A gene cluster involved in metal homeostasis in the cyanobacterium Synechocystis sp. strain PCC 6803

JOURNAL OF BACTERIOLOGY, 0021-9193/00/$04.00⫹0Ma . 2000, p. 1507–1514 Vol. 182, No. 6 Copy igh © 2000, Ame ican Socie y o Mic obiology. All Righ s Rese ed. A Gene Clus e In ol ed in Me al Homeos asis in he Cyanobac e ium Synechocys is sp. S ain PCC 6803 MARIO GARCI ´A-DOMI ´NGUEZ, LUIS LOPEZ-MAURY, FRANCISCO J. FLORENCIO, AND JOSE ´C. REYES* Ins i u o de Bioquı´mica Vege al y Fo osı´n esis, Uni e sidad de Se illa-CSIC, E-41092 Se illa, Spain Recei ed 18 Oc obe 1999/Accep ed 14 Decembe 1999 A gene clus e composed o nine open eading ames (ORFs) in ol ed in Ni 2ⴙ ,Co 2ⴙ , and Zn 2ⴙ sensing and ole ance in he cyanobac e ium Synechocys is sp. s ain PCC 6803 has been iden i ied. The clus e includes an Ni 2ⴙ esponse ope on and a Co 2ⴙ esponse sys em, as well as a Zn 2ⴙ esponse sys em p e iously desc ibed. Exp ession o he Ni 2ⴙ esponse ope on (n s) was induced in he p esence o Ni 2ⴙ and Co 2ⴙ . Reduced Ni 2ⴙ ole ance was obse ed ollowing dis up ion o wo ORFs o he ope on (n sA and n sD). We also show ha he n sD gene encodes a pu a i e Ni 2ⴙ pe mease whose ca boxy- e minal egion is a me al binding domain. The Co 2ⴙ esponse sys em is composed o wo di e gen ly ansc ibed genes, co R and co T, mu an s o which showed dec eased Co 2ⴙ ole ance. Addi ionally, co R mu an s showed an absence o Co 2ⴙ -dependen induc ion o co T, indica ing ha Co R is a ansc ip ional ac i a o o co T. To ou knowledge, Co R is he i s Co 2ⴙ -sensing ansc ip ion ac o desc ibed. Ou da a sugges ha his egion o he Synechocys is sp. s ain PCC 6803 genome is in ol ed in sensing and homeos asis o Ni 2ⴙ ,Co 2ⴙ , and Zn 2ⴙ . A abo e c i ical concen a ions, essen ial ansi ion me al ions such as Ni 2⫹ ,Co 2⫹ , and Zn 2⫹ a e oxic, being, o exam- ple, po en inhibi o s o p ocesses such as espi a ion and pho- osyn hesis (see, o example, e e ences 4, 22, 28, and 39). In addi ion, ansi ion me als a e equi ed o he ca aly ic ac i i y o a numbe o enzymes because o hei edox ac i i y and hei high cha ge densi y, which allows he pola iza ion o subs a es and he s abiliza ion o ansi ion s a e in e medi- a es. Bac e ia ha e e ol ed sensing, seques e ing, and ans- po sys ems ha allow a p ecise homeos asis o hese me als. Du ing he las yea s i has became clea ha mic obial Ni 2⫹ ,Zn 2⫹ , and Co 2⫹ up ake is media ed by nonspeci ic ans- po sys ems o di alen ca ions (33) and by high-a ini y spe- ci ic sys ems. Two ypes o high-a ini y anspo e s ha e been iden i ied: (i) mul icomponen ATP-binding casse e anspo sys ems (such as NikABCDE o Ni 2⫹ o ZnuABC o Zn 2⫹ ) (31, 37) and (ii) one-componen anspo e s (such as NixA, U eH, HupN, and HoxN o Ni 2⫹ and NhlF o Co 2⫹ ) (12, 16, 23, 27, 29) which a e in eg al memb ane p o eins wi h eigh ansmemb ane-spanning helices. Mos o he s udies on Co 2⫹ ,Zn 2⫹ , and Ni 2⫹ expo and esis ance ha e been ca ied ou wi h he soil chemoli ho o- phic Alcaligenes s ains (now designed Rals onia), whe e h ee sequence- ela ed di alen ca ion e lux ope ons, called czc ( o Cd 2⫹ ,Zn 2⫹ , and Co 2⫹ esis ance) (32), cn ( o Co 2⫹ and Ni 2⫹ esis ance) (25), and ncc ( o Ni 2⫹ ,Co 2⫹ , and Cd 2⫹ e- sis ance) (47), ha e been desc ibed. Zn 2⫹ -dependen e lux ATPases ha e been ecen ly cha ac e ized o Esche ichia coli (zn A) (3) and o he cyanobac e ium Synechocys is sp. s ain PCC 6803 (ziaA) (51). Zn A and ZiaA belong o he P- ype ATPase amily ( ecen ly e iewed in e e ence 40), which in- cludes he bac e ial Cd 2⫹ anspo e CadA (34) and bac e ial Cu 2⫹ anspo e s (20, 35, 38). Much less is known abou how Ni 2⫹ ,Zn 2⫹ , and Co 2⫹ a e sensed and how me al binding p o okes p o ein con o ma- ional changes ha de e mine egula o y esponses. Two ypes o Zn 2⫹ - esponsi e egula o s ha e been ecen ly desc ibed. Zn R is a Me R-like ansc ip ional ac i a o o zn A exp es- sion in E. coli (7). In con as , Synechococcus sp. s ain PCC 7942 Sm B (19), Synechocys is sp. s ain PCC 6803 ZiaR (51), and S aphylococcus au eus Zn R (49) a e ansc ip ional e- p esso s ha belong o he A sR-Sm A amily o helix- u n- helix DNA binding p o eins. Al hough he o e all e na y s uc u e o hese ep esso s is conse ed, he me al binding si e may be unique o each speci ic membe o he amily (9). Regula ion o he czc e lux ope on o Rals onia eu opha is cu en ly unde ac i e s udy, and a leas h ee p o eins, CzcD, CzcR, and CzcS, seem o be in ol ed in me al sensing (55). The only nickel-speci ic esponsi e egula o epo ed is NikR, a Fu - ela ed DNA binding p o ein ha ep esses he an- sc ip ion o he E. coli nikABCDE ope on in he p esence o high Ni 2⫹ concen a ions (11). Finally, no Co 2⫹ -speci ic senso p o eins ha e been epo ed so a . We epo in he p esen wo k he iden i ica ion and cha - ac e iza ion o a me al- egula ed gene clus e in he unicellula cyanobac e ium Synechocys is sp. s ain PCC 6803. The clus e comp ises nine open eading ames (ORFs) o ganized in o i e ansc ip ional uni s and seems o be esponsible o Ni 2⫹ , Co 2⫹ , and Zn 2⫹ homeos asis in Synechocys is sp. s ain PCC 6803. MATERIALS AND METHODS S ains and g ow h condi ions. Synechocys is sp. s ain PCC 6803 was g own pho oau o ophically a 30°C in BG11 medium (43) supplemen ed wi h1go NaHCO 3 pe li e (BG11C) and bubbled wi h a con inuous s eam o 1% ( ol/ ol) CO 2 in ai unde con inuous illumina ion (50 ␮mol o pho ons pe m 2 pe s; whi e ligh om luo escen lamps). Fo pla e cul u es, BG11C liquid medium was supplemen ed wi h 1% (w / ol) aga . Kanamycin was added o a inal concen a ion o 50 o 200 ␮g/ml when equi ed. BG11C medium was supple- men ed wi h di e en concen a ions o ZnSO 4 , CdCl 2 , CoCl 2 , CuSO 4 , NiSO 4 , and MgCl 2 when indica ed. E. coli DH5␣(Be hesda Resea ch Labo a o ies) g own in Lu ia b o h medium as desc ibed p e iously (46) was used o plasmid cons uc ion and eplica ion. E. coli BL21 g own in Lu ia b o h medium supplemen ed wi h 2% glucose was used o exp ession o glu a hione S- ans e ase (GST)–C-N sD o GST p o- eins. E. coli s ains we e supplemen ed wi h 100 ␮g o ampicillin pe ml when equi ed. Inse ional mu agenesis o Synechocys is sp. s ain PCC 6803 genes. Loci sl 0794, sl 0796, sl 0797, and sll0794 we e inac i a ed by in e up ion wi h a kanamycin esis ance casse e (C.K1) (14). Fo his, DNA agmen s con aining * Co esponding au ho . Mailing add ess: Ins i u o de Bioquı´mica Vege al y Fo osı´n esis, Cen o de In es igaciones Cien ı´ icas Isla de la Ca uja, C/. Ame´ ico Vespucio s/n, 41092 Se illa, Spain. Phone: 34 954489518. Fax: 34 954460065. E-mail: [email p o ec ed]. 1507 on July 24, 2017 by USE/BCTA.GEN UNIVERSITARIAh p://jb.asm.o g/Downloaded om loci sl 0794, sl 0796, sl 0797, and sll0794 we e ampli ied by PCR om he cosmid CS1377 (p o ided by Kazusa DNA Resea ch Ins i u e) and cloned in o pGEM-T (P omega). sl 0794 was ampli ied by using oligonucleo ides ni 1 and ni 2 (Table 1) and cloned in o pGEM-T o gene a e pNIQ7. Ta ge ing ec o s we e gene - a ed by inse ing he C.K1 casse e in o he EcoRI si e o sl 0794 in he same o ien a ion as he n s ope on [pNIQ8(⫹)] o in he in e se o ien a ion [pNIQ8(⫺)]. sl 0796 was ampli ied by using oligonucleo ides n p1 and n p2 (Table 1) and cloned in o pGEM-T o gene a e pNIQ1. Ta ge ing ec o s we e gene a ed by inse ing he C.K1 casse e in o he Bs EII si e o sl 0796 in he same o ien a ion as he n s ope on [pNIQ2(⫹)] o in he in e se o ien a ion [pNIQ2(⫺)]. sl 0797 was ampli ied by using oligonucleo ides co 1 and co 2 (Table 1) and cloned in o pGEM-T o gene a e pNIQ10. The a ge ing ec o was gene a ed by inse ing he C.K1 casse e in o he EcoNI si e o sl 0797 in he opposi e o ien a ion o he sl 0797 gene (pNIQ12). sll0794 was ampli ied by using oligonucleo ides m 1 and m 2 (Table 1) and cloned in o pGEM-T o gene a e pNIQ3. The a ge ing ec o was gene a ed by inse ing he C.K1 casse e in o he HindIII si e o sll0794 in he same o ien a ion as he sll0794 ORF [pNIQ4(⫹)]. All a ge ing ec o s we e used o ans o m Synechocys is sp. s ain PCC 6803 s ain as p e iously desc ibed (15). Co ec in eg a ion and comple e seg ega ion o he mu an s ains we e es ed by Sou he n blo ing. Fo his, o al DNA om cyanobac e ia was isola ed as p e iously desc ibed (8). DNA was diges ed and elec opho esed in 0.7% aga ose gels in a T is-bo a e-EDTA bu e sys em (46), and hen DNA was ans e ed o nylon Z-p obe memb anes (Bio-Rad, He cules, Cali .). DNA p obes we e 32 P labeled wi h a andom-p ime ki (Pha macia, Uppsala, Sweden) using [␣- 32 P]dCTP (3,000 Ci/mmol). RNA isola ion and No he n blo hyb idiza ion. To al RNA was isola ed om 25-ml samples o Synechocys is sp. s ain PCC 6803 cul u es a he mid-exponen- ial g ow h phase (3 o 5 ␮g o chlo ophyll/ml). Ex ac ions we e pe o med by o exing cells in he p esence o phenol-chlo o o m and acid-washed baked glass beads (0.25- o 0.3-mm diame e ; B aun, Melsungen, Ge many) as p e i- ously desc ibed (17). Fo No he n blo analyses, 15 ␮g o o al RNA was loaded pe lane and elec opho esed in 1.2% aga ose dena u ing o maldehyde gels. T ans e o nylon memb anes (Hybond N-Plus; Ame sham), p ehyb idiza ion, hyb idiza ion, and washes we e in acco dance wi h Ame sham ins uc ion manuals. P obes o No he n blo hyb idiza ion we e PCR syn hesized using he ollowing oligonu- cleo ides pai s: nia3-nia4, p obe a; n p1-n p2, p obe b; m 1-m 2, p obe c; and co 1-co 2, p obe d(Table 1). DNA p obes we e 32 P labeled wi h a andom- p ime ki (Pha macia) using [␣- 32 P]dCTP (3,000 Ci/mmol). All o he il e s we e s ipped and ep obed wi h a HindIII-BamHI 580-bp p obe om plasmid pAV1100 ha con ains he cons i u i ely exp essed RNase P RNA gene ( npB) om Synechocys is sp. s ain PCC 6803 (56). To de e mine coun s pe minu e o adioac i e a eas in No he n blo hyb idiza ions, an Ins an Image Elec onic Au o adiog aphy appa a us (Packa d Ins umen Company, Me iden, Conn.) was used. Pu i ica ion o GST–C-N sD and me al a ini y ch oma og aphy. The las 126 bp o he n sD ORF, which encodes he las 42 amino acids o N sD, was ampli ied by PCR using he oligonucleo ides n h1 and n h2 (Table 1). The esul ing DNA agmen was diges ed wi h EcoRI and XhoI and cloned in o pGEX-4T-3 in phase wi h he GST gene o gene a e pGEX-C-N sD. GST–C- N sD usion p o ein and GST we e exp essed in E. coli BL21 om he plasmids pGEX-C-N sD and pGEX-4T-3, espec i ely. One li e o cul u e was g own in Lu ia b o h medium supplemen ed wi h 2% glucose o an op ical densi y a 600 nm o 0.6, induced wi h 1 mM isop opyl-␤-D- hiogalac opy anoside o 2.5 h, ha es ed by cen i uga ion, and esuspended in 20 ml o phospha e-bu e ed saline bu e (150 mM NaCl, 16 mM Na 2 HPO 4 ,4mMNaH 2 PO 4 , pH 7.2) supplemen ed wi h 1 mM phenylme hylsul onyl luo ide. Cells we e b oken by sonica ion, and insoluble deb is was pelle ed by cen i uga ion a 18,000 ⫻g o 15 min. The supe na an was hen applied o a glu a hione-aga ose bead column (Pha macia) (1-ml bed olume). A e ex ensi e washing wi h phospha e-bu - e ed saline bu e , GST o GST–C-N sD p o eins we e elu ed wi h 3 ml o 50 mM T is HCl (pH 8.0) con aining 10 mM educed glu a hione. Glu a hione was hen emo ed by gel il a ion in a Sephadex G-25 column. In e ac ion o GST– C-N sD o GST wi h Ni 2⫹ ,Co 2⫹ ,Zn 2⫹ ,Cu 2⫹ ,o Mg 2⫹ was in es iga ed by me al ion a ini y ch oma og aphy. A 0.5-ml po ion o His-bind esin (No agen) was loaded wi h 0.5 ml o 0.5 M ZnSO 4 , CoCl 2 , CuSO 4 , NiSO 4 , o MgCl 2 in wa e and hen equilib a ed in 0.5 M sodium chlo ide–50 mM T is HCl (pH 8.0) (bu e A). Abou 30 ␮g o pu i ied GST–C-N sD o GST p o eins we e applied o he columns. Unbound p o eins we e emo ed by washing wi h bu e A. Bound polypep ides we e elu ed wi h 0.5 ml o 0.4 M imidazole in bu e A. P o eins we e hen analyzed by sodium dodecyl sul a e-polyac ylamide gel elec- opho esis (SDS-PAGE) (24) and Coomassie blue s aining. Quan i ies o bound and unbound p o eins we e de e mined by he me hod o B ad o d (5). Compu e me hods. The BLAST p og am (1) was used o sc een he ans- la ed nucleo ides da abases. The CLUSTAL X p og am was used o gene a e sequence alignmen s (53). Pu a i e memb ane-spanning egions we e iden i y using di e en algo i hms (18, 57). RESULTS AND DISCUSSION A me al- egula ed gene clus e in Synechocys is sp. s ain PCC 6803. Analysis o he ully sequenced Synechocys is sp. s ain PCC 6803 genome (21) allowed us o iden i y a egion o he ch omosome con aining h ee ORFs whose deduced amino acid sequences a e clea ly ela ed o me al anspo p o eins (see below). The egion ex ends 12 kb and comp ises nine genes o ganized in o i e pu a i e ansc ip ion uni s (Fig. 1A). ORF sl 0798 has been epo ed o encode a Zn 2⫹ -depen- den e lux ATPase (ZiaA) whose exp ession is Zn 2⫹ depen- den (51). A pu a i e ope on composed o wo ORFs, sll0793 and sll0792, sepa a ed by 11 bp appea s ups eam om he ziaA gene and in he opposi e o ien a ion. sll0792 encodes ZiaR, he ansc ip ional ep esso o ziaA. sll0793 is a pu a i e memb ane p o ein ha does no sha e signi ican homology wi h any o he p o ein in he EMBL-GenBank da abase (51). Me al-dependen exp ession o he emaining h ee pu a i e ansc ip ional uni s was analyzed by No he n blo ing. Fo his, ou p obes we e used o hyb idize o al RNA ob ained om mid-log-phase Synechocys is sp. s ain PCC 6803 cells g own in BG11C medium and exposed du ing1h oa15␮M concen a ion o ei he ZnSO 4 , CdCl 2 , CoCl 2 , CuSO 4 , NiSO 4 , o MgCl 2 (Fig. 1B). Con ol cells we e no exposed o added me als. P obes a(in e nal o sl 0793) and b(in e nal o sl 0796) hyb idized s ongly wi h RNA ob ained om Ni 2⫹ - exposed Synechocys is sp. s ain PCC 6803 cells and weakly wi h RNA om Co 2⫹ -exposed cells. P obe c(ORF sll0794) showed no hyb idiza ion wi h RNA om any o he condi ions es ed. P obe d, co esponding o ORF sl 0797, hyb idized s ongly wi h RNA om Co 2⫹ -exposed cells and weakly wi h RNA om Zn 2⫹ -exposed cells. T ansc ip le els o he RNase P RNA ( npB gene) (56) emained unchanged unde all es ed condi ions (Fig. 1B). These esul s demons a e he me al-dependen exp ession o wo o he ansc ip ion uni s o he egion. These da a, oge he wi h he esul s o Thelwell e al. (51) abou ziaA and ziaR genes, allow us o de ine he exis ence o a me al- egu- la ed gene clus e in Synechocys is sp. s ain PCC 6803. n s is a nickel esis ance ope on. As shown abo e, a simila pa e n o induc ion was ound using p obes om ORFs sl 0793, and sl 0796 (Fig. 1B). The ac ha bo h p obes hy- b idized wi h RNA o abou 6 kb, oge he wi h he s uc u e o he egion, sugges s ha ORFs sl 0793, sl 0794, sl 0795, and sl 0796 o m a ansc ip ional uni . Since Ni 2⫹ p o oked he highes induc ion o his ansc ip ion uni , he genes we e named n s o Ni 2⫹ esponse sys em. The n s induc ion depen- dence on concen a ion was s udied by using No he n blo expe imen s. The ope on was induced a Ni 2⫹ concen a ions o abo e 0.45 ␮M. An Ni 2⫹ concen a ion o abo e 17 ␮M did no p o oke highe accumula ion o he n s mRNA (Fig. 2A TABLE 1. Oligonucleo ides used in his wo k Oligo- nucleo ide Sequence nia3 .....................5⬘CCCAATTTGAGGTGGTGTGATG3⬘ nia4 .....................5⬘ATAAAGGCAAGGGCTAGAGCAG3⬘ n p1.....................5⬘CCCATATGGGCAAACTACCGCCTATC3⬘ n p2.....................5⬘CGGGTAGTTTAAGGACTCGCC3⬘ m 1......................5⬘AGAAGGGGGAGTTACAACCATGC3⬘ m 2......................5⬘AGGCGAGTCCTTAAACTACCG3⬘ co 1.....................5⬘GATCATCCCGATGCAGTGGCG3⬘ co 2.....................5⬘GCACAGGGAGAAGCCACCACG3⬘ ni 1......................5⬘CGGTGCGCTCTTCTTCTAAGG3⬘ ni 2......................5⬘TTAGTGCGTAGTCCCCGATAG3⬘ n h1.....................5⬘GATGGAATTCAGGATTTTGGCACGAACATTC3⬘ n h2.....................5⬘AAAGCTCGAGAGGGAAAGGATGGTGAAAG3⬘ 1508 GARCI ´A-DOMI ´NGUEZ ET AL. J. BACTERIOL. on July 24, 2017 by USE/BCTA.GEN UNIVERSITARIAh p://jb.asm.o g/Downloaded om and da a no shown). Time cou se analysis indica ed ha n s mRNA was al eady induced 15 min a e me al addi ion and inc eased almos linea ly, a leas du ing he i s 4ho ea - men (Fig. 2B and C). In o de o ge in o ma ion abou he unc ion o n s genes, we ha e analyzed hei deduced amino acid sequences. The ORF sl 0793 (n sB) and sl 0794 (n sA) p oduc s showed clea sequence simila i y wi h he R. eu opha czcB and czcA gene p oduc s, espec i ely (32). While N sA displays 35% iden i y and 55% simila i y wi h CzcA h oughou he en i e amino acid sequence, N sB and CzcB show signi ican simila i y (34% iden i y and 45% simila i y) only in a cen al 80-amino-acid egion ( om amino acid 54 o 132 o he N sB sequence). The czcABC gene p oduc s o m a memb ane-bound p o ein com- plex ca alyzing Co 2⫹ ,Zn 2⫹ , and Cd 2⫹ e lux by a p o on/ca ion an ipo e in R. eu opha. CzcA is hough o be he inne memb ane p o ein esponsible o he e lux ac i i y (48). CzcB is a pe iplasmic p o ein p obably in ol ed in memb ane usion ha b idges he inne and he ou e cell memb anes o g am- nega i e bac e ia (41). The p o ein encoded by ORF sl 0795 (n sC) is no homologous o p o eins encoded by he czc o ela ed ope ons. In e es ingly, he N sC ca boxy- e minal (C- e minal) egion sha es signi ican simila i y (26 o 30% iden- i y in abou 140 amino acids) wi h Neisse ia gono hoeae au- olysin A and bac e iophage-encoded lysozymes. In addi ion, compu e analysis o he N sC sequence indica ed he exis- ence o wo pu a i e ansmemb ane helices in he amino- e minal egion o he p o ein (amino acids 24 o 47 and 70 o 89 om he N sC sequence). Finally, he sl 0796 (n sD) p od- uc is a 445-amino-acid p o ein which shows signi ican amino acid sequence iden i y o he n eB gene p oduc . The n e locus was iden i ied as a low-le el Ni 2⫹ esis ance de e minan in Alcaligenes xylosoxidans 31A (47), di e en om he high-le el Ni 2⫹ esis ance de e minan (ncc) homologous o he czc sys- em. The homologies displayed by he N s p o eins oge he wi h he pa e n o exp ession o hei genes sugges ed ha he N s sys em is in ol ed in Ni 2⫹ and Co 2⫹ ole ance in Synechocys is sp. s ain PCC 6803. In o de o e i y his hypo hesis, wo di e en n s mu an s we e gene a ed by inse ion o kanamycin esis ance casse es (C.K1) (14) in o he n sA and n sD genes (Fig. 3A). In o de o abolish pola e ec s, C.K1 casse es we e inse ed in bo h o ien a ions. Since he C.K1 casse e is lacking a ansc ip ion e mina o (J. C. Reyes, unpublished obse a- ion), inse ional mu agenesis in he same o ien a ion as he n s ope on does no supp ess ansc ip ion o he genes down- s eam o he inse ion poin . Simila esul s we e ob ained o bo h o ien a ions, and he e o e only mu an s wi h he np gene in he same o ien a ion as he n s genes a e shown. n sA::C.K1 and n sD::C.K1 Synechocys is s ains we e iable, and hei g ow h a es in BG11C medium we e compa able o hose o he wild- ype s ain (da a no shown). G ow h o FIG. 1. Me al-dependen exp ession o he Synechocys is ansi ion me al- esis an clus e . (A) ORF o ganiza ion o he me al- egula ed clus e om Synechocys is sp. s ain PCC 6803. (B) To al RNA was isola ed om mid-log-phase Synechocys is sp. s ain PCC 6803 cells exposed o 1h oa15␮M concen a ion o he indica ed me al ions. Con ol cells we e no exposed o added me als (⫺). Fi een mic og ams o o al RNA was dena u ed, sepa a ed by elec opho esis in a 1.2% aga ose gel, blo ed, and hyb idized wi h p obes a o das indica ed in panel A (see Ma e ials and Me hods). The il e s we e s ipped and ehyb idized wi h an npB gene p obe as a con ol. Es ima ed sizes o he ansc ip s (in nucleo ides [n]) a e indica ed. VOL. 182, 2000 A METAL TOLERANCE GENE CLUSTER IN CYANOBACTERIA 1509 on July 24, 2017 by USE/BCTA.GEN UNIVERSITARIAh p://jb.asm.o g/Downloaded om n sA::C.K1 and n sD::C.K1 mu an s was also examined in Zn 2⫹ -, Ni 2⫹ -, and Co 2⫹ -supplemen ed BG11C medium. No - mal g ow h was obse ed in Zn 2⫹ -o Co 2⫹ -con aining medium (da a no shown); howe e , a educed ole ance o Ni 2⫹ was clea ly obse ed o bo h n s mu an s (Fig. 3B). In e es ingly he le el o Ni 2⫹ ole ance o he n sA::C.K1 s ain was lowe han ha o he n sD::C.K1 s ain. While n sA::C.K1 mu an s we e unable o g ow in medium con aining 7 ␮MNi 2⫹ , n sD::C.K1 mu an cells we e sensi i e only o concen a ions o abo e 12 ␮MNi 2⫹ . These da a sugges ha N sD and N sA migh o m pa o wo independen sys ems o Ni 2⫹ ole - ance. This is in good ag eemen wi h he da a epo ed o A. xylosoxidans, whe e he ncc and n e loci o m wo independen sys ems o Ni 2⫹ esis ance (47). Since n sB- and n sA-homol- ogous genes has been ound o be in ol ed in hea y-me al e lux, i seems logical o specula e ha he N sB and N sA p o eins o m an Ni 2⫹ e lux sys em in Synechocys is sp. s ain PCC 6803. A di e ence be ween he N s sys em om Synecho- cys is sp. s ain PCC 6803 and he Czc sys em om R. eu opha is he lack o a CzcC homolog in he cyanobac e ial Ni 2⫹ esponse sys em. Dele ion o he czcC gene esul s in a loss o Cd 2⫹ and Co 2⫹ esis ance, bu no Zn 2⫹ esis ance, sugges ing ha CzcC is in ol ed in subs a e speci ici y bu no in he anspo ac i i y o he complex (32). The amino- e minal pa o N sD is a me al binding do- main. As p e iously men ioned, he closes N sD homolog is he p oduc o he A. xylosoxidans n eB gene, which has no been cha ac e ized. N sD shows also e y signi ican sequence simila i y o se e al membe s o he majo acili a o supe - amily (MFS) (36). MFS anspo e s a e single polypep ides, con aining 12 o 14 ansmemb ane-spanning egions, capable o anspo ing small solu es in esponse o a chemiosmo ic g adien . Compu e analysis o he N sD amino acid sequence indica ed he exis ence o 12 pu a i e ansmemb ane helices dis ibu ed along he i s 400 amino acids o he p o ein (Fig. 4A). These da a, aken oge he wi h he pheno ype o he n sD mu an s, sugges ha N sD is a membe o he MFS o pe meases in ol ed in Ni 2⫹ expo . In e es ingly, he N sD p o ein does no show sequence simila i y wi h a amily o well-cha ac e ized Ni 2⫹ pe meases including U eH, HupN, and HoxN (12, 16, 27). These p o eins show a common opol- ogy, wi h eigh memb ane-spanning segmen s. The second ansmemb ane helix includes a pu a i e Ni 2⫹ binding mo i (HX 4 DH) whose mu a ion comple ely abolishes anspo ac- i i y (13). This mo i is no p esen in he pu a i e ansmem- b ane helices o N sD. The s ongly hyd ophilic C- e minal pa o N sD con ains a ema kably high numbe o his idine esidues (12 ou o 40 amino acids), which a e gene ally con- side ed o be po en ial me al ligands. In o de o es whe he his domain o N sD is in ol ed in me al binding, a chime ic p o ein comp ising amino acids 403 o 445 o N sD (C-N sD) used o he GST was exp essed in E. coli (Fig. 4B). The GST–C-N sD usion p o ein was pu i ied by a ini y ch oma- og aphy on glu a hione-aga ose. One majo band o abou 31 kDa ( usion p o ein be ween he GST [26 kDa] and he C- N sD domain [5 kDa]) was isible a e SDS-PAGE and Coo- massie blue s aining. In e ac ion o GST o GST–C-N sD wi h Ni 2⫹ ,Co 2⫹ ,Zn 2⫹ ,Cu 2⫹ , and Mg 2⫹ was e alua ed by me al a ini y ch oma og aphy. Fo his, GST o GST–C-N sD usion p o eins we e loaded in o His-bind esin chela ing columns cha ged wi h he app op ia e ions. Abou 90% o he GST–C- N sD usion p o ein was e ained by he Ni 2⫹ -, Co 2⫹ -, and Cu 2⫹ -con aining columns (Fig. 4C and D). Abou 60% o he GST–C-N sD p o ein was also e ained in he Zn 2⫹ -con aining column. In con as , GST–C-N sD was no e ained in he Mg 2⫹ -cha ged column (Fig. 4C and D). GST p o ein was no e ained by any o he me al columns (Fig. 4C). These esul s suppo a ole o he hyd ophilic C- e minal pa o N sD as a me al binding domain. Ou da a sugges ha his domain has a low speci ici y o me al binding, which has been p e iously shown o his idine- ich p o eins (58). His idine- ich domains ha e been ound in U eE, HypB, and CooJ, which a e small soluble p o eins ha a e in ol ed in p ocessing Ni 2⫹ o u ease and hyd ogenases (30, 42, 58). In e es ingly, i has been shown ha a unca ed e sion o U eE which lacks he his idine- ich C- e minal egion s ill binds Ni 2⫹ and unc ions in i o (6). O ganisms wi h high-a ini y up ake sys ems o Ni 2⫹ ha e U eE-like p o eins lacking he his idine- ich egion (26), lead- ing o he sugges ion ha he his idine- ich egion unc ions o s o e Ni 2⫹ ions (6). One possibili y is ha he his idine- ich C- e minal egion o N sD is used o s o e me al ions ha a e going o be anspo ed. FIG. 2. Ni 2⫹ concen a ion dependence and ime cou se o he exp ession o n s. (A) The indica ed concen a ion o NiSO 4 was added o mid-log-phase Synechocys is sp. s ain PCC 6803 cells g own in BG11C medium. A e 1 h, cells we e ha es ed and o al RNA was isola ed, p ocessed, and hyb idized as de- sc ibed o Fig. 1, using an n sB gene p obe (p obe a[Fig. 1]). (B) A 17 ␮M concen a ion o NiSO 4 was added o mid-log-phase Synechocys is sp. s ain PCC 6803 cells g own in BG11C medium. Samples o o al RNA isola ion we e aken a he indica ed imes. RNA was p ocessed and hyb idized as o Fig. 1, using an n sB gene p obe. (C) Radioac i e signals o he ime cou se expe imen we e quan i ied wi h a Ins an Image Elec onic Au o adiog aphy appa a us. Le els o n s ope on mRNA we e no malized wi h he npB signal, and plo s o ela i e mRNA le els e sus ime we e d awn. 1510 GARCI ´A-DOMI ´NGUEZ ET AL. J. BACTERIOL. on July 24, 2017 by USE/BCTA.GEN UNIVERSITARIAh p://jb.asm.o g/Downloaded om A Me R- ela ed ansc ip ion ac i a o in ol ed in Co 2ⴙ sensing. The n s ope on was induced by Co 2⫹ (Fig. 1), sug- ges ing ha i migh be in ol ed in Co 2⫹ ole ance. Howe e , n sD::C.K1 and n sA::C.K1 mu an cells did no show educed ole ance o Co 2⫹ . These da a oge he wi h he pa e n o hyb idiza ion ob ained wi h p obe din Fig. 1 sugges ed he exis ence o an al e na i e sys em in ol ed in Co 2⫹ homeos a- sis. The ORF sl 0797 p oduc sha es clea homology wi h ca - FIG. 3. Ni 2⫹ ole ance o Synechocys is n sA::C.K1 and n sD::C.K1 mu an s. (A) Schema ic ep esen a ion o he n s genomic egion in he wild- ype s ain and si es o inse ion o he C.K1 casse e in he n sA::C.K1 and n sD::C.K1 mu an s. The C.K1 casse e was inse ed in bo h o ien a ions, as indica ed. B, Bs EII; E, EcoRI. (B) Ni 2⫹ ole ance o wild- ype Synechocys is sp. s ain PCC 6803 (WT) and Synechocys is n sA::C.K1 and n sD::C.K1 mu an s. Mu an s wi h he C.K1 casse e in he same o ien a ion as he n s genes a e shown. Ten old se ial dilu ions we e spo ed on BG11C pla es, supplemen ed wi h he indica ed concen a ions o NiSO 4 , and pho og aphed a e 10 days o g ow h. FIG. 4. Analysis o N sD p o ein. (A) P edic ion o N sD memb ane-spanning egions. The p obabili y o ansmemb ane egions was calcula ed by using he TM-p ed p og am (18). (B) Schema ic ep esen a ion o GST–C-N sD p o ein. The chime ic p o ein comp ises amino acids 403 o 445 o N sD (C- e minal domain, C-N sD) used o GST. His idine esidues a e unde lined. (C and D) The in e ac ion o GST o GST–C-N sD p o eins wi h me als was analyzed by me al ch oma og aphy. His-bind esin columns we e loaded wi h ei he Mg 2⫹ ,Ni 2⫹ ,Zn 2⫹ ,Co 2⫹ ,o Cu 2⫹ . Abou 30 ␮g o pu i ied GST–C-N sD o GST was applied o he columns. Unbound (lanes U) ( low h ough) and bound (lanes B) (imidazole-elu ed) ac ions we e analyzed by SDS-PAGE (12% polyac ylamide) and Coomassie blue s aining (C), and p o ein was quan i ied by he me hod o B ad o d (5). (D). VOL. 182, 2000 A METAL TOLERANCE GENE CLUSTER IN CYANOBACTERIA 1511 on July 24, 2017 by USE/BCTA.GEN UNIVERSITARIAh p://jb.asm.o g/Downloaded om ion- anspo ing P- ype ATPases, such as he bac e ial Cd 2⫹ anspo e CadA o he bac e ial Cu 2⫹ anspo e s C aA, PacS, CopA, and CopB ( e iewed in e e ence 40). The closes homolog o he sl 0797 p oduc is ZiaA (sl 0798), he Zn 2⫹ - dependen ATPase om Synechocys is sp. s ain PCC 6803 (51), encoded by ano he gene o he clus e (Fig. 1A). Induc- ion o sl 0797 mRNA by Co 2⫹ sugges ed ha he sl 0797 gene p oduc migh be in ol ed in he homeos asis o his ca ion. This hypo hesis was in es iga ed by in e up ing he sl 0797 gene wi h a kanamycin esis ance casse e (Fig. 5A) and es ing he me al ole ance o he esul ing mu an s ain. G ow h o sl 0797::C.K1 mu an s in Zn 2⫹ -, Ni 2⫹ -, and Co 2⫹ -supple- men ed BG11C medium was examined. No mal g ow h was obse ed in Zn 2⫹ -o Ni 2⫹ -con aining medium (da a no shown); howe e , a educed ole ance o Co 2⫹ was de ec ed (Fig. 5B). This esul indica es ha he sl 0797 ORF is in ol ed in Co 2⫹ ole ance. Since he sl 0797 p oduc shows clea ho- mology wi h ca ion- anspo ing P- ype ATPases, ou da a poin o he sl 0797 p oduc as a Co 2⫹ e lux pump. Based on his ole in Co 2⫹ anspo , he sl 0797 ORF was designed co T ( o cobal esponse anspo e ). The ac ha co T is also weakly induced by Zn 2⫹ sugges s ha his ATPase migh be in ol ed in Zn 2⫹ ole ance. Howe e , he co T mu an cells did no show educed Zn 2⫹ ole ance. A p obable eason o his esul is he exis ence o a Zn 2⫹ -speci ic ATPase, ZiaA, able o con ol Zn 2⫹ homeos asis (51). Ano he possibili y is ha Zn 2⫹ is a g a ui ous induce o co T gene exp ession. A 81 bp ups eam o co T and in he opposi e o ien a ion appea s he ORF sll0794 (Fig. 1A). Sequence analysis e ealed ha sll0794 encodes a 370-amino-acid p o ein wi h wo di e - en domains. Thus, he amino- e minal domain (amino acids 10 o 70) sha es s ong simila i y wi h he DNA binding do- mains o componen s o he Me R amily o DNA binding p o eins (50). In con as , he C- e minal egion, om amino acid 170 o 358, shows signi ican simila i y (30% iden i y in 180 amino acids) o p eco in isome ases (p eco in-8x me h- ylmu ases) om di e en o igins (Fig. 6) (10, 52). P eco in isome ase, he p oduc o he gene cobH, is in ol ed in he FIG. 5. Co 2⫹ ole ance o Synechocys is co T::C.K1 and co R::C.K1 mu an s. (A) Schema ic ep esen a ion o he co R-co T genomic egion. The si es o inse ion o he C.K1 casse e in he co T::C.K1 and co R::C.K1 mu an s a e shown. The nucleo ide sequence o he co R-co T in e genic egion is also shown. Pu a i e ⫺10 and ⫺35 boxes o he co T p omo e a e boxed. A hyphena ed in e ed epea (13-6-13) wi h one misma ch is ma ked wi h a ows. The s a codons o co T and co R a e unde lined. (B) Co 2⫹ ole ance o wild- ype Synechocys is sp. s ain PCC 6803 (WT) and he co T::C.K1 and co R::C.K1 mu an s. Ten old se ial dilu ions we e spo ed on BG11C pla es, supplemen ed wi h he indica ed concen a ions o CoCl 2 , and pho og aphed a e 10 days o g ow h. FIG. 6. Sequence alignmen o he Co R C- e minal domain wi h p eco in isome ase (CobH) amino acid sequences om di e en o igins. COBH_SALTY, CobH om Salmonella en e ica se o a Typhimu ium; COBH_SYNY, CobH om Synechocys is sp. s ain PCC 6803; COBH_METJA, CobH om Me hano- coccus jannaschii; COBH_PSEDE, CobH om Pseudomonas deni i icans. Iden- ical amino acids a e ma ked wi h as e isks; conse a i e changes a e ma ked wi h colons o do s (as de ined by CLUSTAL X [53]). 1512 GARCI ´A-DOMI ´NGUEZ ET AL. J. BACTERIOL. on July 24, 2017 by USE/BCTA.GEN UNIVERSITARIAh p://jb.asm.o g/Downloaded om biosyn he ic pa hway o cobalamin. In cobalamin a cobal a om is held by coo dina ion bonds o he ni ogen a oms o he ou py ole ings o co in ( e iewed in e e ence 44). P eco in isome ase ca alyzes he syn hesis o hyd ogenoby inic acid om p eco in-8x by ans e ing a me hyl g oup om C-11 o C-12. I has been shown ha p eco in isome ase is able o igh ly bind hyd ogenoby inic acid, a class o co inoid ing (52). I is also known ha co inoids a e able o bind cobal unde ce ain condi ions (54). The ac ha he sll0794 gene p oduc con ains a domain homologous o p eco in isome ase and ano he domain in ol ed in DNA binding sugges ed he a ac i e hypo hesis ha his p o ein was in ol ed in ansc ip- ional egula ion media ed by Co 2⫹ . We ha e been unable o de ec he co R mRNA (Fig. 1B), indica ing ha Co R is exp essed a e y low le els, consis en wi h i s possible egu- la o y ole. Because o his egula o y ole, sll0794 was named co R ( o cobal esponse egula o ). In o de o e i y his hypo hesis, he co R gene was in e - up ed by a kanamycin esis ance casse e (Fig. 5A). The e- sul ing Synechocys is mu an s ain (co R::C.K1) was iable and g ew no mally in BG11C medium. G ow h o he co R::C.K1 mu an s ain was also examined in Zn 2⫹ -, Ni 2⫹ -, and Co 2⫹ - supplemen ed BG11C medium. No mal g ow h was obse ed in Zn 2⫹ -o Ni 2⫹ -con aining medium (da a no shown); how- e e , a educed g ow h in Co 2⫹ -con aining medium was ob- se ed (Fig. 5B). These da a, oge he wi h he esul s o he sequence analysis commen ed on abo e, sugges ed a ole o Co R as a posi i e egula o o a Co 2⫹ esponse elemen . One ob ious candida e o be egula ed by Co R was he co T gene. Exp ession o di e en ansc ip ional uni s o he clus e was analyzed in he co R::C.K1 mu an . No he n blo expe imen s showed ha Co 2⫹ - and Zn 2⫹ -dependen induc ion o he co T mRNA was absen in co R::C.K1 cells (Fig. 7). In con as , Ni 2⫹ -o Co 2⫹ -dependen induc ion o he n s ope on was no a ec ed in his s ain (Fig. 7). These da a indica e ha Co R is a ansc ip ional ac i a o o co T exp ession, which esponds bo h o Co 2⫹ and, o a lesse ex en , o Zn 2⫹ . Ou da a also indica e ha he low Co 2⫹ ole ance o he co R::C.K1 s ain is a consequence o he absence o co T induc ion. P omo e s dependen on Me R-like p o eins ha e an un- usual s uc u e (2, 50). Unlike egula sigma-70-dependen p oka yo ic p omo e s, in which he ⫺35 and ⫺10 consensus elemen s a e sepa a ed by 16- o 18-bp-long space s, he p o- mo e s egula ed by Me R- ype p o eins ha e 19- o 20-bp- long space s. In ypical Me R-like-dependen p omo e s his space egion con ains long in e ed- epea sequences which a e he DNA binding si es o he Me R-like p o eins. Se- quence analysis o he co R-co T in e genic egion e ealed a pu a i e Me R- ype p omo e wi h a 20-bp space and a 13- bp–13-bp in e ed epea in he o m AAACCTTGACATT- N 6 -AATGTTAAGGTTT (Fig. 5A). Ou p esen hypo hesis is ha his in e ed epea is he DNA a ge o Co R, which in he p esence o Co 2⫹ is able o p omo e ansc ip ional ac i- a ion o co T. While his a icle was unde e iew Ru he o d e al. epo ed expe imen s ha con i m ha Co R binds o he co R-co T in e genic egion (45). How is Co R able o sense Co 2⫹ ? One ob ious possibili y is ha he p eco in isome ase- homologous domain o Co R binds some class o co inoid ing. Co 2⫹ binding o he co inoid ing would p o oke a change in he ansc ip ional unc ion o he p o ein. Howe e , Ru he o d e al. show da a sugges ing ha he me al and he co inoid ing bind o di e en domains (45). Thei model p edic s ha he binding o hyd ogenoby inic acid o he p e- co in isome ase domain o Co R p e en s cobal -media ed con o ma ional change equi ed o ac i a ion. The p o ein Co R is an in e es ing example o how an enzyma ic p o ein domain (p eco in isome ase) has been adap ed du ing e olu- ion o a sensing and egula o y unc ion. In conclusion, we ha e desc ibed he exis ence in Synecho- cys is sp. s ain PCC 6803 o a gene clus e composed o nine ORFs in ol ed in hea y-me al ole ance. While i e o he gene p oduc s seem o ca y ou unc ions ela ed o me al expo , wo o he genes encode p o eins in ol ed in me al sensing and egula ion. The emaining wo p o eins encoded by he clus e show no clea homologs in he da abases, and hei ole in me al esis ance is an open ques ion. Finally, how and why nine genes wi h ela ed unc ions ha e been clus e ed in a egion o he Synechocys is sp. s ain PCC 6803 genome a e in e es ing ques ions ha emain o be add essed. ACKNOWLEDGMENTS We hank he Kazusa DNA Resea ch Ins i u e and S. Taba a o p o iding CS1377 cosmid DNA. We a e g a e ul o E. San e o o c i ical eading o he manusc ip . M. Ga cı´a-Domı´nguez was he ecipien o a ellowship om he Spanish Minis e io de Educacio´n y Cul u a. This wo k was suppo ed by g an PB97-0732 om DGESIC and by Jun a de Andalucı´a (g oup CV1-0112). REFERENCES 1. Al schul, S. F., T. L. Madden, A. A. Scha e , J. Zhang, Z. Zhang, W. Mille , and D. J. Lipman. 1997. Gapped BLAST and PSI-BLAST: a new gene a ion o p o ein da abase sea ch p og ams. Nucleic Acids Res. 25:3389–3402. 2. Ansa i, A. Z., J. E. B adne , and T. V. O’Hallo an. 1995. DNA-bend mod- ula ion in a ep esso - o-ac i a o swi ching mechanism. Na u e 374:371– 375. 3. Bea d, S. J., R. Hashim, J. Memb illo-He nandez, M. N. Hughes, and R. K. Poole. 1997. Zinc(II) ole ance in Esche ichia coli K-12: e idence ha he zn A gene (o732) encodes a ca ion anspo ATPase. Mol. Mic obiol. 25: 883–891. 4. Bea d, S. J., M. N. Hughes, and R. K. Poole. 1995. Inhibi ion o he cy o- ch ome bd- e mina ed NADH oxidase sys em in Esche ichia coli K-12 by di alen me al ca ions. FEMS Mic obiol. Le . 131:205–210. 5. B ad o d, M. M. 1976. A apid and sensi i e me hod o quan i a ion o mic og am quan i ies o p o ein u ilizing he p inciple o p o ein-dye bind- ing. Anal. Biochem. 72:248–254. 6. B ayman, T. G., and R. P. Hausinge . 1996. Pu i ica ion, cha ac e iza ion, and unc ional analysis o a unca ed Klebsiella ae ogenes U eE u ease accesso y p o ein lacking he his idine- ich ca boxyl e minus. J. Bac e iol. 178:5410–5416. 7. B ocklehu s , K. R., J. L. Hobman, B. Lawley, L. Blank, S. J. Ma shall, N. L. B own, and A. P. Mo by. 1999. Zn R is a Zn(II)- esponsi e Me R-like ansc ip ional egula o o zn A in Esche ichia coli. Mol. Mic obiol. 31: 893–902. 8. Cai, Y., and C. P. Wolk. 1990. Use o a condi ionally le hal gene in Anabaena sp. s ain PCC 7120 o selec o double ecombinan s and o en ap inse ion FIG. 7. Loss o co T induc ion in he co R::C.K1 mu an . To al RNA was isola ed om mid-log-phase wild- ype Synechocys is sp. s ain PCC 6803 (WT) o om Synechocys is co R::C.K1 mu an cells exposed o 1h oa15␮M concen- a ion o he indica ed me al ions. Con ol cells we e no exposed o added me als (⫺). RNA was isola ed, p ocessed, and hyb idized as desc ibed o Fig. 1, using an n sB o a co T gene p obe (p obes aand d, espec i ely [Fig. 1A]). The il e s we e s ipped and ehyb idized wi h an npB gene p obe as a con ol. VOL. 182, 2000 A METAL TOLERANCE GENE CLUSTER IN CYANOBACTERIA 1513 on July 24, 2017 by USE/BCTA.GEN UNIVERSITARIAh p://jb.asm.o g/Downloaded om sequences. J. Bac e iol. 172:3138–3145. 9. Cook, W. J., S. R. Ka , K. B. Taylo , and L. M. Hall. 1998. C ys al s uc u e o he cyanobac e ial me allo hionein ep esso Sm B: a model o me al- lo egula o y p o eins. J. Mol. Biol. 275:337–346. 10. C ouze , J., B. Came on, L. Cauchois, S. Rigaul , M. C. Rouyez, F. Blanche, D. Thibau , and L. Debussche. 1990. Gene ic and sequence analysis o an 8.7-kilobase Pseudomonas deni i icans agmen ca ying eigh genes in- ol ed in ans o ma ion o p eco in-2 o coby inic acid. J. Bac e iol. 172: 5980–5990. 11. De Pina, K., V. Desja din, M. A. Mand and-Be helo , G. Gio dano, and L. F. Wu. 1999. Isola ion and cha ac e iza ion o he nikR gene encoding a nickel- esponsi e egula o in Esche ichia coli. J. Bac e iol. 181:670–674. 12. Ei inge , T., and B. F ied ich. 1991. Cloning, nucleo ide sequence, and he e ologous exp ession o a high-a ini y nickel anspo gene om Alcali- genes eu ophus. J. Biol. Chem. 266:3222–3227. 13. Ei inge , T., L. Wol am, O. Degen, and C. An hon. 1997. A Ni2⫹binding mo i is he basis o high a ini y anspo o he Alcaligenes eu ophus nickel pe mease. J. Biol. Chem. 272:17139–17144. 14. Elhai, J., and C. P. Wolk. 1988. A e sa ile class o posi i e-selec ion ec o s based on he non iabili y o palind ome-con aining plasmids ha allows cloning in o long polylinke s. Gene 68:119–138. 15. Fe ino, F., and F. Chau a . 1989. A p omo e -p obe ec o -hos sys em o he cyanobac e ium, Synechocys is PCC6803. Gene 84:257–266. 16. Fu, C., S. Ja edan, F. Moshi i, and R. J. Maie . 1994. Bac e ial genes in ol ed in inco po a ion o nickel in o a hyd ogenase enzyme. P oc. Na l. Acad. Sci. USA 91:5099–5103. 17. Ga cı´a-Domı´nguez, M., and F. J. Flo encio. 1997. Ni ogen a ailabili y and elec on anspo con ol he exp ession o glnB gene (encoding PII p o ein) in he cyanobac e ium Synechocys is sp. PCC 6803. Plan Mol. Biol. 35: 723–734. 18. Ho mann, K., and W. S o el. 1993. TMbase—a da abase o memb ane spanning p o ein segmen s. Biol. Chem. Hoppe-Seyle 347:166. 19. Huckle, J. W., A. P. Mo by, J. S. Tu ne , and N. J. Robinson. 1993. Isola ion o a p oka yo ic me allo hionein locus and analysis o ansc ip ional con ol by ace me al ions. Mol. Mic obiol. 7:177–187. 20. Kanama u, K., S. Kashiwagi, and T. Mizuno. 1994. A coppe - anspo ing P- ype ATPase ound in he hylakoid memb ane o he cyanobac e ium Synechococcus species PCC7942. Mol. Mic obiol. 13:369–377. 21. Kaneko, T., S. Sa o, H. Ko ani, A. Tanaka, E. Asamizu, Y. Nakamu a, N. Miyajima, M. Hi osawa, M. Sugiu a, S. Sasamo o, T. Kimu a, T. Hosouchi, A. Ma suno, A. Mu aki, N. Nakazaki, K. Na uo, S. Okumu a, S. Shimpo, C. Takeuchi, T. Wada, A. Wa anabe, M. Yamada, M. Yasuda, and S. Taba a. 1996. Sequence analysis o he genome o he unicellula cyanobac e ium Synechocys is sp. s ain PCC6803. II. Sequence de e mina ion o he en i e genome and assignmen o po en ial p o ein-coding egions. DNA Res. 3: 109–136. 22. Kleine , D. 1978. Inhibi ion o he espi a o y sys em in Azo obac e inelandii by di alen ansi ion me al ions. FEBS Le . 96:364–366. 23. Komeda, H., M. Kobayashi, and S. Shimizu. 1997. A no el anspo e in ol ed in cobal up ake. P oc. Na l. Acad. Sci. USA 94:36–41. 24. Laemmli, U. K. 1970. Clea age o s uc u al p o eins du ing he assembly o he head o bac e iophage T4. Na u e 227:680–685. 25. Liesegang, H., K. Lemke, R. A. Siddiqui, and H. G. Schlegel. 1993. Cha ac- e iza ion o he inducible nickel and cobal esis ance de e minan cn om pMOL28 o Alcaligenes eu ophus CH34. J. Bac e iol. 175:767–778. 26. Lu z, S., A. Jacobi, V. Schlensog, R. Bohm, G. Sawye s, and A. Bock. 1991. Molecula cha ac e iza ion o an ope on (hyp) necessa y o he ac i i y o he h ee hyd ogenase isoenzymes in Esche ichia coli. Mol. Mic obiol. 5: 123–135. 27. Maeda, M., M. Hidaka, A. Nakamu a, H. Masaki, and T. Uozumi. 1994. Cloning, sequencing, and exp ession o he mophilic Bacillus sp. s ain TB-90 u ease gene complex in Esche ichia coli. J. Bac e iol. 176:432–442. 28. Mallick, N., and L. C. Rai. 1992. Me al induced inhibi ion o pho osyn hesis, pho osyn he ic elec on anspo chain and ATP con en o Anabaena do- liolum and Chlo ella ulga is: in e ac ion wi h exogenous ATP. Biomed. En i on. Sci. 5:241–250. 29. Mobley, H. L., R. M. Ga ne , and P. Baue eind. 1995. Helicobac e pylo i nickel- anspo gene nixA: syn hesis o ca aly ically ac i e u ease in Esche- ichia coli independen o g ow h condi ions. Mol. Mic obiol. 16:97–109. 30. Mul ooney, S. B., and R. P. Hausinge . 1990. Sequence o he Klebsiella ae ogenes u ease genes and e idence o accesso y p o eins acili a ing nickel inco po a ion. J. Bac e iol. 172:5837–5843. 31. Na a o, C., L. F. Wu, and M. A. Mand and-Be helo . 1993. The nik ope on o Esche ichia coli encodes a pe iplasmic binding-p o ein-dependen ans- po sys em o nickel. Mol. Mic obiol. 9:1181–1191. 32. Nies, D. H., A. Nies, L. Chu, and S. Sil e . 1989. Exp ession and nucleo ide sequence o a plasmid-de e mined di alen ca ion e lux sys em om Alcali- genes eu ophus. P oc. Na l. Acad. Sci. USA 86:7351–7355. 33. Nies, D. H., and S. Sil e . 1989. Me al ion up ake by a plasmid- ee me al- sensi i e Alcaligenes eu ophus s ain. J. Bac e iol. 171:4073–4075. 34. Nuci o a, G., L. Chu, T. K. Mis a, and S. Sil e . 1989. Cadmium esis ance om S aphylococcus au eus plasmid pI258 cadA gene esul s om a cadmi- um-e lux ATPase. P oc. Na l. Acad. Sci. USA 86:3544–3548. 35. Ode ma , A., H. Su e , R. K ap , and M. Solioz. 1993. P ima y s uc u e o wo P- ype ATPases in ol ed in coppe homeos asis in En e ococcus hi ae. J. Biol. Chem. 268:12775–12779. 36. Pao, S. S., I. T. Paulsen, and M. H. Saie , J . 1998. Majo acili a o supe - amily. Mic obiol. Mol. Biol. Re . 62:1–34. 37. Pa ze , S. I., and K. Han ke. 1998. The ZnuABC high-a ini y zinc up ake sys em and i s egula o Zu in Esche ichia coli. Mol. Mic obiol. 28:1199– 1210. 38. Phung, L. T., G. Ajlani, and R. Haselko n. 1994. P- ype ATPase om he cyanobac e ium Synechococcus 7942 ela ed o he human Menkes and Wil- son disease gene p oduc s. P oc. Na l. Acad. Sci. USA 91:9651–9654. 39. Rai, P. K., N. Mallick, and L. C. Rai. 1994. E ec o Cu and Ni on g ow h, mine al up ake, pho osyn hesis and enzyme ac i i ies o Chlo ella ulga is a di e en pH alues. Biomed. En i on. Sci. 7:56–67. 40. Rensing, C., M. Ghosh, and B. P. Rosen. 1999. Families o so -me al-ion- anspo ing ATPases. J. Bac e iol. 181:5891–5897. 41. Rensing, C., T. P ibyl, and D. H. Nies. 1997. New unc ions o he h ee subuni s o he CzcCBA ca ion-p o on an ipo e . J. Bac e iol. 179:6871– 6879. 42. Rey, L., J. Impe ial, J. M. Palacios, and T. Ruiz-A gueso. 1994. Pu i ica ion o Rhizobium leguminosa um HypB, a nickel-binding p o ein equi ed o hyd ogenase syn hesis. J. Bac e iol. 176:6066–6073. 43. Rippka, R., J. De uelles, J. B. Wa e bu y, M. He dman, and R. Y. S anie . 1979. Gene ics assignmen s, s ain his o ies and p ope ies o pu e cul u es o cyanobac e ia. J. Gen. Mic obiol. 111:1–61. 44. Ro h, J. R., J. G. Law ence, and T. A. Bobik. 1996. Cobalamin (coenzyme B12): syn hesis and biological signi icance. Annu. Re . Mic obiol. 50:137– 181. 45. Ru he o d, J. C., J. S. Ca e , and N. J. Robinson. 1999. Cobal -dependen ansc ip ional swi ching by a dual-e ec o Me R-like p o ein egula es a cobal -expo ing a ian CPx- ype ATPase. J. Biol. Chem. 274:25827–25832. 46. Samb ook, J., E. F. F i sch, and T. Mania is. 1989. Molecula cloning: a labo a o y manual, 2nd ed. Cold Sp ing Ha bo Labo a o y P ess, Cold Sp ing Ha bo , N.Y. 47. Schmid , T., and H. G. Schlegel. 1994. Combined nickel-cobal -cadmium esis ance encoded by he ncc locus o Alcaligenes xylosoxidans 31A. J. Bac- e iol. 176:7045–7054. 48. Sil e , S., and L. T. Phung. 1996. Bac e ial hea y me al esis ance: new su p ises. Annu. Re . Mic obiol. 50:753–789. 49. Singh, V. K., A. Xiong, T. R. Usgaa d, S. Chak aba i, R. Deo a, T. Mis a, and R. K. Jayaswal. 1999. Zn R is an au o egula o y p o ein and nega i ely egula es he ch omosomal zinc esis ance ope on zn o S aphylococcus au eus. Mol. Mic obiol. 33:200–207. 50. Summe s, A. O. 1992. Un wis and shou : a hea y me al- esponsi e an- sc ip ional egula o . J. Bac e iol. 174:3097–3101. 51. Thelwell, C., N. J. Robinson, and J. S. Tu ne -Ca e . 1998. An Sm B-like ep esso om Synechocys is PCC 6803 egula es a zinc expo e . P oc. Na l. Acad. Sci. USA 95:10728–10733. 52. Thibau , D., M. Coude , A. Famechon, L. Debussche, B. Came on, J. C ouze , and F. Blanche. 1992. The inal s ep in he biosyn hesis o hyd o- genoby inic acid is ca alyzed by he cobH gene p oduc wi h p eco in-8x as he subs a e. J. Bac e iol. 174:1043–1049. 53. Thompson, J. D., T. J. Gibson, F. Plewniak, F. Jeanmougin, and D. G. Higgins. 1997. The CLUSTAL X windows in e ace: lexible s a egies o mul iple sequence alignmen aided by quali y analysis olls. Nucleic Acids Res. 25:4876–4882. 54. Toohey, J. I. 1965. A i amin B12 compound con aining no cobal . P oc. Na l. Acad. Sci. USA 54:934–942. 55. an de Lelie, D., T. Schwuchow, U. Schwide zky, S. Wue z, W. Baeyens, M. Me geay, and D. H. Nies. 1997. Two-componen egula o y sys em in ol ed in ansc ip ional con ol o hea y-me al homoeos asis in Alcaligenes eu o- phus. Mol. Mic obiol. 23:493–503. 56. Vioque, A. 1992. Analysis o he gene encoding he RNA subuni s o ibo- nuclease P om cyanobac e ia. Nucleic Acids Res. 20:6331–6337. 57. on Heijne, G. 1992. Memb ane p o ein s uc u e p edic ion, hyd ophobici y analysis and he posi i e-inside ule. J. Mol. Biol. 225:487–494. 58. Wa , R. K., and P. W. Ludden. 1998. The iden i ica ion, pu i ica ion, and cha ac e iza ion o CooJ. A nickel-binding p o ein ha is co- egula ed wi h he Ni-con aining CO dehyd ogenase om Rhodospi illum ub um. J. Biol. Chem. 273:10019–10025. 1514 GARCI ´A-DOMI ´NGUEZ ET AL. J. BACTERIOL. on July 24, 2017 by USE/BCTA.GEN UNIVERSITARIAh p://jb.asm.o g/Downloaded om