophys Acta 1799, 533-538. Rougemaille, M., Dieppois, G., Kisseleva-Romanova, E., Gudipati, R.K., Lemoine, S., Blugeon, C., Boulay, J., Jensen, T.H., Stutz, F., Devaux, F., et al. (2008). THO/Sub2p functions to coordinate 3'-end processing with gene-nuclear pore association. Cell 135, 308-321. Saguez, C., Gonzales, F.A., Schmid, M., Boggild, A., Latrick, C.M., Malagon, F., Putnam, A., Sanderson, L., Jankowsky, E., Brodersen, D.E., et al. (2013). Mutational analysis of the yeast RNA helicase Sub2p reveals conserved domains required for growth, mRNA export, and genomic stability. RNA 19, 1363-1371. Saguez, C., Schmid, M., Olesen, J.R., Ghazy, M.A., Qu, X., Poulsen, M.B., Nasser, T., Moore, C., and Jensen, T.H. (2008). Nuclear mRNA surveillance in THO/sub2 mutants is triggered by inefficient polyadenylation. Mol Cell 31, 91-103. Salas-Armenteros, I., Perez-Calero, C., Bayona-Feliu, A., Tumini, E., Luna, R., and Aguilera, A. (2017). Human THO-Sin3A interaction reveals new mechanisms to prevent R-loops that cause genome instability. EMBO J 36, 3532-3547. Sambrook, J., Fritsch, E.F., and Maniatis, T. (1989). Molecular cloning : a laboratory manual, 2nd edn (New York: Cold Spring Harbor Laboratory). Santos-Pereira, J.M., and Aguilera, A. (2015). R loops: new modulators of genome dynamics and function. Nat Rev Genet 16, 583-597. REFERENCES 102 Sanz, L.A., and Chedin, F. (2019). High-resolution, strand-specific R-loop mapping via S9.6-based DNA-RNA immunoprecipitation and highthroughput sequencing. Nat Protoc 14, 1734-1755. Sanz, L.A., Hartono, S.R., Lim, Y.W., Steyaert, S., Rajpurkar, A., Ginno, P.A., Xu, X., and Chedin, F. (2016). Prevalent, Dynamic, and Conserved R-Loop Structures Associate with Specific Epigenomic Signatures in Mammals. Mol Cell 63, 167-178. Saponaro, M., Kantidakis, T., Mitter, R., Kelly, G.P., Heron, M., Williams, H., Soding, J., Stewart, A., and Svejstrup, J.Q. (2014). RECQL5 controls transcript elongation and suppresses genome instability associated with transcription stress. Cell 157, 1037-1049. Saporita, A.J., Chang, H.C., Winkeler, C.L., Apicelli, A.J., Kladney, R.D., Wang, J., Townsend, R.R., Michel, L.S., and Weber, J.D. (2011). RNA helicase DDX5 is a p53-independent target of ARF that participates in ribosome biogenesis. Cancer Res 71, 6708-6717. Sarkar, M., and Ghosh, M.K. (2016). DEAD box RNA helicases: crucial regulators of gene expression and oncogenesis. Front Biosci (Landmark Ed) 21, 225- 250. Schwab, R.A., Nieminuszczy, J., Shah, F., Langton, J., Lopez Martinez, D., Liang, C.C., Cohn, M.A., Gibbons, R.J., Deans, A.J., and Niedzwiedz, W. (2015). The Fanconi Anemia Pathway Maintains Genome Stability by Coordinating Replication and Transcription. Mol Cell 60, 351-361. Selth, L.A., Sigurdsson, S., and Svejstrup, J.Q. (2010). Transcript Elongation by RNA Polymerase II. Annu Rev Biochem 79, 271-293. Sengoku, T., Nureki, O., Nakamura, A., Kobayashi, S., and Yokoyama, S. (2006). Structural basis for RNA unwinding by the DEAD-box protein Drosophila Vasa. Cell 125, 287-300. Shen, H., Zheng, X., Shen, J., Zhang, L., Zhao, R., and Green, M.R. (2008). Distinct activities of the DExD/H-box splicing factor hUAP56 facilitate stepwise assembly of the spliceosome. Genes Dev 22, 1796-1803. Shen, J., Zhang, L., and Zhao, R. (2007). Biochemical characterization of the ATPase and helicase activity of UAP56, an essential pre-mRNA splicing and mRNA export factor. J Biol Chem 282, 22544-22550. Shi, H., Cordin, O., Minder, C.M., Linder, P., and Xu, R.M. (2004). Crystal structure of the human ATP-dependent splicing and export factor UAP56. Proc Natl Acad Sci U S A 101, 17628-17633. Shivji, M.K.K., Renaudin, X., Williams, C.H., and Venkitaraman, A.R. (2018). BRCA2 Regulates Transcription Elongation by RNA Polymerase II to Prevent R-Loop Accumulation. Cell Rep 22, 1031-1039. Tesis doctoral-Carmen Pérez Calero 103 Shkreta, L., and Chabot, B. (2015). The RNA Splicing Response to DNA Damage. Biomolecules 5, 2935-2977. Silva, S., Camino, L.P., and Aguilera, A. (2018). Human mitochondrial degradosome prevents harmful mitochondrial R loops and mitochondrial genome instability. Proc Natl Acad Sci U S A 115, 11024-11029. Singh, D.K., Pandita, R.K., Singh, M., Chakraborty, S., Hambarde, S., Ramnarain, D., Charaka, V., Ahmed, K.M., Hunt, C.R., and Pandita, T.K. (2018). MOF Suppresses Replication Stress and Contributes to Resolution of Stalled Replication Forks. Mol Cell Biol 38. Singleton, M.R., Dillingham, M.S., and Wigley, D.B. (2007). Structure and mechanism of helicases and nucleic acid translocases. Annu Rev Biochem 76, 23-50. Skourti-Stathaki, K., Kamieniarz-Gdula, K., and Proudfoot, N.J. (2014). R-loops induce repressive chromatin marks over mammalian gene terminators. Nature 516, 436-439. Skourti-Stathaki, K., and Proudfoot, N.J. (2014). A double-edged sword: R loops as threats to genome integrity and powerful regulators of gene expression. Genes Dev 28, 1384-1396. Skourti-Stathaki, K., Proudfoot, N.J., and Gromak, N. (2011). Human senataxin resolves RNA/DNA hybrids formed at transcriptional pause sites to promote Xrn2-dependent termination. Mol Cell 42, 794-805. Sloan, C.A., Chan, E.T., Davidson, J.M., Malladi, V.S., Strattan, J.S., Hitz, B.C., Gabdank, I., Narayanan, A.K., Ho, M., Lee, B.T., et al. (2016). ENCODE data at the ENCODE portal. Nucleic Acids Res 44, D726-732. Soderberg, O., Gullberg, M., Jarvius, M., Ridderstrale, K., Leuchowius, K.J., Jarvius, J., Wester, K., Hydbring, P., Bahram, F., Larsson, L.G., et al. (2006). Direct observation of individual endogenous protein complexes in situ by proximity ligation. Nat Methods 3, 995-1000. Sollier, J., Stork, C.T., Garcia-Rubio, M.L., Paulsen, R.D., Aguilera, A., and Cimprich, K.A. (2014). Transcription-coupled nucleotide excision repair factors promote R-loop-induced genome instability. Mol Cell 56, 777-785. Song, C., Hotz-Wagenblatt, A., Voit, R., and Grummt, I. (2017). SIRT7 and the DEAD-box helicase DDX21 cooperate to resolve genomic R loops and safeguard genome stability. Genes Dev 31, 1370-1381. Sridhara, S.C., Carvalho, S., Grosso, A.R., Gallego-Paez, L.M., Carmo-Fonseca, M., and de Almeida, S.F. (2017). Transcription Dynamics Prevent RNA- Mediated Genomic Instability through SRPK2-Dependent DDX23 Phosphorylation. Cell Rep 18, 334-343. REFERENCES 104 Stemmler, M.P., Eccles, R.L., Brabletz, S., and Brabletz, T. (2019). Nonredundant functions of EMT transcription factors. Nat Cell Biol 21, 102- 112. Stirling, P.C., Chan, Y.A., Minaker, S.W., Aristizabal, M.J., Barrett, I., Sipahimalani, P., Kobor, M.S., and Hieter, P. (2012). R-loop-mediated genome instability in mRNA cleavage and polyadenylation mutants. Genes Dev 26, 163-175. Strasser, K., Masuda, S., Mason, P., Pfannstiel, J., Oppizzi, M., Rodriguez- Navarro, S., Rondon, A.G., Aguilera, A., Struhl, K., Reed, R., et al. (2002). TREX is a conserved complex coupling transcription with messenger RNA export. Nature 417, 304-308. Stuckey, R., Garcia-Rodriguez, N., Aguilera, A., and Wellinger, R.E. (2015). Role for RNA:DNA hybrids in origin-independent replication priming in a eukaryotic system. Proc Natl Acad Sci U S A 112, 5779-5784. Sugiura, T., Sakurai, K., and Nagano, Y. (2007). Intracellular characterization of DDX39, a novel growth-associated RNA helicase. Exp Cell Res 313, 782- 790. Sulli, G., Di Micco, R., and d'Adda di Fagagna, F. (2012). Crosstalk between chromatin state and DNA damage response in cellular senescence and cancer. Nat Rev Cancer 12, 709-720. Tedeschi, F.A., Cloutier, S.C., Tran, E.J., and Jankowsky, E. (2018). The DEAD- box protein Dbp2p is linked to noncoding RNAs, the helicase Sen1p, and R-loops. RNA 24, 1693-1705. Thiery, J.P. (2003). Epithelial-mesenchymal transitions in development and pathologies. Curr Opin Cell Biol 15, 740-746. Thiery, J.P., Acloque, H., Huang, R.Y., and Nieto, M.A. (2009). Epithelialmesenchymal transitions in development and disease. Cell 139, 871-890. Thiery, J.P., and Sleeman, J.P. (2006). Complex networks orchestrate epithelialmesenchymal transitions. Nat Rev Mol Cell Biol 7, 131-142. Tous, C., and Aguilera, A. (2007). Impairment of transcription elongation by R- loops in vitro. Biochem Biophys Res Commun 360, 428-432. Tran, P.L.T., Pohl, T.J., Chen, C.F., Chan, A., Pott, S., and Zakian, V.A. (2017). PIF1 family DNA helicases suppress R-loop mediated genome instability at tRNA genes. Nat Commun 8, 15025. Tuduri, S., Crabbe, L., Conti, C., Tourriere, H., Holtgreve-Grez, H., Jauch, A., Pantesco, V., De Vos, J., Thomas, A., Theillet, C., et al. (2009). Topoisomerase I suppresses genomic instability by preventing