Full text
MOLECULAR AND CELLULAR BIOLOGY, Feb. 2007, p. 1207–1221 Vol. 27, No. 4
0270-7306/07/$08.00⫹0 doi:10.1128/MCB.01523-06
Copy igh © 2007, Ame ican Socie y o Mic obiology. All Righ s Rese ed.
Cha ac e iza ion o Saccha omyces ce e isiae Npa2p (U b2p) Re eals a
Low-Molecula -Mass Complex Con aining Dbp6p, Npa1p (U b1p),
Nop8p, and Rsa3p In ol ed in Ea ly S eps o 60S
Ribosomal Subuni Biogenesis
䌤
†
I a´n V. Rosado,
1
Ch is ophe Dez,
2
Simon Leba on,
2
Miche`le Caize gues-Fe e ,
2
Y es Hen y,
2
and Jesu´s de la C uz
1
*
Depa amen o de Gene´ ica, Uni e sidad de Se illa, Se illa, Spain,
1
and Equipe Labellise´e Ligue Na ionale con e le Cance ,
Labo a oi e de Biologie Moleculai e Euca yo e, CNRS-Uni e si e Paul Saba ie , IFR 109, Toulouse, F ance
2
Recei ed 16 Augus 2006/Re u ned o modi ica ion 8 Oc obe 2006/Accep ed 24 No embe 2006
We epo he cha ac e iza ion o he yeas Npa2p (U b2p) p o ein, which is essen ial o 60S ibosomal
subuni biogenesis. We iden i ied his p o ein in a syn he ic le hal sc eening wi h he sa3 null allele. Rsa3p is
a gene ic pa ne o he pu a i e RNA helicase Dbp6p. Mu a ion o deple ion o Npa2p leads o a ne de ici
in 60S subuni s and a dec ease in he le els all 27S p e- RNAs and ma u e 25S and 5.8S RNAs. This is likely
due o ins abili y o ea ly p e-60S pa icles. Consis en wi h a ole o Npa2p in 60S subuni biogenesis, g een
luo escen p o ein- agged Npa2p localizes p edominan ly o he nucleolus and TAP- agged Npa2p sedimen s
wi h la ge complexes in suc ose g adien s and is associa ed mainly wi h 27SA
2
p e- RNA-con aining p e ibo-
somal pa icles. In addi ion, we e eal a gene ic syn he ic in e ac ion be ween Npa2p, se e al ac o s equi ed
o ea ly s eps o 60S subuni biogenesis (Dbp6p, Dbp7p, Dbp9p, Npa1p, Nop8p, and Rsa3p), and he 60S
p o ein Rpl3p. Fu he mo e, coimmunop ecipi a ion and gel il a ion analyses demons a ed ha a leas
Npa2p, Dbp6p, Npa1p, Nop8p, and Rsa3p a e p esen oge he in a subcomplex o low molecula mass whose
in eg i y is independen o RNA. Ou esul s suppo he idea ha hese i e ac o s wo k in conce du ing he
ea ly s eps o 60S subuni biogenesis.
The syn hesis o euka yo ic ibosomes is a complex and
highly ene gy-consuming p ocess (53, 103). Ribosome biogen-
esis akes place p ima ily in he nucleolus, bu some e en s
occu in he nucleoplasm, whe e he p e ibosomal subuni s
gain expo compe ence, and in he cy oplasm, whe e he las
s eps in he ma u a ion o he ibosomal subuni s ( -subuni s)
occu (94, 96). Al hough ibosome biogenesis is conse ed
h oughou euka yo es (39, 90), i has been bes cha ac e ized
in he yeas Saccha omyces ce e isiae ( o e iews, see e e -
ences 33, 58, and 100). In yeas , h ee o he ou RNAs (18S,
5.8S, and 25S RNAs) a e ansc ibed as a single p ecu so by
RNA polyme ase I, whe eas RNA polyme ase III sepa a ely
ansc ibes he p e-5S RNA ( o a e iew, see e e ence 73).
Concomi an ly wi h ansc ip ion, he p e- RNA in e media es
a e ex ensi ely modi ied ( o a e iew, see e e ence 13). These
p ecu so s a e hen p ocessed by a complex se ies o endo- and
exonucleoly ic eac ions (see Fig. 1), which equi es small nu-
cleola RNAs and non ibosomal p o eins ( -p o eins) ( o e-
iews, see e e ences 58 and 101). While some o hese p o ein
ac o s ha e clea unc ions in p e- RNA p ocessing and mod-
i ica ion (e.g., nucleases and base me hylases), he p ecise
unc ions o mos o hem emain unclea .
P e- RNA p ocessing does no occu on naked RNA mole-
cules. Ins ead, p e- RNA molecules a all s ages o ma u a ion
associa e wi h mos -p o eins and non ibosomal p o eins o
o m p e ibosomal pa icles ( -pa icles) (27, 37, 94, 104). Re-
cen ad ances in he p o eomic ield ha e acili a ed he iden-
i ica ion o he p o ein componen s o p e ibosomal pa icles
( o e iews, see e e ences 14, 31, 33, and 95). These analyses
ha e also ede ined he model o he -subuni assembly pa h-
way. In his model, he 90S p e ibosomal pa icles con ain he
comple e machine y esponsible o clea ages o he 35S p e-
RNA a si es A
0
o A
2
as well as se e al la ge and small
-p o eins bu lack mos o he ac o s in ol ed in 60S -subuni
o ma ion (5, 23, 41, 49; o e iews, see e e ences 14, 21, 31,
and 33). Following p e- RNA clea age a si e A
2
, he las 90S
pa icle gi es ise o ea ly 43S and 66S p e ibosomal pa icles,
which con ain 20S and 27SA
2
p e- RNAs, espec i ely. I ap-
pea s ha mos o he ac o s associa ed wi h 90S pa icles,
wi h ew excep ions, a e eleased a e his clea age s ep (23,
41, 72, 82). The ea ly 43S p e ibosomal pa icle is apidly
expo ed o he cy oplasm, whe e 20S p e- RNA is p ocessed
o ma u e 18S RNA and he las modi ica ion and assembly
eac ions ake place (8, 96). Only a ew ac o s and 40S ibo-
somal p o eins ha e been desc ibed so a as being needed o
inish he ma u a ion o 40S -subuni s om ea ly 43S p e i-
bosomal pa icles (22, 29, 32, 43, 52, 65, 82, 89, 98). The s udy
o he di e en pu i ied p e-60S complexes is consis en wi h
he p esence o dis inc p e-60S in e media es. These in e me-
dia es a e e med, acco ding o hei posi ion in he pa hway,
ea ly, medium, la e, and cy oplasmic p e-60S -pa icles (4, 19,
28, 44, 72, 80, 81). Much less is known abou he ole o 60S
-p o eins in 60S -subuni ma u a ion (17, 18, 25, 35, 60, 71,
* Co esponding au ho . Mailing add ess: Depa amen o de Gene´ ica,
Facul ad de Biologı´a, Uni e sidad de Se illa, A da. Reina Me cedes, 6,
E-41012 Se illa, Spain. Phone: 34 95 455 71 06. Fax: 34 95 455 71 04.
E-mail: [email p o ec ed].
† Supplemen al ma e ial o his a icle may be ound a h p://mcb
.asm.o g/.
䌤
Published ahead o p in on 4 Decembe 2006.
1207
on July 28, 2016 by USE/BCTA.GEN UNIVERSITARIAh p://mcb.asm.o g/Downloaded om
97). The ea lies 66S p e ibosomal pa icle is likely he esul o
he associa ion o abou 50 non ibosomal p o eins and se e al
la ge -p o eins wi h he 27SA
2
p e- RNA (19; see Discus-
sion). The complexi y o he p e-60S -pa icles dec eases du -
ing hei ma u a ion (36, 72, 80), and he expo -compe en
p e-60S pa icle has comple ed he p e- RNA p ocessing e-
ac ions (4, 72). As o he p e-40S pa icles, las assembly
eac ions occu in he cy oplasm (46, 55, 86).
Despi e he success o he p o eomic app oach in de ining
p e ibosomal pa icles and iden i ying hei componen s, many
challenges clea ly emain o a comple e unde s anding o i-
bosome assembly. Many o he non ibosomal ac o s ha ha e
been iden i ied in p e ibosomal pa icles o in sys ema ic anal-
yses emain uncha ac e ized so a . Fo hose cha ac e ized,
we gene ally lack an unde s anding o hei p ecise unc ion in
ibosome assembly and we do no know hei subs a es and
FIG. 1. P e- RNA p ocessing in S. ce e isiae. (A) S uc u e and p ocessing si es o he 35S p e- RNA. This p ecu so con ains he sequences
o he ma u e 18S, 5.8S, and 25S RNAs ha a e sepa a ed by wo in e nal ansc ibed space sequences, ITS1 and ITS2, and lanked by wo
ex e nal ansc ibed space sequences (ETS), 5⬘ETS and 3⬘ETS. The ma u e RNA species a e shown as ba s and he ansc ibed space
sequences as lines. The p ocessing si es and he a ious p obes used a e indica ed. (B) Schema ic ep esen a ion o he p e- RNA p ocessing
pa hway o he 35S p e- RNA and p e-5S RNA. Clea age and imming eac ions a e indica ed. The da a p esen ed in his s udy sugges ha
Npa2p is equi ed o e icien p ocessing o he 27S p e- RNAs. Fo e iews o p e- RNA p ocessing and he known p ocessing enzymes, see
e e ences 75 and 101.
1208 ROSADO ET AL. MOL.CELL.BIOL.
on July 28, 2016 by USE/BCTA.GEN UNIVERSITARIAh p://mcb.asm.o g/Downloaded om
hei in e ac ing pa ne s. Excep in a ew ins ances, we unde -
s and nei he he o de o ec ui men o he di e en ac o s
o he p e ibosomal pa icles (81) no hei p ecise ime o
ac ion. We a e in e es ed in he iden i ica ion o pa ne s o
he pu a i e RNA helicase Dbp6p, which is equi ed o 60S
-subuni assembly and has been p oposed o ac a an ea ly
s ep du ing his p ocess (56). Ou ini ial gene ic and unc ional
analyses ha e e ealed speci ic in e ac ions be ween Dbp6p,
di e en 60S -subuni assembly ac o s (Dbp7p, Dbp9p,
Nop8p, Npa1p/U b1p, and Rsa3p), and he 60S -p o ein
Rpl3p (16, 78). He e, we p o ide e idence ha he p edomi-
nan ly nucleola Npa2p p o ein is an addi ional membe o he
a o emen ioned ne wo k o p o eins. Ou esul s indica e ha
Npa2p is equi ed o 27S p e- RNA p ocessing and sugges
ha Npa2p has an ea ly ole du ing 60S -subuni assembly
simila o ha desc ibed p e iously o Dbp6p (56), Dbp7p
(12), Dbp9p (11), Nop8p (108), Npa1p (19, 70, 78), o Rsa3p
(16, 78). Recen ly, some o us ha e epo ed he composi ion
o e y ea ly p e-60S -pa icles pu i ied using Npa1p-TAP as
bai (19). These pa icles also con ain Dbp6p, Dbp7p, Dbp9p,
Npa2p, and Nop8p bu seem o lack Rsa3p (19). Npa2p (al-
e na i ely named U b2p) has also been independen ly iden-
i ied in a sys ema ic unc ional analysis o essen ial yeas genes
(70). The ein, Npa2p was desc ibed as a p o ein equi ed o
ibosome biogenesis ha copu i ied wi h Npa1p (70). In ag ee-
men wi h hese epo s, in his s udy, we ound ha Npa2p is
p esen in a e y ea ly p e-60S -pa icle(s) con aining 27SA
2
p e- RNA and ha i physically in e ac s wi h Npa1p. Mo e-
o e , we p o ide e idence ha Npa2p also in ima ely in e ac s
wi h Dbp6p, Nop8p, and Rsa3p e en in he absence o RNA.
We conclude ha Npa2p o ms a RNA-independen he e o-
me ic subcomplex equi ed du ing ea ly ma u a ion o nascen
60S -subuni s.
MATERIALS AND METHODS
S ains, media, and gene ic manipula ions. Mos yeas s ains used in his
s udy (see Table S1 in he supplemen al ma e ial) a e de i a i es o s ain W303
(MATa/MAT␣ade2-1/ade2-1 his3-11,15/his3-11,15 leu2-3,112/leu2-3,112 p1-1/
p1-1 u a3-1/u a3-1 can1-100/can1-100). The isola ion o syn he ic le hal (sl)
mu an s has been p e iously desc ibed (78). S ain IVY317 [YCplac33-NPA2]
was ob ained a e ou consecu i e backc osses o W303-1A wi h a meio ic
npa2::KanMX4 seg egan o Y26839 (Eu osca collec ion) con aining he
YCplac33-NPA2 plasmid. S ain YO795 (NAP2-TAP) was ob ained as ollows:
a gene casse e lanked on he 5⬘side by he las 52 nucleo ides o he NPA2 open
eading ame (ORF) and on he 3⬘side by a segmen o he NPA2 e mina o and
con aining he TAP ag sequence ollowed by a URA3 ma ke gene om Kluy e o-
myces lac is was PCR ampli ied using plasmid pBS1539 (76) and oligonucleo ides
YJR041C-TAP1 (5⬘-TTTCAAAGCACTTTACCTCCAATACAAAAAGGTTGG
TAAATGGCGCGAAGATTCCATGGAAAAGAGAAG-3⬘) and YJR041C-
TAP2 (5⬘-ACTTGTTTAAGCTCCGTCACCCTGTTATTAAACGTGAGCAGA
GAAATGCCTTTACGACTCACTATAGGG-3⬘). This casse e we e in eg a ed
in o s ain YO341, c ea ing s ain YO795.
G ow h and handling o yeas we e pe o med by es ablished p ocedu es (3,
54). Te ad dissec ions we e pe o med using a Singe MSM manual mic oma-
nipula o . Esche ichia coli s ain DH5␣was used o cloning and p opaga ion o
plasmids (79).
Cloning o NPA2.S ain sl3-4, which has a slow g ow h (sg) pheno ype a any
empe a u e es ed, was ans o med wi h a YCplac111-based yeas genomic
lib a y (57), and abou 10,000 ans o man s we e sc eened o wild- ype g ow h
on pla es wi h syn he ic dex ose wi hou leucine (SD-Leu) a 30 and 37°C. One
plasmid, pIV223, con aining a ca. 8.7-kb inse , complemen ed bo h he sg and
he sl pheno ypes o he sl3-4 mu an . The sl pheno ype o s ain sl2-3, which
g ows as he wild- ype s ain a any empe a u e, was also complemen ed by
pIV223. The sequence o he e minal egions shows ha he lib a y inse
con ained YJR040W (GEF1) and YJR041C (NPA2/URB2) as sole comple e
ORFs. Fu he subcloning o YJR041C as a 5.2-kb SphI-BbeI agmen ,
which was blun ended, in o SmaI- es ic ed YCplac111 (40) (he ea e
named YCplac111-NPA2) and YCplac33 (40) (he ea e named YCplac33-
NPA2) con i med ha use o YJR041C was su icien o complemen he sg and
sl pheno ypes o he sl3-4 mu an and he sl pheno ype o he sl2-3 mu an .
Plasmids. YCplac33-NPA2eGFP was cons uc ed as ollows: a 5.1-kb N uI-
Na I agmen om pIV223 was blun ended and cloned in o SmaI- es ic ed
YCplac33-yeGFP/TCYC1 (a gi om M. Hall). One candida e in he app op i-
a e o ien a ion, pIV1-eGFP, was selec ed. Then, a PCR was pe o med using
pIV223 as a empla e and he oligonucleo ides 5⬘-1813-NPA2 (5⬘-GAGGAGA
CAAATATCACG-3⬘, placed 60 bp ups eam om he sole XbaI si e p esen in
he YJR041C ORF) and 3⬘-XBA1-NPA2 (5⬘-GCTCTAGAATCTTCGCGCCA
TTTAC-3⬘, complemen a y o he end o he YJR041C ORF bu lacking he s op
codon; an XbaI si e is unde lined). The PCR p oduc was diges ed wi h XbaI and
cloned in o pIV1-eGFP, which was also es ic ed wi h XbaI. YCplac33-NPA2-
eGFP is one candida e in he app op ia e o ien a ion.
To gene a e pTAPC111-NPA2, pTAPC111-NOP8 (pDK961; a gene ous gi
om D. K essle ) was diges ed wi h EcoRI and BamHI and blun ended. This
double diges ion eleases he NOP8 ORF bu e ains he TAP ag wi h he
ec o . Then, a 5.1-kb N uI-Na I agmen om pIV223 was blun ended and
cloned in he app op ia e o ien a ion o gene a e pIV230. Finally, he a o emen-
ioned XbaI- es ic ed PCR p oduc was cloned in o XbaI- es ic ed pIV230.
pTAPC111-NPA2 is one candida e in he app op ia e o ien a ion.
pRS414-NPA2 was ob ained by cloning a blun -ended 5.1-kb SphI-BbeI ag-
men om pIV223 in o he SmaI si e o pRS414 (87).
The plasmid YCplac22-NOP8-HA was cons uc ed by cloning a ca. 2.3-kb
EcoRI-HindIII agmen om pHAC111-NOP8 (pDK646; a gene ous gi om
D. K essle ) in o he EcoRI-HindIII- es ic ed YCplac22 plasmid (87).
pHAC111-NPA1 was cons uc ed by cloning o a 5.9-kb ApaI-NsiI blun -
ended agmen om pIV222 (78) in o SmaI- es ic ed pHAC33 (a gi om M.
Hall). One candida e in he app op ia e o ien a ion, pIVN1-HA, was selec ed.
Then a PCR was pe o med using YCplac111-NPA1 as a empla e and he
oligonucleo ides NPA1S uIUP and NPA1S opLO (78). The PCR p oduc was
diges ed wi h S uI and BamHI and liga ed in o pIVN1-HA es ic ed wi h he
same enzymes. pHAC33-NPA1 is a co ec candida e o his cloning. PHAC111-
NPA1 was ob ained a e subcloning o a 6.6-kb P uII agmen o pHAC111-
NPA1 in o SmaI- es ic ed YCplac33 plasmid.
YCplac33-RSA3-eGFP and YCplac22-HA-DBP7 we e gene ous gi s om D.
K essle . YCplac22-HA-DBP9 and pRS414-HA-DBP6 ha e been p e iously de-
sc ibed (11). pHAC33-RSA3 has also been p e iously epo ed (16).
Cons uc ion o a GAL::ZZ-NPA2 allele and in i o deple ion o Npa2p. S ain
YH378 (GAL::ZZ-NPA2) was ob ained as ollows. A gene casse e lanked on
he 5⬘side by a segmen o he NPA2 p omo e and on he 3⬘side by he 5⬘end
o he NPA2 ORF and con aining he HIS3 gene ma ke and he GAL10 p o-
mo e ollowed by he ZZ ag sequence was PCR ampli ied using plasmid pTL27
(61) and oligonucleo ides pGAL-YJR041C1 (5⬘-AGAGGGCACTTGGTCACA
ACTACAGAATTGTTTACTAGCATAGGAACATCCTCTTGGCCTCCTCT
AGT-3⬘) and pGAL-YJR041C3bis (5⬘-TTTCGACAAATCTTGGGCATTGTC
TGGGATAGATAGTTCTTCTGTAAGATCACCCATATTCGCGTCTACTT
TCGG-3⬘). This casse e was in eg a ed in o s ain YDL402 (61), c ea ing s ain
GAL::ZZ-NPA2.
Fo in i o deple ion, he GAL::ZZ-NPA2 s ain was g own in YPGal⫹Suc
(1% yeas ex ac , 2% pep one, 2% galac ose, 4% suc ose) medium a 30°C un il
eaching he midexponen ial phase (op ical densi y a 600 nm [OD
600
], 0.8). Cells
we e ha es ed, washed, and used o inocula e cul u es in YPD (1% yeas
ex ac , 2% pep one, 2% glucose) medium. Cell g ow h was moni o ed o e a
pe iod o 30 h, du ing which he cul u es we e egula ly dilu ed in o esh YPD
medium o main ain exponen ial g ow h. As a con ol, he wild- ype YDL402
s ain was used. A di e en ime poin s, samples we e collec ed o pe o m
p o ein and RNA ex ac ions and polysome analysis.
Fluo escence mic oscopy. S ain IVY317 [YCplac111-NPA2] was ans o med
wi h YCplac33-NPA2eGFP ollowed by plasmid seg ega ion on SD-U a pla es.
This s ain g ows a he same a e as a wild- ype s ain.
Fo localiza ion, IVY317 [YCplac33-NPA2eGFP] was i s ans o med wi h
pUN100-DsRedNOP1 (kindly p o ided by J. Bassle ). Then, se e al ans o -
man s we e g own o mid-log phase in SD-Leu-U a liquid medium a 30°C,
washed, and esuspended in wa e . Acquisi ion was pe o med using a Leica
DMR mic oscope equipped wi h a DC came a ollowing he ins uc ions o he
manu ac u e . Digi al images we e p ocessed wi h Adobe Pho oshop 7.0 (Adobe
Sys ems).
Suc ose g adien cen i uga ion. Polysome and -subuni p epa a ion and
analyses we e pe o med as p e iously desc ibed (56). G adien analysis was
pe o med wi h an ISCO UA-6 sys em wi h con inuous moni o ing a A
254
.
VOL. 27, 2007 Npa2p-CONTAINING SUBCOMPLEX 1209
on July 28, 2016 by USE/BCTA.GEN UNIVERSITARIAh p://mcb.asm.o g/Downloaded om
Analyses o p o eins and p e- RNAs om g adien ac ions we e ca ied ou
exac ly as p e iously desc ibed (15).
Syn he ic in e ac ion c osses. To de e mine syn he ic le hal o enhancemen
in e ac ions, c osses in ol ing he npa2-1 o he npa1-1 mu an and selec ed
mu an s a ec ing assembly o 60S -subuni s we e pe o med. In o ma ion on he
c osses can be ound in he supplemen al ma e ial.
An ibodies and Wes e n blo ing. Rabbi an i-p o ein A an ibodies we e pu -
chased om Sigma and HA.11 monoclonal an ibodies om Co ance. Rabbi
polyclonal an i-Has1p an ibodies ha e been p e iously desc ibed (26). An i-
Nog2p an ibodies we e a gi om M. F omon -Racine (81). An i-Nop1p an i-
bodies (MCA-28F2) we e ob ained om EnCo Bio echnology. An i-Nop7p
an ibodies we e a gi om B. S illman (24). An i-Rpl3p monoclonal an ibodies
we e a gi om J. Wa ne (102). An i-Rpl12p and an i-Rpp0p we e a gi om
J. P. G. Balles a (9). An i-Rsp8p was a gi om G. Dieci (67). Sodium dodecyl
sul a e-polyac ylamide gel elec opho esis (SDS-PAGE) and Wes e n blo ing
we e pe o med ollowing s anda d p ocedu es (79). An ibody binding was de-
ec ed wi h ho se adish pe oxidase-conjuga ed seconda y an ibodies (Bio-Rad)
and a chemiluminescence sys em (Pie ce).
RNA ex ac ions, No he n hyb idiza ion, and p ime ex ension. RNA ex ac-
ion, No he n hyb idiza ion, and p ime ex ension analyses we e ca ied ou
acco ding o s anda d p ocedu es (99). In all expe imen s, RNA was ex ac ed
om samples co esponding o 10 OD
600
uni s o exponen ially g own cells and
5o 2.5g was loaded in gels o used in p ime ex ension eac ions. Sequences
o oligonucleo ides used o RNA hyb idiza ion and p ime ex ension analyses
ha e been desc ibed p e iously (20, 78).
Immunop ecipi a ions. Two li e s o he app op ia e cells we e g own in YPD
o speci ic SD medium o an OD
600
o 0.8 and hen ha es ed. The cell pelle s
we e washed wice wi h cold wa e and ozen wi h liquid ni ogen. F ozen cell
pelle s we e b oken wi h d y ice in a RM100 mo o ized mo a g inde (Re sch)
as p e iously desc ibed (84). B oken cells we e esuspended in 2 ml o cold
IPP150 bu e (10 mM T is-HCl [pH 8.0], 150 mM NaCl, 0.1% T i on X-100)
plus 0.5 mM di hio h ei ol, 0.2 mM EDTA (pH 8.0), 20% glyce ol, and p o ease
inhibi o s (Comple e; Roche). To al cell ex ac s we e ob ained by cen i uga ion
a 20,000 ⫻gin a 75VTi o o (Beckman) o 1ha 4°C. The supe na an s we e
used o immunop ecipi a ion o subjec ed o a second cen i uga ion a 180,000 ⫻
gin he same o o o 45 min a 4°C. The la e supe na an s we e named
ul acen i uged ex ac s. Aliquo s o 2 ml o o al o ul acen i uged ex ac s
we e mixed wi h 200 l o immunoglobulin G-Sepha ose 6 Fas Flow (IgG-
Sepha ose) beads (Ame sham) and incuba ed o 2ha 4°Cwi h end-o e -end
ube o a ion. When indica ed, he ul acen i uged ex ac s we e ea ed wi h
100 ng/ml RNase A be o e mixing wi h he IgG-Sepha ose beads. A e incuba-
ion, he beads we e washed eigh imes wi h 1.5 ml o he same bu e a 4°C, he
IgG-Sepha ose beads we e collec ed, and he bound p o eins we e elu ed wi h
900 l 0.5 M ace ic acid and concen a ed by lyophiliza ion. To al, nonbound and
bound p o eins we e sepa a ed on 6 and 12% SDS–PAGE gels and subjec ed o
Wes e n blo analysis using he app op ia e an ibodies.
Fo he immunop ecipi a ion analysis (see Fig. 7), he p o ocols used we e
hose p e iously desc ibed in e e ence 63.
RESULTS
Isola ion o npa2 mu an s ha exhibi a syn he ic le hal
pheno ype wi h he sa3 null allele. We ha e p e iously iden-
i ied a gene ic ne wo k o in e ac ion be ween Dpb6p, Dbp7p,
Dbp9p, Rpl3p, Nop8p, and Rsa3p (16). Mo e ecen ly, we
ha e ex ended he gene ic ne wo k by pe o ming a syn he ic
le hal (sl) sc eening wi h he sa3 null allele (78). This sc een-
ing con i med he in e ac ions be ween RSA3 and DBP6,
DBP9,RPL3, and NOP8 and e ealed addi ional in e ac ions
wi h alleles o NPA1 (78). Two sl mu an s, he sl3-4 and sl2-3
s ains, emained uncha ac e ized (see Ma e ials and Me h-
ods). To iden i y he co esponding mu a ed genes, we i s
ans o med he sl3-4 s ain wi h a yeas genomic lib a y and
eco e ed he lib a y plasmid o he sole colony ha g ew as
he wild- ype s ain a 30°C and los he sl pheno ype ( es o ed
ed-whi e sec o ing and g ow h on 5- luo oo o ic acid [5-FOA]).
Sequence and subcloning analysis o he inse showed ha ORF
YJR041C, which we named NPA2, co esponds o he gene de-
ined by he sl3-4 mu a ion. NPA2 also complemen ed he sl
pheno ype o he sl2-3 s ain.
To isola e he sl mu a ion om he sl3-4 mu an , he ea e
npa2-1, we c ossed his s ain o an isogenic wild- ype s ain,
W303-1A; he esul ing diploid was spo ula ed and e ads
we e dissec ed. In all comple e e ads, wo sg spo e clones
we e ob ained. Fo u he analyses, he meio ic seg egan s
IVY255 and IVY251 we e selec ed (see Table S1 in he sup-
plemen al ma e ial). Fu he gene ic analysis con i med ha
he npa2-1 mu a ion is linked o he NPA2 gene (da a no
shown). Figu e 2 shows ha he npa2-1 mu a ion con e s a sg
pheno ype and causes le hali y in combina ion wi h he sa3
null allele. The sg pheno ype o npa2-1 is enhanced a 37°C
(da a no shown).
Npa2p is an essen ial p o ein ha localizes in he nucleolus.
NPA2 is an essen ial gene ha encodes a ela i ely la ge p o-
ein o 1,147 amino acids (135.2 kDa). A de ailed sequence
analysis e ealed no ob ious p o ein mo i s o Npa2p, bu i s
i s 748 amino acids ha e a p edic ed s uc u e ela ed o
p o eins o he HEAT- epea amily (Yeas Resou ce Cen e
In o ma ics Pla o m; h p://www.yeas c.o g) (45). We also
ound an IMP dehyd ogenase-GMP educ ase domain be-
ween amino acids 520 and 855 (In e P oScan; h p://www.ebi
.ac.uk/In e P oScan), al hough he biological ele ance o his
inding is unclea . Sea ches in he p e ibosomal ne wo k (h p:
//p e- ibosome.de) (68) ound Npa2p associa ed wi h ea ly p e-
60S pa icles. Mo eo e , Npa2p has been desc ibed o be e-
qui ed o p e- RNA p ocessing (70, 74) and i has been ound
by some o us as a componen o a e y ea ly p e-60S pa i-
cle(s) con aining Npa1p-TAP (19).
Fo a i s hin o he unc ion o Npa2p, we de e mined i s
subcellula localiza ion. To do his, we cons uc ed a C- e mi-
nal g een luo escen p o ein- agged NPA2 allele exp essed
unde he con ol o i s cogna e p omo e (see Ma e ials and
Me hods). The esul ing s ain was u he ans o med wi h
pUN100-DSRed-NOP1, which exp essed DsRed- agged Nop1p
FIG. 2. The npa2-1 mu a ion con e s a slow g ow h pheno ype and
is syn he ically le hal wi h he sa3 null allele. S ains IVY251 (npa2-1),
ca ying he plasmid YCplac33-NPA2, and YMD3-2D (⌬ sa3) we e
c ossed, he esul ing diploid was spo ula ed, and e ads we e dis-
sec ed. Comple e e ads we e s eaked on YPD pla es and es eaked
on 5-FOA-con aining pla es o coun e selec YCplac33-NPA2. A ep-
esen a i e e a ype e ad is shown on a YPD pla e ( op hal ) o on
a 5-FOA con aining pla e (bo om hal ). Pla es we e incuba ed a 30°C
o 4 days.
1210 ROSADO ET AL. MOL.CELL.BIOL.
on July 28, 2016 by USE/BCTA.GEN UNIVERSITARIAh p://mcb.asm.o g/Downloaded om
(35). We de ec ed he g een luo escence o Npa2p-g een luo-
escen p o ein in he nucleolus, since i mos ly colocalized wi h
he ed signal o DsRed-Nop1p (see Fig. S1 in he supplemen al
ma e ial). Ou esul s a e in ull ag eemen wi h hose o Huh
e al. (50) and consis en wi h a ole o his p o ein in ibosome
biogenesis.
Mu a ion o deple ion o Npa2p leads o a de iciency in 60S
-subuni s. To in es iga e he ole o Npa2p in ibosome bio-
genesis, we i s analyzed polysome p o iles o npa2-1 and
NPA2 isogenic s ains. Fo he NPA2 s ain, we de ec ed a
ypical wild- ype p o ile (Fig. 3A). Fo he npa2-1 s ain, we
de ec ed a de ici o ee 60S e sus 40S -subuni s, an o e all
dec ease in he le el o 80S ibosomes, and an accumula ion o
hal -me polysomes (Fig. 3B). We also pe o med polysome
p o ile analysis upon deple ion o Npa2p. Fo his, we i s
cons uc ed a condi ional GAL::ZZ-NPA2 s ain (YH378),
which con ains he NPA2 gene unde he con ol o he GAL10
p omo e (see Ma e ials and Me hods). In galac ose-suc ose
con aining medium, he GAL::ZZ-NPA2 s ain had he same
g ow h beha io as he o he wise isogenic s ain, indica ing
ha he GAL::ZZ-NPA2 allele is ully unc ional. As expec ed,
only esidual g ow h o he GAL::ZZ-NPA2 s ain was ob-
se ed on glucose-con aining pla es (see Fig. S2 in he supple-
men al ma e ial). A e a shi om galac ose-suc ose o glu-
cose-con aining liquid medium, he g ow h a e o he
GAL::ZZ-NPA2 s ain emained simila o ha o he wild-
ype s ain du ing a leas he i s 6 h bu hen p og essi ely
dec eased o a doubling ime o ⬎8 h a e 30 h, as compa ed
wi h he 2 h doubling ime o YDL402. A concomi an deple-
ion o Npa2p was obse ed by Wes e n blo ing (see Fig. S2 in
he supplemen al ma e ial). The GAL::ZZ-NPA2 s ain and i s
isogenic wild- ype coun e pa (YDL402) we e g own a 30°C
in medium con aining galac ose and suc ose as a ca bon sou ce
and hen shi ed o glucose-con aining medium o 6, 12, and
24 h. Ex ac s we e p epa ed a he di e en ime poin s, and
polysome p o iles we e analyzed. Wild- ype p o iles we e ob-
ained o bo h s ains in galac ose-suc ose medium and o
YDL402 a any ime a e he shi (Fig. 3C and da a no
shown). In simila i y o he npa2-1 mu an esul s, he Npa2p-
deple ed s ain displayed a de ici in 60S -subuni s. This de ici
was obse ed a e 6 h and became mo e p onounced a e 12
and 24 h in glucose-con aining medium (Fig. 3D o F). These
esul s show clea ly ha Npa2p is equi ed o 60S -subuni
accumula ion.
Npa2p is equi ed o no mal p e- RNA p ocessing. To
de e mine whe he he de ici in 60S -subuni s in he npa2
mu an s ains is associa ed wi h de ec s in p e- RNA p ocess-
ing, we analyzed he s eady-s a e le els o p e- and ma u e
RNA species by No he n blo ing and p ime ex ension.
Fi s , o al RNA was isola ed om he GAL::ZZ-NPA2 and
he isogenic NPA2 s ain a a ious ime poin s a e ans e
om galac ose-suc ose o glucose-con aining medium and an-
alyzed by No he n hyb idiza ion. As shown in Fig. 4, a signi -
ican dec ease in le els o ma u e RNAs was obse ed a e
deple ion o Npa2p. The 35S p e- RNA and he abe an 23S
( ha ex ends om ⫹1 o si e A
3
) and 21S ( ha ex ends om
si e A
1
o si e A
3
) p e- RNA species sligh ly accumula ed, wi h
ongoing deple ion compa ed o esul seen wi h he wild- ype
s ain in glucose medium. These accumula ions a e likely due
o delayed p ocessing a si e A
2
and o a lesse ex en a si es
A
0
and A
1
. P obably in pa as a consequence o he A
2
clea -
age delay, he le els o he 20S and he 27SA
2
p ecu so s we e
signi ican ly a ec ed. Impo an ly, he e was a d as ic educ-
ion in he le els o he 27SB p e- RNA species bu a less
p onounced educ ion o 7S p e- RNAs (Fig. 4A o B). Finally,
we de ec ed mild accumula ion o an abe an A
2
-C
2
agmen
a ea ly ime poin s o deple ion, which sugges s ha deple ion
o Npa2p allows p ema u e clea age o 27SA
2
p e- RNA a
si e C
2
.
In o de o disc imina e be ween he 27SA
2
and 27SA
3
p e- RNAs, dis inguish be ween he 27SB
L
and 27SB
S
p e-
RNAs, and de ec he 25.5S p e- RNA species, we pe -
o med p ime ex ension analyses. As shown in Fig. 4C, he
quan i ies o he cDNAs e mina ing a si es A
3
,B
1L
, and
B
1S
and o a lesse ex en hose e mina ing a si e A
2
we e
ound o be signi ican ly dec eased upon deple ion o
Npa2p. Mo eo e , p ime ex ension analysis h ough si e C
2
showed a clea educ ion in he le el o he 25.5S p e- RNA
upon deple ion o Npa2p.
P e- RNA p ocessing was simila ly a ec ed in he npa2-1
mu an a e a shi o 9h o37°C. The 35S and 23S p e-
RNAs accumula ed, he le els o he 20S and 27SA p ecu so s
we e educed ma kedly, and he le els o he 7S p e- RNA,
FIG. 3. The npa2-1 mu a ion and he deple ion o Npa2p esul in
a de ici in ee 60S -subuni s and in he accumula ion o hal -me
polysomes. W303-1B (NPA2) (A) and IVY251 (npa2-1) (B) s ains
we e g own in YPD a 30°C. S ain YH378 (GAL::ZZ-NPA2) was
g own a 30°C in YPGal⫹Suc (C) o shi ed o YPD o 6 h (D), 12 h
(E), and 24 h (F). Cells we e ha es ed a an OD
600
o 0.8, and cell
ex ac s we e esol ed in 7% o 50% polysome suc ose g adien s. The
A
254
was con inuously measu ed. Sedimen a ion is shown om le o
igh . The peaks o ee 40S and 60S -subuni s, 80S ee couples-
monosomes, and polysomes a e indica ed. Hal -me s a e labeled by
a ows.
VOL. 27, 2007 Npa2p-CONTAINING SUBCOMPLEX 1211
on July 28, 2016 by USE/BCTA.GEN UNIVERSITARIAh p://mcb.asm.o g/Downloaded om
18S, and 25S RNA we e educed mildly; howe e , no clea
al e a ion in he le els o 5.8S and 5S was de ec ed (da a no
shown).
Al oge he , ou esul s sugges ha he de ici in 60S
-subuni le els upon deple ion o mu a ion o Npa2p is a
consequence o impai ed o ma ion o he 27S p ecu so s,
hus leading o dec eased le els o he ma u e 25S and 5.8S
RNAs. The pheno ypes discussed abo e a e mos likely due
o imp ope ea ly assembly and ins abili y o ea ly p e-60S
-pa icles.
Npa2p is a componen o p e ibosomal pa icles con aining
27SA
2
p e- RNA. We p e iously showed ha Npa2p is associ-
a ed wi h Npa1p, i sel p edominan ly p esen wi hin e y ea ly
p e-60S -pa icle(s) (19). This inding sugges ed ha Npa2p is
also a componen o such pa icles. To con i m his in e ence,
we i s analyzed he sedimen a ion beha io o he Npa2p-
TAP usion p o ein in low Mg
2⫹
suc ose densi y g adien s.
This kind o g adien has p o ed e y use ul o s udy he
sedimen a ion o 60S p e ibosomal pa icles (15, 78, 93), which
a e labile and pa ially dissocia ed when subjec ed o s anda d
polysome suc ose g adien s (92) (see below). S ains exp ess-
ing Npa2p-TAP g ow no mally, indica ing ha he agged p o-
ein is unc ional (da a no shown). As shown in Fig. 5A, mos
Npa2p-TAP was ound associa ed wi h high-molecula -mass
pa icles. We de ec ed associa ion wi h high-molecula -mass
pa icles o o he p o eins, including Dbp6p, Has1p, Npa1p,
Nop8p, and Rsa3p (Fig. 5A). All hese ac o s, excep Rsa3p,
ha e also been desc ibed as componen s o he Npa1p-TAP
pu i ied pa icle(s) (19). No he n hyb idiza ion showed ha
he maximum o he peak o Npa2p-TAP coincides wi h he
peak o he 27SA
2
p e- RNA (Fig. 5B).
We also pe o med coimmunop ecipi a ion expe imen s
wi h Npa2p-TAP and non agged con ol s ains and analyzed
cop ecipi a ed RNAs by No he n hyb idiza ion and p ime
ex ension. As is consis en wi h he p e ious published da a o
Npa1p-TAP (19), by a he mos e icien ly cop ecipi a ed
p e- RNA wi h Npa2p-TAP was he 27SA
2
p e- RNA (Fig. 6A
and B). A small ac ion o 35S p e- RNA could also be co-
p ecipi a ed (Fig. 6B). The 27SB and 7S p ecu so s we e p e-
cipi a ed only a backg ound le els, and no signi ican p ecip-
FIG. 4. E ec s o Npa2p deple ion on s eady-s a e le els o p e- RNAs and ma u e RNAs. S ains YDL402 (NPA2) and YH378
(GAL::ZZ-NPA2) we e g own in YPGal⫹Suc medium and hen shi ed o YPD medium. Cells we e ha es ed a he indica ed imes, and o al
RNA was ex ac ed. (A) Equal amoun s o o al RNA (5 g) we e esol ed on a 1.2% aga ose– o maldehyde gel, ans e ed on o a nylon
memb ane, and hyb idized consecu i ely wi h di e en p obes. (B) Equal amoun s o o al RNA (2.5 g) we e esol ed on a 7% polyac ylamide–
u ea gel, ans e ed on o a nylon memb ane, and hyb idized consecu i ely wi h di e en p obes. (C) Equal amoun s o o al RNA (5 g) we e
used o p ime ex ension analysis. P obe gwas labeled and used o he eac ions. No e ha his p obe allows de ec ion o 27SA
2
(as he s op a
si e A
2
), 27SA
3
(as he s op a si e A
3
), bo h 27SBs (as s ops a si es B
1L
and B
1S
), and 25.5S (as he s op a si e C
2
). P obe names a e indica ed
be ween pa en heses (see Fig. 1 o hei loca ions in he 35S p e- RNA). Signal in ensi ies we e measu ed by scanning, and alues ob ained
(indica ed below each lane) we e no malized o hose ob ained o he wild- ype s ain g own in galac ose-suc ose medium, a bi a ily se a 100.
1212 ROSADO ET AL. MOL.CELL.BIOL.
on July 28, 2016 by USE/BCTA.GEN UNIVERSITARIAh p://mcb.asm.o g/Downloaded om
i a ion was seen o he snRNA U4, which was used as a
nega i e con ol (Fig. 6).
We conclude ha Npa2p is a speci ic componen o a e y
ea ly p e-60S ibosomal pa icle(s).
Syn he ic le hali y wi h npa1 and npa2 alleles (gene ic pa -
ne s o Npa2p). To ob ain mo e de ails abou he unc ion o
Npa2p, we ha e es ed he syn he ic in e ac ion ela ionships
be ween he npa2-1 mu an and he se o mu an s ha show
gene ic in e ac ion wi h he sa3 null allele (78). These mu an s
map in genes o he 60S -subuni assembly ac o s Dbp6p,
Dbp7p, Dbp9p, Nop8p, and Npa1p and he 60S -subuni p o-
ein Rpl3p (16, 78). As a speci ici y con ol, we selec ed Spb4p,
since we had p e iously shown ha he e is no syn he ic in e -
ac ion be ween he spb4-1 mu an and mu an alleles o DBP6,
DBP7,o RSA3 (16, 78). As addi ional con ols, we selec ed
di e en has1 alleles, wo nop4 mu an s, and he dbp3 and nop6
null alleles (see Table S1 in he supplemen al ma e ial). Has1p,
Nop4p, and Dbp3p a e 60S -subuni biogenesis ac o s ha
ha e been desc ibed as componen s o he Npa1p-TAP pu i-
ied pa icle(s) (19). Nop6p is a p edic ed 60S -subuni bio-
genesis ac o which was ound associa ed wi h Npa2p in a
la ge-scale a ini y pu i ica ion s udy (47).
As a esul , we de ec ed syn he ic in e ac ion only be ween
npa2-1 and mu an alleles o DBP6,DBP7,DBP9,NOP8,
RSA3, and RPL3 bu no wi h npa1-1 (Fig. 7). In addi ion, none
o he combina ions o npa2-1 wi h he es ed has1 and nop4
alleles, he spb4-1 mu an , o he dbp3 and nop6 null alleles
showed syn he ic in e ac ion (Fig. 7). In e es ingly, when sim-
ila sl analyses we e pe o med wi h he npa1-1 mu an , we
ound iden ical esul s: he npa1-1 showed syn he ic in e ac ion
only wi h mu an alleles o DBP6,DBP7,DBP9,NOP8,RSA3,
and RPL3 (Fig. 7). The speci ic gene ic in e ac ions be ween
Npa2p o Npa1p and Dbp6p, Dbp7p, Dbp9p, Nop8p, Rsa3p,
and Rpl3p s ongly sugges ha all hese p o eins unc ionally
in e ac du ing ea ly assembly o 60S -subuni s.
Npa2p o ms a complex wi h o he ans-ac ing ac o s in-
ol ed in ea ly s eps o 60S -subuni biogenesis (p o ein pa -
ne s o Npa2p). We nex asked whe he he se o p o eins ha
gene ically in e ac wi h Npa2p a e also able o in e ac phys-
ically. Fo his pu pose, we i s analyzed he sedimen a ion
FIG. 5. Npa2p is p esen in la ge complexes, mos likely p e-60S -pa icles. To al cell ex ac s we e ob ained om IVY317 (Npa2p-TAP,
Has1p, Rpl3p), IVY325 (Npa1p-HA), IVY347 (HA-Dbp6p), IVY411 (Nop8p-HA), and IVY409 (Rsa3p-HA) cells ollowing g ow h a 30°C.
Abou 15 A
254
uni s o cell ex ac we e esol ed in 7% o 50% suc ose g adien s con aining a low concen a ion o Mg
2⫹
o dissocia e ibosomes
in o subuni s. Sedimen a ion is shown om le o igh . The sedimen a ion posi ions o 40S and 60S ibosomal subuni s a e indica ed.
(A) F ac ions we e collec ed om he g adien s, and p o eins we e ex ac ed om he same olume o each ac ion, esol ed on 7% SDS–PAGE
gels, and subjec ed o Wes e n blo ing. The blo s we e deco a ed wi h speci ic an ibodies de ec ing he p o eins indica ed. (B) RNA was ex ac ed
om equal olumes o each ac ion, esol ed on a 1.2% aga ose– o maldehyde gel, and ans e ed on o a nylon memb ane. The same memb ane
was hyb idized wi h di e en p obes. P obe names a e indica ed be ween pa en heses. T s ands o o al ex ac , and numbe s co espond o
ac ion numbe s.
VOL. 27, 2007 Npa2p-CONTAINING SUBCOMPLEX 1213
on July 28, 2016 by USE/BCTA.GEN UNIVERSITARIAh p://mcb.asm.o g/Downloaded om
p o ile o Npa2p and o he 60S -subuni assembly ac o s on
polysome suc ose g adien s. This kind o g adien has been
epo ed o allow dissocia ion o a numbe o p e-60S -pa icle
componen s; hus, 27S p ecu so s sedimen mo e slowly han
25S RNA (92) (see Fig. 8B).
As expec ed o a componen o a p e-60S ibosomal pa i-
cle, a ac ion o Npa2p-TAP was p esen in la ge complexes
and cosedimen ed wi h 27SA p e- RNA (Fig. 8A, lanes 12 o
15). Howe e , mos Npa2p was ep oducibly de ec ed in ac-
ions 6 and 7, whe e no p e- RNAs a e de ec ed (Fig. 8A, lanes
6 and 7). In e es ingly, we ound a simila sedimen a ion pa -
e n o Dbp6p, Npa1p, Nop8p, and Rsa3p (Fig. 8A, lanes 6
and 7) and Dbp7p and Dbp9p (da a no shown). A di e en
beha io was obse ed o Has1p, which is en iched in ac-
ions 11 o 13 con aining 27SA
2
p e- RNA, and o Rpl3p,
which sedimen ed wi h he bulk o he 60S -subuni s and
ibosomes (Fig. 8). These esul s indica e ha Npa2p, Dbp6p,
Dbp7p, Dbp9p, Nop8p, Npa1p, and Rsa3p a e p esen in p e-
60S -pa icles bu ha hey can be eleased om hem as a
complex(es) o low molecula mass.
To u he analyze his small complex(es), we decided o
adop he p ocedu e desc ibed by Hughes and cowo ke s (59),
which allowed hem o epo he copu i ica ion o Npa2p wi h
FIG. 6. Npa2p in e ac s p edominan ly wi h he 27SA
2
p e- RNA. (A) No he n analysis o p e- RNAs and ma u e RNAs p ecipi a ed wi h
Npa2p-TAP o om ex ac s lacking a agged p o ein. P ecipi a ions we e pe o med using IgG-Sepha ose beads and o al cellula ex ac s. RNA
was ex ac ed om he pelle s ob ained a e p ecipi a ion (lanes IP) o om an amoun o o al ex ac co esponding o 1/30 o ha used o he
p ecipi a ion (lanes T). (B) P ime ex ension analysis o p e- RNAs p ecipi a ed wi h Npa2p-TAP. P ecipi a ion was pe o med as desc ibed o
panel A. (C) No he n analysis o snRNA U4 p ecipi a ed wi h Npa2p-TAP. P ecipi a ion was pe o med as desc ibed o panel A. Signal in ensi y
was measu ed by phospho image scanning o de i e he pe cen age o inpu RNA p ecipi a ed oge he wi h Npa2p-TAP (indica ed below each
IP lane). bg, backg ound alue. P obe names a e indica ed be ween pa en heses.
FIG. 7. Gene ic pa ne s o Npa2p. Solid lines ep esen syn he ic
le hali y, and dashed lines ep esen syn he ic enhancemen . This pa-
pe shows he gene ic in e ac ion o npa2 and npa1 alleles, wi h mu-
a ions in he genes coding he indica ed p o eins. No e ha he ge-
ne ic ne wo k o med by Dpb6p, Dbp7p, Dbp9p, Nop8p, Rpl3p, and
Rsa3p has been p e iously desc ibed (78). See Ma e ials and Me hods,
Resul s, and he supplemen al ma e ial o mo e de ails.
1214 ROSADO ET AL. MOL.CELL.BIOL.
on July 28, 2016 by USE/BCTA.GEN UNIVERSITARIAh p://mcb.asm.o g/Downloaded om
Npa1p (70). B ie ly, la ge complexes such as p e ibosomal
pa icles and -subuni s p esen in o al ex ac s a e pelle ed by
a high-speed cen i uga ion s ep (180,000 ⫻g o 45 min)
be o e p ecipi a ion o Npa2p-TAP and analysis o coimmu-
nop ecipi a ing p o eins (Fig. 9). When he high-speed cen i-
uga ion s ep was omi ed, Dbp6p, Dbp7p, Dbp9p, Nop8p,
Npa1p, and Rsa3p we e ound associa ed wi h Npa2p-TAP
(Fig. 9). Nei he Nog2p, Nop1p, no Nop7p was ound associ-
a ed wi h Npa2p-TAP (da a no shown). Rpl3p, Rpl12p, and
Rpp0p bu no Rps8p we e ound associa ed wi h Npa2p-TAP
(Fig. 9 and da a no shown). In e es ingly, when he high-speed
cen i uga ion s ep was pe o med, only Dbp6p, Nop8p,
Npa1p, and Rsa3p we e ound associa ed wi h Npa2p-TAP.
Nei he Dbp7p no Dbp9p and he es ed -p o eins cop e-
cipi a ed wi h Npa2p-TAP (Fig. 9 and da a no shown).
When he non agged Npa2p s ains we e used as a con ol,
no coimmunop ecipi a ion was de ec ed excep o Rsa3p
om o al cell ex ac s (Fig. 9). We suspec ha Rsa3p has
some unspeci ic a ini y o Sepha ose suppo s. We con-
clude ha Npa2p in e ac s in ima ely wi h Dbp6p, Nop8p,
Npa1p, and Rsa3p.
In o de o es whe he o no RNA media es he in e ac-
ion be ween he ac o s discussed abo e, an RNase ea men
o he supe na an ob ained ollowing high-speed cen i uga-
ion o ex ac s was pe o med be o e immunop ecipi a ion.
As seen in Fig. 10, he in e ac ion be ween Npa2p and Dbp6p,
Nop8p, Npa1p, and Rsa3p is kep e en a e RNase ea men .
We conclude ha Npa2p is p esen in a s able he e ome ic
subcomplex(es) wi h Dbp6p, Npa1p, Nop8p, and Rsa3p which
is independen o he p esence o p e- RNA.
To de ine be e his subcomplex(es), gel il a ion ac ion-
a ion o RNase- ea ed high-speed cen i uged ex ac s was
pe o med by ch oma og aphy h ough a Supe ose 6HR col-
umn and ac ions we e analyzed by Wes e n blo ing. As
shown in Fig. 11A, Npa2p-TAP ep oducibly peaked in ac-
ions 24 o 28, wi h a maximum a ac ion 26. This indica es
ha Npa2p is p esen in a complex o abou 550 o 600 kDa.
We also s udied he elu ion pa e ns o Dbp6p, Nop8p, Npa1p,
and Rsa3p and ound ha a subs an ial p opo ion o all hese
p o eins coelu ed wi h Npa2p-TAP (Fig. 11A). This was mo e
e iden o Dpb6p and Npa1p, while Nop8p and Rsa3p we e
elu ed oge he in in e media e ac ions. The combined mo-
FIG. 8. Npa2p, Npa1p, Dbp6p, Nop8p, and Rsa3p dissocia e om p e ibosomes upon polysome g adien ac iona ion. To al cell ex ac s we e
ob ained om IVY317 (Npa2p-TAP, Has1p, and Rpl3p), IVY325 (Npa1p-HA), IVY347 (HA-Dbp6p), IVY411 (Nop8p-HA), and IVY409
(Rsa3p-HA) cells ollowing g ow h a 30°C. Abou 15 A
254
uni s o cell ex ac we e esol ed in 7% o 50% s anda d suc ose g adien s o polysome
analysis. Sedimen a ion is shown om le o igh . The peaks o 40S and 60S ibosomal subuni s and 80S couples-monosomes a e indica ed. The
analysis o p o eins (A) and RNA (B) om he g adien s was pe o med as desc ibed in he legend o Fig. 5.
VOL. 27, 2007 Npa2p-CONTAINING SUBCOMPLEX 1215
on July 28, 2016 by USE/BCTA.GEN UNIVERSITARIAh p://mcb.asm.o g/Downloaded om