Perturbing HIV-1 Ribosomal Frameshifting Frequency Reveals a cis Preference for Gag-Pol Incorporation into Assembling Virions

Pe u bing HIV-1 Ribosomal F ameshi ing F equency Re eals a cis P e e ence o Gag-Pol Inco po a ion in o Assembling Vi ions Bayleigh E. Benne , a , b James W. B uce, a , c Jacob R. Ken ala, a Magdalena Mu ay, a Jo dan T. Becke , a Pablo Ga cia-Mi anda, a , d Paul Ahlquis , a , c Samuel E. Bu che , d Na han M. She e a a Depa men o Oncology (McA dle Labo a o y o Cance Resea ch), Ins i u e o Molecula Vi ology, and Ca bone Cance Cen e , Uni e si y o Wisconsin—Madison, Madison, Wisconsin, USA b UW—Madison Mic obiology Doc o al T aining P og am, Madison, Wisconsin, USA c John and Jeanne Rowe Cen e o Resea ch in Vi ology, Mo g idge Ins i u e o Resea ch, Madison, Wisconsin, USA d Depa men o Biochemis y, Uni e si y o Wisconsin—Madison, Madison, Wisconsin, USA ABSTRACT HIV-1 i ion p oduc ion is d i en by Gag and Gag-Pol (GP) p o eins, wi h Gag o ming he bulk o he capsid and d i ing budding, while GP binds Gag o deli e he essen ial i ion enzymes p o ease, e e se ansc ip ase, and in eg ase. Vi ion GP le - els a e adi ionally hough o eflec he ela i e abundances o GP and Gag in cells (;1:20), dic a ed by he equency o a 21 p og ammed ibosomal ameshi ing (PRF) e en occu ing in gag-pol mRNAs. He e, we exploi ed a panel o PRF mu an i uses o show ha mechanisms in addi ion o PRF egula e GP inco po a ion in o i ions. Fi s , we show ha GP is en iched ;3- old in i ions ela i e o cells, wi h i al in ec i i y being be e main ained a subphysiological le els o GP han when GP le els a e oo high. Second, we epo ha GP is mo e e ficien ly inco po a ed in o i ions when Gag and GP a e syn hesized in cis (i.e., om he same gag-pol mRNA) han in ans,sugges - ing ha Gag/GP ansla ion and assembly a e spa ially coupled p ocesses. Thi d, we show ha , su p isingly, i ions exhibi a s ong uppe limi o ans-deli e ed GP inco po- a ion; an adap a ion ha appea s o allow he i us o empe de ec s o GP/Gag clea - age ha may nega i ely impac e e se ansc ip ion. Taking hese esul s oge he , we p opose a “weigh ed Goldilocks”scena io o HIV-1 GP inco po a ion, whe ein combined mechanisms o GP en ichmen and exclusion bu e i ion in ec i i y o e a b oad ange o local GP concen a ions. These esul s p o ide new insigh s in o he HIV-1 i ion as- sembly pa hway ele an o he an icipa ed e ficacy o PRF- a ge ed an i i al s a egies. IMPORTANCE HIV-1 in ec i i y equi es inco po a ion o he Gag-Pol (GP) p ecu so poly- p o ein in o i ions du ing he p ocess o i us pa icle assembly. Mechanisms dic a ing GP inco po a ion in o assembling i ions a e poo ly defined, wi h GP le els in i ions a- di ionally hough o solely eflec ela i e le els o Gag and GP exp essed in cells, dic- a ed by he equency o a 21 p og ammed ibosomal ameshi ing (PRF) e en ha occu s in gag-pol mRNAs. He ein, we p o ide expe imen al suppo o a “weigh ed Goldilocks”scena io o GP inco po a ion, whe ein he i us exploi s bo h andom and non andom mechanisms o bu e in ec i i y o e a wide ange o GP exp ession le els. These mechanis ic da a a e ele an o ongoing e o s o de elop an i i al s a egies a - ge ing PRF equency and/o HIV-1 i ion ma u a ion. KEYWORDS Gag, Gag-Pol, HIV, PRF, cis-ac ing RNA elemen , p o ease, e e se ansc ip ion, ibosomal ameshi , i ion, i us assembly Re o i uses encode cis-ac ing RNA s uc u al elemen s ha egula e key s ages o i al eplica ion, including bu no limi ed o ansc ip ion, splicing, RNA nuclea expo , ansla ion, RNA genome dime iza ion, and genome packaging (1–3). A well- s udied example is he human immunodeficiency i us ype 1 (HIV-1) p og ammed Edi o Vi iana Simon, Icahn School o Medicine a Moun Sinai Copy igh © 2022 Ame ican Socie y o Mic obiology. All Righ s Rese ed. Add ess co espondence o Na han M. She e , [email p o ec ed]. Recei ed 11 Augus 2021 Accep ed 30 Sep embe 2021 Accep ed manusc ip pos ed online 13 Oc obe 2021 Published Janua y 2022 Volume 96 Issue 1 e01349-21 Jou nal o Vi ology j i.asm.o g 1 VIRUS-CELL INTERACTIONS 12 Janua y 2022 Downloaded om h ps://jou nals.asm.o g/jou nal/j i on 13 No embe 2023 by 150.214.182.235. ibosomal ameshi (PRF) egula o y elemen ha con ols he syn hesis o Gag and Gag-Pol (GP) i ion p o eins om a single i al unspliced gag-pol mRNA (4–10). Gag o ms he la ges pe cen age o he HIV-1 i ion and is exp essed as an ;55-kDa p e- cu so polyp o ein (P 55) clea ed in o he subuni s ma ix (MA; p17), capsid (CA; p24), nucleocapsid (NC; p7), and la e domain (p6) and wo space pep ides (SP1 and SP2) (11, 12). GP is la ge (P 160) and consis s o iden ical MA, CA, SP1, and NC subuni domains used o a linke p o ein (p6*) ups eam o subuni s encoding he i al enzymes p o ease (PR), e e se ansc ip ase (RT), and in eg ase (IN) (13). Gag exp es- sion is su ficien o gene a e i us-like pa icles e en in he absence o all o he i al p o eins. Howe e , GP inco po a ion in o i ions is essen ial o i ion in ec i i y because i deli e s PR, which media es clea age o Gag and GP du ing capsid ma u a- ion, RT, which e e se ansc ibes he i al RNA genome o o m double-s anded DNA (dsDNA) ollowing capsid deli e y in o a ge cells, and IN, which in eg a es he dsDNA p o i al genome in e media e in o hos cell ch oma in. GP inco po a ion le els need o be igh ly con olled, based on p io s udies showing ha GP o e exp ession nega- i ely impac s capsid ma u a ion s eps (14–17) and he s abili y o packaged RNA ge- nome dime s (14). Wi h he excep ion o spuma i uses, which exp ess Gag and Pol om independen mRNAs, all o he known e o i uses use ansla ional ecoding o a single gag-pol an- sc ip o gene a e Gag and GP, employing ei he ameshi ing (FS) o codon ead- h ough mechanisms (18). Fo HIV-1, he PRF elemen egula es FS equency h ough he ac i i ies o wo p oximal cis-ac ing egula o y sequences: a conse ed hep anu- cleo ide “slippe y”sequence (UUUUUUA) (SS) loca ed ups eam o a s ong (DG= 221.8 kcal/mol) 11-bp RNA s em-loop posi ioned 164 bases p io o he gag s op codon (8, 19). A consensus model posi s ha ibosome s alling a he s em-loop leads o 21 FS e en s a he SS ;5 o 10% o he ime, so ha Gag and GP a e syn hesized a an app oxima e a io o 20:1 (Gag o GP) (4, 9, 20). Inc easing he local he mody- namic s abili y o he PRF s em-loop enhances FS equency bo h in i o (19) and in cells (21), and we showed p e iously ha s em-loop modifica ions inc easing FS e- quency as li le as 2- old can yield educ ions in i al in ec i i y o .80% (21). Acco dingly, he PRF elemen may ep esen a iable a ge o an i i al in e en ion. Indeed, cell-pe mean small molecules designed o bind he s em-loop and inc ease FS equency ha e been shown o educe i al in ec i i y in cell cul u e (22). The inco po a ion o Gag and GP in o i us pa icles is adi ionally iewed as a s o- chas ic p ocess, whe ein he a io o GP o Gag ound in i ions oughly equals ha ound in cells, wi h GP ec ui ed o i ions h ough andom associa ions wi h Gag and he i al RNA sca old (21, 23, 24). To be e unde s and how al e ing PRF equency a ec s i ion in ec i i y, he e we s udied he assembly cha ac e is ics o mu an HIV-1 i uses enginee ed o ei he inc ease o abolish ameshi ing. Using hese i uses, we demons a ed ha GP inco po a ion le els a e, in ac , go e ned by nons ochas ic mechanisms, wi h GP being mode a ely en iched in i ions ela i e o cells and, mo e s ikingly, much mo e e ficien ly inco po a ed in o i ions when cogene a ed wi h Gag in cis (i.e., om he same gag-pol mRNA) han in ans (i.e., when Gag and GP o igina e om sepa a e gag and GP mRNAs). Unexpec edly, we also disco e ed ha i ions impose an ;2- old sa u a ion ceiling on GP inco po a ion when GP is deli e ed in ans, a ea u e ha helps he i us o p ese e low-le el in ec i i y e en when cy o- plasmic concen a ions o GP a e excep ionally high. RESULTS Inc easing PRF s em-loop s abili y enhances GP syn hesis and inco po a ion in o i ions. Because ou p e ious wo k showed ha inc easing FS equency esul s in significan dec eases o i ion in ec i i y (21), he ini ial goal o his s udy was o mo e p ecisely define he le els o PRF and i ion GP inco po a ion ha would be needed o ab oga e HIV-1 eplica ion in he con ex o an an i i al s a egy (Fig. 1 and 2). To his end, we ocused on a subse o FS mu an s a ei he end o he ameshi ing spec um: M1, which we had p e iously shown o exhibi inc eased FS equency due Benne e al. Jou nal o Vi ology Janua y 2022 Volume 96 Issue 1 e01349-21 j i.asm.o g 2 Downloaded om h ps://jou nals.asm.o g/jou nal/j i on 13 No embe 2023 by 150.214.182.235. o s onge local base-pai ing in e ac ions a he base o he PRF s em-loop, and 2SS, a mu an ha encodes wo U- o-C mu a ions wi hin he slippe y sequence 59 o he PRF s em-loop, he eby abolishing ameshi ing en i ely (Fig. 1A) (21). To es ablish baseline le els o FS equency and GP inco po a ion in o i ions, g een fluo escen p o ein (GFP) epo e i uses bea ing wild- ype (WT), M1, and 2SS ame- shi si es we e ans ec ed in o HEK293T cells ea ed wi h he p o ease inhibi o saquina i , and pelle ed i ions and lysa es we e ha es ed a 48 h pos ans ec ion. Saquina i p e en s Gag and GP p o eoly ic clea age, allowing di ec measu emen s o p ecu so le els using quan i a i e immunoblo ing (Fig. 1B). FS equency and GP inco po a ion equency we e measu ed as GP/Gag a ios ela i e o WT i us o cells (Fig. 1C, o ange ba s) o i ions (Fig. 1C, blue ba s), espec i ely. The WT FS equency was 6.8% (61.7; n= 3) (Fig. 1C, o ange ba s), simila o p io s udies (4, 9, 20), while i- ion GP inco po a ion equency was 22.5% (62.4; n= 3) (Fig. 1C, blue ba s), indica ing ha GP/Gag a ios we e en iched 3.6- old in WT i ions ela i e o cells (Fig. 1C, WT; compa e o ange and blue ba s). In compa ison, M1 exhibi ed a ma kedly highe FS FIG 1 Inc easing PRF elemen s em-loop s abili y esul s in an inc ease in GP p oduc ion and en iched le els o GP associa ed wi h i ions. (A) Rep esen a ion o he wild- ype (WT) HIV-1 gag-pol mRNA ameshi (FS) si e seconda y s uc u e and ha o PRF mu an s –SS and M1. M1 was enginee ed o exhibi ele a ed s em-loop s abili y, wi h DG Local being he p edic ed ee ene gy o he fi s 3 bp o he WT and M1 s em-loops. (B) WT, M1, and 2SS Gag and GP exp ession and inco po a ion in o i us pa icles. HEK293T cells gene a ing WT o he indica ed PRF elemen mu an i uses we e cul u ed in he p esence o he p o ease inhibi o saquina i (10 m M) o p e en Gag and GP p ocessing. Cell lysa es and i ions we e ha es ed a 48 h. Gag and GP we e de ec ed by Wes e n blo ing using an i-p24 Gag p ima y an ise um and in a ed-labeled seconda y an ibodies. HSP90 was de ec ed as a loading con ol. (C) FS equency was defined as he a io o cell-associa ed GP o Gag (o ange ba s). GP inco po a ion equency in o i ions was defined as he a io o i ion-associa ed GP o Gag (blue ba s). Fold changes in GP/Gag a ios o he indica ed condi ions a e indica ed by black lines, wi h compa isons de i ed om h ee independen ly pe o med biological eplica es. E o ba s ep esen he s anda d de ia ions o he means. *,P,0.05, **,P,0.001, and ***,P,0.0001. P alues we e de i ed using S uden ’s wo- ailed es o compa isons as indica ed in he figu e, excep o 2SS P alues, which we e de i ed om compa isons o FS equency and GP inco po a ion le els o he WT alues. HIV-1 Gag-Pol Inco po a ion Jou nal o Vi ology Janua y 2022 Volume 96 Issue 1 e01349-21 j i.asm.o g 3 Downloaded om h ps://jou nals.asm.o g/jou nal/j i on 13 No embe 2023 by 150.214.182.235. equency o 22% ela i e o WT (64.35, n= 3) (Fig. 1C, o ange ba s), which co e- sponded o i ion GP inco po a ion le els o 34.5% (63.71; n= 3) (Fig. 1C, blue ba s). Acco dingly, M1 i us exhibi ed a 3.2- old-g ea e ameshi equency han WT (Fig. 1C, compa e M1 and WT o ange ba s), al hough M1 i ions exhibi ed only a 1.6- old en ichmen o GP inco po a ion equency (Fig. 1C, M1, compa e o ange and blue ba s). As an icipa ed, he FS mu an 2SS p oduced GP-deficien i us pa icles (Fig. 1B and C). FIG 2 Vi us complemen a ion e eals a nonlinea ela ionship be ween GP exp ession and i al in ec i i y a subop imal le els o GP. (A) In ec i i y o i ions p oduced by WT, M1, and 2SS epo e i uses. Vi al GFP exp ession was quan ified and no malized o ha o WT i us (se o 100%). (B) Schema ic o i al 2-colo complemen a ion assay whe ein WT o PRF mu an GFP epo e i uses we e coexp essed in cells gene a ing a Re 2 HIV-1 RFP epo e i us encoding a WT PRF elemen . “FSE” e e s o he RNA ameshi egula o y elemen . (C) Summa y o in ec ious yields o PRF mu an i uses p oduced alone o cop oduced wi h WT RFP epo e i us in HEK239T cells exp essed a a 1:1 a io. Pseudo yped i us pa icles we e assayed by in ec ing HEK293T cells (an example is shown) p io o measu ing pe -well fluo escence in ensi y ela i e o he WT con ol. (D) Da a om panel C shown in g aphical o ma . E o ba s ep esen s anda d de ia ions o he means de i ed om h ee independen biological eplica es. (E) P edic ed cellula GP/Gag a ios plo ed agains cumula i e ela i e in ec i i y, wi h measu emen s de i ed om panels A and D. The dashed g een line indica es ha a GP/Gag a io o 0.5 yields 90% o e all (GFP plus RFP) in ec i i y o he 2SS1WT condi ion, close o ha o WT i us alone. In con as , he dashed ed line indica es a ha a GP/Gag a io o mo e han 2- old yields less in ec i i y (52%) o he M11WT condi ion han WT. Compa isons we e de i ed om h ee independen ly pe o med biological eplica es. *,P,0.05; **,P,0.001; ***,P,0.0001; n.s., nonsignifican ( o compa isons o M1 and 2SS o he co esponding WT using S uden ’s wo- ailed es [A and D]). Benne e al. Jou nal o Vi ology Janua y 2022 Volume 96 Issue 1 e01349-21 j i.asm.o g 4 Downloaded om h ps://jou nals.asm.o g/jou nal/j i on 13 No embe 2023 by 150.214.182.235. A“weigh ed Goldilocks”scena io: HIV-1 in ec i i y is mo e ole an o subphysiological le els o GP han when GP is in excess. To be e define he ela- ionship be ween cellula GP exp ession le els and i al in ec i i y, we gene a ed WT, M1, and 2SS GFP epo e i uses pseudo yped using esicula s oma i is i us G p o- ein (VSV-G) and used he supe na an s o in ec HEK293T a ge cells (Fig. 2A). Rela i e o WT, we obse ed significan ly lowe in ec i i y (;5- old compa ed o WT) based on epo e gene (GFP) exp ession o M1 (18% 60.88%; n= 3) (Fig. 2A), consis en wi h ou p io s udy (21). We no e ha he M1 PRF mu a ions caused a small numbe o amino acid changes in Gag and GP (see de ails in e e ence 21 and Ma e ials and Me hods). Howe e , hese changes we e in egions o he p o eins (Gag p1 and GP p6*) p e iously shown o accommoda e changes wi hou a ec ing Gag o GP assembly unc ion (21, 25–27). As expec ed, 2SS i ions, which lacked GP due o he ameshi - blocking 2SS mu a ion, we e no in ec ious (Fig. 2A). We nex es ed he e ec s o modula ing cellula GP/Gag a ios by coexp essing WT, M1, o 2SS GFP i us genomes a a 1:1 a io wi h WT PRF epo e i us exp essing ed fluo escen p o ein (RFP) ins ead o GFP (Fig. 2; schema ic depic ion o i us con- s uc s is in Fig. 2B). We hypo hesized ha WT RFP i us would imp o e he in ec i i y o bo h M1 and 2SS GFP i uses by ei he educing (wi h M1) o inc easing (wi h 2SS) he ela i e cell-associa ed GP/Gag a io. In his expe imen , he WT RFP i us was also mu a ed o inac i a e he i al e gene, needed o ac i a e unspliced and pa ially spliced i al RNA nuclea expo , so ha i would be exp essed only i coexp essed in he same cell wi h a complemen ing GFP i us genome supplying Re in ans (28). The VSV-G-pseudo yped i ions esul ing om hese co ans ec ions we e used o in ec HEK293T cells, which we e fixed a 48 h pos in ec ion (hpi), and GFP, RFP, o bo h combined we e measu ed o assess ela i e le els o in ec i i y (Fig. 2C and D). As an icipa ed, coexp essing M1 GFP and WT RFP i us genomes (M11WT) yielded highe cumula i e in ec i i y (51.7% 62.8%, n= 3) han M1 alone (Fig. 2B o D), which was consis en wi h a cellula GP/Gag a io o ;2- old highe being needed o achie e an ;50% d op o in ec i i y (Fig. 2E, ed dashed line). In e es ingly, when in ec i i y yields om independen exp ession o he mu an M1 GFP and WT RFP i al genomes we e compa ed o he coexp ession esul s, M1 (GFP) in ec i i y was only mode a ely imp o ed by coexp essing he WT i al genome (;18% [Fig. 2A, M1] o 35.2% 6 9.86%; n= 3 [Fig. 2D, M1, g een ba ]), and WT (RFP) in ec i i y was only mode a ely dec eased ( o 68.1% 614.32%; n= 3 [Fig. 2D, WT, middle ed ba ]). We in e p e ed his esul as indica ing ha while excess GP gene a ed by M1 is dele e ious o bo h i uses, i had a bigge ne nega i e e ec on M1 genomes po en ially due o i s ope - a ing in cis (add essed u he in Fig. 3 and 4). Also as expec ed, 1:1 coexp ession o 2SS GFP i us genomes wi h WT RFP i us genomes imp o ed 2SS i us in ec i i y. Rema kably, howe e , his escue was nea ly comple e (90.2% 61.33%; n= 3), despi e he p edic ed GP/Gag a io o only 50% ela- i e o he WT-alone con ol (Fig. 2C and D). When coexp essed, bo h he 2SS (GFP) and WT (RFP) genomes exhibi ed ela i ely high le els o in ec i i y (83.4% 620.4% o 2SS and 96.9% 618.1% o WT, espec i ely; n= 3) (Fig. 2C and D). This esul demon- s a ed ha GP is e ficien ly ec ui ed o i ions packaging 2SS genomes in ans e en when in acellula le els o GP a e ela i ely low. Using hese da a, we plo ed p edic ed cellula GP/Gag a ios ela i e o cumula i e in ec i i y om Fig. 2A and D in Fig. 2E, illus a ing a nonlinea “weigh ed Goldilocks” scena io o cellula GP le els whe ein “ oo li le”GP (e.g., a p edic ed 50% le el o GP/ Gag in cells compa ed o WT GP/Gag le els se o 100%) (Fig. 2E, g een dashed lines) is well ole a ed by he i us, while “ oo much”GP (e.g., an ;2- old GP/Gag inc ease; Fig. 2E, ed dashed lines) is mo e de imen al (2SS1WT compa ed o M11WT condi ions [Fig. 2E]). Subop imal e ec s o ans-deli e ed GP on in ec i i y sugges a cis p e e ence o GP inco po a ion in o i ions. We nex sough o es ou “weigh ed Goldilocks” model by mo e ca e ully con olling le els o GP exp essed in cells using a Gag-Pol- only (GP Only ) RFP epo e i us, whe ein we abolished ameshi ing by placing he pol HIV-1 Gag-Pol Inco po a ion Jou nal o Vi ology Janua y 2022 Volume 96 Issue 1 e01349-21 j i.asm.o g 5 Downloaded om h ps://jou nals.asm.o g/jou nal/j i on 13 No embe 2023 by 150.214.182.235. FIG 3 Subop imal ac i i y o GP supplied in ans sugges s a cis p e e ence o GP inco po a ion in o i ions. (A) Schema ic o GP Only HIV-1 RFP epo e i us and al e ed slippe y sequence ha places pol in he 0 eading ame. “FSRE” e e s o he RNA ameshi egula o y elemen . (B) Wes e n blo analysis o Gag and GP exp ession confi med ha he GP Only RFP i us gene a ed GP and no Gag, and a highe le els han GP de i ed om WT ansc ip s. To al Gag plus GP p o ein exp ession le els we e simila o WT and GP Only ansc ip s. No e ha GP exp ession alone did no p oduce i us pa icles. Hai lines indica e si es whe e bands om a single immunoblo we e spliced oge he o imp o e da a p esen a ion, bu wi h no u he modifica ions. (C) E ec s o GP on i al in ec i i y and Gag p ocessing when coexp essed wi h WT, 2SS, o M1 i uses. HEK293T cells we e ans ec ed wi h plasmids encoding WT, –SS, o M1 GFP epo e i uses (1,500 ng inpu plasmid) in he p esence o absence o inc easing amoun s o GP Only RFP epo e i us plasmid (25, 50, 100, 150, 200, and 300 ng). Vi al in ec i i y was de e mined as o Fig. 2, wi h alues shown no malized o WT i us p oduc ion, o h ee independen ly pe o med biological eplica es. Bo h GFP (g een) and RFP ( ed) ou pu is shown o each condi ion, wi h e o ba s ep esen ing he s anda d de ia ions o he means o bo h GFP and RFP in ec i i y, no malized o WT. Cell lysa es and i ions we e also p obed o p24 Gag by Wes e n blo ing as desc ibed o (Con inued on nex page) Benne e al. Jou nal o Vi ology Janua y 2022 Volume 96 Issue 1 e01349-21 j i.asm.o g 6 Downloaded om h ps://jou nals.asm.o g/jou nal/j i on 13 No embe 2023 by 150.214.182.235. coding egion di ec ly in o he 0 eading ame (Fig. 3A). As expec ed, he GP Only i us yielded exclusi e p oduc ion o GP (Fig. 3B) and, in e es ingly, did no p oduce i us pa icles when exp essed alone, po en ially eflec ing GP’s la ge size ela i e o Gag and i s lacking he p6 Gag la e domain necessa y o ec ui componen s o he cellula endosomal so ing complex equi ed o anspo (ESCRT) machine y, which media es i us pa icle elease (Fig. 3B) (29–32). We coexp essed he GP Only i usa inc easingle elswi hWT,M1,and2SS GFP i uses, wi h ela i e in ec i i y measu ed as desc ibed o Fig. 2 (Fig. 3C and D; Table 1). As expec ed, inc easing le els o GP exp essed in ans esul ed in a dose-dependen dec ease in WT GFP in ec i i y, and coexp ession wi h he GP Only i us ma kedly imp o ed he in ec- i i y o 2SS GFP i us, which confi med GP unc ionali y (Fig. 3C). Unexpec edly, exp essing inc easing amoun s o GP Only i us wi h M1 i us did no lead o any u he dec ease in M1 in ec i i y; ha emained in he ange o 20 o 30% o WT e en a wha we es ima ed would be ex ao dina ily high (.4- old ela i e o WT [Table 1]) p edic ed cellula GP/Gag a ios (Fig. 3C and G). An i-p24 Gag immunoblo confi med ha hese e ec s we e no a ibu able o he GP Only i us a ec ing he e fi- ciency o i us pa icle assembly, conside ing ha i ion-associa ed p24 Gag le els we e simila o M1 and WT i ions ac oss he ull ange o GP exp ession le els (Fig. 3C). Fu he , i ion p24 Gag le els co ela ed well only wi h in ec i i y o 2SS i us coex- p essed wi h low le els o GP, as would be expec ed due o GP Only i us being able o complemen he 2SS i us’s lack o p o ease ac i i y (Fig. 3C; co ela ion analysis is in Fig. 3D). Acco dingly, we could explain his esul only by hypo hesizing ha HIV-1 FIG 3 Legend (Con inued) Fig. 1B. Hai lines indica e si es whe e bands om a single immunoblo we e spliced oge he o imp o e da a p esen a ion, bu wi h no u he modifica ions. (D) Vi ion p24 Gag le els we e quan ified om he expe imen epo ed in panel C and plo ed agains he co esponding o al ela i e in ec i i y measu emen s (GFP and RFP) o each coexp ession scena io. Pea son co ela ion coe ficien s we e de e mined o each condi ion. (E o G) Plo s depic ing expec ed in ec i i y (dashed blue lines) based on expec ed pe - ansc ip GP/Gag a ios (de i ed as shown in Table 1) and he p edic i e model in Fig. 2E, ela i e o ac ual obse ed in ec i i y (o ange lines; measu ed in panel C) o WT, 2SS, and M1 coexp ession wi h GP Only , espec i ely. E o ba s ep esen he s anda d de ia ions o he means o he h ee biological eplica es. FIG 4 P o ease inhibi o ea men confi ms cis p e e ence and e eals a s ong uppe limi o ans-media ed deli e y o Gag-Pol in o i ions. (A) HEK293T cells cul u ed in he p esence o 10 m M saquina i we e ans ec ed o exp ess WT, M1, o 2SS i uses (1,500 ng plasmid) in he absence o p esence o inc easing le els o GP Only i us (25, 100, o 500 ng plasmid). Cell lysa es and i ions we e ha es ed a 48 h and p obed o Gag and GP le els by quan i a i e Wes e n blo ing as o Fig. 1B. All alues we e no malized o he WT- only condi ion (black dashed line). The appa en limi o ans GP inco po a ion is indica ed by he ed dashed line. Hai lines indica e si es whe e bands om a single immunoblo we e spliced oge he o imp o e da a p esen a ion, bu wi h no u he modifica ions. (B) Ba g aph showing he old change in GP inco po a ion e ficiencies calcula ed om GP band in ensi ies o i ions di ided by GP associa ed wi h cells, om h ee independen biological eplica es, showing g ea e inco po a ion o GP when made in cis by WT and M1 i uses. E o ba s ep esen he s anda d de ia ions o he means. *,P,0.05; **,P,0.001; ***,P,0.0001 ( o compa isons o WT using S uden ’s wo- ailed es ). HIV-1 Gag-Pol Inco po a ion Jou nal o Vi ology Janua y 2022 Volume 96 Issue 1 e01349-21 j i.asm.o g 7 Downloaded om h ps://jou nals.asm.o g/jou nal/j i on 13 No embe 2023 by 150.214.182.235. i ion in ec i i y is pa ially bu e ed agains he e ec s o ans-deli e ed GP, pe haps by limi ing GP inco po a ion le els in i ions. Consis en wi h his hypo hesis, GP Only coexp essed wi h WT o 2SS i us in ans also exhibi ed less- han-expec ed e ec s on ei he loss (WT) o gain (2SS) o i ion in ec i i y based on p edic ed GP/Gag a ios (Fig. 3C, E, and F; p edic ed a ios a e gi en in Table 1). P o ease inhibi o ea men confi ms a cis p e e ence o GP inco po a ion in o i ions and e eals an uppe limi o ans-deli e ed GP. To mo e di ec ly es o a cis p e e ence, we measu ed he le els o cis- e sus ans-media ed GP inco po- a ed in o i ions in he absence o p o eoly ic clea age, di ec ly quan i ying Gag and GP p ecu so le els in cells and i ions unde saquina i ea men a e coexp essing WT, M1, o 2SS wi h inc easing amoun s o GP Only i us (Fig. 4A). Rema kably, GP/Gag a ios in i ions o any coexp ession condi ion ne e exceeded an ;2- old i ion inco po a ion uppe limi , sugges ing a ceiling o GP inco po a ion whe e only a limi ed amoun o ans-deli e ed GP can be inco po a ed in o assem- bling i ions be o e sa u a ion (Fig. 4A, compa e lane 4 o lane 1), always lowe han he cis-media ed le el o GP inco po a ion achie ed by M1 e en in he absence o any coexp essed GP (Fig. 4A, compa e lane 5 o lane 4). Mo eo e , inc easing GP Only exp es- sion had li le o no e ec on GP le els in M1 i ions (Fig. 4A, lanes 5 o 8), hus likely explaining why M1 i uses did no lose in ec i i y when GP was o e exp essed (Fig. 3C and G). In e es ingly, we no ed ha pa icula ly high le els o GP Only exp ession caused some ans-media ed ep ession o Gag syn hesis in cells (e.g., in Fig. 4A, compa e P 55 Gag lane 4 o lane 1 o cell lysa es). Howe e , hese e ec s would no be an ici- pa ed o accoun o any di e ences in GP/Gag a ios in i ions. Tha HIV-1 exhibi s a ans GP inco po a ion ceiling was mos clea ly illus a ed when inc easing le els o GP Only i us we e exp essed wi h 2SS i us, whe ein GP le els could TABLE 1 Summa y o p edic ed and obse ed in ec i i y measu emen s o he GP i a ion expe imen epo ed in Fig. 3 Plasmid(s) Am (ng) Rela i e expec ed in-cell GP/Gag a io a In ec i i y (% GFP) P edic ed b Obse ed c WT 1,500 1.00 100 100.0 WT:GP Only 1,500:25 1.22 92.5 94.6 1,500:50 1.44 83 85.5 1,500:100 1.86 63 75.4 1,500:150 2.25 47.7 67.9 1,500:200 2.62 35.5 63.4 1,500:300 3.29 16 43.2 2SS 1,500 0.00 0 3.1 2SS:GP Only 1,500:25 0.24 46 10.2 1,500:50 0.47 87 28.9 1,500:100 0.92 101 56.4 1,500:150 1.34 87.5 77.2 1,500:200 1.74 69 80.8 1,500:300 2.48 39.5 88.3 M1 1,500 3.24 18 20.5 M1:GP Only 1,500:25 3.42 12 29.5 1,500:50 3.60 7 28.1 1,500:100 3.95 0 33.2 1,500:150 4.28 0 31.5 1,500:200 4.59 0 24.3 1,500:300 5.15 0 20.7 a Calcula ed based on he a ios o i al cons uc s exp essed and pe ansc ip ameshi equency a ios measu ed om Fig. 1. b P edic ed om complemen a ion-based modeling in Fig. 2E, u ilizing calcula ed expec ed GP/Gag a ios. GFP i uses (WT, 2SS, o M1) we e exp essed om plasmids co ans ec ed wi h inc easing amoun s o GP Only i us and/o emp y ec o con ol plasmid o a o al DNA concen a ion o 1,800 ng. c Measu ed om Fig. 3C. All alues we e no malized o he WT-alone condi ion. Benne e al. Jou nal o Vi ology Janua y 2022 Volume 96 Issue 1 e01349-21 j i.asm.o g 8 Downloaded om h ps://jou nals.asm.o g/jou nal/j i on 13 No embe 2023 by 150.214.182.235. ne e achie e hose obse ed o M1 i ions, e en when GP was exp essed in ma ked excess (Fig. 4A; compa e lanes 10, 11, and 12 o lane 5; he ed do ed line indica es he appa en ans uppe limi ). Compa ing i ion GP le els o in-cell GP le els unde cis e sus ans condi ions u he suppo ed he no ion ha GP is much mo e e ficien ly inco po- a ed in o i ions when exp essed in cis han in ans (Fig. 4B; in pa icula , compa e WT and M1 wi hou GP Only condi ions o 2SS wi h GP Only coexp ession). Taken oge he , his analysis ein o ced (i) ha e ficien GP en ichmen in o i ions is highly a o ed unde cis condi ions ela i e o ans and (ii) ha HIV-1 is capable o p e en ing he inco po a ion o ans-deli e ed GP o i ions should GP be exp essed a ex ao dina ily high le els. Excessi e cis-media ed GP inco po a ion in o i ions causes p ema u e Gag/GP clea age and loss o Pol subuni s RT and IN om i ions. The obse a ion ha M1 i us main ained ;20% in ec i i y e en in he p esence o a ma ked excess o GP p omp ed us o a emp o be e define he mechanis ic basis o he M1 in ec i i y de ec in he fi s place. We had p e iously shown ha M1 and o he PRF mu an i uses exhibi ing ele a ed FS equency cause changes o Gag clea age e ficiency eflec ed in a dec ease in i ion-associa ed P 55/p24 a ios, consis en wi h excessi e p o ease ac i i y (21). To e alua e he impac o excess GP on M1 i ion genesis o e ime, we compa ed WT and M1 i us Gag/GP i ion p oduc ion o e 48 h using an i- p24 Gag immunoblo ing. We obse ed an ;2- old dec ease in M1 Gag P 55/p24 a ios ela i e o WT in ha es ed i ions e en a he ea lies ime o i ion de ec ion (24 h pos ans ec ion), consis en wi h he idea ha M1’s ela i ely high le els o GP cause p ema u e Gag p o eoly ic p ocessing (Fig. 5A, compa e he quan ifica ion o P 55/p24 a 24 h [lanes 4 and 5] and 48 h [lanes 7 and 8] in he i ion blo ). To subsequen ly e alua e he impac o p ema u e clea age on he s a us o c ucial Pol p oduc s, we also p obed cells and i ions o de ec RT and IN a he 48-h ime poin using an ise a specific o ei he p o ein, wi h i ions p epa ed in he p esence o absence o saquina i (Fig. 5B and D). Rema kably, his expe imen e ealed ha de- spi e ele a ed (;1.4- old) le els o GP polyp o ein inco po a ion (Fig. 5C and E, g ay ba s), M1 i ions con ained smalle amoun s o RT and IN (;10% less) han WT i ions when gene a ed in he p esence o an ac i e p o ease (Fig. 5B and D, compa e lanes 3 and 1; quan ified in Fig. 5C and E, blue and o ange ba s). This ne loss o GP p oduc s (IN and RT) in M1 i ions (Fig. 5B o E) migh mos easily be explained by a d opou o a subse o IN and RT p oduc s occu ing due o p ema u e o abe an GP clea age e en s, occu ing ei he du ing o a e he p ocess o i ion assembly. Taken oge he , hese da a sugges ed ha Gag and GP clea age e en s esul ing om excess GP in M1 i us may accoun o a leas some o he loss o in ec i i y obse ed o he M1 mu- an (Fig. 2A). A GP inco po a ion ceiling may limi de ec s o e e se ansc ip ion. Conside ing ha IN and RT we e los om M1 i ions and because high le els o GP we e p e iously shown o a ec RNA dime s abili y (14), we subsequen ly measu ed le els o i al RNA associa ed wi h M1 i ions as well as he capaci y o hese i ions o comple e e e se ansc ip ion using quan i a i e eal- ime PCR (qRT-PCR) (Fig. 6). We obse ed no di e - ences in he abundance o unspliced i al RNA in associa ion wi h M1 i ions compa ed o WT, in he p esence o absence o saquina i , indica ing ha M1’s in ec i i y de ec s a e unlikely o eflec a de ec in ne i al RNA genome packaging (Fig. 6A). In con as , assessmen o RT p oduc s in in ec ed a ge cells e ealed significan dec eases o he le els o ea ly, la e, and wo-long- e minal- epea (2LTR) ci cle DNA RT p oduc s, indi- ca ing ha M1 i ions a e highly de ec i e in he p ocess o e e se ansc ip ion (Fig. 6B). As expec ed, no RT p oduc s we e obse ed o FS mu an 2SS, which did no exp ess GP. We we e su p ised, howe e , o de ec a mode a e bu ep oducible ;50% dec ease in he e ficiency o i al RNA packaging by he 2SS i us (Fig. 6A, 2SS alone [black and g ay ba s]). We also sough o be e unde s and he loss o in ec i i y we had obse ed o WT i us in he p esence o ele a ed le els o ans-deli e ed GP (Fig. 3), measu ing RNA packaging and RT e ficiency o WT, M1, o 2SS i uses coexp essed wi h GP Only i us HIV-1 Gag-Pol Inco po a ion Jou nal o Vi ology Janua y 2022 Volume 96 Issue 1 e01349-21 j i.asm.o g 9 Downloaded om h ps://jou nals.asm.o g/jou nal/j i on 13 No embe 2023 by 150.214.182.235. ansc ip s p oduced om ans ec ions wi h a WT HIV-1 genome. Fo compa isons wi h h ee o mo e g oups, a one-way analysis o a iance (ANOVA) was pe o med using Mic oso Excel. I his de e mined ha a s a is ically significan di e ence exis ed wi hin he g oup (P,0.05), a u he pos hoc es was done using Tukey’s hones ly significan di e ence es (HSD) in Excel (66, 67). I only wo g oups we e compa ed, S uden ’s es in Excel was used. ANOVA esul s and ele an Tukey’s HSD and es com- pa isons a e shown in he figu es, unless Pwas .0.05 o he ANOVA, in which case only he ANOVA esul s a e shown. Analysis o e e se ansc ip ion p oduc s. Cells (1 10 6 ) we e in ec ed wi h VSV-G pseudo yped VLPs. A 24 h pos in ec ion, o al DNA was ha es ed using he DNeasy ki om Qiagen. Quan i a i e eal- ime PCR was pe o med using he SsoFas p obe ki (Bio-Rad). Fo ea ly RT p oduc s, we used p i- me s as p e iously desc ibed (68): e 2 (GTGCCCGTCTGTTGTGTGAC), e 2 (GGCGCCACTGCTAGAG ATTT), and e 2 p obe (CTAGAGATCCCTCAGACCCTTTTAGTCAGTGTGG). Fo la e RT and 2LTR, we used p ime s ha we e desc ibed p e iously (69) bu modified as necessa y o analyzing he NL4-3 s ain as ollows: HIV-1 la e o wa d MH531 (TGTGTGCCCGTCTGTTGTGT), e MH532 (GAGTCCTGCGTCGAG AGATC), la e RT p obe (CAGTGGCGCCCGAACAGGGA), HIV-1 2LTR Fwd p ime (AACTAGGGAACCCA CTGCTTAAG), HIV-1 2LTR Re p ime (TCCACAGATCAAGGATATCTTGTC), and HIV-1 2LTR p obe (ACAC TACTTTGAGCACTCAAGGCAAGCTTT). A s anda d cu e was de i ed using a gene block (In eg a ed DNA Technologies) con aining he amplicon o de e mine he absolu e numbe o molecules p esen , and o al e e se ansc ip ion p oduc s in each sample we e calcula ed and compa ed o in ec ion wi h WT HIV-1 genomes. p24 Gag Wes e n blo s we e used o ensu e in ec ion wi h equi alen numbe s o i ions. S a is ical analyses we e pe o med as desc ibed abo e o analysis o i al RNA packaging. ACKNOWLEDGMENTS The ollowing eagen s we e ob ained h ough he NIH AIDS Reagen P og am, Di ision o AIDS, NIAID, NIH: HIV-1 p24 hyb idoma (183-H12-5C) om B uce Cheseb o (62), HIV-1 IN monoclonal an ibody (2C11) om Dag E. Helland (ca alog no. 7374) (63), and saquina i . This esea ch was suppo ed by NIH g an s R01AI110221 (N.M.S.), P01CA022332 (N.M.S., P.A.), R35GM118131 (S.E.B.), and T32GM008349 (B.E.B.); NSF g adua e esea ch ellowships DGE1747503 (B.E.B.) and DGE-1256269 (J.T.B.); a Shaw Scien is Awa d om he G ea e Milwaukee Founda ion (N.M.S.); and s uden ellowships om he Uni e si y o Wisconsin-Madison (J.R.K.) and Wisconsin Alumni Resea ch Founda ion (J.T.B.). REFERENCES 1. Wa s JM, Dang KK, Go elick RJ, Leona d CW, Bess JW, J , Swans om R, Bu ch CL, Weeks KM. 2009. A chi ec u e and seconda y s uc u e o an en i e HIV-1 RNA genome. Na u e 460:711–716. h ps://doi.o g/10.1038/ na u e08237. 2. D'Souza V, Summe s MF. 2005. How e o i uses selec hei genomes. Na Re Mic obiol 3:643–655. h ps://doi.o g/10.1038/n mic o1210. 3. Kuzembaye a M, Dilley K, Sa do L, Hu WS. 2014. Li e o psi: how ull- leng h HIV-1 RNAs become packaged genomes in he i al pa icles. Vi ol- ogy 454-455:362–370. h ps://doi.o g/10.1016/j. i ol.2014.01.019. 4. Jacks T, Powe MD, Masia z FR, Luciw PA, Ba PJ, Va mus HE. 1988. Cha - ac e iza ion o ibosomal ameshi ing in HIV-1 gag-pol exp ession. Na- u e 331:280–283. h ps://doi.o g/10.1038/331280a0. 5. Pa kin NT, Chamo o M, Va mus HE. 1992. Human immunodeficiency i- us ype 1 gag-pol ameshi ing is dependen on downs eam mRNA sec- onda y s uc u e: demons a ion by exp ession in i o. J Vi ol 66: 5147–5151. h ps://doi.o g/10.1128/JVI.66.8.5147-5151.1992. 6. Ba il M, Dulude D, Gend on K, Lemay G, B akie -Ging as L. 2003. E ficiency o a p og ammed -1 ibosomal ameshi in he di e en sub ypes o he human immunodeficiency i us ype 1 g oup M. RNA 9:1246–1253. h ps://doi.o g/10.1261/ na.5113603. 7. S aple DW, Bu che SE. 2003. Solu ion s uc u e o he HIV-1 ameshi inducing s em-loop RNA. Nucleic Acids Res 31:4326–4331. h ps://doi .o g/10.1093/na /gkg654. 8. S aple DW, Bu che SE. 2005. Solu ion s uc u e and he modynamic in es iga ion o he HIV-1 ameshi inducing elemen . J Mol Biol 349: 1011–1023. h ps://doi.o g/10.1016/j.jmb.2005.03.038. 9. B ie ley I, Dos Ramos FJ. 2006. P og ammed ibosomal ameshi ing in HIV-1 and he SARS-CoV. Vi us Res 119:29–42. h ps://doi.o g/10.1016/j . i us es.2005.10.008. 10. B akie -Ging as L, Cha bonneau J, Bu che SE. 2012. Ta ge ing ameshi - ing in he human immunodeficiency i us. Expe Opin The Ta ge s 16: 249–258. h ps://doi.o g/10.1517/14728222.2012.665879. 11. F eed EO. 2015. HIV-1 assembly, elease and ma u a ion. Na Re Mic o- biol 13:484–496. h ps://doi.o g/10.1038/n mic o3490. 12. Sundquis WI, K ausslich HG. 2012. HIV-1 assembly, budding, and ma u a- ion. Cold Sp ing Ha b Pe spec Med 2:a006924. h ps://doi.o g/10.1101/ cshpe spec .a006924. 13. F ankel AD, Young JA. 1998. HIV-1: fi een p o eins and an RNA. Annu Re Biochem 67:1–25. h ps://doi.o g/10.1146/annu e .biochem.67.1.1. 14. Shehu-Xhilaga M, C owe SM, Mak J. 2001. Main enance o he Gag/Gag- Pol a io is impo an o human immunodeficiency i us ype 1 RNA dime iza ion and i al in ec i i y. J Vi ol 75:1834–1841. h ps://doi.o g/10 .1128/JVI.75.4.1834-1841.2001. 15. Gan X, Gould SJ. 2012. HIV Pol inhibi s HIV budding and media es he se e e budding de ec o Gag-Pol. PLoS One 7:e29421. h ps://doi.o g/10 .1371/jou nal.pone.0029421. 16. Ha aguchi H, Sudo S, Noda T, Momose F, Kawaoka Y, Mo ikawa Y. 2010. In acellula localiza ion o human immunodeficiency i us ype 1 Gag and GagPol p oduc s and i us pa icle elease: ela ionship wi h he Gag- o-GagPol a io. Mic obiol Immunol 54:734–746. h ps://doi.o g/10 .1111/j.1348-0421.2010.00276.x. 17. Yu FH, Huang KJ, Wang CT. 2020. HIV-1 mu an assembly, p ocessing and in ec i i y exp esses Pol independen o Gag. Vi uses 12:54. h ps://doi .o g/10.3390/ 12010054. 18. Hill M, Tachedjian G, Mak J. 2005. The packaging and ma u a ion o he HIV-1 Pol p o eins. Cu HIV Res 3:73–85. h ps://doi.o g/10.2174/1570 162052772942. 19. Mouzakis KD, Lang AL, Vande Meulen KA, Eas e day PD, Bu che SE. 2013. HIV-1 ameshi e ficiency is p ima ily de e mined by he s abili y o base pai s posi ioned a he mRNA en ance channel o he ibosome. Nucleic Acids Res 41:1901–1913. h ps://doi.o g/10.1093/na /gks1254. 20. Ko niy N, Goyal A, Ho mann M, Sama o a E, Peske F, Pohlmann S, Rodnina MV. 2019. Modula ion o HIV-1 Gag/Gag-Pol ameshi ing by RNA abundance. Nucleic Acids Res 47:5210–5222. h ps://doi.o g/10 .1093/na /gkz202. Benne e al. Jou nal o Vi ology Janua y 2022 Volume 96 Issue 1 e01349-21 j i.asm.o g 16 Downloaded om h ps://jou nals.asm.o g/jou nal/j i on 13 No embe 2023 by 150.214.182.235. 21. Ga cia-Mi anda P, Becke JT, Benne BE, Blume A, She e NM, Bu che SE. 2016. S abili y o HIV ameshi si e RNA co ela es wi h ameshi e fi- ciency and dec eased i us in ec i i y. J Vi ol 90:6906–6917. h ps://doi .o g/10.1128/JVI.00149-16. 22. Hilimi e TA, Benne RP, S ewa RA, Ga cia-Mi anda P, Blume A, Becke J, She e N, Helms ED, Bu che SE, Smi h HC, Mille BL. 2016. N-Me hyla ion as a s a egy o enhancing he a fini y and selec i i y o RNA-binding pep ides: applica ion o he HIV-1 ameshi -s imula ing RNA. ACS Chem Biol 11:88–94. h ps://doi.o g/10.1021/acschembio.5b00682. 23. Kho chid A, Halwani R, Wainbe g MA, Kleiman L. 2002. Role o RNA in acili a ing Gag/Gag-Pol in e ac ion. J Vi ol 76:4131–4137. h ps://doi.o g/ 10.1128/j i.76.8.4131-4137.2002. 24. Huang Y, Kho chid A, Wang J, Pa niak MA, Da lix JL, Wainbe g MA, Kleiman L. 1997. E ec o mu a ions in he nucleocapsid p o ein (NCp7) upon P 160(gag-pol) and RNA(Lys) inco po a ion in o human immuno- deficiency i us ype 1. J Vi ol 71:4378–4384. h ps://doi.o g/10.1128/JVI .71.6.4378-4384.1997. 25. Hill MK, Shehu-Xhilaga M, C owe SM, Mak J. 2002. P oline esidues wi hin space pep ide p1 a e impo an o human immunodeficiency i us ype 1 in ec i i y, p o ein p ocessing, and genomic RNA dime s abili y. J Vi ol 76:11245–11253. h ps://doi.o g/10.1128/j i.76.22.11245-11253.2002. 26. de Ma co A, Heuse AM, Glass B, K ausslich HG, Mulle B, B iggs JA. 2012. Role o he SP2 domain and i s p o eoly ic clea age in HIV-1 s uc u al ma u a ion and in ec i i y. J Vi ol 86:13708–13716. h ps://doi.o g/10 .1128/JVI.01704-12. 27. Leihe e A, Ludwig C, Wagne R. 2009. Uncoupling human immunodefi- ciency i us ype 1 Gag and Pol eading ames: ole o he ans ame p o ein p6*in i al eplica ion. J Vi ol 83:7210–7220. h ps://doi.o g/10 .1128/JVI.02603-08. 28. Hende son BR, Pe cipalle P. 1997. In e ac ions be ween HIV Re and nu- clea impo and expo ac o s: he Re nuclea localisa ion signal medi- a es specific binding o human impo in-be a. J Mol Biol 274:693–707. h ps://doi.o g/10.1006/jmbi.1997.1420. 29. Me gene K, Facke M, Welke R, B inkmann V, Gelde blom HR, K ausslich HG. 1992. Analysis o HIV pa icle o ma ion using ansien exp ession o sub i al cons uc s in mammalian cells. Vi ology 186:25–39. h ps://doi .o g/10.1016/0042-6822(92)90058-w. 30. Ga us JE, on Schwedle UK, Po nillos OW, Mo ham SG, Za i z KH, Wang HE, We s ein DA, S ay KM, Co e M, Rich RL, Myszka DG, Sundquis WI. 2001. Tsg101 and he acuola p o ein so ing pa hway a e essen ial o HIV-1 bud- ding. Cell 107:55–65. h ps://doi.o g/10.1016/s0092-8674(01)00506-2. 31. Demi o DG, Ono A, O ens ein JM, F eed EO. 2002. O e exp ession o he N- e minal domain o TSG101 inhibi s HIV-1 budding by blocking la e do- main unc ion. P oc Na l Acad Sci U S A 99:955–960. h ps://doi.o g/10 .1073/pnas.032511899. 32. Demi o DG, O ens ein JM, F eed EO. 2002. The la e domain o human immu- nodeficiency i us ype 1 p6 p omo es i us elease in a cell ype-dependen manne . J Vi ol 76:105–117. h ps://doi.o g/10.1128/j i.76.1.105-117.2002. 33. Hill MK, Hooke CW, Ha ich D, C owe SM, Mak J. 2001. Gag-Pol supplied in ans is e ficien ly packaged and suppo s i al unc ion in human im- munodeficiency i us ype 1. J Vi ol 75:6835–6840. h ps://doi.o g/10 .1128/JVI.75.15.6835-6840.2001. 34. Shehu-Xhilaga M, Lee JY, Campbell S, Ma shall JA, C owe SM, Mak J. 2002. O e exp ession and inco po a ion o GagPol p ecu so does no impede packaging o HIV-1 RNA(Lys3) bu p omo es in acellula budding o i us- like pa icles. J Biomed Sci 9:697–705. h ps://doi.o g/10.1007/BF02254998. 35. Smi h AJ, S ini asakuma N, Hamma skjold ML, Rekosh D. 1993. Requi e- men s o inco po a ion o P 160gag-pol om human immunodeficiency i us ype 1 in o i us-like pa icles. J Vi ol 67:2266–2275. h ps://doi.o g/ 10.1128/JVI.67.4.2266-2275.1993. 36. Huang M, Ma in MA. 1997. Inco po a ion o P 160(gag-pol) in o i us pa icles equi es he p esence o bo h he majo homology egion and adjacen C- e minal capsid sequences wi hin he Gag-Pol polyp o ein. J Vi ol 71:4472–4478. h ps://doi.o g/10.1128/JVI.71.6.4472-4478.1997. 37. Wills JW, C a en RC. 1991. Fo m, unc ion, and use o e o i al gag p o eins. AIDS 5:639–654. h ps://doi.o g/10.1097/00002030-199106000-00002. 38. Takagi S, Momose F, Mo ikawa Y. 2017. FRET analysis o HIV-1 Gag and Gag- Pol in e ac ions. FEBS Open Bio 7:1815–1825. h ps://doi.o g/10.1002/2211 -5463.12328. 39. Ku luay SB, Bieniasz PD. 2010. Analysis o he ini ia ing e en s in HIV-1 pa icle assembly and genome packaging. PLoS Pa hog 6:e1001200. h ps://doi.o g/10.1371/jou nal.ppa .1001200. 40. Hend ix J, Baumga el V, Sch imp W, I anchenko S, Digman MA, G a on E, K ausslich HG, Mulle B, Lamb DC. 2015. Li e-cell obse a ion o cy osolic HIV-1 assembly onse e eals RNA-in e ac ing Gag oligome s. J Cell Biol 210:629–646. h ps://doi.o g/10.1083/jcb.201504006. 41. Ba ajas BC, Tanaka M, Robinson BA, Phuong DJ, Chu i aka K, Reed JC, Lingappa JR. 2018. Iden i ying he assembly in e media e in which Gag fi s associa es wi h unspliced HIV-1 RNA sugges s a no el model o HIV- 1 RNA packaging. PLoS Pa hog 14:e1006977. h ps://doi.o g/10.1371/ jou nal.ppa .1006977. 42. Reed JC, Mol e B, Gea y CD, McNe in J, McEl a h J, Gi i S, Klein KC, Lingappa JR. 2012. HIV-1 Gag co-op s a cellula complex con aining DDX6, a helicase ha acili a es capsid assembly. J Cell Biol 198:439–456. h ps://doi.o g/10.1083/jcb.201111012. 43. Lingappa JR, Reed JC, Tanaka M, Chu i aka K, Robinson BA. 2014. How HIV-1 Gag assembles in cells: pu ing oge he pieces o he puzzle. Vi us Res 193:89–107. h ps://doi.o g/10.1016/j. i us es.2014.07.001. 44. Doohe JE, Schneide BL, Reed JC, Lingappa JR. 2007. Hos ABCE1 is a plasma memb ane HIV assembly si es and i s dissocia ion om Gag is linked o subsequen e en s o i us p oduc ion. T a fic 8:195–211. h ps://doi.o g/10.1111/j.1600-0854.2006.00524.x. 45. Deng Y, Hammond JA, Pauszek R, Ozog S, Chai I, Rabuck-Gibbons J, Lamichhane R, Hende son SC, Milla DP, To be BE, Williamson JR. 2021. Disc imina ion be ween unc ional and non- unc ional cellula Gag com- plexes in ol ed in HIV-1 assembly. J Mol Biol 433:166842. h ps://doi.o g/ 10.1016/j.jmb.2021.166842. 46. Lyon K, Aguile a LU, Mo isaki T, Munsky B, S ase ich TJ. 2019. Li e-cell sin- gle RNA imaging e eals bu s s o ansla ional ameshi ing. Mol Cell 75: 172–183.E9. h ps://doi.o g/10.1016/j.molcel.2019.05.002. 47. Chen J, Liu Y, Wu B, Nikolai chik OA, Mohan PR, Chen J, Pa hak VK, Hu WS. 2020. Visualizing he ansla ion and packaging o HIV-1 ull-leng h RNA. P oc Na l Acad Sci U S A 117:6145–6155. h ps://doi.o g/10.1073/pnas .1917590117. 48. Pocock GM, Zimda s LL, Yuan M, Elicei i KW, Ahlquis P, She e NM. 2017. Di e se ac i i ies o i al cis-ac ing RNA egula o y elemen s e ealed using mul icolo , long- e m, single-cell imaging. Mol Biol Cell 28:476–487. h ps://doi.o g/10.1091/mbc.E16-08-0612. 49. Pocock GM, Becke JT, Swanson CM, Ahlquis P, She e NM. 2016. HIV-1 and M-PMV RNA nuclea expo elemen s p og am i al genomes o dis- inc cy oplasmic a ficking beha io s. PLoS Pa hog 12:e1005565. h ps://doi.o g/10.1371/jou nal.ppa .1005565. 50. Beh ens RT, Alige i M, Pocock GM, Higgins CA, She e NM. 2017. Nuclea expo signal masking egula es HIV-1 Re a ficking and i al RNA nu- clea expo . J Vi ol 91:e02107-16. h ps://doi.o g/10.1128/JVI.02107-16. 51. Jou ene N, Simon SM, Bieniasz PD. 2009. Imaging he in e ac ion o HIV- 1 genomes and Gag du ing assembly o indi idual i al pa icles. P oc Na l Acad Sci U S A 106:19114–19119. h ps://doi.o g/10.1073/pnas .0907364106. 52. Becke JT, She e NM. 2017. Subcellula localiza ion o HIV-1 gag-pol mRNAs egula es si es o i ion assembly. J Vi ol 91:e02315-16. h ps://doi .o g/10.1128/JVI.02315-16. 53. Ha aguchi H, Noda T, Kawaoka Y, Mo ikawa Y. 2012. A la ge ex ension o HIV-1 Gag, like Pol, has nega i e impac s on i ion assembly. PLoS One 7: e47828. h ps://doi.o g/10.1371/jou nal.pone.0047828. 54. Ka acos as V, Wol e EJ, Nagashima K, Gonda MA, Moss B. 1993. O e exp es- sion o he HIV-1 gag-pol polyp o ein esul s in in acellula ac i a ion o HIV- 1 p o ease and inhibi ion o assembly and budding o i us-like pa icles. Vi- ology 193:661–671. h ps://doi.o g/10.1006/ i o.1993.1174. 55. Pa k J, Mo ow CD. 1992. The nonmy is yla ed P 160gag-pol polyp o ein o human immunodeficiency i us ype 1 in e ac s wi h P 55gag and is inco po a ed in o i uslike pa icles. J Vi ol 66:6304–6313. h ps://doi.o g/ 10.1128/JVI.66.11.6304-6313.1992. 56. Yu FH, Chou TA, Liao WH, Huang KJ, Wang CT. 2015. Gag-Pol ans ame domain p6*is essen ial o HIV-1 p o ease-media ed i us ma u a ion. PLoS One 10:e0127974. h ps://doi.o g/10.1371/jou nal.pone.0127974. 57. K ausslich HG. 1991. Human immunodeficiency i us p o einase dime as componen o he i al polyp o ein p e en s pa icle assembly and i al in ec i i y. P oc Na l Acad Sci U S A 88:3213–3217. h ps://doi.o g/10 .1073/pnas.88.8.3213. 58. Bendjenna M, Sa a ian S. 2016. The ace agains p o ease ac i a ion defines he ole o ESCRTs in HIV budding. PLoS Pa hog 12:e1005657. h ps://doi.o g/10.1371/jou nal.ppa .1005657. 59. Adachi A, Gendelman HE, Koenig S, Folks T, Willey R, Rabson A, Ma in MA. 1986. P oduc ion o acqui ed immunodeficiency synd ome-associ- a ed e o i us in human and nonhuman cells ans ec ed wi h an in ec- ious molecula clone. J Vi ol 59:284–291. h ps://doi.o g/10.1128/JVI.59.2 .284-291.1986. HIV-1 Gag-Pol Inco po a ion Jou nal o Vi ology Janua y 2022 Volume 96 Issue 1 e01349-21 j i.asm.o g 17 Downloaded om h ps://jou nals.asm.o g/jou nal/j i on 13 No embe 2023 by 150.214.182.235. 60. Alige i M, Beh ens RT, Pocock GM, Schindelin J, Die z C, Elicei i KW, Swanson CM, Malim MH, Ahlquis P, She e NM. 2014. Coope a i i y among Re -associa ed nuclea expo signals egula es HIV-1 gene exp ession and is a de e minan o i us species opism. J Vi ol 88:14207–14221. h ps://doi .o g/10.1128/JVI.01897-14. 61. Vella S, Flo idia M. 1998. Saquina i . Clinical pha macology and e ficacy. Clin Pha macokine 34:189–201. h ps://doi.o g/10.2165/00003088-199834030 -00002. 62. Cheseb o B, Weh ly K, Nishio J, Pe yman S. 1992. Mac ophage- opic human immunodeficiency i us isola es om di e en pa ien s exhibi unusual V3 en elope sequence homogenei y in compa ison wi h T- cell- opic isola es: defini ion o c i ical amino acids in ol ed in cell opism. J Vi ol 66:6547–6554. h ps://doi.o g/10.1128/JVI.66.11.6547 -6554.1992. 63.NilsenBM,HauganIR,Be gK,OlsenL,B ownPO,HellandDE.1996. Monoclonal an ibodies agains human immunodeficiency i us ype 1 in eg ase: epi ope mapping and di e en ial e ec s on in eg ase ac i - i ies in i o. J Vi ol 70:1580–1587. h ps://doi.o g/10.1128/JVI.70.3 .1580-1587.1996. 64. Schindelin J, A ganda-Ca e as I, F ise E, Kaynig V, Longai M, Pie zsch T, P eibisch S, Rueden C, Saal eld S, Schmid B, Tine ez JY, Whi e DJ, Ha ens ein V, Elicei i K, Tomancak P, Ca dona A. 2012. Fiji: an open- sou ce pla o m o biological-image analysis. Na Me hods 9:676–682. h ps://doi.o g/10.1038/nme h.2019. 65. Shan L, Rabi SA, Lai d GM, Eisele EE, Zhang H, Ma golick JB, Siliciano RF. 2013. A no el PCR assay o quan ifica ion o HIV-1 RNA. J Vi ol 87: 6521–6525. h ps://doi.o g/10.1128/JVI.00006-13. 66. Yandell BS. 1997. P ac ical da a analysis o designed expe imen s. Chap- man & Hall, London, Uni ed Kingdom. 67. B uce JW, B acken M, E ans E, She e N, Ahlquis P. 2021. ZBTB2 ep esses HIV-1 ansc ip ion and is egula ed by HIV-1 Vp and cellula DNA damage esponses. PLoS Pa hog 17:e1009364. h ps://doi.o g/10.1371/jou nal.ppa .1009364. 68. Munk C, B and SM, Luce o G, Landau NR. 2002. A dominan block o HIV- 1 eplica ion a e e se ansc ip ion in simian cells. P oc Na l Acad Sci U S A 99:13843–13848. h ps://doi.o g/10.1073/pnas.212400099. 69. Bu le SL, Hansen MS, Bushman FD. 2001. A quan i a i e assay o HIV DNA in eg a ion in i o. Na Med 7:631–634. h ps://doi.o g/10.1038/87979. Benne e al. Jou nal o Vi ology Janua y 2022 Volume 96 Issue 1 e01349-21 j i.asm.o g 18 Downloaded om h ps://jou nals.asm.o g/jou nal/j i on 13 No embe 2023 by 150.214.182.235.