scieee Open visual document viewer

Characterization of saccharomyces cerevisiae Npa2p (Urb2p) reveals a low-molecular-mass complex containing Dbp6p, Npa1p (Urb1p), Nop8p, and Rsa3p involved in early steps of 60S ribosomal subunit biogenesis

Rosado, Iván; Dez, Christophe; Lebaron, Simon; Caizergues-Ferrer, Michèle; Henry, Yves; Cruz Díaz, Jesús de la

Abstract

We report the characterization of the yeast Npa2p (Urb2p) protein, which is essential for 60S ribosomal subunit biogenesis. We identified this protein in a synthetic lethal screening with thersa3null allele. Rsa3p is a genetic partner of the putative RNA helicase Dbp6p. Mutation or depletion of Npa2p leads to a net deficit in 60S subunits and a decrease in the levels all 27S pre-rRNAs and mature 25S and 5.8S rRNAs. This is likely due to instability of early pre-60S particles. Consistent with a role of Npa2p in 60S subunit biogenesis, green fluorescent protein-tagged Npa2p localizes predominantly to the nucleolus and TAP-tagged Npa2p sediments with large complexes in sucrose gradients and is associated mainly with 27SA2 pre-rRNA-containing preribosomal particles. In addition, we reveal a genetic synthetic interaction between Npa2p, several factors required for early steps of 60S subunit biogenesis (Dbp6p, Dbp7p, Dbp9p, Npa1p, Nop8p, and Rsa3p), and the 60S protein Rpl3p. Furthermore, coimmunoprecipitation and gel filtration analyses demonstrated that at least Npa2p, Dbp6p, Npa1p, Nop8p, and Rsa3p are present together in a subcomplex of low molecular mass whose integrity is independent of RNA. Our results support the idea that these five factors work in concert during the early steps of 60S subunit biogenesis

Full text

MOLECULAR AND CELLULAR BIOLOGY, Feb. 2007, p. 1207–1221 Vol. 27, No. 4 0270-7306/07/$08.00⫹0 doi:10.1128/MCB.01523-06 Copy igh © 2007, Ame ican Socie y o Mic obiology. All Righ s Rese ed. Cha ac e iza ion o Saccha omyces ce e isiae Npa2p (U b2p) Re eals a Low-Molecula -Mass Complex Con aining Dbp6p, Npa1p (U b1p), Nop8p, and Rsa3p In ol ed in Ea ly S eps o 60S Ribosomal Subuni Biogenesis 䌤 † I a´n V. Rosado, 1 Ch is ophe Dez, 2 Simon Leba on, 2 Miche`le Caize gues-Fe e , 2 Y es Hen y, 2 and Jesu´s de la C uz 1 * Depa amen o de Gene´ ica, Uni e sidad de Se illa, Se illa, Spain, 1 and Equipe Labellise´e Ligue Na ionale con e le Cance , Labo a oi e de Biologie Moleculai e Euca yo e, CNRS-Uni e si e Paul Saba ie , IFR 109, Toulouse, F ance 2 Recei ed 16 Augus 2006/Re u ned o modi ica ion 8 Oc obe 2006/Accep ed 24 No embe 2006 We epo he cha ac e iza ion o he yeas Npa2p (U b2p) p o ein, which is essen ial o 60S ibosomal subuni biogenesis. We iden i ied his p o ein in a syn he ic le hal sc eening wi h he sa3 null allele. Rsa3p is a gene ic pa ne o he pu a i e RNA helicase Dbp6p. Mu a ion o deple ion o Npa2p leads o a ne de ici in 60S subuni s and a dec ease in he le els all 27S p e- RNAs and ma u e 25S and 5.8S RNAs. This is likely due o ins abili y o ea ly p e-60S pa icles. Consis en wi h a ole o Npa2p in 60S subuni biogenesis, g een luo escen p o ein- agged Npa2p localizes p edominan ly o he nucleolus and TAP- agged Npa2p sedimen s wi h la ge complexes in suc ose g adien s and is associa ed mainly wi h 27SA 2 p e- RNA-con aining p e ibo- somal pa icles. In addi ion, we e eal a gene ic syn he ic in e ac ion be ween Npa2p, se e al ac o s equi ed o ea ly s eps o 60S subuni biogenesis (Dbp6p, Dbp7p, Dbp9p, Npa1p, Nop8p, and Rsa3p), and he 60S p o ein Rpl3p. Fu he mo e, coimmunop ecipi a ion and gel il a ion analyses demons a ed ha a leas Npa2p, Dbp6p, Npa1p, Nop8p, and Rsa3p a e p esen oge he in a subcomplex o low molecula mass whose in eg i y is independen o RNA. Ou esul s suppo he idea ha hese i e ac o s wo k in conce du ing he ea ly s eps o 60S subuni biogenesis. The syn hesis o euka yo ic ibosomes is a complex and highly ene gy-consuming p ocess (53, 103). Ribosome biogen- esis akes place p ima ily in he nucleolus, bu some e en s occu in he nucleoplasm, whe e he p e ibosomal subuni s gain expo compe ence, and in he cy oplasm, whe e he las s eps in he ma u a ion o he ibosomal subuni s ( -subuni s) occu (94, 96). Al hough ibosome biogenesis is conse ed h oughou euka yo es (39, 90), i has been bes cha ac e ized in he yeas Saccha omyces ce e isiae ( o e iews, see e e - ences 33, 58, and 100). In yeas , h ee o he ou RNAs (18S, 5.8S, and 25S RNAs) a e ansc ibed as a single p ecu so by RNA polyme ase I, whe eas RNA polyme ase III sepa a ely ansc ibes he p e-5S RNA ( o a e iew, see e e ence 73). Concomi an ly wi h ansc ip ion, he p e- RNA in e media es a e ex ensi ely modi ied ( o a e iew, see e e ence 13). These p ecu so s a e hen p ocessed by a complex se ies o endo- and exonucleoly ic eac ions (see Fig. 1), which equi es small nu- cleola RNAs and non ibosomal p o eins ( -p o eins) ( o e- iews, see e e ences 58 and 101). While some o hese p o ein ac o s ha e clea unc ions in p e- RNA p ocessing and mod- i ica ion (e.g., nucleases and base me hylases), he p ecise unc ions o mos o hem emain unclea . P e- RNA p ocessing does no occu on naked RNA mole- cules. Ins ead, p e- RNA molecules a all s ages o ma u a ion associa e wi h mos -p o eins and non ibosomal p o eins o o m p e ibosomal pa icles ( -pa icles) (27, 37, 94, 104). Re- cen ad ances in he p o eomic ield ha e acili a ed he iden- i ica ion o he p o ein componen s o p e ibosomal pa icles ( o e iews, see e e ences 14, 31, 33, and 95). These analyses ha e also ede ined he model o he -subuni assembly pa h- way. In his model, he 90S p e ibosomal pa icles con ain he comple e machine y esponsible o clea ages o he 35S p e- RNA a si es A 0 o A 2 as well as se e al la ge and small -p o eins bu lack mos o he ac o s in ol ed in 60S -subuni o ma ion (5, 23, 41, 49; o e iews, see e e ences 14, 21, 31, and 33). Following p e- RNA clea age a si e A 2 , he las 90S pa icle gi es ise o ea ly 43S and 66S p e ibosomal pa icles, which con ain 20S and 27SA 2 p e- RNAs, espec i ely. I ap- pea s ha mos o he ac o s associa ed wi h 90S pa icles, wi h ew excep ions, a e eleased a e his clea age s ep (23, 41, 72, 82). The ea ly 43S p e ibosomal pa icle is apidly expo ed o he cy oplasm, whe e 20S p e- RNA is p ocessed o ma u e 18S RNA and he las modi ica ion and assembly eac ions ake place (8, 96). Only a ew ac o s and 40S ibo- somal p o eins ha e been desc ibed so a as being needed o inish he ma u a ion o 40S -subuni s om ea ly 43S p e i- bosomal pa icles (22, 29, 32, 43, 52, 65, 82, 89, 98). The s udy o he di e en pu i ied p e-60S complexes is consis en wi h he p esence o dis inc p e-60S in e media es. These in e me- dia es a e e med, acco ding o hei posi ion in he pa hway, ea ly, medium, la e, and cy oplasmic p e-60S -pa icles (4, 19, 28, 44, 72, 80, 81). Much less is known abou he ole o 60S -p o eins in 60S -subuni ma u a ion (17, 18, 25, 35, 60, 71, * Co esponding au ho . Mailing add ess: Depa amen o de Gene´ ica, Facul ad de Biologı´a, Uni e sidad de Se illa, A da. Reina Me cedes, 6, E-41012 Se illa, Spain. Phone: 34 95 455 71 06. Fax: 34 95 455 71 04. E-mail: [email p o ec ed]. † Supplemen al ma e ial o his a icle may be ound a h p://mcb .asm.o g/. 䌤 Published ahead o p in on 4 Decembe 2006. 1207 on July 28, 2016 by USE/BCTA.GEN UNIVERSITARIAh p://mcb.asm.o g/Downloaded om 97). The ea lies 66S p e ibosomal pa icle is likely he esul o he associa ion o abou 50 non ibosomal p o eins and se e al la ge -p o eins wi h he 27SA 2 p e- RNA (19; see Discus- sion). The complexi y o he p e-60S -pa icles dec eases du - ing hei ma u a ion (36, 72, 80), and he expo -compe en p e-60S pa icle has comple ed he p e- RNA p ocessing e- ac ions (4, 72). As o he p e-40S pa icles, las assembly eac ions occu in he cy oplasm (46, 55, 86). Despi e he success o he p o eomic app oach in de ining p e ibosomal pa icles and iden i ying hei componen s, many challenges clea ly emain o a comple e unde s anding o i- bosome assembly. Many o he non ibosomal ac o s ha ha e been iden i ied in p e ibosomal pa icles o in sys ema ic anal- yses emain uncha ac e ized so a . Fo hose cha ac e ized, we gene ally lack an unde s anding o hei p ecise unc ion in ibosome assembly and we do no know hei subs a es and FIG. 1. P e- RNA p ocessing in S. ce e isiae. (A) S uc u e and p ocessing si es o he 35S p e- RNA. This p ecu so con ains he sequences o he ma u e 18S, 5.8S, and 25S RNAs ha a e sepa a ed by wo in e nal ansc ibed space sequences, ITS1 and ITS2, and lanked by wo ex e nal ansc ibed space sequences (ETS), 5⬘ETS and 3⬘ETS. The ma u e RNA species a e shown as ba s and he ansc ibed space sequences as lines. The p ocessing si es and he a ious p obes used a e indica ed. (B) Schema ic ep esen a ion o he p e- RNA p ocessing pa hway o he 35S p e- RNA and p e-5S RNA. Clea age and imming eac ions a e indica ed. The da a p esen ed in his s udy sugges ha Npa2p is equi ed o e icien p ocessing o he 27S p e- RNAs. Fo e iews o p e- RNA p ocessing and he known p ocessing enzymes, see e e ences 75 and 101. 1208 ROSADO ET AL. MOL.CELL.BIOL. on July 28, 2016 by USE/BCTA.GEN UNIVERSITARIAh p://mcb.asm.o g/Downloaded om hei in e ac ing pa ne s. Excep in a ew ins ances, we unde - s and nei he he o de o ec ui men o he di e en ac o s o he p e ibosomal pa icles (81) no hei p ecise ime o ac ion. We a e in e es ed in he iden i ica ion o pa ne s o he pu a i e RNA helicase Dbp6p, which is equi ed o 60S -subuni assembly and has been p oposed o ac a an ea ly s ep du ing his p ocess (56). Ou ini ial gene ic and unc ional analyses ha e e ealed speci ic in e ac ions be ween Dbp6p, di e en 60S -subuni assembly ac o s (Dbp7p, Dbp9p, Nop8p, Npa1p/U b1p, and Rsa3p), and he 60S -p o ein Rpl3p (16, 78). He e, we p o ide e idence ha he p edomi- nan ly nucleola Npa2p p o ein is an addi ional membe o he a o emen ioned ne wo k o p o eins. Ou esul s indica e ha Npa2p is equi ed o 27S p e- RNA p ocessing and sugges ha Npa2p has an ea ly ole du ing 60S -subuni assembly simila o ha desc ibed p e iously o Dbp6p (56), Dbp7p (12), Dbp9p (11), Nop8p (108), Npa1p (19, 70, 78), o Rsa3p (16, 78). Recen ly, some o us ha e epo ed he composi ion o e y ea ly p e-60S -pa icles pu i ied using Npa1p-TAP as bai (19). These pa icles also con ain Dbp6p, Dbp7p, Dbp9p, Npa2p, and Nop8p bu seem o lack Rsa3p (19). Npa2p (al- e na i ely named U b2p) has also been independen ly iden- i ied in a sys ema ic unc ional analysis o essen ial yeas genes (70). The ein, Npa2p was desc ibed as a p o ein equi ed o ibosome biogenesis ha copu i ied wi h Npa1p (70). In ag ee- men wi h hese epo s, in his s udy, we ound ha Npa2p is p esen in a e y ea ly p e-60S -pa icle(s) con aining 27SA 2 p e- RNA and ha i physically in e ac s wi h Npa1p. Mo e- o e , we p o ide e idence ha Npa2p also in ima ely in e ac s wi h Dbp6p, Nop8p, and Rsa3p e en in he absence o RNA. We conclude ha Npa2p o ms a RNA-independen he e o- me ic subcomplex equi ed du ing ea ly ma u a ion o nascen 60S -subuni s. MATERIALS AND METHODS S ains, media, and gene ic manipula ions. Mos yeas s ains used in his s udy (see Table S1 in he supplemen al ma e ial) a e de i a i es o s ain W303 (MATa/MAT␣ade2-1/ade2-1 his3-11,15/his3-11,15 leu2-3,112/leu2-3,112 p1-1/ p1-1 u a3-1/u a3-1 can1-100/can1-100). The isola ion o syn he ic le hal (sl) mu an s has been p e iously desc ibed (78). S ain IVY317 [YCplac33-NPA2] was ob ained a e ou consecu i e backc osses o W303-1A wi h a meio ic npa2::KanMX4 seg egan o Y26839 (Eu osca collec ion) con aining he YCplac33-NPA2 plasmid. S ain YO795 (NAP2-TAP) was ob ained as ollows: a gene casse e lanked on he 5⬘side by he las 52 nucleo ides o he NPA2 open eading ame (ORF) and on he 3⬘side by a segmen o he NPA2 e mina o and con aining he TAP ag sequence ollowed by a URA3 ma ke gene om Kluy e o- myces lac is was PCR ampli ied using plasmid pBS1539 (76) and oligonucleo ides YJR041C-TAP1 (5⬘-TTTCAAAGCACTTTACCTCCAATACAAAAAGGTTGG TAAATGGCGCGAAGATTCCATGGAAAAGAGAAG-3⬘) and YJR041C- TAP2 (5⬘-ACTTGTTTAAGCTCCGTCACCCTGTTATTAAACGTGAGCAGA GAAATGCCTTTACGACTCACTATAGGG-3⬘). This casse e we e in eg a ed in o s ain YO341, c ea ing s ain YO795. G ow h and handling o yeas we e pe o med by es ablished p ocedu es (3, 54). Te ad dissec ions we e pe o med using a Singe MSM manual mic oma- nipula o . Esche ichia coli s ain DH5␣was used o cloning and p opaga ion o plasmids (79). Cloning o NPA2.S ain sl3-4, which has a slow g ow h (sg) pheno ype a any empe a u e es ed, was ans o med wi h a YCplac111-based yeas genomic lib a y (57), and abou 10,000 ans o man s we e sc eened o wild- ype g ow h on pla es wi h syn he ic dex ose wi hou leucine (SD-Leu) a 30 and 37°C. One plasmid, pIV223, con aining a ca. 8.7-kb inse , complemen ed bo h he sg and he sl pheno ypes o he sl3-4 mu an . The sl pheno ype o s ain sl2-3, which g ows as he wild- ype s ain a any empe a u e, was also complemen ed by pIV223. The sequence o he e minal egions shows ha he lib a y inse con ained YJR040W (GEF1) and YJR041C (NPA2/URB2) as sole comple e ORFs. Fu he subcloning o YJR041C as a 5.2-kb SphI-BbeI agmen , which was blun ended, in o SmaI- es ic ed YCplac111 (40) (he ea e named YCplac111-NPA2) and YCplac33 (40) (he ea e named YCplac33- NPA2) con i med ha use o YJR041C was su icien o complemen he sg and sl pheno ypes o he sl3-4 mu an and he sl pheno ype o he sl2-3 mu an . Plasmids. YCplac33-NPA2eGFP was cons uc ed as ollows: a 5.1-kb N uI- Na I agmen om pIV223 was blun ended and cloned in o SmaI- es ic ed YCplac33-yeGFP/TCYC1 (a gi om M. Hall). One candida e in he app op i- a e o ien a ion, pIV1-eGFP, was selec ed. Then, a PCR was pe o med using pIV223 as a empla e and he oligonucleo ides 5⬘-1813-NPA2 (5⬘-GAGGAGA CAAATATCACG-3⬘, placed 60 bp ups eam om he sole XbaI si e p esen in he YJR041C ORF) and 3⬘-XBA1-NPA2 (5⬘-GCTCTAGAATCTTCGCGCCA TTTAC-3⬘, complemen a y o he end o he YJR041C ORF bu lacking he s op codon; an XbaI si e is unde lined). The PCR p oduc was diges ed wi h XbaI and cloned in o pIV1-eGFP, which was also es ic ed wi h XbaI. YCplac33-NPA2- eGFP is one candida e in he app op ia e o ien a ion. To gene a e pTAPC111-NPA2, pTAPC111-NOP8 (pDK961; a gene ous gi om D. K essle ) was diges ed wi h EcoRI and BamHI and blun ended. This double diges ion eleases he NOP8 ORF bu e ains he TAP ag wi h he ec o . Then, a 5.1-kb N uI-Na I agmen om pIV223 was blun ended and cloned in he app op ia e o ien a ion o gene a e pIV230. Finally, he a o emen- ioned XbaI- es ic ed PCR p oduc was cloned in o XbaI- es ic ed pIV230. pTAPC111-NPA2 is one candida e in he app op ia e o ien a ion. pRS414-NPA2 was ob ained by cloning a blun -ended 5.1-kb SphI-BbeI ag- men om pIV223 in o he SmaI si e o pRS414 (87). The plasmid YCplac22-NOP8-HA was cons uc ed by cloning a ca. 2.3-kb EcoRI-HindIII agmen om pHAC111-NOP8 (pDK646; a gene ous gi om D. K essle ) in o he EcoRI-HindIII- es ic ed YCplac22 plasmid (87). pHAC111-NPA1 was cons uc ed by cloning o a 5.9-kb ApaI-NsiI blun - ended agmen om pIV222 (78) in o SmaI- es ic ed pHAC33 (a gi om M. Hall). One candida e in he app op ia e o ien a ion, pIVN1-HA, was selec ed. Then a PCR was pe o med using YCplac111-NPA1 as a empla e and he oligonucleo ides NPA1S uIUP and NPA1S opLO (78). The PCR p oduc was diges ed wi h S uI and BamHI and liga ed in o pIVN1-HA es ic ed wi h he same enzymes. pHAC33-NPA1 is a co ec candida e o his cloning. PHAC111- NPA1 was ob ained a e subcloning o a 6.6-kb P uII agmen o pHAC111- NPA1 in o SmaI- es ic ed YCplac33 plasmid. YCplac33-RSA3-eGFP and YCplac22-HA-DBP7 we e gene ous gi s om D. K essle . YCplac22-HA-DBP9 and pRS414-HA-DBP6 ha e been p e iously de- sc ibed (11). pHAC33-RSA3 has also been p e iously epo ed (16). Cons uc ion o a GAL::ZZ-NPA2 allele and in i o deple ion o Npa2p. S ain YH378 (GAL::ZZ-NPA2) was ob ained as ollows. A gene casse e lanked on he 5⬘side by a segmen o he NPA2 p omo e and on he 3⬘side by he 5⬘end o he NPA2 ORF and con aining he HIS3 gene ma ke and he GAL10 p o- mo e ollowed by he ZZ ag sequence was PCR ampli ied using plasmid pTL27 (61) and oligonucleo ides pGAL-YJR041C1 (5⬘-AGAGGGCACTTGGTCACA ACTACAGAATTGTTTACTAGCATAGGAACATCCTCTTGGCCTCCTCT AGT-3⬘) and pGAL-YJR041C3bis (5⬘-TTTCGACAAATCTTGGGCATTGTC TGGGATAGATAGTTCTTCTGTAAGATCACCCATATTCGCGTCTACTT TCGG-3⬘). This casse e was in eg a ed in o s ain YDL402 (61), c ea ing s ain GAL::ZZ-NPA2. Fo in i o deple ion, he GAL::ZZ-NPA2 s ain was g own in YPGal⫹Suc (1% yeas ex ac , 2% pep one, 2% galac ose, 4% suc ose) medium a 30°C un il eaching he midexponen ial phase (op ical densi y a 600 nm [OD 600 ], 0.8). Cells we e ha es ed, washed, and used o inocula e cul u es in YPD (1% yeas ex ac , 2% pep one, 2% glucose) medium. Cell g ow h was moni o ed o e a pe iod o 30 h, du ing which he cul u es we e egula ly dilu ed in o esh YPD medium o main ain exponen ial g ow h. As a con ol, he wild- ype YDL402 s ain was used. A di e en ime poin s, samples we e collec ed o pe o m p o ein and RNA ex ac ions and polysome analysis. Fluo escence mic oscopy. S ain IVY317 [YCplac111-NPA2] was ans o med wi h YCplac33-NPA2eGFP ollowed by plasmid seg ega ion on SD-U a pla es. This s ain g ows a he same a e as a wild- ype s ain. Fo localiza ion, IVY317 [YCplac33-NPA2eGFP] was i s ans o med wi h pUN100-DsRedNOP1 (kindly p o ided by J. Bassle ). Then, se e al ans o - man s we e g own o mid-log phase in SD-Leu-U a liquid medium a 30°C, washed, and esuspended in wa e . Acquisi ion was pe o med using a Leica DMR mic oscope equipped wi h a DC came a ollowing he ins uc ions o he manu ac u e . Digi al images we e p ocessed wi h Adobe Pho oshop 7.0 (Adobe Sys ems). Suc ose g adien cen i uga ion. Polysome and -subuni p epa a ion and analyses we e pe o med as p e iously desc ibed (56). G adien analysis was pe o med wi h an ISCO UA-6 sys em wi h con inuous moni o ing a A 254 . VOL. 27, 2007 Npa2p-CONTAINING SUBCOMPLEX 1209 on July 28, 2016 by USE/BCTA.GEN UNIVERSITARIAh p://mcb.asm.o g/Downloaded om Analyses o p o eins and p e- RNAs om g adien ac ions we e ca ied ou exac ly as p e iously desc ibed (15). Syn he ic in e ac ion c osses. To de e mine syn he ic le hal o enhancemen in e ac ions, c osses in ol ing he npa2-1 o he npa1-1 mu an and selec ed mu an s a ec ing assembly o 60S -subuni s we e pe o med. In o ma ion on he c osses can be ound in he supplemen al ma e ial. An ibodies and Wes e n blo ing. Rabbi an i-p o ein A an ibodies we e pu - chased om Sigma and HA.11 monoclonal an ibodies om Co ance. Rabbi polyclonal an i-Has1p an ibodies ha e been p e iously desc ibed (26). An i- Nog2p an ibodies we e a gi om M. F omon -Racine (81). An i-Nop1p an i- bodies (MCA-28F2) we e ob ained om EnCo Bio echnology. An i-Nop7p an ibodies we e a gi om B. S illman (24). An i-Rpl3p monoclonal an ibodies we e a gi om J. Wa ne (102). An i-Rpl12p and an i-Rpp0p we e a gi om J. P. G. Balles a (9). An i-Rsp8p was a gi om G. Dieci (67). Sodium dodecyl sul a e-polyac ylamide gel elec opho esis (SDS-PAGE) and Wes e n blo ing we e pe o med ollowing s anda d p ocedu es (79). An ibody binding was de- ec ed wi h ho se adish pe oxidase-conjuga ed seconda y an ibodies (Bio-Rad) and a chemiluminescence sys em (Pie ce). RNA ex ac ions, No he n hyb idiza ion, and p ime ex ension. RNA ex ac- ion, No he n hyb idiza ion, and p ime ex ension analyses we e ca ied ou acco ding o s anda d p ocedu es (99). In all expe imen s, RNA was ex ac ed om samples co esponding o 10 OD 600 uni s o exponen ially g own cells and 5o 2.5␮g was loaded in gels o used in p ime ex ension eac ions. Sequences o oligonucleo ides used o RNA hyb idiza ion and p ime ex ension analyses ha e been desc ibed p e iously (20, 78). Immunop ecipi a ions. Two li e s o he app op ia e cells we e g own in YPD o speci ic SD medium o an OD 600 o 0.8 and hen ha es ed. The cell pelle s we e washed wice wi h cold wa e and ozen wi h liquid ni ogen. F ozen cell pelle s we e b oken wi h d y ice in a RM100 mo o ized mo a g inde (Re sch) as p e iously desc ibed (84). B oken cells we e esuspended in 2 ml o cold IPP150 bu e (10 mM T is-HCl [pH 8.0], 150 mM NaCl, 0.1% T i on X-100) plus 0.5 mM di hio h ei ol, 0.2 mM EDTA (pH 8.0), 20% glyce ol, and p o ease inhibi o s (Comple e; Roche). To al cell ex ac s we e ob ained by cen i uga ion a 20,000 ⫻gin a 75VTi o o (Beckman) o 1ha 4°C. The supe na an s we e used o immunop ecipi a ion o subjec ed o a second cen i uga ion a 180,000 ⫻ gin he same o o o 45 min a 4°C. The la e supe na an s we e named ul acen i uged ex ac s. Aliquo s o 2 ml o o al o ul acen i uged ex ac s we e mixed wi h 200 ␮l o immunoglobulin G-Sepha ose 6 Fas Flow (IgG- Sepha ose) beads (Ame sham) and incuba ed o 2ha 4°Cwi h end-o e -end ube o a ion. When indica ed, he ul acen i uged ex ac s we e ea ed wi h 100 ng/ml RNase A be o e mixing wi h he IgG-Sepha ose beads. A e incuba- ion, he beads we e washed eigh imes wi h 1.5 ml o he same bu e a 4°C, he IgG-Sepha ose beads we e collec ed, and he bound p o eins we e elu ed wi h 900 ␮l 0.5 M ace ic acid and concen a ed by lyophiliza ion. To al, nonbound and bound p o eins we e sepa a ed on 6 and 12% SDS–PAGE gels and subjec ed o Wes e n blo analysis using he app op ia e an ibodies. Fo he immunop ecipi a ion analysis (see Fig. 7), he p o ocols used we e hose p e iously desc ibed in e e ence 63. RESULTS Isola ion o npa2 mu an s ha exhibi a syn he ic le hal pheno ype wi h he sa3 null allele. We ha e p e iously iden- i ied a gene ic ne wo k o in e ac ion be ween Dpb6p, Dbp7p, Dbp9p, Rpl3p, Nop8p, and Rsa3p (16). Mo e ecen ly, we ha e ex ended he gene ic ne wo k by pe o ming a syn he ic le hal (sl) sc eening wi h he sa3 null allele (78). This sc een- ing con i med he in e ac ions be ween RSA3 and DBP6, DBP9,RPL3, and NOP8 and e ealed addi ional in e ac ions wi h alleles o NPA1 (78). Two sl mu an s, he sl3-4 and sl2-3 s ains, emained uncha ac e ized (see Ma e ials and Me h- ods). To iden i y he co esponding mu a ed genes, we i s ans o med he sl3-4 s ain wi h a yeas genomic lib a y and eco e ed he lib a y plasmid o he sole colony ha g ew as he wild- ype s ain a 30°C and los he sl pheno ype ( es o ed ed-whi e sec o ing and g ow h on 5- luo oo o ic acid [5-FOA]). Sequence and subcloning analysis o he inse showed ha ORF YJR041C, which we named NPA2, co esponds o he gene de- ined by he sl3-4 mu a ion. NPA2 also complemen ed he sl pheno ype o he sl2-3 s ain. To isola e he sl mu a ion om he sl3-4 mu an , he ea e npa2-1, we c ossed his s ain o an isogenic wild- ype s ain, W303-1A; he esul ing diploid was spo ula ed and e ads we e dissec ed. In all comple e e ads, wo sg spo e clones we e ob ained. Fo u he analyses, he meio ic seg egan s IVY255 and IVY251 we e selec ed (see Table S1 in he sup- plemen al ma e ial). Fu he gene ic analysis con i med ha he npa2-1 mu a ion is linked o he NPA2 gene (da a no shown). Figu e 2 shows ha he npa2-1 mu a ion con e s a sg pheno ype and causes le hali y in combina ion wi h he sa3 null allele. The sg pheno ype o npa2-1 is enhanced a 37°C (da a no shown). Npa2p is an essen ial p o ein ha localizes in he nucleolus. NPA2 is an essen ial gene ha encodes a ela i ely la ge p o- ein o 1,147 amino acids (135.2 kDa). A de ailed sequence analysis e ealed no ob ious p o ein mo i s o Npa2p, bu i s i s 748 amino acids ha e a p edic ed s uc u e ela ed o p o eins o he HEAT- epea amily (Yeas Resou ce Cen e In o ma ics Pla o m; h p://www.yeas c.o g) (45). We also ound an IMP dehyd ogenase-GMP educ ase domain be- ween amino acids 520 and 855 (In e P oScan; h p://www.ebi .ac.uk/In e P oScan), al hough he biological ele ance o his inding is unclea . Sea ches in he p e ibosomal ne wo k (h p: //p e- ibosome.de) (68) ound Npa2p associa ed wi h ea ly p e- 60S pa icles. Mo eo e , Npa2p has been desc ibed o be e- qui ed o p e- RNA p ocessing (70, 74) and i has been ound by some o us as a componen o a e y ea ly p e-60S pa i- cle(s) con aining Npa1p-TAP (19). Fo a i s hin o he unc ion o Npa2p, we de e mined i s subcellula localiza ion. To do his, we cons uc ed a C- e mi- nal g een luo escen p o ein- agged NPA2 allele exp essed unde he con ol o i s cogna e p omo e (see Ma e ials and Me hods). The esul ing s ain was u he ans o med wi h pUN100-DSRed-NOP1, which exp essed DsRed- agged Nop1p FIG. 2. The npa2-1 mu a ion con e s a slow g ow h pheno ype and is syn he ically le hal wi h he sa3 null allele. S ains IVY251 (npa2-1), ca ying he plasmid YCplac33-NPA2, and YMD3-2D (⌬ sa3) we e c ossed, he esul ing diploid was spo ula ed, and e ads we e dis- sec ed. Comple e e ads we e s eaked on YPD pla es and es eaked on 5-FOA-con aining pla es o coun e selec YCplac33-NPA2. A ep- esen a i e e a ype e ad is shown on a YPD pla e ( op hal ) o on a 5-FOA con aining pla e (bo om hal ). Pla es we e incuba ed a 30°C o 4 days. 1210 ROSADO ET AL. MOL.CELL.BIOL. on July 28, 2016 by USE/BCTA.GEN UNIVERSITARIAh p://mcb.asm.o g/Downloaded om (35). We de ec ed he g een luo escence o Npa2p-g een luo- escen p o ein in he nucleolus, since i mos ly colocalized wi h he ed signal o DsRed-Nop1p (see Fig. S1 in he supplemen al ma e ial). Ou esul s a e in ull ag eemen wi h hose o Huh e al. (50) and consis en wi h a ole o his p o ein in ibosome biogenesis. Mu a ion o deple ion o Npa2p leads o a de iciency in 60S -subuni s. To in es iga e he ole o Npa2p in ibosome bio- genesis, we i s analyzed polysome p o iles o npa2-1 and NPA2 isogenic s ains. Fo he NPA2 s ain, we de ec ed a ypical wild- ype p o ile (Fig. 3A). Fo he npa2-1 s ain, we de ec ed a de ici o ee 60S e sus 40S -subuni s, an o e all dec ease in he le el o 80S ibosomes, and an accumula ion o hal -me polysomes (Fig. 3B). We also pe o med polysome p o ile analysis upon deple ion o Npa2p. Fo his, we i s cons uc ed a condi ional GAL::ZZ-NPA2 s ain (YH378), which con ains he NPA2 gene unde he con ol o he GAL10 p omo e (see Ma e ials and Me hods). In galac ose-suc ose con aining medium, he GAL::ZZ-NPA2 s ain had he same g ow h beha io as he o he wise isogenic s ain, indica ing ha he GAL::ZZ-NPA2 allele is ully unc ional. As expec ed, only esidual g ow h o he GAL::ZZ-NPA2 s ain was ob- se ed on glucose-con aining pla es (see Fig. S2 in he supple- men al ma e ial). A e a shi om galac ose-suc ose o glu- cose-con aining liquid medium, he g ow h a e o he GAL::ZZ-NPA2 s ain emained simila o ha o he wild- ype s ain du ing a leas he i s 6 h bu hen p og essi ely dec eased o a doubling ime o ⬎8 h a e 30 h, as compa ed wi h he 2 h doubling ime o YDL402. A concomi an deple- ion o Npa2p was obse ed by Wes e n blo ing (see Fig. S2 in he supplemen al ma e ial). The GAL::ZZ-NPA2 s ain and i s isogenic wild- ype coun e pa (YDL402) we e g own a 30°C in medium con aining galac ose and suc ose as a ca bon sou ce and hen shi ed o glucose-con aining medium o 6, 12, and 24 h. Ex ac s we e p epa ed a he di e en ime poin s, and polysome p o iles we e analyzed. Wild- ype p o iles we e ob- ained o bo h s ains in galac ose-suc ose medium and o YDL402 a any ime a e he shi (Fig. 3C and da a no shown). In simila i y o he npa2-1 mu an esul s, he Npa2p- deple ed s ain displayed a de ici in 60S -subuni s. This de ici was obse ed a e 6 h and became mo e p onounced a e 12 and 24 h in glucose-con aining medium (Fig. 3D o F). These esul s show clea ly ha Npa2p is equi ed o 60S -subuni accumula ion. Npa2p is equi ed o no mal p e- RNA p ocessing. To de e mine whe he he de ici in 60S -subuni s in he npa2 mu an s ains is associa ed wi h de ec s in p e- RNA p ocess- ing, we analyzed he s eady-s a e le els o p e- and ma u e RNA species by No he n blo ing and p ime ex ension. Fi s , o al RNA was isola ed om he GAL::ZZ-NPA2 and he isogenic NPA2 s ain a a ious ime poin s a e ans e om galac ose-suc ose o glucose-con aining medium and an- alyzed by No he n hyb idiza ion. As shown in Fig. 4, a signi - ican dec ease in le els o ma u e RNAs was obse ed a e deple ion o Npa2p. The 35S p e- RNA and he abe an 23S ( ha ex ends om ⫹1 o si e A 3 ) and 21S ( ha ex ends om si e A 1 o si e A 3 ) p e- RNA species sligh ly accumula ed, wi h ongoing deple ion compa ed o esul seen wi h he wild- ype s ain in glucose medium. These accumula ions a e likely due o delayed p ocessing a si e A 2 and o a lesse ex en a si es A 0 and A 1 . P obably in pa as a consequence o he A 2 clea - age delay, he le els o he 20S and he 27SA 2 p ecu so s we e signi ican ly a ec ed. Impo an ly, he e was a d as ic educ- ion in he le els o he 27SB p e- RNA species bu a less p onounced educ ion o 7S p e- RNAs (Fig. 4A o B). Finally, we de ec ed mild accumula ion o an abe an A 2 -C 2 agmen a ea ly ime poin s o deple ion, which sugges s ha deple ion o Npa2p allows p ema u e clea age o 27SA 2 p e- RNA a si e C 2 . In o de o disc imina e be ween he 27SA 2 and 27SA 3 p e- RNAs, dis inguish be ween he 27SB L and 27SB S p e- RNAs, and de ec he 25.5S p e- RNA species, we pe - o med p ime ex ension analyses. As shown in Fig. 4C, he quan i ies o he cDNAs e mina ing a si es A 3 ,B 1L , and B 1S and o a lesse ex en hose e mina ing a si e A 2 we e ound o be signi ican ly dec eased upon deple ion o Npa2p. Mo eo e , p ime ex ension analysis h ough si e C 2 showed a clea educ ion in he le el o he 25.5S p e- RNA upon deple ion o Npa2p. P e- RNA p ocessing was simila ly a ec ed in he npa2-1 mu an a e a shi o 9h o37°C. The 35S and 23S p e- RNAs accumula ed, he le els o he 20S and 27SA p ecu so s we e educed ma kedly, and he le els o he 7S p e- RNA, FIG. 3. The npa2-1 mu a ion and he deple ion o Npa2p esul in a de ici in ee 60S -subuni s and in he accumula ion o hal -me polysomes. W303-1B (NPA2) (A) and IVY251 (npa2-1) (B) s ains we e g own in YPD a 30°C. S ain YH378 (GAL::ZZ-NPA2) was g own a 30°C in YPGal⫹Suc (C) o shi ed o YPD o 6 h (D), 12 h (E), and 24 h (F). Cells we e ha es ed a an OD 600 o 0.8, and cell ex ac s we e esol ed in 7% o 50% polysome suc ose g adien s. The A 254 was con inuously measu ed. Sedimen a ion is shown om le o igh . The peaks o ee 40S and 60S -subuni s, 80S ee couples- monosomes, and polysomes a e indica ed. Hal -me s a e labeled by a ows. VOL. 27, 2007 Npa2p-CONTAINING SUBCOMPLEX 1211 on July 28, 2016 by USE/BCTA.GEN UNIVERSITARIAh p://mcb.asm.o g/Downloaded om 18S, and 25S RNA we e educed mildly; howe e , no clea al e a ion in he le els o 5.8S and 5S was de ec ed (da a no shown). Al oge he , ou esul s sugges ha he de ici in 60S -subuni le els upon deple ion o mu a ion o Npa2p is a consequence o impai ed o ma ion o he 27S p ecu so s, hus leading o dec eased le els o he ma u e 25S and 5.8S RNAs. The pheno ypes discussed abo e a e mos likely due o imp ope ea ly assembly and ins abili y o ea ly p e-60S -pa icles. Npa2p is a componen o p e ibosomal pa icles con aining 27SA 2 p e- RNA. We p e iously showed ha Npa2p is associ- a ed wi h Npa1p, i sel p edominan ly p esen wi hin e y ea ly p e-60S -pa icle(s) (19). This inding sugges ed ha Npa2p is also a componen o such pa icles. To con i m his in e ence, we i s analyzed he sedimen a ion beha io o he Npa2p- TAP usion p o ein in low Mg 2⫹ suc ose densi y g adien s. This kind o g adien has p o ed e y use ul o s udy he sedimen a ion o 60S p e ibosomal pa icles (15, 78, 93), which a e labile and pa ially dissocia ed when subjec ed o s anda d polysome suc ose g adien s (92) (see below). S ains exp ess- ing Npa2p-TAP g ow no mally, indica ing ha he agged p o- ein is unc ional (da a no shown). As shown in Fig. 5A, mos Npa2p-TAP was ound associa ed wi h high-molecula -mass pa icles. We de ec ed associa ion wi h high-molecula -mass pa icles o o he p o eins, including Dbp6p, Has1p, Npa1p, Nop8p, and Rsa3p (Fig. 5A). All hese ac o s, excep Rsa3p, ha e also been desc ibed as componen s o he Npa1p-TAP pu i ied pa icle(s) (19). No he n hyb idiza ion showed ha he maximum o he peak o Npa2p-TAP coincides wi h he peak o he 27SA 2 p e- RNA (Fig. 5B). We also pe o med coimmunop ecipi a ion expe imen s wi h Npa2p-TAP and non agged con ol s ains and analyzed cop ecipi a ed RNAs by No he n hyb idiza ion and p ime ex ension. As is consis en wi h he p e ious published da a o Npa1p-TAP (19), by a he mos e icien ly cop ecipi a ed p e- RNA wi h Npa2p-TAP was he 27SA 2 p e- RNA (Fig. 6A and B). A small ac ion o 35S p e- RNA could also be co- p ecipi a ed (Fig. 6B). The 27SB and 7S p ecu so s we e p e- cipi a ed only a backg ound le els, and no signi ican p ecip- FIG. 4. E ec s o Npa2p deple ion on s eady-s a e le els o p e- RNAs and ma u e RNAs. S ains YDL402 (NPA2) and YH378 (GAL::ZZ-NPA2) we e g own in YPGal⫹Suc medium and hen shi ed o YPD medium. Cells we e ha es ed a he indica ed imes, and o al RNA was ex ac ed. (A) Equal amoun s o o al RNA (5 ␮g) we e esol ed on a 1.2% aga ose– o maldehyde gel, ans e ed on o a nylon memb ane, and hyb idized consecu i ely wi h di e en p obes. (B) Equal amoun s o o al RNA (2.5 ␮g) we e esol ed on a 7% polyac ylamide– u ea gel, ans e ed on o a nylon memb ane, and hyb idized consecu i ely wi h di e en p obes. (C) Equal amoun s o o al RNA (5 ␮g) we e used o p ime ex ension analysis. P obe gwas labeled and used o he eac ions. No e ha his p obe allows de ec ion o 27SA 2 (as he s op a si e A 2 ), 27SA 3 (as he s op a si e A 3 ), bo h 27SBs (as s ops a si es B 1L and B 1S ), and 25.5S (as he s op a si e C 2 ). P obe names a e indica ed be ween pa en heses (see Fig. 1 o hei loca ions in he 35S p e- RNA). Signal in ensi ies we e measu ed by scanning, and alues ob ained (indica ed below each lane) we e no malized o hose ob ained o he wild- ype s ain g own in galac ose-suc ose medium, a bi a ily se a 100. 1212 ROSADO ET AL. MOL.CELL.BIOL. on July 28, 2016 by USE/BCTA.GEN UNIVERSITARIAh p://mcb.asm.o g/Downloaded om i a ion was seen o he snRNA U4, which was used as a nega i e con ol (Fig. 6). We conclude ha Npa2p is a speci ic componen o a e y ea ly p e-60S ibosomal pa icle(s). Syn he ic le hali y wi h npa1 and npa2 alleles (gene ic pa - ne s o Npa2p). To ob ain mo e de ails abou he unc ion o Npa2p, we ha e es ed he syn he ic in e ac ion ela ionships be ween he npa2-1 mu an and he se o mu an s ha show gene ic in e ac ion wi h he sa3 null allele (78). These mu an s map in genes o he 60S -subuni assembly ac o s Dbp6p, Dbp7p, Dbp9p, Nop8p, and Npa1p and he 60S -subuni p o- ein Rpl3p (16, 78). As a speci ici y con ol, we selec ed Spb4p, since we had p e iously shown ha he e is no syn he ic in e - ac ion be ween he spb4-1 mu an and mu an alleles o DBP6, DBP7,o RSA3 (16, 78). As addi ional con ols, we selec ed di e en has1 alleles, wo nop4 mu an s, and he dbp3 and nop6 null alleles (see Table S1 in he supplemen al ma e ial). Has1p, Nop4p, and Dbp3p a e 60S -subuni biogenesis ac o s ha ha e been desc ibed as componen s o he Npa1p-TAP pu i- ied pa icle(s) (19). Nop6p is a p edic ed 60S -subuni bio- genesis ac o which was ound associa ed wi h Npa2p in a la ge-scale a ini y pu i ica ion s udy (47). As a esul , we de ec ed syn he ic in e ac ion only be ween npa2-1 and mu an alleles o DBP6,DBP7,DBP9,NOP8, RSA3, and RPL3 bu no wi h npa1-1 (Fig. 7). In addi ion, none o he combina ions o npa2-1 wi h he es ed has1 and nop4 alleles, he spb4-1 mu an , o he dbp3 and nop6 null alleles showed syn he ic in e ac ion (Fig. 7). In e es ingly, when sim- ila sl analyses we e pe o med wi h he npa1-1 mu an , we ound iden ical esul s: he npa1-1 showed syn he ic in e ac ion only wi h mu an alleles o DBP6,DBP7,DBP9,NOP8,RSA3, and RPL3 (Fig. 7). The speci ic gene ic in e ac ions be ween Npa2p o Npa1p and Dbp6p, Dbp7p, Dbp9p, Nop8p, Rsa3p, and Rpl3p s ongly sugges ha all hese p o eins unc ionally in e ac du ing ea ly assembly o 60S -subuni s. Npa2p o ms a complex wi h o he ans-ac ing ac o s in- ol ed in ea ly s eps o 60S -subuni biogenesis (p o ein pa - ne s o Npa2p). We nex asked whe he he se o p o eins ha gene ically in e ac wi h Npa2p a e also able o in e ac phys- ically. Fo his pu pose, we i s analyzed he sedimen a ion FIG. 5. Npa2p is p esen in la ge complexes, mos likely p e-60S -pa icles. To al cell ex ac s we e ob ained om IVY317 (Npa2p-TAP, Has1p, Rpl3p), IVY325 (Npa1p-HA), IVY347 (HA-Dbp6p), IVY411 (Nop8p-HA), and IVY409 (Rsa3p-HA) cells ollowing g ow h a 30°C. Abou 15 A 254 uni s o cell ex ac we e esol ed in 7% o 50% suc ose g adien s con aining a low concen a ion o Mg 2⫹ o dissocia e ibosomes in o subuni s. Sedimen a ion is shown om le o igh . The sedimen a ion posi ions o 40S and 60S ibosomal subuni s a e indica ed. (A) F ac ions we e collec ed om he g adien s, and p o eins we e ex ac ed om he same olume o each ac ion, esol ed on 7% SDS–PAGE gels, and subjec ed o Wes e n blo ing. The blo s we e deco a ed wi h speci ic an ibodies de ec ing he p o eins indica ed. (B) RNA was ex ac ed om equal olumes o each ac ion, esol ed on a 1.2% aga ose– o maldehyde gel, and ans e ed on o a nylon memb ane. The same memb ane was hyb idized wi h di e en p obes. P obe names a e indica ed be ween pa en heses. T s ands o o al ex ac , and numbe s co espond o ac ion numbe s. VOL. 27, 2007 Npa2p-CONTAINING SUBCOMPLEX 1213 on July 28, 2016 by USE/BCTA.GEN UNIVERSITARIAh p://mcb.asm.o g/Downloaded om p o ile o Npa2p and o he 60S -subuni assembly ac o s on polysome suc ose g adien s. This kind o g adien has been epo ed o allow dissocia ion o a numbe o p e-60S -pa icle componen s; hus, 27S p ecu so s sedimen mo e slowly han 25S RNA (92) (see Fig. 8B). As expec ed o a componen o a p e-60S ibosomal pa i- cle, a ac ion o Npa2p-TAP was p esen in la ge complexes and cosedimen ed wi h 27SA p e- RNA (Fig. 8A, lanes 12 o 15). Howe e , mos Npa2p was ep oducibly de ec ed in ac- ions 6 and 7, whe e no p e- RNAs a e de ec ed (Fig. 8A, lanes 6 and 7). In e es ingly, we ound a simila sedimen a ion pa - e n o Dbp6p, Npa1p, Nop8p, and Rsa3p (Fig. 8A, lanes 6 and 7) and Dbp7p and Dbp9p (da a no shown). A di e en beha io was obse ed o Has1p, which is en iched in ac- ions 11 o 13 con aining 27SA 2 p e- RNA, and o Rpl3p, which sedimen ed wi h he bulk o he 60S -subuni s and ibosomes (Fig. 8). These esul s indica e ha Npa2p, Dbp6p, Dbp7p, Dbp9p, Nop8p, Npa1p, and Rsa3p a e p esen in p e- 60S -pa icles bu ha hey can be eleased om hem as a complex(es) o low molecula mass. To u he analyze his small complex(es), we decided o adop he p ocedu e desc ibed by Hughes and cowo ke s (59), which allowed hem o epo he copu i ica ion o Npa2p wi h FIG. 6. Npa2p in e ac s p edominan ly wi h he 27SA 2 p e- RNA. (A) No he n analysis o p e- RNAs and ma u e RNAs p ecipi a ed wi h Npa2p-TAP o om ex ac s lacking a agged p o ein. P ecipi a ions we e pe o med using IgG-Sepha ose beads and o al cellula ex ac s. RNA was ex ac ed om he pelle s ob ained a e p ecipi a ion (lanes IP) o om an amoun o o al ex ac co esponding o 1/30 o ha used o he p ecipi a ion (lanes T). (B) P ime ex ension analysis o p e- RNAs p ecipi a ed wi h Npa2p-TAP. P ecipi a ion was pe o med as desc ibed o panel A. (C) No he n analysis o snRNA U4 p ecipi a ed wi h Npa2p-TAP. P ecipi a ion was pe o med as desc ibed o panel A. Signal in ensi y was measu ed by phospho image scanning o de i e he pe cen age o inpu RNA p ecipi a ed oge he wi h Npa2p-TAP (indica ed below each IP lane). bg, backg ound alue. P obe names a e indica ed be ween pa en heses. FIG. 7. Gene ic pa ne s o Npa2p. Solid lines ep esen syn he ic le hali y, and dashed lines ep esen syn he ic enhancemen . This pa- pe shows he gene ic in e ac ion o npa2 and npa1 alleles, wi h mu- a ions in he genes coding he indica ed p o eins. No e ha he ge- ne ic ne wo k o med by Dpb6p, Dbp7p, Dbp9p, Nop8p, Rpl3p, and Rsa3p has been p e iously desc ibed (78). See Ma e ials and Me hods, Resul s, and he supplemen al ma e ial o mo e de ails. 1214 ROSADO ET AL. MOL.CELL.BIOL. on July 28, 2016 by USE/BCTA.GEN UNIVERSITARIAh p://mcb.asm.o g/Downloaded om Npa1p (70). B ie ly, la ge complexes such as p e ibosomal pa icles and -subuni s p esen in o al ex ac s a e pelle ed by a high-speed cen i uga ion s ep (180,000 ⫻g o 45 min) be o e p ecipi a ion o Npa2p-TAP and analysis o coimmu- nop ecipi a ing p o eins (Fig. 9). When he high-speed cen i- uga ion s ep was omi ed, Dbp6p, Dbp7p, Dbp9p, Nop8p, Npa1p, and Rsa3p we e ound associa ed wi h Npa2p-TAP (Fig. 9). Nei he Nog2p, Nop1p, no Nop7p was ound associ- a ed wi h Npa2p-TAP (da a no shown). Rpl3p, Rpl12p, and Rpp0p bu no Rps8p we e ound associa ed wi h Npa2p-TAP (Fig. 9 and da a no shown). In e es ingly, when he high-speed cen i uga ion s ep was pe o med, only Dbp6p, Nop8p, Npa1p, and Rsa3p we e ound associa ed wi h Npa2p-TAP. Nei he Dbp7p no Dbp9p and he es ed -p o eins cop e- cipi a ed wi h Npa2p-TAP (Fig. 9 and da a no shown). When he non agged Npa2p s ains we e used as a con ol, no coimmunop ecipi a ion was de ec ed excep o Rsa3p om o al cell ex ac s (Fig. 9). We suspec ha Rsa3p has some unspeci ic a ini y o Sepha ose suppo s. We con- clude ha Npa2p in e ac s in ima ely wi h Dbp6p, Nop8p, Npa1p, and Rsa3p. In o de o es whe he o no RNA media es he in e ac- ion be ween he ac o s discussed abo e, an RNase ea men o he supe na an ob ained ollowing high-speed cen i uga- ion o ex ac s was pe o med be o e immunop ecipi a ion. As seen in Fig. 10, he in e ac ion be ween Npa2p and Dbp6p, Nop8p, Npa1p, and Rsa3p is kep e en a e RNase ea men . We conclude ha Npa2p is p esen in a s able he e ome ic subcomplex(es) wi h Dbp6p, Npa1p, Nop8p, and Rsa3p which is independen o he p esence o p e- RNA. To de ine be e his subcomplex(es), gel il a ion ac ion- a ion o RNase- ea ed high-speed cen i uged ex ac s was pe o med by ch oma og aphy h ough a Supe ose 6HR col- umn and ac ions we e analyzed by Wes e n blo ing. As shown in Fig. 11A, Npa2p-TAP ep oducibly peaked in ac- ions 24 o 28, wi h a maximum a ac ion 26. This indica es ha Npa2p is p esen in a complex o abou 550 o 600 kDa. We also s udied he elu ion pa e ns o Dbp6p, Nop8p, Npa1p, and Rsa3p and ound ha a subs an ial p opo ion o all hese p o eins coelu ed wi h Npa2p-TAP (Fig. 11A). This was mo e e iden o Dpb6p and Npa1p, while Nop8p and Rsa3p we e elu ed oge he in in e media e ac ions. The combined mo- FIG. 8. Npa2p, Npa1p, Dbp6p, Nop8p, and Rsa3p dissocia e om p e ibosomes upon polysome g adien ac iona ion. To al cell ex ac s we e ob ained om IVY317 (Npa2p-TAP, Has1p, and Rpl3p), IVY325 (Npa1p-HA), IVY347 (HA-Dbp6p), IVY411 (Nop8p-HA), and IVY409 (Rsa3p-HA) cells ollowing g ow h a 30°C. Abou 15 A 254 uni s o cell ex ac we e esol ed in 7% o 50% s anda d suc ose g adien s o polysome analysis. Sedimen a ion is shown om le o igh . The peaks o 40S and 60S ibosomal subuni s and 80S couples-monosomes a e indica ed. The analysis o p o eins (A) and RNA (B) om he g adien s was pe o med as desc ibed in he legend o Fig. 5. VOL. 27, 2007 Npa2p-CONTAINING SUBCOMPLEX 1215 on July 28, 2016 by USE/BCTA.GEN UNIVERSITARIAh p://mcb.asm.o g/Downloaded om