Full text
MOLECULAR AND CELLULAR BIOLOGY, Feb. 2011, p. 674–685 Vol. 31, No. 4
0270-7306/11/$12.00 doi:10.1128/MCB.01188-10
Copy igh © 2011, Ame ican Socie y o Mic obiology. All Righ s Rese ed.
New Supp esso s o THO Mu a ions Iden i y Thp3 (Yp 045c)-Csn12
as a P o ein Complex In ol ed in T ansc ip ion Elonga ion
䌤
†
Sonia Jimeno,
1
C is ina Tous,
1
Ma ía L. Ga cía-Rubio,
1,2
Michael Ranes,
1
C is ina Gonza´lez-Aguile a,
1,2
An onio Ma ín,
2
and And e´s Aguile a
1,2
*
Cen o Andaluz de Biología Molecula y Medicina Regene a i a (CABIMER), A . Ame´ ico Vespucio s/n, 41092 Se ille, Spain,
1
and
Depa amen o de Gene´ ica, F. Biología, Uni e sidad de Se illa, Se ille, Spain
2
Recei ed 8 Oc obe 2010/Re u ned o modi ica ion 16 No embe 2010/Accep ed 3 Decembe 2010
Fo ma ion o a ibonucleop o ein pa icle (mRNP) compe en o expo equi es he coupling o ansc ip-
ion wi h mRNA p ocessing and RNA expo . A key link be ween hese p ocesses is p o ided by he THO
complex. To p og ess in ou unde s anding o his coupling, we ha e pe o med a sea ch o supp esso s o he
ansc ip ion de ec caused by he hp 1⌬mu a ion. This has pe mi ed us o iden i y mu a ions in he genes
o he RNA polyme ase II media o componen Med10, he Sch9 p o ein kinase, and he Yp 045c p o ein. We
epo a ole in ansc ip ion elonga ion o Yp 045c (Thp3) and he Csn12 componen o he COP9 signalo-
some. Thp3 and Csn12 o m a complex ha is ec ui ed o ansc ibed genes. Thei mu a ions supp ess he
gene exp ession de ec s o THO complex mu an s in ol ed in mRNP biogenesis and expo and show de ec s
in mRNA accumula ion. T ansc ip ion elonga ion impai men o hp3⌬mu an s is shown by in i o ansc ip
un-on analysis pe o med in G-less sys ems. Thp3-Csn12 es ablishes a no el link be ween ansc ip ion and
mRNA p ocessing ha opens new pe spec i es on ou unde s anding o gene exp ession and e eals no el
unc ions o a componen o he COP9 signalosome. Thp3-Csn12 also copu i ies wi h ibosomal p o eins,
which opens he possibili y ha i has o he unc ions in addi ion o ansc ip ion.
Fo ma ion o a ma u e ibonucleop o ein pa icle (mRNP)
compe en o expo equi es he co ec coupling o an-
sc ip ion wi h mRNA p ocessing s eps such as 5⬘-end capping,
splicing, 3⬘-end clea age, and polyadenyla ion, as well as wi h
RNA expo (1, 4, 9, 42). A connec ion be ween mRNP o -
ma ion and ansc ip ion is p o ided by he conse ed THO
complex. In Saccha omyces ce e isiae, THO is composed o
s oichiome ic amoun s o Tho2, Hp 1, M 1, and Thp2 (7). I
is ec ui ed o ac i e ch oma in, unc ions du ing ansc ip ion
elonga ion and RNA expo , and physically associa es wi h he
RNA-dependen ATPase Sub2/UAP56 in a la ge p o ein
complex e med TREX (61). Di e en esul s e eal a unc-
ional ela ionship be ween THO and RNA expo . These in-
clude he indings ha mu a ions in RNA expo ac o s such
as Sub2, Y a1, he Mex67-M 2 he e odime , o Nab2 hnRNP
con e gene exp ession de ec s simila o hose o THO mu-
an s and ha THO mu a ions con e syn he ic le hali y wi h
RNA expo mu a ions (35, 61). A hallma k o THO mu an s
is hei s ong genome ins abili y pheno ype ha is linked o
ansc ip ion elonga ion impai men and o he co ansc ip-
ional o ma ion o R loops (DNA-RNA hyb ids) (2, 31).
The THSC complex, also e med TREX-2 (composed o
Thp1, Sac3, Sus1, and Cdc31), is also in ol ed in mRNP bio-
genesis and expo , and he mu an o ms o i s componen s
also con e gene exp ession and mRNA expo de ec s and
inc eased genome ins abili y simila o hose o THO mu an s
(19, 22, 24, 56, 68). Despi e hei simila pheno ypes, in con-
as o THO, which is ound all o e he nucleus, THSC is
loca ed p ima ily a he nuclea pe iphe y in associa ion wi h
nucleopo ins (19, 40). No ably, i has ecen ly been shown ha
THSC physically in e ac s wi h Sem1 (15, 66), a ac o ha , in
addi ion, in e ac s wi h o he complexes such as he 19S p o-
easome (21) and he COP9 signalosome (CSN) (15). THSC,
he p o easome, and he CSN all ha e among hei compo-
nen s a subuni wi h a Sac3 domain and ano he subuni wi h
a PAM domain (8, 15, 66).
The CSN was i s iden i ied in A abidopsis haliana as an
eigh -subuni complex in ol ed in he supp ession o ligh -
dependen de elopmen (63). I is conse ed om ission yeas
o humans and is hough o be a egula o o signaling and
de elopmen al p ocesses (20, 48, 65). The CSN is a mul isub-
uni p o ease ha egula es he ac i i y o cullin-RING ligase
amilies o ubiqui in E3 complexes ia i s deneddlyase ac i i y.
The conse ed NEDD8 p o ein (Rub1 in S.ce e isiae) can be
conjuga ed o subs a e p o eins in a p ocess known as neddy-
la ion, a pos ansla ional p o ein modi ica ion closely ela ed
o ubiqui ina ion. Neddyla ion is essen ial in mos model o -
ganisms bu no in S.ce e isiae, and i is e e sed by NEDD8
isopep idases such as yeas CSN5, a componen o he CSN
(see e e ence 54). In addi ion o i s deneddyla ion unc ion, i
has also been shown ha CSN in luences he DNA damage
esponse, cell cycle con ol, and gene exp ession, al hough he
mechanism unde lying hese ac ions is unknown (6, 43). A
CSN-like complex has been desc ibed in S.ce e isiae ha i is
composed o six subuni s, Csn5, Csn9, Csn10, Csn11, Csn12,
and Csi1 (46).
Despi e he inc easing da a suppo ing he coupling be ween
ansc ip ion and RNA expo and i s impac on genome in-
s abili y, he unc ion o he ac o s in ol ed in his p ocess is
* Co esponding au ho . Mailing add ess: Cen o Andaluz de Bi-
ología Molecula y Medicina Regene a i a (CABIMER), A . Ame´ ico
Vespucio s/n, 41092 Se ille, Spain. Phone: 34 954468372. Fax: 34
954461664. E-mail: [email p o ec ed].
† Supplemen al ma e ial o his a icle may be ound a h p://mcb
.asm.o g/.
䌤
Published ahead o p in on 13 Decembe 2010.
674
on Oc obe 5, 2015 by USE/BCTA.GEN UNIVERSITARIAh p://mcb.asm.o g/Downloaded om
a om clea . To u he unde s and his coupling, as medi-
a ed by he THO complex, we ha e pe o med a sea ch o
supp esso s o he ansc ip ion de ec o hp 1⌬ ha has pe -
mi ed us o iden i y mu a ions in he gene o he RNA poly-
me ase II (RNAPII) media o componen Med10, he Sch9
p o ein kinase, and he Yp 045c p o ein o unknown unc ion.
They supp ess he ansc ip ion and RNA expo de ec s, as
well as he hype ecombina ion pheno ype, o THO mu an s.
A ho ough analysis e eals ha Yp 045c is ec ui ed o an-
sc ibed ch oma in and has a unc ional ole in ansc ip ion
elonga ion in i o, e en hough an addi ional ole in ini ia ion
canno be excluded. We show ha his no el p o ein, named
Thp3, o ms a physical and unc ional uni wi h he Csn12
componen o he CSN and copu i ies wi h ibosomal p o eins.
Ou wo k es ablishes a new link be ween RNAPII ansc ip-
ion and a p o ein complex ela ed o he CSN.
MATERIALS AND METHODS
S ains and plasmids. The yeas s ains used in his s udy a e lis ed in Table 1.
Plasmid pCYC-LacZ was cons uc ed by ampli ying he lacZ gene om plasmid
pCM184-LAUR wi h oligonucleo ides LacZUp (5⬘AAGTACTCGAGACCAT
GATTACGGAT3⬘) and LacZ-Down (5⬘TCAGATCCGCGGTCGCTATGACG
3⬘) using P u polyme ase. A 2-kb agmen was cloned in o pG-Leu-CYCds
diges ed wi h XhoI a e illing wi h Klenow agmen (C. Tous e al., unpub-
lished da a). Plasmids pG-Leu-CYCds (60), pCM184-LAUR and pCM184-
LY⌬NS (35), and pCM189-LEU2 (25) we e p e iously desc ibed. Fo he am-
pli ica ion o he FLAG cons uc s, we used he pU6H10F plasmid (12).
Tn3inse ion mu agenesis. S ain U678-1C was ans o med wi h a yeas
genomic lib a y mu agenized by he inse ion o an mTn3-lacZ/LEU2 ansposon
(5). Si es o Tn3inse ions we e iden i ied by he “ ec o e e” PCR escue
p o ocol (h p://ygac.med.yale.edu/m n/inse ion_lib a ies.s m).
Ch oma in immunop ecipi a ion (ChIP) analysis. Fo ChIP expe imen s,
s ains we e g own ei he in ich medium ( o PMA1) o in syn he ic comple e
(SC) medium con aining 2% glyce ol and 2% lac a e o an op ical densi y a 600
nm (OD
660
) o 0.5 ( o GAL1). Fo GAL1 ChIPs, he cul u e was spli in wo and
one hal was supplemen ed wi h 2% glucose ( ep essed ansc ip ion) and he
o he was supplemen ed wi h 2% galac ose (ac i a ed ansc ip ion). Samples
we e hen aken a e 4ho induc ion, and ChIP assays we e pe o med as
desc ibed p e iously (30). An i-Rpb1-CTD monoclonal an ibody 8WG16
(Be keley An ibody Company) and p o ein A-Sepha ose we e used o RNAPII
immunop ecipi a ion, and an i-FLAG M2 monoclonal an ibody om Sigma was
used o Hp 1-FLAG immunop ecipi a ion. Tandem a ini y pu i ica ion (TAP)-
agged e sions o Thp3 and Csn12 we e used. The GFX pu i ica ion sys em
(Ame sham) was used o he las DNA pu i ica ion s ep. We used he PCR o
he in e genic egion a posi ions 9716 o 9863 o ch omosome V as a nega i e
con ol. Real- ime quan i a i e PCR and calcula ion o he ela i e abundance o
each DNA agmen we e pe o med as desc ibed p e iously (32). Fo each
expe imen , he DNA a ios in he di e en egions we e calcula ed om he
amoun o DNA in hese egions ela i e o ha in he in e genic egion. Me-
dians and s anda d de ia ions (SD) o h ee independen expe imen s a e shown.
TABLE 1. Yeas s ains used in his s udy
S ain Geno ype Re e ence o
sou ce
AYW3-3C MAT␣ade2-1 can1-100 his3 u a3 leu2-k::ADE2-URA3::leu2-k hp 1⌬HIS3 58
W303-1A MATaade2-1 can1-100 his3-11 p1-1 u a3-1 leu2-3,112 R. Ro hs ein
WMK-1A MATaade2-1 can1-100 his3-11 p1-1 u a3-1 leu2-3,112 m 1⌬KAN 7
U678-1C MATaade2-1 can1-100 his3-11 p1-1 u a3-1 leu2-3,112 hp 1⌬HIS3 50
WSH-2A MAT␣ade2-1 can1-100 his3-11 p1-1 u a3-1 leu2-3,112 hp 1⌬::HIS3 sem1⌬KAN This s udy
WMT-2C MATaade2-1 can1-100 his3-11 p1-1 u a3-1 leu2-3,112 yo 045c-101 hp1⌬::KAN This s udy
BWCH-1B MATahis3 p1 u a3 leu2 hp 1⌬::HIS3 csn12⌬::KAN This s udy
BWCS12-3B MATaade2 his3 p1 u a3 leu2 csn12⌬::KAN This s udy
WMM-12D MATaade2-1 can1-100 his3-11 p1-1 u a3-1 leu2-3,112 mex67-5 yp 045c-101 This s udy
WSM-1D MATaade2-1 can1-100 his3-11 p1-1 u a3-1 leu2-3,112 yp 045c-101 sem1⌬::KAN This s udy
WWM-1D MATaade2-1 can1-100 his3-11 p1-1 u a3-1 leu2-3,112 yp 045c-101 m 1⌬::KAN This s udy
WM454-2B MAT␣ade2-1 can1-100 his3-11 p1-1 u a3-1 leu2-3,112 yp 045c-101 GAL1p::YLR454w-TRP1 This s udy
W303-454 MATaade2-1 can1-100 his3-11 p1-1 u a3-1 leu2-3,112 GAL1p::YLR454w-TRP1 45
WMC1 MATaade2-1 can1-100 his3-11 p1-1 u a3-1 leu2-3,112 mex67-535
WFBE046 MATaade2-1 can1-100 his3-11 p1-1 u a3-1 leu2-3,112 hp1⌬::KAN 22
BWC9H-1A MATahis3 p1 u a3 leu2 csn9⌬::KAN hp 1⌬:HIS3 This s udy
BWC9-4A MAT␣his3 p1 u a3 leu2 csn9⌬::KAN This s udy
BWMN-2B MATahis3 p1 u a3 leu2 yp 045c⌬::KAN This s udy
BWMH-8D MAT␣his3 p1 u a3 leu2 yp 045c⌬KAN hp 1⌬HIS3 This s udy
BWMN-1A MATaade2 his3 p1 u a3 leu2 This s udy
BWMN-1A MATaade2 his3 p1 u a3 leu2 This s udy
WA41-2B MATaade2-1 his3 u a3 leu2-k::ADE2-URA3::leu2-k hp 1⌬::HIS3 yp 045c-101 This s udy
WA48-1D MAT␣ade2-1 his3 u a3 leu2-k::ADE2-URA3::leu2-k hp 1⌬::HIS3 med10-101 This s udy
WB45-5B MATaade2-1 can1-100 his3 u a3 leu2-k::ADE2-URA3::leu2-k hp 1⌬::HIS3 sch9-101 This s udy
WA48-4B MAT␣ade2 his3 p1 u a3 leu2-k::ADE2-URA3::leu2-k med10-101 This s udy
WB45-1D MAT␣ade2 his3 p1 u a3 leu-2k::ADE2-URA3::leu2-k sch9-101 This s udy
WA41-1B MATaade2 his3 p1 u a3 leu2-k::ADE2-URA3::leu2-k hp 1⌬HIS3 This s udy
WA41-6B MATaade2 his3 p1 u a3 leu2-k::ADE2-URA3::leu2-kThis s udy
WCSHP-3B MATaade2 his3 p1 u a3 hp 1⌬::HIS3 csn12⌬::KAN This s udy
BWMN-2A MAT␣ade2 his3 p1 u a3 hp 1⌬::HIS3 This s udy
BWMN-3B MATahis3 p1 u a3 hp 1⌬::HIS3 hp3⌬::KAN This s udy
Thp3-TAP THP3-TAP in eg a ed in BY4741 Open Biosys ems
THTCS-9F CSN9-FLAG in eg a ed in he Thp3-TAP s ain This s udy
THTCS-12F CSN12-FLAG in eg a ed in he Thp3-TAP s ain This s udy
SYHPR1 MATaade2-1 can1-100 his3-11 p1-1 u a3-1 leu2-3,112 HPR1-FLAG This s udy
SYTHP3 MATaade2-1 can1-100 his3-11 p1-1 u a3-1 leu2-3,112 HPR1-FLAG hp3-101 This s udy
BTHT-1D MATau a3⌬0 his3 leu2⌬0 me -THP3-TAP::HIS3 hp1⌬::KAN This s udy
BTHH-6C MATau a3 his3 leu2 me -THP3-TAP::HIS3 hp 1⌬::HIS This s udy
VOL. 31, 2011 Thp3-Csn12 AND TRANSCRIPTION ELONGATION 675
on Oc obe 5, 2015 by USE/BCTA.GEN UNIVERSITARIAh p://mcb.asm.o g/Downloaded om
In i o G-less RNA-based un on (GLRO). S ains ha bo ing plasmid pG-Leu-
CYCds o pCYC-LacZ we e g own o an OD
600
o 0.5 in SC medium lacking
leucine (SC-leu) a 30°C. Run-on assays we e ca ied ou as p e iously desc ibed
(60). Run-on p oduc s we e diges ed wi h RNase T1, which canno deg ade
G-less RNA, and esol ed by 6% polyac ylamide gel elec opho esis (PAGE).
D ied gels we e analyzed wi h a phospho image (Fuji FLA-5100) using Image-
Quan so wa e (Molecula Dynamics). Fo each sample, he a io o he o al
coun s in he 132-n G-less casse e band o hose in he 262-n G-less casse e
band was de e mined (Tous e al., unpublished).
TAP- agged pu i ica ion o p o ein complexes. The Thp3-Csn12 complex was
pu i ied by using a TAP- agged Thp3 p o ein ( om Open Biosys ems). The
pu i ica ion was essen ially as desc ibed p e iously (55). The Thp3-TAP p o ein
was isola ed om yeas lysa es by a ini y pu i ica ion using an IgG-Sepha ose
column. P o eins in he a ious elu ion ac ions we e concen a ed wi h ichlo-
oace ic acid, esol ed by 8 o 16% g adien sodium dodecyl sul a e (SDS)-
PAGE, and sil e s ained o isualiza ion. Only he bands ha did no appea in
he nega i e con ol o he pu i ica ion (non agged s ain) we e used o ma ix-
assis ed lase deso p ion ioniza ion– ime o ligh (MALDI-TOF) mass spec-
ome y iden i ica ion.
Coimmunop ecipi a ion analyses. Fo he coimmunop ecipi a ion s udies, we
in eg a ed in o he s ain exp essing he Thp3-TAP usion p o ein ei he he
Csn9-FLAG o he Csn12-FLAG usion cons uc , which was ob ained by PCR
using p ime s CSN9-FW (5⬘-TCGGAGCTGGGAAACAAAGCTCAAA
CAGAATATATTGGAG cccaccacca ca ca cac-3⬘[lowe case le e s indica e he
sequence co esponding o he FLAG epi ope]) and CSN9-Re (5⬘-CTAATAT
CGTCATTATTATGCCTTTTTCATATTTGATTTAac a agggagaccggcaga
c-3⬘) o CSN12-FW (5⬘-CATCGTTTTCAGTAAGAAGGAGCCCTTTCCCC
ATAGCAAA cccaccacca ca ca cac3⬘) and CSN12-Re (5⬘-TTTTTTTTTCTTC
GTTCAATTATTGACTATTTTTCTATCAac a agggagaccggcaga c), using he
s anda d p ocedu e.
Fo ChIP, 50 ml o mid-log-phase YPD cul u e was incuba ed, pelle ed,
washed, and esuspended in 1 ml o lysis bu e (50 mM T is-HCl [pH 7.5], 100
mM NaCl, 1.5 mM MgCl
2
, 0.0075 NP-40, 100 mM di hio h ei ol). A e b eak-
age, 5 mg/ml ex ac was incuba ed o e nigh a 4°C wi h 10 g o an i-FLAG M2
Clone2 monoclonal an ibody (Sigma). Thi y mic oli e s o p o ein A-Sepha ose
(10%, w / ol) was incuba ed o e nigh a 4°C in 1⫻bo ine se um albumin–
phospha e-bu e ed saline (PBS). A e wa ds, he p o ein A-Sepha ose was pel-
le ed, washed wi h PBS, incuba ed wi h he ex ac and an i-FLAG an ibody o
3 h a 4°C, cen i uged, washed wi h PBS, and esuspended in 40 l o Laemmli
bu e . Finally, Wes e n immunoblo assays using a 10% ac ylamide gel and
ei he an i-FLAG o an i-TAP abbi polyclonal an ibody (The mo Scien i ic)
we e pe o med.
Mic oa ay analysis. Analysis o mic oa ay da a was ca ied ou wi h DNA-
Chip Analyze (www.dchip.o g) (41). No maliza ion o p obe cell iles and com-
pu a ion o exp ession alues we e pe o med using he In a ian Se No mal-
iza ion me hod and he Model Based me hod, espec i ely (41). Genes wi h
exp ession inc eased o dec eased by mo e han 1.5- old wi h espec o he wild
ype we e selec ed o u he s udy. GO slim e ms (Biological P ocess) we e
ob ained wi h he SGD Gene On ology Slim Mappe (h p://www.yeas genome
.o g/cgi-bin/GO/goSlimMappe .pl). The sea ch o s a is ically signi ican e ms
in he lis s o genes up- and down egula ed was pe o med using Gene On ology
Te m Finde (h p://www.yeas genome.o g/cgi-bin/GO/goTe mFinde .pl). Yeas
open eading ame (ORF) sequences we e ob ained om h p://downloads
.yeas genome.o g/sequence/genomic_sequence/o _dna/ (May 2009).
De e mina ion o ecombina ion equencies. Recombina ion equencies
we e de e mined as desc ibed p e iously (50), using 12 independen colonies o
each s ain s udied. Yeas s ains we e g own on SC medium pla es ( hose
ca ying he in ach omosomal di ec - epea sys em leu2-k::URA3-ADE2::leu2-k)
o on SC medium lacking u acil (SC-u a) ( hose ca ying he plasmid-bo ne
di ec - epea sys em LY⌬NS). A e 4 days, independen colonies we e picked,
esuspended in wa e , and pla ed in SC medium con aining 5- luo oo o ic acid
o he leu2-k::URA3-ADE2::leu2-ksys em o on SC-u a-leu pla es o he
LY⌬NS sys em. The numbe o U a
⫺
o Leu
⫹
ecombinan colonies was quan-
i ied, and he median equency o ecombina ion o each s ain pe iable cell
numbe was calcula ed (de e mined on SC medium o SC-u a).
Miscellaneous. No he n analyses we e pe o med acco ding o s anda d p o-
cedu es wi h
32
P- adiolabeled p obes. RNA was isola ed om mid-log-phase
cells, ans o med wi h ei he he e ::lacZ-URA3 o he e ::LEU2 sys em, and
g own in SC medium wi hou doxycycline. As a
32
P-labeled DNA p obe, we used
a 3-kb BamHI lacZ agmen , a 0.4-kb ClaI-EcoRV LEU2 agmen , and he
in e nal 589-bp 28S RNA agmen ob ained by PCR (7). Fo he MED10 and
SCH9 p obes, PCR agmen s we e ob ained om genomic DNA using p ime s
5⬘ATGGAAACAGCACTAACAATGA3⬘and 5⬘TCAATGGGAGATGTTCTC
TTTA3⬘(MED10) o 5⬘ATCGTCGAATCAGGATACTGGA3⬘and 5⬘TTACC
GTTGGCATCGAGTAGAA3⬘(SCH9).
RNA expo was de e mined by in si u localiza ion wi h digoxigenin-labeled
oligo(dT)
16
(3). Samples we e aken om mid-log-phase cul u es and shi ed o
37° o 4 h. Nuclei (DNA) we e isualized by s aining wi h 10 g/ml 4⬘,6-
diamidino-2-phenylindole (DAPI). Analyses we e pe o med in an Olympus
AHBT3 mic oscope.
RESULTS
A sea ch o supp esso s o he gene exp ession de ec o he
hp 1⌬mu an . To ge u he insigh in o mRNP biogenesis
and he unc ional ole o he THO complex in gene exp es-
sion, we sea ched o new genes ha could ha e a unc ion
ela ed o ha o THO. Fo his, we used he cen ome ic
plasmid pCM184-LAUR con aining a 4.15-kb lacZ-URA3
ansla ional usion unde he con ol o he e p omo e .
Wild- ype cells exp ess his usion p o ein, and consequen ly,
hey can o m colonies on SC-u a. On he con a y, THO
mu an s, like he hp 1⌬mu an , do no exp ess he lacZ-URA3
usion a su icien le els and he e o e do no o m colonies on
SC-u a (35). Using his assay, we sea ched o new hp 1⌬
supp esso s wi h he yeas genomic lib a y mu agenized wi h
he mTn3-lacZ/LEU2 ansposon (5). F om app oxima ely
22,000 yeas ans o man s wi h he inse ion lib a y es ed, we
selec ed 90 clones ha eco e ed he capaci y o hp 1⌬mu an
cells o g ow in SC-u a. A e con i ming by No he n blo ing
ha pLAUR RNA le els we e indeed inc eased (da a no
shown) and ha he Tn3inse ion ma ke (LEU2) coseg e-
ga ed wi h he supp esso pheno ype, genomic DNA om he
selec ed clones was isola ed and he DNA a ound he inse ion
was sequenced. This allowed us o selec h ee di e en mu-
an s. In wo o hem, Tn3was inse ed in he p omo e o he
SCH9 and MED10 essen ial genes (sch9-101 and med10-101),
espec i ely. Tn3inse ion caused a educ ion in he exp ession
o bo h genes (Fig. 1C). The hi d inse ion was in he middle
o he ORF o YPR045c, a new gene ha will be e e ed o as
THP3 (THO- ela ed p o ein 3) om now on ( hp3-101). Fig-
u e 1A shows ha hp 1⌬ hp3-101,hp 1⌬med10-101, and
hp 1⌬sch9-101 double mu an s ha bo ing he pLAUR sys em
eco e he capaci y o g ow in SC-u a. In Fig. 1B, we show
ha , indeed, he e is an inc ease in mRNA le els o he lacZ-
URA3 usion in he double mu an s compa ed wi h ha in he
hp 1⌬simple mu an .
Pa ial supp ession o all hp 1⌬pheno ypes by mu a ion o
YPR045c/THP3,MED10, and SCH9.We assayed nex whe he
supp ession o he gene exp ession de ec o hp 1⌬mu an
cells by hp3-101,med10-101, and sch9-101 was gene al o any
pheno ype o hp 1⌬mu an cells, including mRNA expo and
ecombina ion o whe he i was speci ic o ansc ip ion.
RNA expo o o al poly(A)
⫹
RNA was assayed by in si u
hyb idiza ion wi h Cy3-conjuga ed oligo(dT)s. As shown in
Fig. 2A, he s ong nuclea accumula ion o poly(A)
⫹
RNA
disappea ed om all double mu an s. Finally, we de e mined
he abili y o he h ee mu a ions o supp ess he hype ecom-
bina ion pheno ype o he hp 1⌬single mu an . As shown in
Fig. 2B, he h ee mu a ions we e able o educe he equency
o ecombina ion by 4- o 5- old. Supp ession was no comple e
o any o he h ee pheno ypes analyzed, bu i was clea ly
gene al and no speci ic o a pa icula pheno ype. This sug-
676 JIMENO ET AL. MOL.CELL.BIOL.
on Oc obe 5, 2015 by USE/BCTA.GEN UNIVERSITARIAh p://mcb.asm.o g/Downloaded om
ges s ha he h ee mu a ions supp essed he gene al e ec o
THO mu a ions.
Sch9 is a majo a ge o TORC1 in S.ce e isiae (62). I is a
kinase in ol ed in egula ion o RNAPIII ansc ip ion by
phospho yla ion o he Ma 1 ep esso (39). Nu 2/Med10 is a
componen o he RNAPII media o complex (27). The pu a-
i e unc ion o he SCH9 and MED10 genes ela ed o an-
sc ip ion migh cause he mu a ions o educe he a e o an-
sc ip ion, alle ia ing he need o he THO complex in mRNP
biogenesis (see Discussion). Li le is known abou Thp3/
Yp 045c. I is a nuclea p o ein wi h a conse ed SAC3 do-
main, which is also ound in he Sac3 componen o he THSC
complex, bu i s unc ion is unknown. In high- h oughpu s ud-
ies, i has been shown o in e ac physically wi h Y a1 and
gene ically wi h he Ta 9 componen o SAGA (37, 47). A
ecen global analysis o gene ic and physical in e ac ion da a
has shown ha Thp3/Yp 045c is also ela ed o Sem1, a ac o
ha in e ac s wi h he p o easome and wi h THSC/TREX-2
(66), bu he physiological meaning o his in e ac ion is un-
known. Fo hese easons, we ocused all ou wo k on Thp3/
Yp 045c.
THP3 mu a ion speci ically supp esses THO complex mu-
a ions. We wonde ed whe he he supp ession con e ed by
hp3-101 was speci ic o THO mu a ions o i i was gene al o
mu a ions in o he genes wi h a ole a he ansc ip ion-RNA
expo in e ace ha con e ed pheno ypes simila o hose
con e ed by THO mu a ions. We es ed he abili y o hp3-101
o supp ess m 1⌬, a subuni o THO, he hp1⌬mu a ion o
he THSC complex, and he mex67-5mu a ion o he Mex67-
M 2 RNA expo ac o . As shown in Fig. 3, hp3-101 was able
o supp ess he inabili y o he m 1⌬mu an o o m colonies
in medium lacking u acil and he e o e o exp ess lacZ-URA3
a he app op ia e le els o suppo g ow h. Ins ead, his sup-
p ession was no obse ed in hp1⌬ hp3-101 and mex67-5
FIG. 1. Supp ession o he gene exp ession pheno ype o hp 1⌬by
he YPR045c/THP3,MED10, and SCH9 mu a ions. (A) Pheno ypic
analysis o hp 1⌬(U678-1C), hp 1⌬ hp3-101,hp 1⌬med10-101, and
hp 1⌬sch9-101 isogenic s ains ans o med wi h he pLAUR sys em.
The capaci y o each s ain o o m colonies on SC-u a a e 4 days a
30°C is shown. A scheme o he pLAUR sys em is shown a he op.
(B) No he n blo analyses o he s ains shown in panel A. RNA le els
in a bi a y uni s (A.U.) we e ob ained in a Fuji FLA 3000 and no -
malized wi h espec o he RNA le els o each sample. (C) No he n
analyses o he MED10 and SCH9 endogenous genes in he wild- ype
(WT; WA41-6B) and med10-101 (WA48-4B) and sch9-101 (WB45-1D)
mu an congenic s ains. O he de ails a e as in panel B.
FIG. 2. Supp ession o he RNA expo and hype ecombina ion
pheno ypes o hp 1⌬mu an cells by he YPR045c/THP3,MED10, and
SCH9 mu a ions. (A) Subcellula localiza ion o poly(A)
⫹
RNAs de-
ec ed by in si u hyb idiza ion wi h digoxigenin-labeled oligo(dT)
16
o
hp 1⌬(U678-1C), hp 1⌬ hp3-101,hp 1⌬med10-101, and hp 1⌬sch9-
101 isogenic s ains. Samples we e aken om mid-log-phase cul u es
and shi ed o 37°C o 4 h. (B) Recombina ion equency o he
in ach omosomal di ec - epea sys em leu2-k::URA3-ADE2::leu2-kin
hp 1⌬(AYW3-3C), hp 1⌬yp 045c-101 (WA41-2B), hp 1⌬med10-
101(WA48-1D), and hp 1⌬sch9-101 (WB45-5B) mu an isogenic
s ains. A schema ic o he ecombina ion assay is shown a he op.
VOL. 31, 2011 Thp3-Csn12 AND TRANSCRIPTION ELONGATION 677
on Oc obe 5, 2015 by USE/BCTA.GEN UNIVERSITARIAh p://mcb.asm.o g/Downloaded om
hp3-101 double mu an s. Ac ually, he mex67-5 hp3-101
double mu an is e y sick and does no g ow a 30°C (Fig.
3). This implies ha hp3-101 speci ically supp esses mu a-
ions o he THO complex, no only o Hp 1, whe eas i does
no supp ess o he mRNP biogenesis- and expo - ela ed
mu a ions. The e o e, Thp3 migh be a p o ein wi h a unc-
ion ela ed o ha o THO.
T ansc ip ion is impai ed in hp3⌬mu an s. Gi en he ge-
ne ic ela ionship o he hp3 mu a ion wi h THO mu a ions,
we asked whe he his mu a ion also impai s ansc ip ion
elonga ion. We i s de e mined he capabili y o hp3-101 mu-
an cells o ansc ibe e p::lacZ-URA3 o he plasmid-bo ne
pLAUR sys em. As shown in Fig. 4A, hp3-101 mu an s accu-
mula ed lacZ-URA3 RNA a le els below 50% o ha o he
wild ype. Howe e , in he sho e e p::LEU2 con ol sys em,
he LEU2 ansc ip accumula ed a 30% o he wild- ype le -
els (Fig. 4B). This sugges s ha he hp3 mu an may ha e a
de ec in he ac i a ion o he e p omo e .
Consequen ly, we would expec ha hp3-101 may ha e a
gene al e ec in ansc ip ion.
P e iously, analysis o RNAPII ec ui men by ChIP analysis
was used o assess in i o ansc ip ion impai men in se e al
mu an s. ChIPs we e pe o med a he 8-kb-long YLR454c
gene used o he GAL1 p omo e in h ee di e en egions (5⬘
end, middle, and 3⬘end). In he wild- ype s ain, abo e 95% o
he RNAPIIs eached he 3⬘end o he gene and his alue was
signi ican ly educed in mu an s de ec i e in ansc ip ion elon-
ga ion, such as sp 4 o THO mu an s (43). Analysis o he
dis ibu ion o RNAPII a he GAL1p::YLR454 cons uc e-
ealed ha he ela i e le els o RNAPII h oughou he p o-
mo e , 5⬘, and 3⬘ egions did no change in wild- ype o hp3-
101 mu an cells, bu in hp3-101 mu an cells, he o e all le els
we e hal o he wild- ype le els a he h ee posi ions es ed
(Fig. 4C). These esul s indica e a gene al educ ion in an-
sc ip ion bu do no o e a clea answe abou an e ec on
ansc ip ion elonga ion. In his sense, i is wo h no ing ha
FIG. 4. T ansc ip ion analysis o hp3⌬mu an s. (A) No he n
analysis o he P e ::lacZ-URA3 usion in he wild- ype (w o WT)
and hp3⌬mu an (BWMN-2B) congenic s ains. O he de ails a e
as in Fig. 1B. A.U., a bi a y uni s. (B) Gene exp ession analysis o
he pCM189-LEU2 cons uc . Analysis o he capaci y o he hp3⌬
mu an and wild- ype s ains o ansc ibe he P e ::LEU2 cons uc ,
measu ed by No he n blo analysis, is shown. O he de ails a e as
in Fig. 1B. (C) RNAPII occupancy a he GAL1-YLR454w gene in
he hp3-101 mu an . ChIP analyses (using 8WG16 an i-RNPII an-
ibodies) in he wild- ype (W303) and hp3-101 mu an (WM454-
2B) isogenic s ains ca ying he GAL1p::YLR454w usion cons uc
loca ed a he endogenous YLR454w ch omosomal locus a e shown.
A schema ic o he gene and he PCR-ampli ied agmen s is shown.
The DNA a ios in he p omo e (ba s 1), 5⬘(ba s 2), and 3⬘(ba s
3) egions we e calcula ed om he DNA amoun s in hese egions
ela i e o ha in he in e genic egion. Medians and SD o h ee
independen expe imen s a e shown. (D) Sensi i i y o he hp3⌬
mu an o 6-azau acil. Ten old se ial dilu ions o he wild- ype
(BY4741) and hp3⌬and sp 4⌬mu an isogenic s ains we e cul-
u ed o 4 days a 30°C in YPD medium ei he wi h o wi hou
6-azau acil.
FIG. 3. Speci ici y o he supp ession o he gene exp ession phe-
no ype o he hp 1⌬mu an by he THP3 mu a ion. Pheno ypic analysis
o m 1⌬(WMK-1A), m 1⌬ hp3-101 (WWM-1D), mex67-5(WMC1),
mex67-5 hp3-101 (WMM-12D), hp1⌬(WFBE046), and hp1⌬ hp3-
101 (WMT-2C) mu an s ains ans o med wi h he pLAUR sys em.
The capaci y o each s ain o o m colonies on SC-u a a e 4 days a
30°C o 26°C is shown. O he de ails a e he same as in Fig. 1A.
678 JIMENO ET AL. MOL.CELL.BIOL.
on Oc obe 5, 2015 by USE/BCTA.GEN UNIVERSITARIAh p://mcb.asm.o g/Downloaded om
mu a ions in he yeas PAF complex show a simila RNAPII
ChIP dis ibu ion (45). Howe e , his complex has been shown
o be equi ed o ansc ip ion elonga ion in i o (57) and in
i o (C. Tous e al., unpublished). Simila ly, he ole o human
PAF in ansc ip ion elonga ion has been demons a ed in a
ch oma in empla e (36).
Fu he mo e, we ha e obse ed ha , as is he case o he
hp3-101 allele ob ained in ou sc eening, he hp3⌬null mu-
an is able o supp ess he ansc ip ional de ec o he hp 1⌬
mu an (see Fig. S1 in he supplemen al ma e ial) and is sen-
si i e o 6-azau acil, an inhibi o o ansc ip ion elonga ion
(Fig. 4D).
Finally, we di ec ly assayed he e ec o hp3⌬on ansc ip-
ion elonga ion. This was done in i o wi h a no el assay based
on a un-on analysis o ansc ip ion uni s ca ying wo G-less
casse es (GLRO assays). The GLRO assays a e based on wo
plasmid-bo ne cons uc s con aining wo G-less casse es o
262 nucleo ides (n ) and 132 n sepa a ed by a 243-n CYC1
(GLRO-sho ) o a 2-kb lacZ (GLRO-long) agmen as a
space sequence; bo h casse es a e unde he con ol o he
s ong and cons i u i e TDH3 p omo e (Tous e al., unpub-
lished) (Fig. 5A). T ansc ip ion elonga ion was measu ed by
un-on analysis, ollowed by pu i ica ion o syn hesized RNAs
and subsequen RNase T1 ea men , which does no deg ade
G-less RNAs. Figu e 5B shows ha he e iciency o ansc ip-
ion elonga ion, as assayed by he abili y o ansc ibe he
downs eam 243-n G-less casse e e sus he ups eam 132-n
casse e, was 80% o he wild- ype le el o he GLRO-sho
sys em and 56% o he wild- ype le el o he GLRO-long
sys em. This esul clea ly shows ha ansc ip ion elonga ion
is de ec i e in hp3⌬mu an cells, his de ec being mo e e i-
den o long ansc ip s, consis en wi h he idea ha he
longe he ansc ip ion uni analyzed he highe he ansc ip-
ion elonga ion de ec expec ed, e en hough i does no ex-
clude he possibili y ha i can also wo k in ini ia ion.
Thp3 is ec ui ed o ORFs in a ansc ip ion-dependen
manne . We nex asked whe he his p o ein is ec ui ed o
ansc ip ionally ac i e ORFs. Fo his, we used a wild- ype
s ain con aining a TAP- agged Thp3 p o ein and de e mined
by quan i a i e PCR he ec ui men o Thp3 o he cons i u-
i e PMA1 gene and he egula ed GAL1 gene, he la e unde
bo h ep essed (2% glucose) and ac i a ed (2% galac ose)
condi ions. As shown in Fig. 6A, Thp3 was clea ly ec ui ed o
he h ee egions o PMA1, he p oximal 5⬘-end, he middle,
and he dis al 3⬘-end egions, wi h simila amoun s in all o he
egions. Fo GAL1 unde ep essed condi ions, Thp3 ec ui -
men was almos unde ec able along he 5⬘-end, middle, and
3⬘-end ORF egions, as well as he un ansla ed egion. In-
s ead, unde ac i a ed ansc ip ion condi ions, Thp3 was e-
c ui ed all o e he gene om he 5⬘-end o he 3⬘-end ORF
egion (Fig. 6B). The e o e, consis en wi h i s pu a i e ole in
elonga ion, Thp3 is ec ui ed o ansc ibed ORFs.
Thp3 o ms a physical and unc ional complex wi h Csn12.
To ge u he insigh in o he unc ion o Thp3, we unde ook
a biochemical analysis aimed a iden i ying o he p o eins ha
physically in e ac ed wi h Thp3 in i o. Fo his, we used a
s ain ca ying a TAP- agged Thp3 p o ein o pu i y in i o
Thp3-bound p o eins by wo-s ep ch oma og aphy pu i ica-
ion. A e es ablishing ha he p o ein bands ob ained in he
pu i ica ion we e speci ic o he Thp3-TAP s ain (Fig. 7A), we
iden i ied hem by MALDI-TOF. As shown in Fig. 7B, Csn12,
which has been shown o in e ac wi h he CSN, was clea ly
copu i ied wi h Thp3. In addi ion o Csn12, we ob ained se -
e al ibosomal p o eins ha appea ed in he Thp3-TAP bu
no in he con ol s ain (Fig. 7A and B).
We asked nex whe he Thp3-Csn12 o ms a unc ional uni
and whe he o no i unc ions in he con ex o he signalo-
some. Fo his, we analyzed whe he csn12⌬supp esses he
ansc ip ion de ec o hp 1⌬mu an cells, as was he case o
hp3⌬, and we compa ed he esul s wi h hose o csn9⌬,abona
ide ep esen a i e o he signalosome complex and he ela ed
sem1⌬mu an . Indeed, csn12⌬, bu no csn9⌬o sem1⌬, was
able o supp ess he he mosensi i i y o hp 1⌬, as well as i s
inabili y o ansc ibe he lacZ-URA3 ORF, as de e mined by
he capaci y o g ow on SC-u a (Fig. 8A). We ha e also
checked ha he csn12⌬mu a ion, as is he case o hp3⌬,
pa ially supp esses he hype ecombina ion pheno ype due o
hp 1⌬, as de e mined wi h he LY⌬NS plasmid-bo ne ecom-
bina ion sys em (Fig. 8B). The e o e, supp ession o THO
FIG. 5. E ec o hp3⌬on ansc ip ion elonga ion. (A) Schema ic
o andem G-less casse e cons uc s pG-leu-CYCds (GLRO-sho )
and pCYCLacZ (GLRO-long). (B) GLRO analysis o wild- ype (w ;
BY4741) and hp3⌬mu an isogenic s ains ans o med wi h pG-leu-
CYCds and pCYCLacZ sys ems. The ec angles ep esen he wo
G-less casse es. T ans o man s we e g own in SC-leu medium o ex-
ponen ial phase and un on ansc ip ion assays we e pe o med as
desc ibed in Ma e ials and Me hods. Radioac i i y inco po a ed in o
he G-less casse es was quan i ied in a Fuji FLA-5100. Fo each
sample, he a io o he o al numbe s o coun s inco po a ed in o he
dis al e sus he p oximal G-less casse e was de e mined and no mal-
ized agains he a io o he same cons uc in he wild- ype s ain. The
a e age and SD o h ee independen expe imen s a e shown. The
alues o he le a e molecula sizes in nucleo ides.
VOL. 31, 2011 Thp3-Csn12 AND TRANSCRIPTION ELONGATION 679
on Oc obe 5, 2015 by USE/BCTA.GEN UNIVERSITARIAh p://mcb.asm.o g/Downloaded om
mu a ions is speci ically sha ed by hp3⌬and csn12⌬and no by
mu a ions in he signalosome complex. In ag eemen wi h his
conclusion, we ha e obse ed ha hp3⌬and csn12⌬con e
sensi i i y o mycophenolic acid (MPA), a d ug ha deple es
cells o GTP, impai ing ansc ip ion elonga ion (28), whe eas
his is no he case o csn9⌬(Fig. 8C). We ha e u he
con i med by coimmunop ecipi a ion analyses ha he in e -
ac ion be ween Thp3 and Csn12 is speci ic and no sha ed by
o he componen s o he signalosome. As shown in Fig. 9,
Thp3 cop ecipi a ed wi h Csn12 bu no wi h Csn9. Mo eo e ,
No he n analysis o ansc ip ion o csn12⌬mu an cells e-
ealed ha hey yield abou 75% o he o al lacZ-URA3 an-
sc ip s om he pLAUR sys em, implying a de ec in ansc ip-
ion, al hough weake han ha o hp3⌬mu an cells in his
assay (Fig. 10A). Howe e , in he sho e e p::LEU2 con ol
sys em, he LEU2 ansc ip accumula ed a he same le els as
in he wild ype (Fig. 10B), implying ha hp3⌬did no ha e a
nega i e e ec on he ac i a ion o he e p omo e . Finally, o
u he con i m ha Csn12 was no only physically bu unc-
ionally ela ed o Thp3, we de e mined he abili y o a TAP-
agged Csn12 p o ein o immunop ecipi a e ch oma in. As
shown in Fig. 10C, Csn12 was ec ui ed h oughou he PMA1
gene a he h ee posi ions es ed, he 5⬘end, he middle, and
he 3⬘end. Fu he mo e, using he inducible GAL1 endoge-
nous gene, we ha e seen ha , as is he case o Thp3, Csn12 is
ec ui ed o ansc ibed ch oma in. Rec ui men o GAL1 was
de ec ed only in galac ose-con aining medium (Fig. 10D). We
can he e o e conclude ha Csn12 and Thp3 o m a physical
and unc ional uni wi h a ole in ansc ip ion. Ou esul s
he e o e con i m a ole o Thp3-Csn12 in ansc ip ion elon-
ga ion in i o ha is unc ionally independen o he signalo-
some.
To know whe he he p esence o a numbe o ibosome
p o eins in he Thp3-TAP has an addi ional biological meaning
equi es a mo e elabo a e analysis. Ne e heless, he ac ha
ibosomal p o eins we e no obse ed in ou blank con ol
opens he possibili y ha Thp3-Csn12 physically in e ac s wi h
a ibosomal coun e pa . De e mina ion o whe he o no his
implies an addi ional pos ansc ip ional unc ion o Thp3-
FIG. 6. Rec ui men o Thp3-TAP o ansc ibed ch oma in.
(A) ChIP analysis o Thp3 a he endogenous PMA1 gene in he
wild- ype s ain ca ying TAP- agged Thp3 ( om Open Biosys ems). A
schema ic o he gene analyzed and he ampli ied PCR agmen s is
shown. The median and SD o h ee independen expe imen s a e
shown. (B) ChIP analysis o Thp3 a he endogenous GAL1 gene.
O he de ails a e as in panel A.
FIG. 7. Pu i ica ion o a Thp3 p o ein complex. (A) TAP and i s
blank con ol. Isogenic (BY4741) Thp3-TAP and un agged s ains
we e used o TAP.A4 o12%g adien gel (NuPAGE No ex Bis-T is
om In i ogen) and sil e s ain we e used. (B) Thp3-TAP p o eome.
Sil e -s ained 8 o 16% g adien SDS-PAGE o he Thp3-TAP- agged
complex pu i ied om wild- ype cells. In addi ion o he ull Thp3 and
Csn12 p o eins, we ob ained unca ed Thp3 (Thp3- ); ibosomal p o-
eins Rpl3 (band 1), Rpl4 (bands 2 and 4), Rpl7 (band 6), Rps13 (band
8), and Rps16 (band 9); and he common TAP con aminan s Tdh3
(band 3), Ee 2 (calmodulin-dependen p o ein) (band 5), and human
calpain (band 7).
680 JIMENO ET AL. MOL.CELL.BIOL.
on Oc obe 5, 2015 by USE/BCTA.GEN UNIVERSITARIAh p://mcb.asm.o g/Downloaded om
Csn12, such as ansla ion o ibosome biosyn hesis, equi es
u he in es iga ion.
Genome-wide analysis o gene exp ession in hp3⌬mu an s.
To assay i he e ec o hp3⌬was due o he down egula ion
o a ansc ip ion elonga ion ac o , we de e mined he an-
sc ip le els o he whole genome in hp3⌬mu an cells by
mic oa ay gene exp ession analysis. Using he A yme ix pla -
o m, we de e mined he RNA le els o 5,800 genes. Among
hese, 76 we e signi ican ly down egula ed (le els ⱕ0.5 imes
ha o he wild ype) (see Table S1 in he supplemen al ma-
e ial). They do no sha e any s uc u al o unc ional ea u es,
and none o hem has been shown o ha e a ole in ansc ip-
ion elonga ion. The e o e, he e ec o hp3⌬on ansc ip ion
does no seem o be media ed by a second gene.
In e es ingly, a compa a i e analysis wi h p e ious da a o
he hp1⌬and ho2⌬mu an s (44) e ealed ha 28 genes
down egula ed in he hp3⌬mu an a e down egula ed in he
ho2⌬mu an and ha 30 genes down egula ed in he hp3⌬
mu an a e down egula ed in he ho2⌬mu an . Mo eo e , 26
o hese genes a e he same in he h ee mu an s. In e es ingly,
mos o hese 26 genes a e ei he subcen ome ic (14 ou o 26)
o sub elome ic (10 ou o 26) (see Table S2 and Fig. S2 in he
supplemen al ma e ial). This sugges s an in iguing link be-
ween Thp3-Csn12 and he e och oma in-p oximal egions ha
would equi e u he analysis o e alua e i s biological signi -
icance.
DISCUSSION
A sea ch o supp esso s o he gene exp ession de ec o he
hp 1⌬mu an has led o he isola ion o inse ion mu a ions in
YPR045c,MED10, and SCH9. P e ious sc eenings o supp es-
so s o he hp 1⌬mu a ion ha e iden i ied se e al ac o s in-
ol ed in ansc ip ion. Thus, mu a ions in componen s o he
media o o RNAPII like H s1/Med3, S b2/Med20, Gal11/
Med15, and Sin4/Med16 ha e been shown o supp ess hp 1⌬
hype ecombina ion (14, 51, 52, 58). Besides, mu a ions in he
Rad3 componen o he TFIIH ini ia ion ac o supp ess he
accumula ion o ansc ip s a he si e o ansc ip ion in m 1⌬
mu an s (33), and he soh alleles o Med31, Rpb2, and TFIIB
supp ess he hp 1⌬mu an he mosensi i i y pheno ype (14).
Ou iden i ica ion o Med10 as a supp esso o hp 1⌬cons i-
u es new e idence ha a de ec i e media o o RNAPII p o-
ein supp esses THO mu a ions. In e es ingly, Soh1/Med31
has been shown o in e ac wi h Nu 2/Med10 by wo-hyb id
assay and a ini y cap u e (10). This could imply ha a subse o
FIG. 8. Gene ic analysis o he Thp3 p o ein complex. (A) G ow h
on SC-u a o hp 1⌬ hp3⌬(BWMH-8D), hp 1⌬csn12⌬(BWCH-1B),
hp 1⌬sem1⌬(WSH-2A), and hp 1⌬csn9⌬(BWC9H-4A) mu an con-
genic s ains ca ying he pLAUR sys em and g ow h o he same
s ains in YPD a 30 and 37°C. O he de ails a e as in Fig. 1A. (B) Sup-
p ession o he hype ecombina ion pheno ype o he hp 1⌬mu an by
he hp3 and csn12 mu a ions. The ecombina ion equencies o he
plasmid-bo ne di ec - epea sys em LY⌬NS in he hp 1⌬(BWMN-
2A), hp 1⌬ hp3⌬(BWMN-3B), and hp 1⌬csn12⌬(WCSHP-3B) mu-
an congenic s ains a e shown. A schema ic o he ecombina ion
assay is shown a he op. (C) Se ial dilu ions o he wild- ype (WT;
BY4741) and hp3⌬,csn12⌬, and csn9⌬mu an isogenic s ains cul-
u ed in YPD medium wi h and wi hou MPA (150 g/ml) a 37°C.
FIG. 9. Speci ici y o he in e ac ion be ween Thp3 and Csn12.
Expe imen s in which Thp3-TAP was coimmunop ecipi a ed wi h
Csn12-FLAG (le ) o Csn9-FLAG ( igh ) a e shown. Isogenic s ains
wi h no ag (BY4741) o ca ying bo h he Thp3-TAP usion p o ein
and ei he he Csn12-FLAG (THT-12FLAG) o he Csn9-FLAG
(THT-9FLAG) usion p o ein we e used. IP, immunop ecipi a e; WB,
Wes e n blo ing.
VOL. 31, 2011 Thp3-Csn12 AND TRANSCRIPTION ELONGATION 681
on Oc obe 5, 2015 by USE/BCTA.GEN UNIVERSITARIAh p://mcb.asm.o g/Downloaded om
media o o RNAPII p o eins may unc ionally in e ac wi h
THO. Howe e , i seems likely ha he common beha io o
hese supp esso s, including med10, is a educ ion in ansc ip-
ion i ing o ansc ip ion e iciency, consis en wi h he ob-
se a ion ha a dec ease in he s eng h o ansc ip ion can
alle ia e hp 1⌬gene exp ession de ec s (33, 34).
The second supp esso isola ed in his s udy is Sch9, a majo
a ge o TORC1 in S.ce e isiae (62). I is a kinase in ol ed in
he egula ion o RNAPIII-media ed ansc ip ion (39). In e -
es ingly, SCH9 mu a ions ha e also been shown o supp ess
o he ansc ip ion-associa ed ecombina ion e en s in yeas ,
as is he case o HOT1-s imula ed ecombina ion and ibo-
somal DNA ecombina ion (53). SCH9 mu a ions also sup-
p ess he genomic ins abili y o null mu an s o he Sgs1 DNA
helicase in ol ed in double-s and b eak epai (43). These
esul s sugges ha Sch9 could play a no el ole in he con ol
o genomic in eg i y, bu he molecula basis and biological
signi icance o his pu a i e ole emain o be seen. In e es -
ingly, di e en ypes o gene ic in e ac ions ha e been epo ed
o SCH9 wi h SEM1 and SOH1/MED31 (18) and wi h MED10
(59). Sem1 physically in e ac s wi h he THSC complex, and i s
mu a ion shows de ec s simila o hose obse ed in THO and
THSC complex mu an s (15, 66). Al oge he , hese da a may
indica e ha Sch9, Nu 2/Med10, and Soh1/Med31 ac in he
same gene ic pa hway, he absence o which alle ia es he
pheno ypes o THO mu an s, p esumably by al e ing ansc ip-
ion and mRNP biogenesis o le els ha ole a e he absence
o THO, as has been sugges ed o o he supp esso s (33, 34).
No ably, ou supp esso analysis has iden i ied Yp 045c
(Thp3). Li le is known abou his p o ein. I is nuclea , and i
has been p e iously shown o coimmunop ecipi a e wi h Csn12
oge he wi h o he p o eins, including he Y a1 mRNA expo
ac o (37). We show he e ha Thp3 has a ole in ansc ip ion.
Howe e , he de ec o he hp3 mu an is no simila o ha o
THO mu an s. This is no su p ising, gi en ha mu a ions in
he media o and o he ansc ip ion ac o s ha also supp ess
hp 1 mu a ions do no ha e he same unc ion o e ec as THO
(14, 51, 58). hp3 mu an s ha e a de ec in ansc ip ion a bo h
he ini ia ion and elonga ion s eps. The ec ui men o Thp3
h oughou he whole ORF unde ac i e ansc ip ion condi-
ions sugges s an ac i e ole o Thp3 du ing ansc ip ion
elonga ion, al hough i does no elimina e he possibili y o a
ole in o he ansc ip ion s eps. This ac i e ole is con i med
by he sensi i i y o 6-azau acil and wi h he ansc ip ion elon-
FIG. 10. Cha ac e iza ion o Csn12. (A) No he n analysis o he lacZ-URA3 usion in wild- ype (w ; BWMN-1A) and csn12⌬mu an
(BWCS12-3B) congenic s ains. O he de ails a e as in Fig. 1B. A.U., a bi a y uni s. (B) No he n analysis o he e p::LEU2 usion. O he de ails
a e as in panel A. (C) ChIP analysis o TAP- agged Csn12 a he PMA1 gene. (D) ChIP o Csn12-TAP a he GAL1 gene. O he de ails a e as
in Fig. 6.
682 JIMENO ET AL. MOL.CELL.BIOL.
on Oc obe 5, 2015 by USE/BCTA.GEN UNIVERSITARIAh p://mcb.asm.o g/Downloaded om