Conserved structure of IS200 elements in Salmonella

 1997 Ox o d Uni e si y P ess 1355–1361 Nucleic Acids Resea ch, 1997, Vol. 25, No. 7 Conse ed s uc u e o IS 200 elemen s in Salmonella Ca men R. Beuzón and Josep Casadesús* Depa amen o de Gené ica, Facul ad de Biología, Uni e sidad de Se illa, Apa ado 1095, E-41080 Se illa, Spain Recei ed Decembe 12, 1996; Re ised and Accep ed Feb ua y 7, 1997 DDBJ/EMBL/GenBank accession nos X56834, Y09564, Y08755 ABSTRACT Sequence analysis o h ee IS 200 elemen s ( wo om Salmonella yphimu ium , one om Salmonella abo uso is ) e eals a highly conse ed s uc u e, wi h a leng h o 707–708 bp and absence o e minal epea s. IS 200 con ains an open- eading- ame (ORF) which po en ially encodes a pep ide o 151 amino acids, wi h a pu a i e ibosome-binding-si e p ope ly placed ups eam o he ORF. A po en ial RNA s em– loop s uc u e ha migh occlude he ibosome- binding-si e o he ORF is also ound. Ano he conse ed ai is a po en ial RNA hai pin which esembles a Rho-independen ansc ip ion e mi- na o , loca ed nea one end o IS 200 . The junc ions be ween IS 200 and hos DNA sequences a e A+T- ich. Upon inse ion, IS 200 duplica es 1–2 bp o hos DNA sequences. The obse a ion ha IS 200 elemen s cha ac e ized as ‘hops’ a e oughly iden ical o hose esiding in he Salmonella genome sugges s ha IS 200 ansposi ion is unlikely o gene a e inac i e copies. I such is he case and many o all IS 200 elemen s a e ac i e, he ex emely low equency o IS 200 ans- posi ion may e lec he no mal beha io o he elemen . INTRODUCTION IS200 is an inse ion elemen abundan in he genus Salmonella (1,2) and spo adically ound in s ains o Shigella (2), Esche ichia coli (3) and Ye sinia (4). The ch omosome o Salmonella yphimu ium LT2 con ains six copies o IS200 (1,5,6); in o he S. yphimu ium s ains he numbe o IS200 copies anges om 1 o >12 (2). One pa adoxical ai o IS200 beha io is i s poo con ibu ion o spon aneous mu agenesis (7,8), which can be co ela ed wi h he ex emely low ansposi ion equency o he elemen (8–10). In ac , only wo IS200 inse ion mu a ions ha e been epo ed in S. yphimu ium: one in he his ope on (1), ano he in he gp gene (8). Hun s o IS200-induced mu an s in S. yphimu ium, some imes in ol ing posi i e selec ion s a egies, ha e con i med ha ansposi ion is a e (7–10). Fu he mo e, su eys ca ied ou in ield isola es ha e indica ed ha IS200 ansposi ion is also in equen in na u al popula ions o Salmonella (11). One possible explana ion o he low ac i i y o IS200 migh be he gene a ion a ela i ely high equencies o de ec i e copies o he elemen . Such a beha io has no p eceden s among p oka yo ic inse ion elemen s (12) bu is ela i ely common in euka yo ic ansposons (13). To in es iga e his possibili y, we compa ed he s uc u e o IS200 ‘hops’ wi h ha o ‘genomic copies’ o he elemen . The esul s we e unequi ocal: elemen s cha ac e ized as IS200 hops a e ex emely simila , i no iden ical, o IS200 elemen s esiding in he Salmonella genome. Thus IS200 ansposi ion is unlikely o gene a e inac i e o abe an copies. A co olla y is ha he ex emely low equency o IS200 ansposi ion and i s sca ce con ibu ion o spon aneous mu agenesis likely e lec he no mal beha io o he elemen . Cladog ams cons uc ed wi h he p edic ed pep ides o IS200 ORFs om Salmonella, E.coli and Ye sinia ma ch he phylogene ic ee o he En e obac e iaceae (14,15). This obse a ion gi es suppo o he hypo hesis ha IS200 is an ances al elemen o en e ic bac e ia (16). MATERIALS AND METHODS Bac e ial s ains and plasmids All s ains and isola es o S. yphimu ium used in his wo k de i e om he s anda d wild- ype LT2. S ain SS44 o Salmonella abo uso is (17) was p o ided by S. Rubino, Ins i u e o Mic obiology, Uni e si à degli S udi di Sassa i, Sassa i, Sa dinia, I aly. The plasmid ec o s used o cloning we e pBluesc ip I KS(+) and pBluesc ip II SK(+) (S a agene, La Jolla, CA). pIZ46 is a pUC19 de i a i e ca ying a ail- o- ail dime o he 0.3 kb EcoRI–HindIII agmen o IS200 (2). pIZ47 is a pUC19 de i a i e ca ying a e ame o he in e nal TaqI agmen o IS200, lanked by EcoRI si es (I. Gibe and J. Casadesús, unpublished). T ans o ma ion wi h plasmid DNA ollowed he p ocedu e o Inoue e al. (18). The ecipien s ain o ans o ma ion was E.coli DH5α (19). Media and chemicals Lu ia–Be ani medium (LB) wi h added NaCl (5 g/l) was used as he s anda d ich b o h. Solid medium con ained Di co aga a a inal concen a ion o 1.5%. EBU indica o pla es we e p epa ed as desc ibed elsewhe e (20). Concen a ions o an ibio ics we e as ollows: kanamycin sul a e (Sigma, S Louis, MO), 50 mg/l; ampicillin (Sigma), 100 mg/l. The indica o 5-b omo-4-chlo o-3- indolyl-β-D-galac opy anoside (‘X-gal’, Uni ed S a es Bio- logical, Swampsco , MA), was dissol ed in N,N-dime hyl o ma- mide (2 mg/ml) and used a he inal concen a ion o 25 µg/ml. Fo gel elec opho esis, aga ose (SeaKem, FMC, Rockland, ME) was p epa ed in ei he TAE o TBE bu e s (21). The inal aga ose concen a ion (0.7–1.0%) depended on he ange o DNA *To whom co espondence should be add essed. Tel: +34 5 455 7105; Fax: +34 5 455 7104; Email: [email p o ec ed] Nucleic Acids Resea ch, 1997, Vol. 25, No. 7 1356 agmen s o be sepa a ed. E bu e con ained 40 mM T is-base and 2 mM EDTA; pH was adjus ed o 7.9 wi h glacial ace ic acid. The lysis solu ion con ained 3% sodium dodecyl sul a e, 50 mM T izma base and 72 mM NaOH. Bac e iophages and ansduc ion The ansducing phage was P22 HT 105/1 in 201 (22), hence o h e e ed as P22 HT. Phage sensi i i y was es ed wi h he clea -plaque mu an P22 H5. To ob ain phage- ee isola es, ansduc an s we e pu i ied on EBU pla es. Fo ansduc ion o an ibio ic- esis ance ma ke s (e.g. Km ), ansducing mix u es we e made on LB pla es and incuba ed 4–5 h be o e eplica-p in ing o selec i e pla es wi h s e ile el e s. Vi ulence plasmid cu ing Cu ing o he i ulence plasmid (pSLT) o S. yphimu ium was achie ed by des abiliza ion o he pa locus wi h a kanamycin- esis an ca idge (23). The Km ca idge was in oduced in o he s ain o be cu ed by P22 HT ansduc ion. Km ansduc an s we e s eaked on EBU pla es; indi idual phage- ee colonies we e hen sco ed o loss o kanamycin esis ance. DNA ex ac ion and pu i ica ion Genomic DNA p epa a ions we e ob ained acco ding o Ausubel e al. (24), using 10 ml o an o e nigh cul u e. Plasmid DNA o bo h clone analysis and DNA sequencing was ob ained wi h he alkaline lysis me hod, wi hou phenol ex ac ion (25). Plasmid DNA p epa a ions o he gene a ion o nes ed dele ions we e ob ained wi h he ‘boiling’ me hod (26), ollowed by pu i ica ion in Sephadex G-50 columns. Vi ulence plasmid DNA was ex ac ed as desc ibed elsewhe e (11). Diges ion, end modi ica ion and liga ion o DNA agmen s Res ic ion enzymes we e pu chased om P omega Bio ech (Madison, WI), Boeh inge Mannheim (Mannheim, Ge many) and New England Biolabs (Be e ly, MA). The bu e s used we e hose p o ided by he supplie . Fo mul iple diges ions, we used he ‘One-pho -all’ bu e (Pha macia Bio ech, San F ancisco, CA). Deoxy ibonucleo ides and Klenow DNA polyme ase we e pu chased om P omega Bio ech. T4 polynucleo ide ligase was om Boeh inge Mannheim; liga ion was achie ed by incuba ing >12 h a 16C. Fo blun end liga ion, a low-ATP bu e was used (New England Biolabs, unpublished obse a ions). DNA hyb idiza ion Diges ion o DNA wi h es ic ion enzymes, elec opho e ic sepa a ion o es ic ion agmen s, DNA dena u a ion, ans e o DNA om aga ose gels o nylon il e s, DNA labeling and DNA hyb idiza ion ollowed he p ocedu es desc ibed by Sou he n (27) and Samb ook e al. (21). Reco e y o DNA om aga ose gels was achie ed wi h he GeneClean sys em (Bio 101, La Jolla, CA). The s anda d IS200 p obes we e he EcoRI agmen s o pIZ46 and pIZ47. These agmen s we e eco e ed om aga ose gels and pu i ied by he GeneClean sys em (Bio 101), modi ied acco ding o Boyle and Lew (28). DNA p obes we e labeled wi h he DIG DNA labeling ki om Boeh inge Mannheim. Gene a ion o nes ed dele ions Dele ions we e gene a ed wi h E.coli exonuclease III, using he double-s anded nes ed dele ion ki om Pha macia Bio ech. P o ec ed, 3′ o e hanging ends we e gene a ed by ApaI diges ion, while he subs a e o exonuclease III diges ion was gene a ed wi h ClaI. Dele ed plasmids we e ea ed wi h nuclease S1 o gene a e blun ends; hese we e hen liga ed wi h T4 poly- nucleo ide ligase. DNA sequencing Sequencing eac ions we e pe o med wi h he dideoxy chain e mina ion p ocedu e (29), using he Sequenase ki e sion 2.0 (Uni ed S a es Biochemical Co po a ion, Cle eland, OH). The p ime s used o sequencing a e shown in Table 1. Sequencing gels we e p epa ed in TBE and con ained 6% ac ylamide and 500 g/l u ea. Gels we e un in a Poke Face SE1500 sequence (Hoe e Scien i ic Ins umen s, San F ancisco, CA), d ied in a Slab Gel D ye , model SE1160 (Hoe e ) and de eloped by exposu e o an X- ay ilm. Sequence analysis and phylogeny me hods We used he compu e analysis package o he Gene ics Compu e G oup, Uni e si y o Wisconsin, Madison, WI (30). F ee ene gies o RNA seconda y s uc u es we e calcula ed wi h he p og am ‘Fold RNA’ (31). E olu iona y dis ances be ween pep ide sequences we e measu ed using he Jukes–Can o algo i hm (32). Phylogene ic ees we e cons uc ed wi h he G owT ee p og am, using he ‘unweigh ed pai -g oup a ihme ic a e age’ (UPGMA) me hod (33). RESULTS Sequence analysis o he inse ion hisD984::IS200 The o iginal mu a ion hisD984::IS200 (1) had been p e iously cloned on se e al plasmid ec o s (2). One o hese clones, pIZ44, is a pUC9 de i a i e ca ying a ∼2 kb inse which includes he inse ion hisD984::IS200 and lanking sequences o he S. yphimu ium his ope on (2). DNA sequencing o he hisD984::IS200 inse ion (hence o h called IS200-HIS) was ca ied ou di ec ly on pIZ44, using p ime s I, II and V (Table 1). These p ime s we e designed using p e ious sequencing da a (34). The EMBL accession numbe o IS200-HIS is X56834. The p edic ed IS200 ORF (see below) uns opposi e o hisD ( o a map o he his idine ope on; e . 35). Table 1. DNA p ime s used o sequencing IS200 elemen s P ime Sequence (5′–3′) O igin T3 ATTAACCCTCACTAAAG pBluesc ip T7 AATACGACTCACTATAG pBluesc ip I GTGCAGAGGGTACTATC IS200 II GAGCTTAGCGCACACCC IS200 III CCCGCCGAAGATGAGTGTGT IS200 IV GTCTTCGGTATTTGGGCGC IS200 VCTGCCTACTGCCCTACGCTTCT IS200 1357 Nucleic Acids Resea ch, 1994, Vol. 22, No. 1 Nucleic Acids Resea ch, 1997, Vol. 25, No. 7 1357 Cha ac e iza ion o an IS200 elemen inse ed in he S. yphimu ium i ulence plasmid Inc ease in he numbe o IS200 elemen s is obse ed a low bu de ec able equencies among he su i o s o s ab cul u es (1,9,10), a beha io p e iously epo ed o o he inse ion elemen s (36–38). Howe e , in a gi en s ain, IS200 copy numbe can po en ially inc ease by duplica ion o ch omosomal egions (39). This ca ea di ec ed ou sea ch o he de ec ion o IS200 inse ions in he S. yphimu ium i ulence plasmid; he a ionale was ha a ‘hop’ in ans was unlikely o be caused by DNA ea angemen s o he han ansposi ion. Because he i ulence plasmid (pSLT) o S. yphimu ium LT2 does no ca y IS200 (5), he p esence o IS200 inse ions in pSLT can be sco ed by compa ing he IS200 p o iles o isola es ca ying ex a IS200 copies and hose o de i a i es cu ed o he i ulence plasmid. Cu ing o pSLT was achie ed wi h he me hod o Tinge and Cu iss III (23). Analysis o 54 LT2 de i a i es ca ying mo e han six IS200 copies yielded h ee independen examples o plasmid-bo ne IS200 elemen s. Sou he n hyb idiza ion analysis o pSLT DNA diges ed wi h P uII, HincII, Ps I and A aI (and wi h combina ions o hese enzymes) indica ed ha P uII–HincII diges ion o one o he candida es gene a ed a band o only 3.7 kb, absen in he cu ed de i a i e. This 3.7 kb agmen was cloned on o he SmaI si e o pBluesc ip II SK(+) o gene a e plasmid pIZ801. Nes ed dele ions wi h exonuclease III educed he size o he inse o pIZ801 o 1 kb; Sou he n hyb idiza ion analysis indica ed ha he esul ing plasmid, pIZ802, s ill ca ied IS200. The inse o pIZ802 was sequenced using p ime s T7, T3, III and IV (Table 1). This IS200 elemen inse ed in he i ulence plasmid (EMBL accession no. Y09564) will be hence o h called IS200-VP. Cha ac e iza ion o an IS200 elemen om S.abo uso is S ain SS44 o S.abo uso is ca ies an IS200 elemen on a ∼9 kb Ps I ch omosomal agmen (11). Ps I agmen s o ∼9 kb om S.abo uso is SS44 we e cloned on o pBluesc ip I KS(+). The p esence o IS200 among Lac–, Ap ans o man s o E.coli DH5α was sc eened by Sou he n hyb idiza ion, using he EcoRI agmen o pIZ46 as a p obe (2). One posi i e isola e was he sou ce o plasmid pIZ72. Res ic ion analysis p o ed ha pIZ72 ca ied an inse o 9.5 kb. This inse was spli in wo agmen s o 6.5 and 3 kb by S uI diges ion. The 3 kb agmen (bu no he 6.5 kb agmen ) hyb idized agains IS200 p obes, sugges ing ha he IS200 elemen was loca ed in he small S uI agmen . The la e was cloned on o pBluesc ip I KS(+) o gene a e plasmid pIZ73. To educe he size o he 3 kb S uI agmen o pIZ73, nes ed dele ions we e gene a ed wi h exonuclease III. The p esence o IS200 among dele ion de i a i es o pIZ73 was de ec ed by Sou he n hyb idiza ion, as abo e. One plasmid ca ying a ∼1 kb inse (pIZ74) was chosen o DNA sequencing wi h p ime s I, II, V, T3 and T7. This IS200 elemen (EMBL accesion no. Y08755) will be hence o h called IS200-SAO. Gene al ea u es o IS200 elemen s om Salmonella The h ee IS200 elemen s sequenced a e e y simila . IS200-HIS is 707 bp, while IS200-VP and IS200-SAO a e bo h 708 bp. Some ele an ea u es ound in hei sequences a e as ollows. (i) All elemen s lack e minal epea s, as p e iously epo ed (8,34,40). The ends o he h ee elemen s a e highly conse ed: in he le -mos 50 bp, only 1 bp di e ence is ound be ween IS200-HIS and IS200-VP, while IS200-SAO shows a 2 bp di e ence wi h bo h IS200-HIS and IS200-VP. In u n, he igh -mos 50 bp a e iden ical in IS200-HIS and IS200-VP and 1 bp di e ence (wi h bo h) is ound in IS200-SAO. (ii) The h ee elemen s con ain a single ORF which can po en ially yield a pep ide o 151 amino acids. The p edic ed pep ides encoded by IS200-HIS and IS200-VP a e iden ical, while he p edic ed pep ide o IS200-SAO shows ou amino acid changes (Fig. 1). The numbe o changes in he nucleo ide sequence o he ORFs a e as ollows: (a) only 1 bp di e ence (a a hi d-codon posi ion) be ween IS200-HIS and IS200-VP; (b) 10 n di e ences (six a hi d-codon posi ions) be ween IS200-SAO and IS200-HIS; (c) 11 n di e ences (se en a hi d-codon posi ions) be ween IS200-SAO and IS200-VP. Thus he di e gence is highe a he DNA le el han a he pep ide le el, sugges ing ha he coding capaci y o he ORF is selec i ely main ained. A da abank sea ch indica ed ha he IS200 ORF is ela ed o he ansposase o IS1004, an inse ion elemen ound in Vib io chole ae (41). Addi ional e idence ha he IS200 ORF may encode he ansposase o he elemen is p o ided by he obse a ion ha exp ession o he IS200 ORF om an inducible p omo e inc eases he equency o a ious IS200-associa ed DNA ea angemen s (42; C. R. Beuzón and J. Casadesús, unpublished). Un o una ely, he a i y o IS200 ansposi ion has so a hampe ed a di ec su ey o he unc ion o ORF1 (e.g. mu a ions in ORF1 should ende a non- ansposing elemen ). (iii) A po en ial ibosome-binding si e (5′-AGGGG-3′) is loca ed be ween nucleo ides –5 and –9 ups eam o he s a codon o he ORF. The sequence di e s only 1 bp om he consensus and is loca ed a a s anda d dis ance om he s a codon (43,44). This pu a i e ibosome-binding-si e is 100% conse ed in all elemen s cha ac e ized in his s udy (and in IS200 elemen s om o he sou ces: see below). (i ) Two egions ha can be expec ed o gi e ise o seconda y s uc u es in hei ansc ip s a e ound ups eam o he ORF. The le -mos s uc u e (nucleo ides 9–32) can gi e ise o a hai pin (∆G0: –14.1 kcal/mol) which eminds o a Rho-independen ansc ip ion e mina o (Fig. 2). This egion has been ac ually shown o cause he pola i y o he inse ion hisD984::IS200 on he dis al gene hisC (40). The po en ial hai pin is iden ical in IS200-HIS and IS200-VP and shows a 1 bp di e ence (loca ed in he s em) in IS200-SAO. T ansc ip ional e mina o s, bo h Rho-dependen and Rho-independen , ha e been ound nea he ends o many inse ion sequences and a e usually ega ded as con ol elemen s ha e mina e ansc ip s en e ing he IS (12). The second s uc u e is de ined by wo in e ed epea s loca ed be ween nucleo ides 66–85 and 120–139. The second epea is only 3 bp away om he s a o he ORF. The in e ed epea s can gi e ise o a s em–loop s uc u e in he ansc ip (∆G0: –25.8 kcal/mol). I o med, his s uc u e migh cause occlusion o he ibosome-binding-si e (Fig. 2). The po en ial s em–loop egion is iden ical in IS200-HIS and IS200-SAO and shows a 1 bp di e ence (in he s em) in IS200-VP. Res ic ion analysis o IS200 elemen s om S. yphimu ium LT2 Fi e IS200 elemen s p esen in he ch omosome o S. yphimu ium LT2 (copies I, II, III, V and VI; 5,6) we e cloned using ‘locked-in’ Nucleic Acids Resea ch, 1997, Vol. 25, No. 7 1358 Figu e 1. Alignmen o he p edic ed pep ides encoded by he ORF o IS200 elemen s om a ious sou ces. HIS, VP and SAO a e he h ee IS200 elemen s sequenced in his wo k. Copy IV is one o he IS200 elemen s o he S. yphimu ium ch omosome (5,6,46). SARA17 is ano he Salmonella IS200 elemen (3), while ECOR8, ECOR51, ECOR63 and ECOR72 a e IS200 elemen s om E.coli (3). An IS200 elemen om Y.pes is (4) is also included. Columns a e shaded when mo e han hal o he en ies a e iden ical. Mud-P22 p ophages (10,45). Diges ions we e ca ied ou wi h es ic ion enzymes ha gene a e dis inc es ic ion agmen s in he elemen s IS200-HIS, IS200-VP and IS200-SAO: HpaII, HaeIII, HindIII, HphI and EcoRI. Res ic ion agmen s we e hen analyzed by Sou he n hyb idiza ion agains IS200 p obes. The i e elemen s p o ed o ha e iden ical es ic ion maps (da a no shown). These esul s sugges ha IS200 elemen s om S. yphimu ium ha e a highly conse ed s uc u e, as p e iously p oposed (3). Copy IV was no included in hese expe imen s because i has been al eady sequenced (46); i is ex emely simila o bo h IS200-HIS and IS200-VP (see below). Sequence compa isons among IS200 elemen s om a ious sou ces Sequences o o he IS200 elemen s we e e ie ed om he EMBL da abank and used o u he compa isons. The se- quences compiled we e: (i) he comple e sequence o an IS200 elemen om Ye sinia pes is (6); (ii) he comple e sequence o IS200 copy IV om he ch omosome o S. yphimu ium (46); he pa ial sequences ob ained o an IS200 elemen om Salmonella s ain SARA17 (16) and o IS200 elemen s om E.coli s ains ECOR8, ECOR51, ECOR63 and ECOR72 (16). Rele an da a a e as ollows. (i) IS200 copy IV is 710 bp (46), ha is, 2 bp longe han IS200-SAO and IS200-VP and 3 bp longe han IS200-HIS. The IS200 elemen om Y.pes is is 709 bp (4). The leng h o he IS200 elemen s om s ains SARA17, ECOR8, ECOR51, ECOR63 and ECOR72 is no known (16). (ii) Only 1 bp change is ound in he 50 bp o he le end o IS200 copy IV, wi h espec o IS200-HIS and IS200-VP. Likewise, 1 bp change is ound in he igh end. The ends o he IS200 elemen om Y.pes is a e also ex emely simila o hose o IS200-HIS, IS200-SAO and IS200-VP: only 2 bp di e ences om each o he IS200-HIS ends; 3 and 2 bp, espec i ely, wi h he igh and le ends o IS200-VP; 4 and 1 bp di e ences wi h he ends o IS200-SAO. The ends o he IS200 elemen s ound in s ains SARA17, ECOR8, ECOR51, ECOR63 and ECOR72 ha e no been sequenced (3,16). (iii) The IS200 elemen om Y.pes is con ains an ORF ha po en ially encodes a pep ide o 151 amino acids, like IS200-SAO, IS200-VP and IS200-HIS. Howe e he ORF om 1359 Nucleic Acids Resea ch, 1994, Vol. 22, No. 1 Nucleic Acids Resea ch, 1997, Vol. 25, No. 7 1359 Figu e 2. (A) P edic ed s uc u e o he highly conse ed RNA hai pin loca ed nea he le end o IS200. Base pai numbe s a e o IS200-HIS. (B) P edic ed s uc u e o he s em–loop RNA s uc u e ha p ecedes he IS200 ORF. ‘SD’ indica es he posi ion o he pu a i e ibosome-binding-si e, whose bases a e shown in bold ace. The posi ion o he s a codon o he ORF is also shown. he Y.pes is IS200 elemen shows 14 amino acid di e ences wi h he ORFs o IS200-HIS and IS200-VP (which a e iden ical). The numbe o amino acid di e ences be ween IS200 SARA17 and he pai IS200-HIS / IS200-VP is only i e. In ac , ou o hese changes a ec he las i e amino acids o he p edic ed pep ide and a e caused by a single –1 ameshi in IS200 SARA 17. The ORF o IS200 copy IV is iden ical o ha o IS200 SARA 17. (i ) The ORFs o he E.coli IS200 elemen s (3) encode po en ial pep ides o ei he 152 amino acids (ECOR8, ECOR51 and ECOR63) o 142 amino acids (ECOR72). The numbe o amino acid di e ences be ween hese elemen s and he pai IS200-HIS/IS200-VP anges om 9 o 15. ( ) Excep when ameshi s a e in ol ed, he di e ences in amino acid composi ion o he ORF unde es ima e he nucleo ide a ia ion among IS200 elemen s. Fo ins ance, he ollowing nucleo ide di e ences a e ound be ween he IS200-HIS ORF egion and he ORFs o o he elemen s: IS200-VP, 1 bp; IS200 SARA17, 4 bp; IS200-SAO, 10 bp; IS200 ECOR51, 48 bp; and IS200 ECOR72, 49 bp; IS200 ECOR 63, 52 bp; IS200 ECOR8, 53 bp; IS200 om Y.pes is, 75 bp. Because he ORF is he only egion sequenced in all IS200 elemen s cha ac e ized om di e en hos s, we used he di e - ences in he composi ion o hei p edic ed pep ides o ob ain he phylogene ic ee shown in Figu e 3. This ee ep oduces he phylogeny o he bac e ial species used as sou ces o IS200 (Salmonella, E.coli and Ye sinia: 14,15) and also e lec s he ela edness among Salmonella species o se o a s (47). These esul s a e he e o e suppo i e o he model ha IS200 is an ances al elemen o he En e obac e iaceae (16). Figu e 3. E olu iona y ee o IS200 elemen s om Salmonella, E.coli and Ye sinia, cons uc ed using he p edic ed amino acid sequences o he pep ides encoded by he IS200 ORF. A key o he names and ac onyms used o designa e IS200 elemen s is gi en in he legend o Figu e 1. The scale ba co esponds o one subs i u ion pe 100 amino acids. Ou side he ORF, ex emely high sequence conse a ion is also ound in he hai pin and s em–loop egions o IS200: o ins ance no di e ences a e ound in hese DNA ac s be ween IS200 copy IV (46) and he h ee elemen s whose sequence is epo ed in his wo k (IS200-SAO, IS200-VP and IS200-HIS). The pu a i e ibosome-binding-si e is also 100% conse ed in all IS200 elemen s, i espec i e o hei o igin. Cha ac e iza ion o IS200 inse ion si es The DNA sequences lanking he IS200 elemen inse ed a hisD show wo A–T pai s a each side o he elemen (Fig. 4), hus con i ming ha inse ion o IS200 a his si e caused a 2 bp duplica ion, as p e iously epo ed (40). In u n, a da abank sea ch o sequences homologous o he egions which lank he IS200 inse ion in pSLT indica ed ha IS200 had inse ed in o he imb ial ope on pe (48). An ex a A–T pai is ound a he IS200 inse ion si e, sugges ing ha IS200 inse ion a his si e has gene a ed a 1 bp duplica ion. The IS200 elemen om he S.abo uso is ch omosome is lanked by wo A–T pai s a one side and eigh A–T pai s a he o he side (Fig. 4). Because an IS200- ee e sion o his locus is no a ailable, he occu ence o a duplica ion canno be con- i med. Howe e , he p esence o A–T pai s a bo h sides sugges s ha duplica ion o ei he 1 o 2 bp may ha e occu ed. Suppo o he hypo hesis ha IS200 may duplica e 1 o 2 bp a he inse ion si e is p o ided by addi ional da a collec ed om he li e a u e (4,8) and om da abases (46). These da a, included in Figu e 4, a e as ollows. (i) The IS200 elemen inse ed in he gp gene is lanked by h ee A–T pai s a one side and ou A–T pai s a he o he side (8). Thus duplica ion o 1–3 bp may ha e occu ed. The exis ence o a duplica ion canno be con i med because he wild- ype gp sequence is no a ailable. (ii) The IS200 elemen inse ed in he in A gene o Y.pes is is lanked by ou A–T pai s a one side and wo A–T pai s a he o he side (4); hus duplica ion o 1–2 bp may ha e occu ed. The wild- ype sequence o he in A locus is no a ailable. Howe e , Nucleic Acids Resea ch, 1997, Vol. 25, No. 7 1360 Figu e 4. Junc ions be ween IS200 elemen s and hos sequences. The h ee uppe examples a e om elemen s sequenced in his s udy; sequences o he o he IS200 elemen s ha e been e ie ed om he li e a u e (4,8) o om he EMBL da abank (46). in A loci ha e been sequenced in Y.en e ocoli ica (49,50) and Y.pseudo ube culosa (51). These loci a e homologous o he Y.pes is in A gene (77 and 94%, espec i ely). When he compa ison is ca ied ou o he 30 bp ha lank he inse ion si e, he homology is 100% and he only di e ence is he p esence o wo ex a A–T pai s a he inse ion si e. Thus a 2 bp duplica ion mus ha e occu ed. Alignmen o IS200 inse ion si es does no disclose any signi ican homologies; howe e , all he IS200 inse ion si es appea o be A+T- ich: in he neighbo ing 13–25 bp, he pe cen ages o A+T base pai s ange be ween 76 and 95%. Thus we en a i ely sugges ha IS200 may ha e egional speci ici y o A+T- ich DNA ac s, like o he inse ion elemen s (52–54). DISCUSSION Sequence compa isons sugges ha IS200 was al eady p esen in he common ances o o E.coli, Salmonella and Ye sinia, a hypo hesis ha ul ills he p edic ions o Bise cic and Ochman (16). The ecen disco e y o an IS200-like elemen in Vib io (41), a genus un ela ed o en e ic bac e ia, migh indica e ei he he exis ence o IS200 in emo e s ages o bac e ial e olu ion o he occu ence o ho izon al ans e . The la e is ega ded as a a e e en among bac e ia (55), bu inse ion sequences a e po en ial excep ions (56). In he case discussed he e, he high di e gence be ween IS200 elemen s om en e ics and he V.chole ae IS200-like elemen seems o ule ou ecen ho izon al ans e (e.g., he p edic ed amino acid sequence o he ORF o he V.chole ae IS200 elemen shows only a 40% iden i y wi h IS200-HIS). Thus IS200 may be an ex emely old ansposable elemen . The IS200 elemen s cha ac e ized in his s udy a e 707–708 bp, while S. yphimu ium copy IV is 710 bp (46) and he Y.pes is IS200 elemen is 709 bp (4). A size o 707–710 bp makes IS200 one o he smalles inse ion elemen s ound in bac e ia (12). Ano he ele an ea u e, he lack o e minal epea s, is a e among p oka yo ic inse ion elemen s (12), albei wi h well- known excep ions like bac e iophage Mu (57). All IS200 inse ion si es show a high A+T con en , bu a consensus a ge si e canno be deduced om he inse ion si es a ailable. I he numbe o a ge s s udied is signi ican , he p e e ence o IS200 o A+T- ich egions may co ela e he beha io o IS200 wi h ha o elemen s ha show egional speci ici y bu no de ined a ge s: o ins ance, IS1 (52–54), IS21 (58), IS50 (59,60) and IS186 (61,62). Regional speci ici y may be aken as e idence ha he ansposase o he elemen ecognizes a opological DNA s uc u e, a he han a de ined a ge (63,64). IS200 gene a es duplica ions o 1–2 bp a he inse ion si e (Fig. 4), al hough he da a a ailable do no exclude he possibili y o longe duplica ions (e.g., 3 bp). I con i med, he o ma ion o duplica ions o a iable leng h would es ablish again a pa allel- lism be ween IS200 and IS1 (54,65), IS21 (58) and IS186 (61,62). The sca ci y o IS200-induced mu a ions and he lack o eliable ansposi ion assays aised he ques ion o whe he he Salmonella genome migh con ain inac i e (i.e., degene a e) IS200 copies (9). Howe e , his s udy seems o ule ou his possibili y: IS200 ‘hops’ and IS200 elemen s esiding in he Salmonella genome a e simila o iden ical; hus mos , pe haps all Salmonella IS200 elemen s can be expec ed o be ac i e. I such is he case, he ex emely low equency o IS200 ansposi ion (9,10) mus e lec he no mal beha io o he elemen . This hypo hesis is suppo ed by he obse a ion ha na u al isola es o Salmonella show s able S200 inge p in s (11). Al hough he da a a ailable a e la gely desc ip i e, ce ain s uc u al ea u es o IS200 sugges hypo he ical mechanisms ha migh educe he ac i i y o he elemen . The pu a i e ansposase gene appea s o be ansc ibed a ex emely low a es (10). In addi ion, he hai pin loca ed nea he le end o IS200 migh p e en ansc ip ion om ex e nal p omo e s and he s em–loop ha occludes he ibosome-binding-si e o he pu a i e anspo- sase gene migh keep ansla ion low. Al hough he exis ence o hese mul iple con ols awai s expe imen al con i ma ion, i p o ides a model o explain he pa adoxical beha io o IS200, an inse ion elemen ha a ely ‘hops’. A low equency o ansposi ion can be iewed as a sel - es ain mechanism (66); hus he low ac i i y o IS200 migh ha e ac ually a o ed i s e olu iona y pe sis ence. ACKNOWLEDGEMENTS This s udy was suppo ed by g an PB93/649 om he Di ección Gene al de In es igación Cien í ica y Técnica (DGICYT) o 1361 Nucleic Acids Resea ch, 1994, Vol. 22, No. 1 Nucleic Acids Resea ch, 1997, Vol. 25, No. 7 1361 Spain. Addi ional unding was p o ided by he Regional Go e nmen o Andalusia (Jun a de Andalucía). We a e g a e ul o Angela Schia ino o he con ibu ion o he cloning o IS200-SAO, o Ja ie Ruiz Albe o ad ice abou DNA sequencing, o Nicolás P ados o help wi h compu e p og ams and o Gab iel Gu ié ez o ad ice on phylogene ic ees. We hank John Ro h, Ken Haack, Fe nando Go an es and Edua do San e o o help ul discussions. We also acknowledge he e icien assis ance ecei ed om José Có doba and Luis Romanco. REFERENCES 1 Lam, S. T. and Ro h J. R. (1983) Cell, 34, 951–960. 2 Gibe , I., Ba bé, J. and Casadesús, J. (1990) J. Gen. Mic obiol., 136, 2555–2560. 3 Bise cic, M. and Ochman, H. (1993) Gene ics, 133, 449–454. 4 Simone , M., Rio , B., Fo ineau, N. and Be che, P. (1996) In ec . Immun., 64, 375–379. 5 Lam, S. T. and Ro h, J. R. (1983) Gene ics, 105, 801–811. 6 Sande son, K. E., Scio e, P., Liu, S. L. and Hessel, A. (1993) J. Bac e iol., 175, 7624–7628. 7 Casadesús, J. and Ro h, J. R. (1989) Mol. Gen. Gene ., 216, 210–216. 8 O’Reilly, C., Black, G. W., La ey, R. and McConnell, D. J. (1990) J. Bac e iol., 172, 6599–6601. 9 Casadesús, J., Beuzón, C. R. and Gibe , I. (1992) Gene . (Li e Sci. Ad .), 11, 179–186. 10 Beuzón, C. R. (1996) S uc u al and unc ional analysis o inse ion elemen IS200. Ph. D. Thesis, Uni e si y o Se ille, Se ille, Spain. 11 Schia ino, A., Beuzón, C. R., Uzzau, S., Leo i, G., Cappuccinelli. P., Casadesús, J. and Rubino, S. (1996) Appl. En i on. Mic obiol., 62, 2375–2380. 12 Galas, D. J. and Chandle , M. (1989) In Be g, D. E. and Howe, M. M. (eds) Mobile DNA. Ame ican Socie y o Mic obiology, Washing on, DC, pp. 109–162. 13 Finnegan, D. J. (1989) T ends Gene ., 5, 103–107. 14 Ochman, H. and Wilson, A. C. (1987) In Neidha d . F. C., Ing aham, J. L., Low, K. B., Magasanik, B., Schaech e , M. and Umba ge , H. E. (eds) Esche ichia coli and Salmonella yphimu ium. Cellula and Molecula Biology. Ame ican Socie y o Mic obiology, Washing on, DC, pp. 1649–1654. 15 Law ence, J. G., Ha l, D. L. and Ochman, H. (1991) J. Gen. Mic obiol., 137, 1911–1921. 16 Bise cic, M. and Ochman, H. (1993) J. Bac e iol., 175, 7863–7868. 17 Colombo, M. M., Leo i, G., Rubino, S., Ba ba o, A. and Cappuccinelli, P. (1992) J. Gen. Mic obiol., 138, 725–731. 18 Inoue, H., Nojima, H. and Okayama, H. (1990) Gene, 93, 26–28. 19 Yanisch-Pe on, V., Viei a, J. and Messing, J. (1985) Gene, 33, 103–119. 20 Ga zón, A., Beuzón, C. R., Mahan, M. J. and Casadesús, J. (1996) Mol. Gen. Gene ., 250, 570–580. 21 Samb ook, J., F i sch, E. F. and Mania is, T. (1989) Molecula Cloning; A Labo a o y Manual. 2nd. edi ion. Cold Sp ing Ha bo Labo a o y P ess, Cold Sp ing Ha bo , NY. 22 Schmiege , H. (1972) Mol. Gen. Gene ., 119, 75–88. 23 Tinge, S. A. and Cu iss, R. III (1990) In ec . Immun., 58, 3084–3092. 24 Ausubel, F. M., B en , R., Kings on, R. E., Moo e, D. D., Seidman, J. G., Smi h, J. A. and S uhl, K. (1987) Cu en P o ocols in Molecula Biology. G eene Publishing Associa es & Wiley In e science, New Yo k, NY. 25 S ephen, D., Jones, C. and Scho ield, P. J. (1990) Nucleic Acids Res., 18, 7463–7464. 26 Holmes, D. S. and Quigley, M. (1981) Anal. Biochem., 114, 193–197. 27 Sou he n, E. M. (1975) J. Mol. Biol., 98, 503–517. 28 Boyle, J. S. and Lew, A. M. (1995) T ends Gene ., 11, 8. 29 Sange , F., Nicklen, S. and Coulson, A. R. (1977) P oc. Na l. Acad. Sci. USA, 74, 5463–5467. 30 P og am Manual o he Wisconsin Package, Ve sion 8 (1994). 31 Zuke , M. (1989) Me hods Enzymol., 180, 262–288. 32 Swo o d, D. L. (1993) PAUP: phylogene ic analysis using pa simony, e sion 3.1.1. Illinois Na u al His o y Su ey, Champaign, IL. 33 Snea h, P. H. A. and Sokal, R. R. (1973) Nume ical Taxonomy. W. H. F eeman & Co, San F ancisco. 34 Gibe , I., Ca oll, K., Hillya d, D. R., Ba bé, J. and Casadesús, J. (1991) Nucleic Acids Res., 19, 1343. 35 Winkle , M. E. (1996) In Neidha d , F. C., Cu iss, R. III, Ing aham, J. L., Lin, A. C. C., Low, K. B., Magasanik, B., Rezniko , W. S., Riley, M., Schaech e , M. and Umba ge , H. E. (eds) Esche ichia coli and Salmonella. Cellula and Molecula Biology. 2nd. edi ion. Ame ican Socie y o Mic obiology, Washing on, DC, pp. 485–505. 36 A be , W., Iida, S., Ju e, H., Caspe s, P., Meye , J. and Hänni, C. (1978) Cold Sp ing Ha bo Symp. Quan . Biol., 43, 1197–1208. 37 G een, L., Mille , R., Dykhuizen, D. E. and Ha l, D. L. (1984) P oc. Na l. Acad. Sci. USA, 81, 4500–4504. 38 Naas, T., Blo , M., Fi ch, W. M. and A be , W. (1994) Gene ics, 136, 721–730. 39 Ande son, R. P. and Ro h, J. R. (1979) Cold Sp ing Ha bo Symp. Quan . Biol., 43, 1083–1087. 40 Lam, S. T. and Ro h, J. R. (1986) J. Mol. Biol., 187, 157–167. 41 Bik, E. M., Gouw, R. D. and Mooi, F. R. (1996) J. Clin. Mic obiol., 34, 1453–1461. 42 Haack, K. R. and Ro h, J. R. (1995) Gene ics, 141, 1245–1252. 43 Shine, J. and Dalga no, L. (1975) Na u e, 254, 34–38. 44 D ape , D. E. (1996) In Neidha d , F. C., Cu iss, R. III, Ing aham, J. L., Lin, A. C. C., Low, K. B., Magasanik, B., Rezniko , W, S., Riley, M., Schaech e , M. and Umba ge , H. E. (eds) Esche ichia coli and Salmonella. Cellula and Molecula Biology. 2nd. edi ion. Ame ican Socie y o Mic obiology, Washing on, D. C., pp. 902–908. 45 Youde ian, P., Sugiono, P., B ewe , K., Higgins, N. P. and Ellio , T. (1988) Gene ics, 118, 581–592. 46 Bu nens, A. P., S anley, J., Hunkize , P., B oda d, I. and Nicole , J. (unpublished) Z54217. 47 B enne , D. J. (1984) In K ieg. N. R. and Hol , J. G. (eds) Be gey’s Manual o Sys ema ic Bac e iology. Williams & Wilkins, Bal imo e and London, pp. 408–430. 48 F ied ich. M. J., Kinsey, N. E., Vila, J. and Kadne , R. J. (1993) Mol. Mic obiol., 8, 543–558. 49 Young, V. B., Mille , V. L., Falkow, S. and Schoolnik, G. K. (1990) Mol. Mic obiol., 4, 1119–1128. 50 Pepe, J. C., Badge , J. L. and Mille , V. L. (1994) Mol. Mic obiol., 11, 123–135. 51 Isbe g, R. R., Voo his, D. L. and Falkow, S. (1987) Cell, 50, 769–778. 52 Meye , J., Iida, S. and A be , W. (1980) Mol. Gen. Gene ., 178, 471–473. 53 Galas, D. J., Calos, P. and Mille , J. H. (1980) J. Mol. Biol., 144, 19–41. 54 Ze bib, D., Gamas, P., Chandle , M., P en ki, P., Bass, S. and Galas, D. (1985) J. Mol. Biol., 185, 517–524. 55 Mayna d Smi h, J., Dowson, C. G. and Sp a , B. G. (1991) Na u e, 349, 29–31. 56 Law ence, J. G., Ochman, H. and Ha l, D. L. (1992) Gene ics, 131, 9–20. 57 Chaconas, G. (1987) In Symonds, N., Toussain , A., an de Pu e, P. and Howe, M. M. Bac e iophage Mu. Cold Sp ing Ha bo Labo a o y, Cold Sp ing Ha bo , NY, pp. 137–157. 58 Reimmann, C., Moo e, R., Li le, S., Sa ioz, A., Wille s, N. S. and Haas, D. (1989) Mol. Gen. Gene ., 215, 416–424. 59 Be g, D. E., Schmand , M. A. and Lowe, J. B. (1983) Gene ics, 105, 813–828. 60 Lupski, J. R., Ge shon, P., Osaki, L. S. and Godson, G. N. (1984) Gene, 30, 99–106. 61 Ko ha y, R. K., Jones, D. and Candido, P. E. (1985) J. Bac e iol., 164, 957–959. 62 Sengs ag, C., Iida, S., Hies and-Naue , R. and A be , W. (1986) Gene, 49, 153–156. 63 S ellwagen, N. C. (1983) Biochemis y, 22, 6186–6193. 64 Gamas, P., Chandle , M. G., P enk i, P. and Galas, D. J. (1987) J. Mol. Biol., 195, 261–272. 65 Iida, S., Hies and-Naue , R. and A be , W. (1985) P oc. Na l. Acad. Sci. USA, 82, 839–843. 66 Dooli le, W. F., Ki kwood, T. B. L. and Demps e , M. A. H. (1984) Na u e, 307, 501–502.