Full text
Pe u bing HIV-1 Ribosomal F ameshi ing F equency Re eals a
cis P e e ence o Gag-Pol Inco po a ion in o Assembling Vi ions
Bayleigh E. Benne ,
a
,
b
James W. B uce,
a
,
c
Jacob R. Ken ala,
a
Magdalena Mu ay,
a
Jo dan T. Becke ,
a
Pablo Ga cia-Mi anda,
a
,
d
Paul Ahlquis ,
a
,
c
Samuel E. Bu che ,
d
Na han M. She e
a
a
Depa men o Oncology (McA dle Labo a o y o Cance Resea ch), Ins i u e o Molecula Vi ology, and Ca bone Cance Cen e , Uni e si y o Wisconsin—Madison,
Madison, Wisconsin, USA
b
UW—Madison Mic obiology Doc o al T aining P og am, Madison, Wisconsin, USA
c
John and Jeanne Rowe Cen e o Resea ch in Vi ology, Mo g idge Ins i u e o Resea ch, Madison, Wisconsin, USA
d
Depa men o Biochemis y, Uni e si y o Wisconsin—Madison, Madison, Wisconsin, USA
ABSTRACT HIV-1 i ion p oduc ion is d i en by Gag and Gag-Pol (GP) p o eins, wi h
Gag o ming he bulk o he capsid and d i ing budding, while GP binds Gag o deli e
he essen ial i ion enzymes p o ease, e e se ansc ip ase, and in eg ase. Vi ion GP le -
els a e adi ionally hough o eflec he ela i e abundances o GP and Gag in cells
(;1:20), dic a ed by he equency o a 21 p og ammed ibosomal ameshi ing (PRF)
e en occu ing in gag-pol mRNAs. He e, we exploi ed a panel o PRF mu an i uses o
show ha mechanisms in addi ion o PRF egula e GP inco po a ion in o i ions. Fi s ,
we show ha GP is en iched ;3- old in i ions ela i e o cells, wi h i al in ec i i y
being be e main ained a subphysiological le els o GP han when GP le els a e oo
high. Second, we epo ha GP is mo e e ficien ly inco po a ed in o i ions when Gag
and GP a e syn hesized in cis (i.e., om he same gag-pol mRNA) han in ans,sugges -
ing ha Gag/GP ansla ion and assembly a e spa ially coupled p ocesses. Thi d, we
show ha , su p isingly, i ions exhibi a s ong uppe limi o ans-deli e ed GP inco po-
a ion; an adap a ion ha appea s o allow he i us o empe de ec s o GP/Gag clea -
age ha may nega i ely impac e e se ansc ip ion. Taking hese esul s oge he , we
p opose a “weigh ed Goldilocks”scena io o HIV-1 GP inco po a ion, whe ein combined
mechanisms o GP en ichmen and exclusion bu e i ion in ec i i y o e a b oad ange
o local GP concen a ions. These esul s p o ide new insigh s in o he HIV-1 i ion as-
sembly pa hway ele an o he an icipa ed e ficacy o PRF- a ge ed an i i al s a egies.
IMPORTANCE HIV-1 in ec i i y equi es inco po a ion o he Gag-Pol (GP) p ecu so poly-
p o ein in o i ions du ing he p ocess o i us pa icle assembly. Mechanisms dic a ing
GP inco po a ion in o assembling i ions a e poo ly defined, wi h GP le els in i ions a-
di ionally hough o solely eflec ela i e le els o Gag and GP exp essed in cells, dic-
a ed by he equency o a 21 p og ammed ibosomal ameshi ing (PRF) e en ha
occu s in gag-pol mRNAs. He ein, we p o ide expe imen al suppo o a “weigh ed
Goldilocks”scena io o GP inco po a ion, whe ein he i us exploi s bo h andom and
non andom mechanisms o bu e in ec i i y o e a wide ange o GP exp ession le els.
These mechanis ic da a a e ele an o ongoing e o s o de elop an i i al s a egies a -
ge ing PRF equency and/o HIV-1 i ion ma u a ion.
KEYWORDS Gag, Gag-Pol, HIV, PRF, cis-ac ing RNA elemen , p o ease, e e se
ansc ip ion, ibosomal ameshi , i ion, i us assembly
Re o i uses encode cis-ac ing RNA s uc u al elemen s ha egula e key s ages o
i al eplica ion, including bu no limi ed o ansc ip ion, splicing, RNA nuclea
expo , ansla ion, RNA genome dime iza ion, and genome packaging (1–3). A well-
s udied example is he human immunodeficiency i us ype 1 (HIV-1) p og ammed
Edi o Vi iana Simon, Icahn School o
Medicine a Moun Sinai
Copy igh © 2022 Ame ican Socie y o
Mic obiology. All Righ s Rese ed.
Add ess co espondence o Na han M. She e ,
[email p o ec ed].
Recei ed 11 Augus 2021
Accep ed 30 Sep embe 2021
Accep ed manusc ip pos ed online
13 Oc obe 2021
Published
Janua y 2022 Volume 96 Issue 1 e01349-21 Jou nal o Vi ology j i.asm.o g 1
VIRUS-CELL INTERACTIONS
12 Janua y 2022
Downloaded om h ps://jou nals.asm.o g/jou nal/j i on 13 No embe 2023 by 150.214.182.235.
ibosomal ameshi (PRF) egula o y elemen ha con ols he syn hesis o Gag and
Gag-Pol (GP) i ion p o eins om a single i al unspliced gag-pol mRNA (4–10). Gag
o ms he la ges pe cen age o he HIV-1 i ion and is exp essed as an ;55-kDa p e-
cu so polyp o ein (P 55) clea ed in o he subuni s ma ix (MA; p17), capsid (CA; p24),
nucleocapsid (NC; p7), and la e domain (p6) and wo space pep ides (SP1 and SP2)
(11, 12). GP is la ge (P 160) and consis s o iden ical MA, CA, SP1, and NC subuni
domains used o a linke p o ein (p6*) ups eam o subuni s encoding he i al
enzymes p o ease (PR), e e se ansc ip ase (RT), and in eg ase (IN) (13). Gag exp es-
sion is su ficien o gene a e i us-like pa icles e en in he absence o all o he i al
p o eins. Howe e , GP inco po a ion in o i ions is essen ial o i ion in ec i i y
because i deli e s PR, which media es clea age o Gag and GP du ing capsid ma u a-
ion, RT, which e e se ansc ibes he i al RNA genome o o m double-s anded DNA
(dsDNA) ollowing capsid deli e y in o a ge cells, and IN, which in eg a es he dsDNA
p o i al genome in e media e in o hos cell ch oma in. GP inco po a ion le els need o
be igh ly con olled, based on p io s udies showing ha GP o e exp ession nega-
i ely impac s capsid ma u a ion s eps (14–17) and he s abili y o packaged RNA ge-
nome dime s (14).
Wi h he excep ion o spuma i uses, which exp ess Gag and Pol om independen
mRNAs, all o he known e o i uses use ansla ional ecoding o a single gag-pol an-
sc ip o gene a e Gag and GP, employing ei he ameshi ing (FS) o codon ead-
h ough mechanisms (18). Fo HIV-1, he PRF elemen egula es FS equency h ough
he ac i i ies o wo p oximal cis-ac ing egula o y sequences: a conse ed hep anu-
cleo ide “slippe y”sequence (UUUUUUA) (SS) loca ed ups eam o a s ong (DG=
221.8 kcal/mol) 11-bp RNA s em-loop posi ioned 164 bases p io o he gag s op
codon (8, 19). A consensus model posi s ha ibosome s alling a he s em-loop leads
o 21 FS e en s a he SS ;5 o 10% o he ime, so ha Gag and GP a e syn hesized
a an app oxima e a io o 20:1 (Gag o GP) (4, 9, 20). Inc easing he local he mody-
namic s abili y o he PRF s em-loop enhances FS equency bo h in i o (19) and in
cells (21), and we showed p e iously ha s em-loop modifica ions inc easing FS e-
quency as li le as 2- old can yield educ ions in i al in ec i i y o .80% (21).
Acco dingly, he PRF elemen may ep esen a iable a ge o an i i al in e en ion.
Indeed, cell-pe mean small molecules designed o bind he s em-loop and inc ease FS
equency ha e been shown o educe i al in ec i i y in cell cul u e (22).
The inco po a ion o Gag and GP in o i us pa icles is adi ionally iewed as a s o-
chas ic p ocess, whe ein he a io o GP o Gag ound in i ions oughly equals ha
ound in cells, wi h GP ec ui ed o i ions h ough andom associa ions wi h Gag and
he i al RNA sca old (21, 23, 24). To be e unde s and how al e ing PRF equency
a ec s i ion in ec i i y, he e we s udied he assembly cha ac e is ics o mu an HIV-1
i uses enginee ed o ei he inc ease o abolish ameshi ing. Using hese i uses, we
demons a ed ha GP inco po a ion le els a e, in ac , go e ned by nons ochas ic
mechanisms, wi h GP being mode a ely en iched in i ions ela i e o cells and, mo e
s ikingly, much mo e e ficien ly inco po a ed in o i ions when cogene a ed wi h Gag
in cis (i.e., om he same gag-pol mRNA) han in ans (i.e., when Gag and GP o igina e
om sepa a e gag and GP mRNAs). Unexpec edly, we also disco e ed ha i ions
impose an ;2- old sa u a ion ceiling on GP inco po a ion when GP is deli e ed in
ans, a ea u e ha helps he i us o p ese e low-le el in ec i i y e en when cy o-
plasmic concen a ions o GP a e excep ionally high.
RESULTS
Inc easing PRF s em-loop s abili y enhances GP syn hesis and inco po a ion
in o i ions. Because ou p e ious wo k showed ha inc easing FS equency esul s
in significan dec eases o i ion in ec i i y (21), he ini ial goal o his s udy was o
mo e p ecisely define he le els o PRF and i ion GP inco po a ion ha would be
needed o ab oga e HIV-1 eplica ion in he con ex o an an i i al s a egy (Fig. 1 and
2). To his end, we ocused on a subse o FS mu an s a ei he end o he ameshi ing
spec um: M1, which we had p e iously shown o exhibi inc eased FS equency due
Benne e al. Jou nal o Vi ology
Janua y 2022 Volume 96 Issue 1 e01349-21 j i.asm.o g 2
Downloaded om h ps://jou nals.asm.o g/jou nal/j i on 13 No embe 2023 by 150.214.182.235.
o s onge local base-pai ing in e ac ions a he base o he PRF s em-loop, and 2SS, a
mu an ha encodes wo U- o-C mu a ions wi hin he slippe y sequence 59 o he PRF
s em-loop, he eby abolishing ameshi ing en i ely (Fig. 1A) (21).
To es ablish baseline le els o FS equency and GP inco po a ion in o i ions, g een
fluo escen p o ein (GFP) epo e i uses bea ing wild- ype (WT), M1, and 2SS ame-
shi si es we e ans ec ed in o HEK293T cells ea ed wi h he p o ease inhibi o
saquina i , and pelle ed i ions and lysa es we e ha es ed a 48 h pos ans ec ion.
Saquina i p e en s Gag and GP p o eoly ic clea age, allowing di ec measu emen s o
p ecu so le els using quan i a i e immunoblo ing (Fig. 1B). FS equency and GP
inco po a ion equency we e measu ed as GP/Gag a ios ela i e o WT i us o cells
(Fig. 1C, o ange ba s) o i ions (Fig. 1C, blue ba s), espec i ely. The WT FS equency
was 6.8% (61.7; n= 3) (Fig. 1C, o ange ba s), simila o p io s udies (4, 9, 20), while i-
ion GP inco po a ion equency was 22.5% (62.4; n= 3) (Fig. 1C, blue ba s), indica ing
ha GP/Gag a ios we e en iched 3.6- old in WT i ions ela i e o cells (Fig. 1C, WT;
compa e o ange and blue ba s). In compa ison, M1 exhibi ed a ma kedly highe FS
FIG 1 Inc easing PRF elemen s em-loop s abili y esul s in an inc ease in GP p oduc ion and en iched le els o
GP associa ed wi h i ions. (A) Rep esen a ion o he wild- ype (WT) HIV-1 gag-pol mRNA ameshi (FS) si e
seconda y s uc u e and ha o PRF mu an s –SS and M1. M1 was enginee ed o exhibi ele a ed s em-loop
s abili y, wi h DG
Local
being he p edic ed ee ene gy o he fi s 3 bp o he WT and M1 s em-loops. (B) WT,
M1, and 2SS Gag and GP exp ession and inco po a ion in o i us pa icles. HEK293T cells gene a ing WT o he
indica ed PRF elemen mu an i uses we e cul u ed in he p esence o he p o ease inhibi o saquina i
(10
m
M) o p e en Gag and GP p ocessing. Cell lysa es and i ions we e ha es ed a 48 h. Gag and GP we e
de ec ed by Wes e n blo ing using an i-p24
Gag
p ima y an ise um and in a ed-labeled seconda y an ibodies.
HSP90 was de ec ed as a loading con ol. (C) FS equency was defined as he a io o cell-associa ed GP o
Gag (o ange ba s). GP inco po a ion equency in o i ions was defined as he a io o i ion-associa ed GP o
Gag (blue ba s). Fold changes in GP/Gag a ios o he indica ed condi ions a e indica ed by black lines, wi h
compa isons de i ed om h ee independen ly pe o med biological eplica es. E o ba s ep esen he
s anda d de ia ions o he means. *,P,0.05, **,P,0.001, and ***,P,0.0001. P alues we e de i ed using
S uden ’s wo- ailed es o compa isons as indica ed in he figu e, excep o 2SS P alues, which we e
de i ed om compa isons o FS equency and GP inco po a ion le els o he WT alues.
HIV-1 Gag-Pol Inco po a ion Jou nal o Vi ology
Janua y 2022 Volume 96 Issue 1 e01349-21 j i.asm.o g 3
Downloaded om h ps://jou nals.asm.o g/jou nal/j i on 13 No embe 2023 by 150.214.182.235.
equency o 22% ela i e o WT (64.35, n= 3) (Fig. 1C, o ange ba s), which co e-
sponded o i ion GP inco po a ion le els o 34.5% (63.71; n= 3) (Fig. 1C, blue ba s).
Acco dingly, M1 i us exhibi ed a 3.2- old-g ea e ameshi equency han WT (Fig.
1C, compa e M1 and WT o ange ba s), al hough M1 i ions exhibi ed only a 1.6- old
en ichmen o GP inco po a ion equency (Fig. 1C, M1, compa e o ange and blue
ba s). As an icipa ed, he FS mu an 2SS p oduced GP-deficien i us pa icles (Fig. 1B
and C).
FIG 2 Vi us complemen a ion e eals a nonlinea ela ionship be ween GP exp ession and i al in ec i i y a subop imal le els o
GP. (A) In ec i i y o i ions p oduced by WT, M1, and 2SS epo e i uses. Vi al GFP exp ession was quan ified and no malized
o ha o WT i us (se o 100%). (B) Schema ic o i al 2-colo complemen a ion assay whe ein WT o PRF mu an GFP epo e
i uses we e coexp essed in cells gene a ing a Re
2
HIV-1 RFP epo e i us encoding a WT PRF elemen . “FSE” e e s o he RNA
ameshi egula o y elemen . (C) Summa y o in ec ious yields o PRF mu an i uses p oduced alone o cop oduced wi h WT
RFP epo e i us in HEK239T cells exp essed a a 1:1 a io. Pseudo yped i us pa icles we e assayed by in ec ing HEK293T cells
(an example is shown) p io o measu ing pe -well fluo escence in ensi y ela i e o he WT con ol. (D) Da a om panel C shown
in g aphical o ma . E o ba s ep esen s anda d de ia ions o he means de i ed om h ee independen biological eplica es.
(E) P edic ed cellula GP/Gag a ios plo ed agains cumula i e ela i e in ec i i y, wi h measu emen s de i ed om panels A and
D. The dashed g een line indica es ha a GP/Gag a io o 0.5 yields 90% o e all (GFP plus RFP) in ec i i y o he 2SS1WT
condi ion, close o ha o WT i us alone. In con as , he dashed ed line indica es a ha a GP/Gag a io o mo e han 2- old
yields less in ec i i y (52%) o he M11WT condi ion han WT. Compa isons we e de i ed om h ee independen ly pe o med
biological eplica es. *,P,0.05; **,P,0.001; ***,P,0.0001; n.s., nonsignifican ( o compa isons o M1 and 2SS o he
co esponding WT using S uden ’s wo- ailed es [A and D]).
Benne e al. Jou nal o Vi ology
Janua y 2022 Volume 96 Issue 1 e01349-21 j i.asm.o g 4
Downloaded om h ps://jou nals.asm.o g/jou nal/j i on 13 No embe 2023 by 150.214.182.235.
A“weigh ed Goldilocks”scena io: HIV-1 in ec i i y is mo e ole an o
subphysiological le els o GP han when GP is in excess. To be e define he ela-
ionship be ween cellula GP exp ession le els and i al in ec i i y, we gene a ed WT,
M1, and 2SS GFP epo e i uses pseudo yped using esicula s oma i is i us G p o-
ein (VSV-G) and used he supe na an s o in ec HEK293T a ge cells (Fig. 2A). Rela i e
o WT, we obse ed significan ly lowe in ec i i y (;5- old compa ed o WT) based on
epo e gene (GFP) exp ession o M1 (18% 60.88%; n= 3) (Fig. 2A), consis en wi h
ou p io s udy (21). We no e ha he M1 PRF mu a ions caused a small numbe o
amino acid changes in Gag and GP (see de ails in e e ence 21 and Ma e ials and
Me hods). Howe e , hese changes we e in egions o he p o eins (Gag p1 and GP
p6*) p e iously shown o accommoda e changes wi hou a ec ing Gag o GP assembly
unc ion (21, 25–27). As expec ed, 2SS i ions, which lacked GP due o he ameshi -
blocking 2SS mu a ion, we e no in ec ious (Fig. 2A).
We nex es ed he e ec s o modula ing cellula GP/Gag a ios by coexp essing
WT, M1, o 2SS GFP i us genomes a a 1:1 a io wi h WT PRF epo e i us exp essing
ed fluo escen p o ein (RFP) ins ead o GFP (Fig. 2; schema ic depic ion o i us con-
s uc s is in Fig. 2B). We hypo hesized ha WT RFP i us would imp o e he in ec i i y
o bo h M1 and 2SS GFP i uses by ei he educing (wi h M1) o inc easing (wi h 2SS)
he ela i e cell-associa ed GP/Gag a io. In his expe imen , he WT RFP i us was also
mu a ed o inac i a e he i al e gene, needed o ac i a e unspliced and pa ially
spliced i al RNA nuclea expo , so ha i would be exp essed only i coexp essed in
he same cell wi h a complemen ing GFP i us genome supplying Re in ans (28).
The VSV-G-pseudo yped i ions esul ing om hese co ans ec ions we e used o
in ec HEK293T cells, which we e fixed a 48 h pos in ec ion (hpi), and GFP, RFP, o
bo h combined we e measu ed o assess ela i e le els o in ec i i y (Fig. 2C and D).
As an icipa ed, coexp essing M1 GFP and WT RFP i us genomes (M11WT) yielded
highe cumula i e in ec i i y (51.7% 62.8%, n= 3) han M1 alone (Fig. 2B o D), which
was consis en wi h a cellula GP/Gag a io o ;2- old highe being needed o achie e
an ;50% d op o in ec i i y (Fig. 2E, ed dashed line). In e es ingly, when in ec i i y
yields om independen exp ession o he mu an M1 GFP and WT RFP i al genomes
we e compa ed o he coexp ession esul s, M1 (GFP) in ec i i y was only mode a ely
imp o ed by coexp essing he WT i al genome (;18% [Fig. 2A, M1] o 35.2% 6
9.86%; n= 3 [Fig. 2D, M1, g een ba ]), and WT (RFP) in ec i i y was only mode a ely
dec eased ( o 68.1% 614.32%; n= 3 [Fig. 2D, WT, middle ed ba ]). We in e p e ed his
esul as indica ing ha while excess GP gene a ed by M1 is dele e ious o bo h
i uses, i had a bigge ne nega i e e ec on M1 genomes po en ially due o i s ope -
a ing in cis (add essed u he in Fig. 3 and 4).
Also as expec ed, 1:1 coexp ession o 2SS GFP i us genomes wi h WT RFP i us
genomes imp o ed 2SS i us in ec i i y. Rema kably, howe e , his escue was nea ly
comple e (90.2% 61.33%; n= 3), despi e he p edic ed GP/Gag a io o only 50% ela-
i e o he WT-alone con ol (Fig. 2C and D). When coexp essed, bo h he 2SS (GFP)
and WT (RFP) genomes exhibi ed ela i ely high le els o in ec i i y (83.4% 620.4% o
2SS and 96.9% 618.1% o WT, espec i ely; n= 3) (Fig. 2C and D). This esul demon-
s a ed ha GP is e ficien ly ec ui ed o i ions packaging 2SS genomes in ans e en
when in acellula le els o GP a e ela i ely low.
Using hese da a, we plo ed p edic ed cellula GP/Gag a ios ela i e o cumula i e
in ec i i y om Fig. 2A and D in Fig. 2E, illus a ing a nonlinea “weigh ed Goldilocks”
scena io o cellula GP le els whe ein “ oo li le”GP (e.g., a p edic ed 50% le el o GP/
Gag in cells compa ed o WT GP/Gag le els se o 100%) (Fig. 2E, g een dashed lines) is
well ole a ed by he i us, while “ oo much”GP (e.g., an ;2- old GP/Gag inc ease; Fig.
2E, ed dashed lines) is mo e de imen al (2SS1WT compa ed o M11WT condi ions
[Fig. 2E]).
Subop imal e ec s o ans-deli e ed GP on in ec i i y sugges a cis p e e ence
o GP inco po a ion in o i ions. We nex sough o es ou “weigh ed Goldilocks”
model by mo e ca e ully con olling le els o GP exp essed in cells using a Gag-Pol-
only (GP
Only
) RFP epo e i us, whe ein we abolished ameshi ing by placing he pol
HIV-1 Gag-Pol Inco po a ion Jou nal o Vi ology
Janua y 2022 Volume 96 Issue 1 e01349-21 j i.asm.o g 5
Downloaded om h ps://jou nals.asm.o g/jou nal/j i on 13 No embe 2023 by 150.214.182.235.
FIG 3 Subop imal ac i i y o GP supplied in ans sugges s a cis p e e ence o GP inco po a ion in o i ions. (A) Schema ic o GP
Only
HIV-1 RFP epo e
i us and al e ed slippe y sequence ha places pol in he 0 eading ame. “FSRE” e e s o he RNA ameshi egula o y elemen . (B) Wes e n blo analysis
o Gag and GP exp ession confi med ha he GP
Only
RFP i us gene a ed GP and no Gag, and a highe le els han GP de i ed om WT ansc ip s. To al
Gag plus GP p o ein exp ession le els we e simila o WT and GP
Only
ansc ip s. No e ha GP exp ession alone did no p oduce i us pa icles. Hai lines
indica e si es whe e bands om a single immunoblo we e spliced oge he o imp o e da a p esen a ion, bu wi h no u he modifica ions. (C) E ec s o
GP on i al in ec i i y and Gag p ocessing when coexp essed wi h WT, 2SS, o M1 i uses. HEK293T cells we e ans ec ed wi h plasmids encoding WT,
–SS, o M1 GFP epo e i uses (1,500 ng inpu plasmid) in he p esence o absence o inc easing amoun s o GP
Only
RFP epo e i us plasmid (25, 50,
100, 150, 200, and 300 ng). Vi al in ec i i y was de e mined as o Fig. 2, wi h alues shown no malized o WT i us p oduc ion, o h ee independen ly
pe o med biological eplica es. Bo h GFP (g een) and RFP ( ed) ou pu is shown o each condi ion, wi h e o ba s ep esen ing he s anda d de ia ions o
he means o bo h GFP and RFP in ec i i y, no malized o WT. Cell lysa es and i ions we e also p obed o p24
Gag
by Wes e n blo ing as desc ibed o
(Con inued on nex page)
Benne e al. Jou nal o Vi ology
Janua y 2022 Volume 96 Issue 1 e01349-21 j i.asm.o g 6
Downloaded om h ps://jou nals.asm.o g/jou nal/j i on 13 No embe 2023 by 150.214.182.235.
coding egion di ec ly in o he 0 eading ame (Fig. 3A). As expec ed, he GP
Only
i us
yielded exclusi e p oduc ion o GP (Fig. 3B) and, in e es ingly, did no p oduce i us
pa icles when exp essed alone, po en ially eflec ing GP’s la ge size ela i e o Gag
and i s lacking he p6
Gag
la e domain necessa y o ec ui componen s o he cellula
endosomal so ing complex equi ed o anspo (ESCRT) machine y, which media es
i us pa icle elease (Fig. 3B) (29–32).
We coexp essed he GP
Only
i usa inc easingle elswi hWT,M1,and2SS GFP i uses,
wi h ela i e in ec i i y measu ed as desc ibed o Fig. 2 (Fig. 3C and D; Table 1). As
expec ed, inc easing le els o GP exp essed in ans esul ed in a dose-dependen dec ease
in WT GFP in ec i i y, and coexp ession wi h he GP
Only
i us ma kedly imp o ed he in ec-
i i y o 2SS GFP i us, which confi med GP unc ionali y (Fig. 3C).
Unexpec edly, exp essing inc easing amoun s o GP
Only
i us wi h M1 i us did no
lead o any u he dec ease in M1 in ec i i y; ha emained in he ange o 20 o 30%
o WT e en a wha we es ima ed would be ex ao dina ily high (.4- old ela i e o
WT [Table 1]) p edic ed cellula GP/Gag a ios (Fig. 3C and G). An i-p24
Gag
immunoblo
confi med ha hese e ec s we e no a ibu able o he GP
Only
i us a ec ing he e fi-
ciency o i us pa icle assembly, conside ing ha i ion-associa ed p24
Gag
le els we e
simila o M1 and WT i ions ac oss he ull ange o GP exp ession le els (Fig. 3C).
Fu he , i ion p24
Gag
le els co ela ed well only wi h in ec i i y o 2SS i us coex-
p essed wi h low le els o GP, as would be expec ed due o GP
Only
i us being able o
complemen he 2SS i us’s lack o p o ease ac i i y (Fig. 3C; co ela ion analysis is in
Fig. 3D). Acco dingly, we could explain his esul only by hypo hesizing ha HIV-1
FIG 3 Legend (Con inued)
Fig. 1B. Hai lines indica e si es whe e bands om a single immunoblo we e spliced oge he o imp o e da a p esen a ion, bu wi h no u he
modifica ions. (D) Vi ion p24
Gag
le els we e quan ified om he expe imen epo ed in panel C and plo ed agains he co esponding o al ela i e
in ec i i y measu emen s (GFP and RFP) o each coexp ession scena io. Pea son co ela ion coe ficien s we e de e mined o each condi ion. (E o G) Plo s
depic ing expec ed in ec i i y (dashed blue lines) based on expec ed pe - ansc ip GP/Gag a ios (de i ed as shown in Table 1) and he p edic i e model
in Fig. 2E, ela i e o ac ual obse ed in ec i i y (o ange lines; measu ed in panel C) o WT, 2SS, and M1 coexp ession wi h GP
Only
, espec i ely. E o ba s
ep esen he s anda d de ia ions o he means o he h ee biological eplica es.
FIG 4 P o ease inhibi o ea men confi ms cis p e e ence and e eals a s ong uppe limi o ans-media ed
deli e y o Gag-Pol in o i ions. (A) HEK293T cells cul u ed in he p esence o 10
m
M saquina i we e
ans ec ed o exp ess WT, M1, o 2SS i uses (1,500 ng plasmid) in he absence o p esence o inc easing
le els o GP
Only
i us (25, 100, o 500 ng plasmid). Cell lysa es and i ions we e ha es ed a 48 h and p obed
o Gag and GP le els by quan i a i e Wes e n blo ing as o Fig. 1B. All alues we e no malized o he WT-
only condi ion (black dashed line). The appa en limi o ans GP inco po a ion is indica ed by he ed dashed
line. Hai lines indica e si es whe e bands om a single immunoblo we e spliced oge he o imp o e da a
p esen a ion, bu wi h no u he modifica ions. (B) Ba g aph showing he old change in GP inco po a ion
e ficiencies calcula ed om GP band in ensi ies o i ions di ided by GP associa ed wi h cells, om h ee
independen biological eplica es, showing g ea e inco po a ion o GP when made in cis by WT and M1
i uses. E o ba s ep esen he s anda d de ia ions o he means. *,P,0.05; **,P,0.001; ***,P,0.0001
( o compa isons o WT using S uden ’s wo- ailed es ).
HIV-1 Gag-Pol Inco po a ion Jou nal o Vi ology
Janua y 2022 Volume 96 Issue 1 e01349-21 j i.asm.o g 7
Downloaded om h ps://jou nals.asm.o g/jou nal/j i on 13 No embe 2023 by 150.214.182.235.
i ion in ec i i y is pa ially bu e ed agains he e ec s o ans-deli e ed GP, pe haps
by limi ing GP inco po a ion le els in i ions. Consis en wi h his hypo hesis, GP
Only
coexp essed wi h WT o 2SS i us in ans also exhibi ed less- han-expec ed e ec s on
ei he loss (WT) o gain (2SS) o i ion in ec i i y based on p edic ed GP/Gag a ios
(Fig. 3C, E, and F; p edic ed a ios a e gi en in Table 1).
P o ease inhibi o ea men confi ms a cis p e e ence o GP inco po a ion
in o i ions and e eals an uppe limi o ans-deli e ed GP. To mo e di ec ly es
o a cis p e e ence, we measu ed he le els o cis- e sus ans-media ed GP inco po-
a ed in o i ions in he absence o p o eoly ic clea age, di ec ly quan i ying Gag and
GP p ecu so le els in cells and i ions unde saquina i ea men a e coexp essing
WT, M1, o 2SS wi h inc easing amoun s o GP
Only
i us (Fig. 4A).
Rema kably, GP/Gag a ios in i ions o any coexp ession condi ion ne e exceeded
an ;2- old i ion inco po a ion uppe limi , sugges ing a ceiling o GP inco po a ion
whe e only a limi ed amoun o ans-deli e ed GP can be inco po a ed in o assem-
bling i ions be o e sa u a ion (Fig. 4A, compa e lane 4 o lane 1), always lowe han
he cis-media ed le el o GP inco po a ion achie ed by M1 e en in he absence o any
coexp essed GP (Fig. 4A, compa e lane 5 o lane 4). Mo eo e , inc easing GP
Only
exp es-
sion had li le o no e ec on GP le els in M1 i ions (Fig. 4A, lanes 5 o 8), hus likely
explaining why M1 i uses did no lose in ec i i y when GP was o e exp essed (Fig. 3C
and G). In e es ingly, we no ed ha pa icula ly high le els o GP
Only
exp ession caused
some ans-media ed ep ession o Gag syn hesis in cells (e.g., in Fig. 4A, compa e
P 55
Gag
lane 4 o lane 1 o cell lysa es). Howe e , hese e ec s would no be an ici-
pa ed o accoun o any di e ences in GP/Gag a ios in i ions.
Tha HIV-1 exhibi s a ans GP inco po a ion ceiling was mos clea ly illus a ed when
inc easing le els o GP
Only
i us we e exp essed wi h 2SS i us, whe ein GP le els could
TABLE 1 Summa y o p edic ed and obse ed in ec i i y measu emen s o he GP i a ion
expe imen epo ed in Fig. 3
Plasmid(s) Am (ng)
Rela i e expec ed in-cell
GP/Gag a io
a
In ec i i y (% GFP)
P edic ed
b
Obse ed
c
WT 1,500 1.00 100 100.0
WT:GP
Only
1,500:25 1.22 92.5 94.6
1,500:50 1.44 83 85.5
1,500:100 1.86 63 75.4
1,500:150 2.25 47.7 67.9
1,500:200 2.62 35.5 63.4
1,500:300 3.29 16 43.2
2SS 1,500 0.00 0 3.1
2SS:GP
Only
1,500:25 0.24 46 10.2
1,500:50 0.47 87 28.9
1,500:100 0.92 101 56.4
1,500:150 1.34 87.5 77.2
1,500:200 1.74 69 80.8
1,500:300 2.48 39.5 88.3
M1 1,500 3.24 18 20.5
M1:GP
Only
1,500:25 3.42 12 29.5
1,500:50 3.60 7 28.1
1,500:100 3.95 0 33.2
1,500:150 4.28 0 31.5
1,500:200 4.59 0 24.3
1,500:300 5.15 0 20.7
a
Calcula ed based on he a ios o i al cons uc s exp essed and pe ansc ip ameshi equency a ios
measu ed om Fig. 1.
b
P edic ed om complemen a ion-based modeling in Fig. 2E, u ilizing calcula ed expec ed GP/Gag a ios. GFP
i uses (WT, 2SS, o M1) we e exp essed om plasmids co ans ec ed wi h inc easing amoun s o GP
Only
i us
and/o emp y ec o con ol plasmid o a o al DNA concen a ion o 1,800 ng.
c
Measu ed om Fig. 3C. All alues we e no malized o he WT-alone condi ion.
Benne e al. Jou nal o Vi ology
Janua y 2022 Volume 96 Issue 1 e01349-21 j i.asm.o g 8
Downloaded om h ps://jou nals.asm.o g/jou nal/j i on 13 No embe 2023 by 150.214.182.235.
ne e achie e hose obse ed o M1 i ions, e en when GP was exp essed in ma ked
excess (Fig. 4A; compa e lanes 10, 11, and 12 o lane 5; he ed do ed line indica es he
appa en ans uppe limi ). Compa ing i ion GP le els o in-cell GP le els unde cis e sus
ans condi ions u he suppo ed he no ion ha GP is much mo e e ficien ly inco po-
a ed in o i ions when exp essed in cis han in ans (Fig. 4B; in pa icula , compa e WT
and M1 wi hou GP
Only
condi ions o 2SS wi h GP
Only
coexp ession).
Taken oge he , his analysis ein o ced (i) ha e ficien GP en ichmen in o i ions
is highly a o ed unde cis condi ions ela i e o ans and (ii) ha HIV-1 is capable o
p e en ing he inco po a ion o ans-deli e ed GP o i ions should GP be exp essed
a ex ao dina ily high le els.
Excessi e cis-media ed GP inco po a ion in o i ions causes p ema u e Gag/GP
clea age and loss o Pol subuni s RT and IN om i ions. The obse a ion ha M1
i us main ained ;20% in ec i i y e en in he p esence o a ma ked excess o GP
p omp ed us o a emp o be e define he mechanis ic basis o he M1 in ec i i y
de ec in he fi s place. We had p e iously shown ha M1 and o he PRF mu an
i uses exhibi ing ele a ed FS equency cause changes o Gag clea age e ficiency
eflec ed in a dec ease in i ion-associa ed P 55/p24 a ios, consis en wi h excessi e
p o ease ac i i y (21). To e alua e he impac o excess GP on M1 i ion genesis o e
ime, we compa ed WT and M1 i us Gag/GP i ion p oduc ion o e 48 h using an i-
p24
Gag
immunoblo ing. We obse ed an ;2- old dec ease in M1 Gag P 55/p24 a ios
ela i e o WT in ha es ed i ions e en a he ea lies ime o i ion de ec ion (24 h
pos ans ec ion), consis en wi h he idea ha M1’s ela i ely high le els o GP cause
p ema u e Gag p o eoly ic p ocessing (Fig. 5A, compa e he quan ifica ion o P 55/p24
a 24 h [lanes 4 and 5] and 48 h [lanes 7 and 8] in he i ion blo ).
To subsequen ly e alua e he impac o p ema u e clea age on he s a us o c ucial
Pol p oduc s, we also p obed cells and i ions o de ec RT and IN a he 48-h ime
poin using an ise a specific o ei he p o ein, wi h i ions p epa ed in he p esence o
absence o saquina i (Fig. 5B and D). Rema kably, his expe imen e ealed ha de-
spi e ele a ed (;1.4- old) le els o GP polyp o ein inco po a ion (Fig. 5C and E, g ay
ba s), M1 i ions con ained smalle amoun s o RT and IN (;10% less) han WT i ions
when gene a ed in he p esence o an ac i e p o ease (Fig. 5B and D, compa e lanes 3
and 1; quan ified in Fig. 5C and E, blue and o ange ba s). This ne loss o GP p oduc s
(IN and RT) in M1 i ions (Fig. 5B o E) migh mos easily be explained by a d opou o
a subse o IN and RT p oduc s occu ing due o p ema u e o abe an GP clea age
e en s, occu ing ei he du ing o a e he p ocess o i ion assembly. Taken oge he ,
hese da a sugges ed ha Gag and GP clea age e en s esul ing om excess GP in M1
i us may accoun o a leas some o he loss o in ec i i y obse ed o he M1 mu-
an (Fig. 2A).
A GP inco po a ion ceiling may limi de ec s o e e se ansc ip ion. Conside ing
ha IN and RT we e los om M1 i ions and because high le els o GP we e p e iously
shown o a ec RNA dime s abili y (14), we subsequen ly measu ed le els o i al RNA
associa ed wi h M1 i ions as well as he capaci y o hese i ions o comple e e e se
ansc ip ion using quan i a i e eal- ime PCR (qRT-PCR) (Fig. 6). We obse ed no di e -
ences in he abundance o unspliced i al RNA in associa ion wi h M1 i ions compa ed
o WT, in he p esence o absence o saquina i , indica ing ha M1’s in ec i i y de ec s
a e unlikely o eflec a de ec in ne i al RNA genome packaging (Fig. 6A). In con as ,
assessmen o RT p oduc s in in ec ed a ge cells e ealed significan dec eases o he
le els o ea ly, la e, and wo-long- e minal- epea (2LTR) ci cle DNA RT p oduc s, indi-
ca ing ha M1 i ions a e highly de ec i e in he p ocess o e e se ansc ip ion (Fig.
6B). As expec ed, no RT p oduc s we e obse ed o FS mu an 2SS, which did no
exp ess GP. We we e su p ised, howe e , o de ec a mode a e bu ep oducible ;50%
dec ease in he e ficiency o i al RNA packaging by he 2SS i us (Fig. 6A, 2SS alone
[black and g ay ba s]).
We also sough o be e unde s and he loss o in ec i i y we had obse ed o WT
i us in he p esence o ele a ed le els o ans-deli e ed GP (Fig. 3), measu ing RNA
packaging and RT e ficiency o WT, M1, o 2SS i uses coexp essed wi h GP
Only
i us
HIV-1 Gag-Pol Inco po a ion Jou nal o Vi ology
Janua y 2022 Volume 96 Issue 1 e01349-21 j i.asm.o g 9
Downloaded om h ps://jou nals.asm.o g/jou nal/j i on 13 No embe 2023 by 150.214.182.235.
ansc ip s p oduced om ans ec ions wi h a WT HIV-1 genome. Fo compa isons wi h h ee o mo e
g oups, a one-way analysis o a iance (ANOVA) was pe o med using Mic oso Excel. I his de e mined
ha a s a is ically significan di e ence exis ed wi hin he g oup (P,0.05), a u he pos hoc es was
done using Tukey’s hones ly significan di e ence es (HSD) in Excel (66, 67). I only wo g oups we e
compa ed, S uden ’s es in Excel was used. ANOVA esul s and ele an Tukey’s HSD and es com-
pa isons a e shown in he figu es, unless Pwas .0.05 o he ANOVA, in which case only he ANOVA
esul s a e shown.
Analysis o e e se ansc ip ion p oduc s. Cells (1 10
6
) we e in ec ed wi h VSV-G pseudo yped
VLPs. A 24 h pos in ec ion, o al DNA was ha es ed using he DNeasy ki om Qiagen. Quan i a i e
eal- ime PCR was pe o med using he SsoFas p obe ki (Bio-Rad). Fo ea ly RT p oduc s, we used p i-
me s as p e iously desc ibed (68): e 2 (GTGCCCGTCTGTTGTGTGAC), e 2 (GGCGCCACTGCTAGAG
ATTT), and e 2 p obe (CTAGAGATCCCTCAGACCCTTTTAGTCAGTGTGG). Fo la e RT and 2LTR, we used
p ime s ha we e desc ibed p e iously (69) bu modified as necessa y o analyzing he NL4-3 s ain as
ollows: HIV-1 la e o wa d MH531 (TGTGTGCCCGTCTGTTGTGT), e MH532 (GAGTCCTGCGTCGAG
AGATC), la e RT p obe (CAGTGGCGCCCGAACAGGGA), HIV-1 2LTR Fwd p ime (AACTAGGGAACCCA
CTGCTTAAG), HIV-1 2LTR Re p ime (TCCACAGATCAAGGATATCTTGTC), and HIV-1 2LTR p obe (ACAC
TACTTTGAGCACTCAAGGCAAGCTTT). A s anda d cu e was de i ed using a gene block (In eg a ed DNA
Technologies) con aining he amplicon o de e mine he absolu e numbe o molecules p esen , and
o al e e se ansc ip ion p oduc s in each sample we e calcula ed and compa ed o in ec ion wi h WT
HIV-1 genomes. p24
Gag
Wes e n blo s we e used o ensu e in ec ion wi h equi alen numbe s o i ions.
S a is ical analyses we e pe o med as desc ibed abo e o analysis o i al RNA packaging.
ACKNOWLEDGMENTS
The ollowing eagen s we e ob ained h ough he NIH AIDS Reagen P og am,
Di ision o AIDS, NIAID, NIH: HIV-1 p24 hyb idoma (183-H12-5C) om B uce Cheseb o
(62), HIV-1 IN monoclonal an ibody (2C11) om Dag E. Helland (ca alog no. 7374) (63),
and saquina i .
This esea ch was suppo ed by NIH g an s R01AI110221 (N.M.S.), P01CA022332
(N.M.S., P.A.), R35GM118131 (S.E.B.), and T32GM008349 (B.E.B.); NSF g adua e esea ch
ellowships DGE1747503 (B.E.B.) and DGE-1256269 (J.T.B.); a Shaw Scien is Awa d om
he G ea e Milwaukee Founda ion (N.M.S.); and s uden ellowships om he Uni e si y
o Wisconsin-Madison (J.R.K.) and Wisconsin Alumni Resea ch Founda ion (J.T.B.).
REFERENCES
1. Wa s JM, Dang KK, Go elick RJ, Leona d CW, Bess JW, J , Swans om R,
Bu ch CL, Weeks KM. 2009. A chi ec u e and seconda y s uc u e o an
en i e HIV-1 RNA genome. Na u e 460:711–716. h ps://doi.o g/10.1038/
na u e08237.
2. D'Souza V, Summe s MF. 2005. How e o i uses selec hei genomes.
Na Re Mic obiol 3:643–655. h ps://doi.o g/10.1038/n mic o1210.
3. Kuzembaye a M, Dilley K, Sa do L, Hu WS. 2014. Li e o psi: how ull-
leng h HIV-1 RNAs become packaged genomes in he i al pa icles. Vi ol-
ogy 454-455:362–370. h ps://doi.o g/10.1016/j. i ol.2014.01.019.
4. Jacks T, Powe MD, Masia z FR, Luciw PA, Ba PJ, Va mus HE. 1988. Cha -
ac e iza ion o ibosomal ameshi ing in HIV-1 gag-pol exp ession. Na-
u e 331:280–283. h ps://doi.o g/10.1038/331280a0.
5. Pa kin NT, Chamo o M, Va mus HE. 1992. Human immunodeficiency i-
us ype 1 gag-pol ameshi ing is dependen on downs eam mRNA sec-
onda y s uc u e: demons a ion by exp ession in i o. J Vi ol 66:
5147–5151. h ps://doi.o g/10.1128/JVI.66.8.5147-5151.1992.
6. Ba il M, Dulude D, Gend on K, Lemay G, B akie -Ging as L. 2003. E ficiency
o a p og ammed -1 ibosomal ameshi in he di e en sub ypes o he
human immunodeficiency i us ype 1 g oup M. RNA 9:1246–1253.
h ps://doi.o g/10.1261/ na.5113603.
7. S aple DW, Bu che SE. 2003. Solu ion s uc u e o he HIV-1 ameshi
inducing s em-loop RNA. Nucleic Acids Res 31:4326–4331. h ps://doi
.o g/10.1093/na /gkg654.
8. S aple DW, Bu che SE. 2005. Solu ion s uc u e and he modynamic
in es iga ion o he HIV-1 ameshi inducing elemen . J Mol Biol 349:
1011–1023. h ps://doi.o g/10.1016/j.jmb.2005.03.038.
9. B ie ley I, Dos Ramos FJ. 2006. P og ammed ibosomal ameshi ing in
HIV-1 and he SARS-CoV. Vi us Res 119:29–42. h ps://doi.o g/10.1016/j
. i us es.2005.10.008.
10. B akie -Ging as L, Cha bonneau J, Bu che SE. 2012. Ta ge ing ameshi -
ing in he human immunodeficiency i us. Expe Opin The Ta ge s 16:
249–258. h ps://doi.o g/10.1517/14728222.2012.665879.
11. F eed EO. 2015. HIV-1 assembly, elease and ma u a ion. Na Re Mic o-
biol 13:484–496. h ps://doi.o g/10.1038/n mic o3490.
12. Sundquis WI, K ausslich HG. 2012. HIV-1 assembly, budding, and ma u a-
ion. Cold Sp ing Ha b Pe spec Med 2:a006924. h ps://doi.o g/10.1101/
cshpe spec .a006924.
13. F ankel AD, Young JA. 1998. HIV-1: fi een p o eins and an RNA. Annu Re
Biochem 67:1–25. h ps://doi.o g/10.1146/annu e .biochem.67.1.1.
14. Shehu-Xhilaga M, C owe SM, Mak J. 2001. Main enance o he Gag/Gag-
Pol a io is impo an o human immunodeficiency i us ype 1 RNA
dime iza ion and i al in ec i i y. J Vi ol 75:1834–1841. h ps://doi.o g/10
.1128/JVI.75.4.1834-1841.2001.
15. Gan X, Gould SJ. 2012. HIV Pol inhibi s HIV budding and media es he
se e e budding de ec o Gag-Pol. PLoS One 7:e29421. h ps://doi.o g/10
.1371/jou nal.pone.0029421.
16. Ha aguchi H, Sudo S, Noda T, Momose F, Kawaoka Y, Mo ikawa Y. 2010.
In acellula localiza ion o human immunodeficiency i us ype 1 Gag
and GagPol p oduc s and i us pa icle elease: ela ionship wi h he
Gag- o-GagPol a io. Mic obiol Immunol 54:734–746. h ps://doi.o g/10
.1111/j.1348-0421.2010.00276.x.
17. Yu FH, Huang KJ, Wang CT. 2020. HIV-1 mu an assembly, p ocessing and
in ec i i y exp esses Pol independen o Gag. Vi uses 12:54. h ps://doi
.o g/10.3390/ 12010054.
18. Hill M, Tachedjian G, Mak J. 2005. The packaging and ma u a ion o he
HIV-1 Pol p o eins. Cu HIV Res 3:73–85. h ps://doi.o g/10.2174/1570
162052772942.
19. Mouzakis KD, Lang AL, Vande Meulen KA, Eas e day PD, Bu che SE.
2013. HIV-1 ameshi e ficiency is p ima ily de e mined by he s abili y
o base pai s posi ioned a he mRNA en ance channel o he ibosome.
Nucleic Acids Res 41:1901–1913. h ps://doi.o g/10.1093/na /gks1254.
20. Ko niy N, Goyal A, Ho mann M, Sama o a E, Peske F, Pohlmann S,
Rodnina MV. 2019. Modula ion o HIV-1 Gag/Gag-Pol ameshi ing by
RNA abundance. Nucleic Acids Res 47:5210–5222. h ps://doi.o g/10
.1093/na /gkz202.
Benne e al. Jou nal o Vi ology
Janua y 2022 Volume 96 Issue 1 e01349-21 j i.asm.o g 16
Downloaded om h ps://jou nals.asm.o g/jou nal/j i on 13 No embe 2023 by 150.214.182.235.
21. Ga cia-Mi anda P, Becke JT, Benne BE, Blume A, She e NM, Bu che SE.
2016. S abili y o HIV ameshi si e RNA co ela es wi h ameshi e fi-
ciency and dec eased i us in ec i i y. J Vi ol 90:6906–6917. h ps://doi
.o g/10.1128/JVI.00149-16.
22. Hilimi e TA, Benne RP, S ewa RA, Ga cia-Mi anda P, Blume A, Becke J,
She e N, Helms ED, Bu che SE, Smi h HC, Mille BL. 2016. N-Me hyla ion
as a s a egy o enhancing he a fini y and selec i i y o RNA-binding
pep ides: applica ion o he HIV-1 ameshi -s imula ing RNA. ACS Chem
Biol 11:88–94. h ps://doi.o g/10.1021/acschembio.5b00682.
23. Kho chid A, Halwani R, Wainbe g MA, Kleiman L. 2002. Role o RNA in
acili a ing Gag/Gag-Pol in e ac ion. J Vi ol 76:4131–4137. h ps://doi.o g/
10.1128/j i.76.8.4131-4137.2002.
24. Huang Y, Kho chid A, Wang J, Pa niak MA, Da lix JL, Wainbe g MA,
Kleiman L. 1997. E ec o mu a ions in he nucleocapsid p o ein (NCp7)
upon P 160(gag-pol) and RNA(Lys) inco po a ion in o human immuno-
deficiency i us ype 1. J Vi ol 71:4378–4384. h ps://doi.o g/10.1128/JVI
.71.6.4378-4384.1997.
25. Hill MK, Shehu-Xhilaga M, C owe SM, Mak J. 2002. P oline esidues wi hin
space pep ide p1 a e impo an o human immunodeficiency i us ype
1 in ec i i y, p o ein p ocessing, and genomic RNA dime s abili y. J Vi ol
76:11245–11253. h ps://doi.o g/10.1128/j i.76.22.11245-11253.2002.
26. de Ma co A, Heuse AM, Glass B, K ausslich HG, Mulle B, B iggs JA. 2012.
Role o he SP2 domain and i s p o eoly ic clea age in HIV-1 s uc u al
ma u a ion and in ec i i y. J Vi ol 86:13708–13716. h ps://doi.o g/10
.1128/JVI.01704-12.
27. Leihe e A, Ludwig C, Wagne R. 2009. Uncoupling human immunodefi-
ciency i us ype 1 Gag and Pol eading ames: ole o he ans ame
p o ein p6*in i al eplica ion. J Vi ol 83:7210–7220. h ps://doi.o g/10
.1128/JVI.02603-08.
28. Hende son BR, Pe cipalle P. 1997. In e ac ions be ween HIV Re and nu-
clea impo and expo ac o s: he Re nuclea localisa ion signal medi-
a es specific binding o human impo in-be a. J Mol Biol 274:693–707.
h ps://doi.o g/10.1006/jmbi.1997.1420.
29. Me gene K, Facke M, Welke R, B inkmann V, Gelde blom HR, K ausslich
HG. 1992. Analysis o HIV pa icle o ma ion using ansien exp ession o
sub i al cons uc s in mammalian cells. Vi ology 186:25–39. h ps://doi
.o g/10.1016/0042-6822(92)90058-w.
30. Ga us JE, on Schwedle UK, Po nillos OW, Mo ham SG, Za i z KH, Wang HE,
We s ein DA, S ay KM, Co e M, Rich RL, Myszka DG, Sundquis WI. 2001.
Tsg101 and he acuola p o ein so ing pa hway a e essen ial o HIV-1 bud-
ding. Cell 107:55–65. h ps://doi.o g/10.1016/s0092-8674(01)00506-2.
31. Demi o DG, Ono A, O ens ein JM, F eed EO. 2002. O e exp ession o he
N- e minal domain o TSG101 inhibi s HIV-1 budding by blocking la e do-
main unc ion. P oc Na l Acad Sci U S A 99:955–960. h ps://doi.o g/10
.1073/pnas.032511899.
32. Demi o DG, O ens ein JM, F eed EO. 2002. The la e domain o human immu-
nodeficiency i us ype 1 p6 p omo es i us elease in a cell ype-dependen
manne . J Vi ol 76:105–117. h ps://doi.o g/10.1128/j i.76.1.105-117.2002.
33. Hill MK, Hooke CW, Ha ich D, C owe SM, Mak J. 2001. Gag-Pol supplied
in ans is e ficien ly packaged and suppo s i al unc ion in human im-
munodeficiency i us ype 1. J Vi ol 75:6835–6840. h ps://doi.o g/10
.1128/JVI.75.15.6835-6840.2001.
34. Shehu-Xhilaga M, Lee JY, Campbell S, Ma shall JA, C owe SM, Mak J. 2002.
O e exp ession and inco po a ion o GagPol p ecu so does no impede
packaging o HIV-1 RNA(Lys3) bu p omo es in acellula budding o i us-
like pa icles. J Biomed Sci 9:697–705. h ps://doi.o g/10.1007/BF02254998.
35. Smi h AJ, S ini asakuma N, Hamma skjold ML, Rekosh D. 1993. Requi e-
men s o inco po a ion o P 160gag-pol om human immunodeficiency
i us ype 1 in o i us-like pa icles. J Vi ol 67:2266–2275. h ps://doi.o g/
10.1128/JVI.67.4.2266-2275.1993.
36. Huang M, Ma in MA. 1997. Inco po a ion o P 160(gag-pol) in o i us
pa icles equi es he p esence o bo h he majo homology egion and
adjacen C- e minal capsid sequences wi hin he Gag-Pol polyp o ein. J
Vi ol 71:4472–4478. h ps://doi.o g/10.1128/JVI.71.6.4472-4478.1997.
37. Wills JW, C a en RC. 1991. Fo m, unc ion, and use o e o i al gag p o eins.
AIDS 5:639–654. h ps://doi.o g/10.1097/00002030-199106000-00002.
38. Takagi S, Momose F, Mo ikawa Y. 2017. FRET analysis o HIV-1 Gag and Gag-
Pol in e ac ions. FEBS Open Bio 7:1815–1825. h ps://doi.o g/10.1002/2211
-5463.12328.
39. Ku luay SB, Bieniasz PD. 2010. Analysis o he ini ia ing e en s in HIV-1
pa icle assembly and genome packaging. PLoS Pa hog 6:e1001200.
h ps://doi.o g/10.1371/jou nal.ppa .1001200.
40. Hend ix J, Baumga el V, Sch imp W, I anchenko S, Digman MA, G a on
E, K ausslich HG, Mulle B, Lamb DC. 2015. Li e-cell obse a ion o
cy osolic HIV-1 assembly onse e eals RNA-in e ac ing Gag oligome s. J
Cell Biol 210:629–646. h ps://doi.o g/10.1083/jcb.201504006.
41. Ba ajas BC, Tanaka M, Robinson BA, Phuong DJ, Chu i aka K, Reed JC,
Lingappa JR. 2018. Iden i ying he assembly in e media e in which Gag
fi s associa es wi h unspliced HIV-1 RNA sugges s a no el model o HIV-
1 RNA packaging. PLoS Pa hog 14:e1006977. h ps://doi.o g/10.1371/
jou nal.ppa .1006977.
42. Reed JC, Mol e B, Gea y CD, McNe in J, McEl a h J, Gi i S, Klein KC,
Lingappa JR. 2012. HIV-1 Gag co-op s a cellula complex con aining
DDX6, a helicase ha acili a es capsid assembly. J Cell Biol 198:439–456.
h ps://doi.o g/10.1083/jcb.201111012.
43. Lingappa JR, Reed JC, Tanaka M, Chu i aka K, Robinson BA. 2014. How
HIV-1 Gag assembles in cells: pu ing oge he pieces o he puzzle. Vi us
Res 193:89–107. h ps://doi.o g/10.1016/j. i us es.2014.07.001.
44. Doohe JE, Schneide BL, Reed JC, Lingappa JR. 2007. Hos ABCE1 is a
plasma memb ane HIV assembly si es and i s dissocia ion om Gag is
linked o subsequen e en s o i us p oduc ion. T a fic 8:195–211.
h ps://doi.o g/10.1111/j.1600-0854.2006.00524.x.
45. Deng Y, Hammond JA, Pauszek R, Ozog S, Chai I, Rabuck-Gibbons J,
Lamichhane R, Hende son SC, Milla DP, To be BE, Williamson JR. 2021.
Disc imina ion be ween unc ional and non- unc ional cellula Gag com-
plexes in ol ed in HIV-1 assembly. J Mol Biol 433:166842. h ps://doi.o g/
10.1016/j.jmb.2021.166842.
46. Lyon K, Aguile a LU, Mo isaki T, Munsky B, S ase ich TJ. 2019. Li e-cell sin-
gle RNA imaging e eals bu s s o ansla ional ameshi ing. Mol Cell 75:
172–183.E9. h ps://doi.o g/10.1016/j.molcel.2019.05.002.
47. Chen J, Liu Y, Wu B, Nikolai chik OA, Mohan PR, Chen J, Pa hak VK, Hu WS.
2020. Visualizing he ansla ion and packaging o HIV-1 ull-leng h RNA.
P oc Na l Acad Sci U S A 117:6145–6155. h ps://doi.o g/10.1073/pnas
.1917590117.
48. Pocock GM, Zimda s LL, Yuan M, Elicei i KW, Ahlquis P, She e NM. 2017.
Di e se ac i i ies o i al cis-ac ing RNA egula o y elemen s e ealed
using mul icolo , long- e m, single-cell imaging. Mol Biol Cell 28:476–487.
h ps://doi.o g/10.1091/mbc.E16-08-0612.
49. Pocock GM, Becke JT, Swanson CM, Ahlquis P, She e NM. 2016. HIV-1
and M-PMV RNA nuclea expo elemen s p og am i al genomes o dis-
inc cy oplasmic a ficking beha io s. PLoS Pa hog 12:e1005565.
h ps://doi.o g/10.1371/jou nal.ppa .1005565.
50. Beh ens RT, Alige i M, Pocock GM, Higgins CA, She e NM. 2017. Nuclea
expo signal masking egula es HIV-1 Re a ficking and i al RNA nu-
clea expo . J Vi ol 91:e02107-16. h ps://doi.o g/10.1128/JVI.02107-16.
51. Jou ene N, Simon SM, Bieniasz PD. 2009. Imaging he in e ac ion o HIV-
1 genomes and Gag du ing assembly o indi idual i al pa icles. P oc
Na l Acad Sci U S A 106:19114–19119. h ps://doi.o g/10.1073/pnas
.0907364106.
52. Becke JT, She e NM. 2017. Subcellula localiza ion o HIV-1 gag-pol
mRNAs egula es si es o i ion assembly. J Vi ol 91:e02315-16. h ps://doi
.o g/10.1128/JVI.02315-16.
53. Ha aguchi H, Noda T, Kawaoka Y, Mo ikawa Y. 2012. A la ge ex ension o
HIV-1 Gag, like Pol, has nega i e impac s on i ion assembly. PLoS One 7:
e47828. h ps://doi.o g/10.1371/jou nal.pone.0047828.
54. Ka acos as V, Wol e EJ, Nagashima K, Gonda MA, Moss B. 1993. O e exp es-
sion o he HIV-1 gag-pol polyp o ein esul s in in acellula ac i a ion o HIV-
1 p o ease and inhibi ion o assembly and budding o i us-like pa icles. Vi-
ology 193:661–671. h ps://doi.o g/10.1006/ i o.1993.1174.
55. Pa k J, Mo ow CD. 1992. The nonmy is yla ed P 160gag-pol polyp o ein
o human immunodeficiency i us ype 1 in e ac s wi h P 55gag and is
inco po a ed in o i uslike pa icles. J Vi ol 66:6304–6313. h ps://doi.o g/
10.1128/JVI.66.11.6304-6313.1992.
56. Yu FH, Chou TA, Liao WH, Huang KJ, Wang CT. 2015. Gag-Pol ans ame
domain p6*is essen ial o HIV-1 p o ease-media ed i us ma u a ion.
PLoS One 10:e0127974. h ps://doi.o g/10.1371/jou nal.pone.0127974.
57. K ausslich HG. 1991. Human immunodeficiency i us p o einase dime as
componen o he i al polyp o ein p e en s pa icle assembly and i al
in ec i i y. P oc Na l Acad Sci U S A 88:3213–3217. h ps://doi.o g/10
.1073/pnas.88.8.3213.
58. Bendjenna M, Sa a ian S. 2016. The ace agains p o ease ac i a ion
defines he ole o ESCRTs in HIV budding. PLoS Pa hog 12:e1005657.
h ps://doi.o g/10.1371/jou nal.ppa .1005657.
59. Adachi A, Gendelman HE, Koenig S, Folks T, Willey R, Rabson A, Ma in
MA. 1986. P oduc ion o acqui ed immunodeficiency synd ome-associ-
a ed e o i us in human and nonhuman cells ans ec ed wi h an in ec-
ious molecula clone. J Vi ol 59:284–291. h ps://doi.o g/10.1128/JVI.59.2
.284-291.1986.
HIV-1 Gag-Pol Inco po a ion Jou nal o Vi ology
Janua y 2022 Volume 96 Issue 1 e01349-21 j i.asm.o g 17
Downloaded om h ps://jou nals.asm.o g/jou nal/j i on 13 No embe 2023 by 150.214.182.235.
60. Alige i M, Beh ens RT, Pocock GM, Schindelin J, Die z C, Elicei i KW,
Swanson CM, Malim MH, Ahlquis P, She e NM. 2014. Coope a i i y among
Re -associa ed nuclea expo signals egula es HIV-1 gene exp ession and
is a de e minan o i us species opism. J Vi ol 88:14207–14221. h ps://doi
.o g/10.1128/JVI.01897-14.
61. Vella S, Flo idia M. 1998. Saquina i . Clinical pha macology and e ficacy. Clin
Pha macokine 34:189–201. h ps://doi.o g/10.2165/00003088-199834030
-00002.
62. Cheseb o B, Weh ly K, Nishio J, Pe yman S. 1992. Mac ophage- opic
human immunodeficiency i us isola es om di e en pa ien s exhibi
unusual V3 en elope sequence homogenei y in compa ison wi h T-
cell- opic isola es: defini ion o c i ical amino acids in ol ed in cell
opism. J Vi ol 66:6547–6554. h ps://doi.o g/10.1128/JVI.66.11.6547
-6554.1992.
63.NilsenBM,HauganIR,Be gK,OlsenL,B ownPO,HellandDE.1996.
Monoclonal an ibodies agains human immunodeficiency i us ype 1
in eg ase: epi ope mapping and di e en ial e ec s on in eg ase ac i -
i ies in i o. J Vi ol 70:1580–1587. h ps://doi.o g/10.1128/JVI.70.3
.1580-1587.1996.
64. Schindelin J, A ganda-Ca e as I, F ise E, Kaynig V, Longai M, Pie zsch T,
P eibisch S, Rueden C, Saal eld S, Schmid B, Tine ez JY, Whi e DJ,
Ha ens ein V, Elicei i K, Tomancak P, Ca dona A. 2012. Fiji: an open-
sou ce pla o m o biological-image analysis. Na Me hods 9:676–682.
h ps://doi.o g/10.1038/nme h.2019.
65. Shan L, Rabi SA, Lai d GM, Eisele EE, Zhang H, Ma golick JB, Siliciano RF.
2013. A no el PCR assay o quan ifica ion o HIV-1 RNA. J Vi ol 87:
6521–6525. h ps://doi.o g/10.1128/JVI.00006-13.
66. Yandell BS. 1997. P ac ical da a analysis o designed expe imen s. Chap-
man & Hall, London, Uni ed Kingdom.
67. B uce JW, B acken M, E ans E, She e N, Ahlquis P. 2021. ZBTB2 ep esses HIV-1
ansc ip ion and is egula ed by HIV-1 Vp and cellula DNA damage esponses.
PLoS Pa hog 17:e1009364. h ps://doi.o g/10.1371/jou nal.ppa .1009364.
68. Munk C, B and SM, Luce o G, Landau NR. 2002. A dominan block o HIV-
1 eplica ion a e e se ansc ip ion in simian cells. P oc Na l Acad Sci
U S A 99:13843–13848. h ps://doi.o g/10.1073/pnas.212400099.
69. Bu le SL, Hansen MS, Bushman FD. 2001. A quan i a i e assay o HIV DNA
in eg a ion in i o. Na Med 7:631–634. h ps://doi.o g/10.1038/87979.
Benne e al. Jou nal o Vi ology
Janua y 2022 Volume 96 Issue 1 e01349-21 j i.asm.o g 18
Downloaded om h ps://jou nals.asm.o g/jou nal/j i on 13 No embe 2023 by 150.214.182.235.