scieee Open visual document viewer

Hpr1 is preferentially required for transcription of either long or G+C-rich DNA sequences in Saccharomyces cerevisiae

Chávez de Diego, Sebastián; García Rubio, María Luisa; Prado Velasco, José Félix; Aguilera López, Andrés

Abstract

Hpr1 forms, together with Tho2, Mft1, and Thp2, the THO complex, which controls transcription elongation and genome stability in Saccharomyces cerevisiae. Mutations in genes encoding the THO complex confer strong transcription-impairment and hyperrecombination phenotypes in the bacterial lacZ gene. In this work we demonstrate that Hpr1 is a factor required for transcription of long as well as G C-rich DNA sequences. Using different lacZ segments fused to the GAL1 promoter, we show that the negative effect of lacZ sequences on transcription depends on their distance from the promoter. In parallel, we show that transcription of either a long LYS2 fragment or the S. cerevisiae YAT1 G C-rich open reading frame fused to the GAL1 promoter is severely impaired in hpr1 mutants, whereas transcription of LAC4, the Kluyveromyces lactis ortholog of lacZ but with a lower G C content, is only slightly affected. The hyperrecombination behavior of the DNA sequences studied is consistent with the transcriptional defects observed in hpr1 cells. These results indicate that both length and G C content are important elements influencing transcription in vivo. We discuss their relevance for the understanding of the functional role of Hpr1 and, by extension, the THO complex.

Full text

MOLECULAR AND CELLULAR BIOLOGY, 0270-7306/01/$04.00⫹0 DOI: 10.1128/MCB.21.20.7054–7064.2001 Oc . 2001, p. 7054–7064 Vol. 21, No. 20 Copy igh © 2001, Ame ican Socie y o Mic obiology. All Righ s Rese ed. Hp 1 Is P e e en ially Requi ed o T ansc ip ion o Ei he Long o G⫹C-Rich DNA Sequences in Saccha omyces ce e isiae SEBASTIA ´N CHA ´VEZ, MARI ´A GARCI ´A-RUBIO, FE ´LIX PRADO, AND ANDRE ´S AGUILERA* Depa amen o de Gene´ ica, Facul ad de Biologı´a, Uni e sidad de Se illa, 41012 Se ille, Spain Recei ed 21 May 2001/Re u ned o modi ica ion 26 June 2001/Accep ed 24 July 2001 Hp 1 o ms, oge he wi h Tho2, M 1, and Thp2, he THO complex, which con ols ansc ip ion elonga ion and genome s abili y in Saccha omyces ce e isiae. Mu a ions in genes encoding he THO complex con e s ong ansc ip ion-impai men and hype ecombina ion pheno ypes in he bac e ial lacZ gene. In his wo k we demons a e ha Hp 1 is a ac o equi ed o ansc ip ion o long as well as GⴙC- ich DNA sequences. Using di e en lacZ segmen s used o he GAL1 p omo e , we show ha he nega i e e ec o lacZ sequences on ansc ip ion depends on hei dis ance om he p omo e . In pa allel, we show ha ansc ip ion o ei he a long LYS2 agmen o he S. ce e isiae YAT1 GⴙC- ich open eading ame used o he GAL1 p omo e is se e ely impai ed in hp 1 mu an s, whe eas ansc ip ion o LAC4, he Kluy e omyces lac is o holog o lacZ bu wi h a lowe GⴙC con en , is only sligh ly a ec ed. The hype ecombina ion beha io o he DNA sequences s udied is consis en wi h he ansc ip ional de ec s obse ed in hp 1 cells. These esul s indica e ha bo h leng h and GⴙC con en a e impo an elemen s in luencing ansc ip ion in i o. We discuss hei ele ance o he unde s anding o he unc ional ole o Hp 1 and, by ex ension, he THO complex. The con ol o genome s abili y is essen ial o ensu e main- enance o gene ic in o ma ion in all cells o a li ing o ganism. Dys unc ion o his con ol causes mu a ions and ch omosomal abe a ions ha can gi e ise o loss o gene unc ion, cell dea h, o i e e sible changes in he cell p og am. Gene ic ecombina ion is equi ed o mi o ic DNA epai and o p ope meio ic ch omosome seg ega ion. In addi ion, i may also be esponsible o p ocesses o gene ic ins abili y. A numbe o animal diseases, including cance , o igina e by e en s o mi o ic ecombina ion be ween epea s ha lead o ch omosomal abe a ions (34). Se e al elemen s ha e been desc ibed o enhance mi o ic ecombina ion, including DNA damage, eplica ion de ec s, al e a ion o ch oma in s uc u e, and ansc ip ional ac i i y ( e iewed in e e ence 3). Ikeda and Ma sumo o (26) i s desc ibed he in luence o ansc ip- ion on ecombina ion showing ha ecombina ion o phage ␭ was s imula ed by ansc ip ion. In yeas , he i s example o ansc ip ion-associa ed ecombina ion was he inding ha a ho spo o ibosomal DNA ( DNA) ecombina ion, HOT1, was dependen on RNA polyme ase I-d i en ansc ip ion (55, 60). Thomas and Ro hs ein (56) ex ended ansc ip ion-induced ecombina ion o sequences ansc ibed by RNA polyme ase II (RNAPII). Addi ional examples o RNAPII-dependen e- combina ion ha e been subsequen ly desc ibed in yeas (21, 36, 50) and mammalian cells (37, 57). Special men ion mus be made o he modula ion o ecombina ion a he immunoglob- ulin loci, as bo h V(D)J ecombina ion (7, 31, 38) and class swi ching (15) a e posi i ely con olled by ansc ip ion. A gene linking ansc ip ion and genome ins abili y in Sac- cha omyces ce e isae is HPR1,ashp 1 mu an s show bo h in- c eased le els o ecombina ion be ween di ec epea s and ch omosome loss (2, 49) as well as s ong ansc ip ional de- ec s (11, 44, 67). De ailed cha ac e iza ion o hese de ec s has shown ha he absence o Hp 1 causes impai men o an- sc ip ion elonga ion. The in ensi y o such a ansc ip ional impai men depends on he ansc ibed DNA sequence (11). The e is a close co ela ion be ween he eluc ance o a DNA sequence o be ansc ibed in hp 1 cells and he abili y o such a sequence o p omo e ecombina ion when inse ed be ween di ec epea s (11, 44). Biochemical and gene ic analyses ha e con ibu ed o iden- i ying se e al ac o s ha pa icipa e in RNAPII-media ed ansc ip ion elonga ion ( e iewed in e e ence 14). Acco ding o hei unc ion in ansc ip ional elonga ion, hese ac o s can be classi ied in di e en g oups. TFIIS p e en s RNAPII a es and induces nascen ansc ip clea age ( e iewed in e e ence 64). Some o he ac o s, like TFIIF, CSB, ELL, and elongin, in luence elonga ion by supp essing he pausing o RNAPII (5, 46, 52, 53). P-TEFb s imula es ansc ip ion elonga ion in e- sponse o ansac i a o s ( e iewed in e e ence 45) by an ag- onizing nega i e ac o s like DSIF and NELF (22, 61, 65). Finally, some ansc ip ion elonga ion ac o s like FACT and Elonga o play a ole in acili a ing RNAPII-d i en ansc ip- ion on ch oma in empla es (39, 40). Al hough hp 1⌬cells a e a ec ed in ansc ip ion elonga ion in i o, Hp 1 does no seem o be physically associa ed wi h any o he known elonga ion ac o s. I has been demons a ed ha Hp 1 is physically p esen in a new o m o RNAPII ho- loenzyme ha has been p oposed o espond o p o ein kinase C-media ed signal ansduc ion (10). Hp 1 o ms he THO complex in i o oge he wi h he p oduc s o he THO2, MFT1, and THP2 genes (12). The absence o any o he ou p o eins con e s simila pheno ypes o ansc ip ional elonga- ion impai men and hype ecombina ion, indica ing ha he THO complex is a unc ional uni in gene exp ession and genome s abili y (12). Howe e , he way THO con ols hese p ocesses emains obscu e. * Co esponding au ho . Mailing add ess: Depa amen o de Ge- ne´ ica, Facul ad de Biologı´a, Uni e sidad de Se illa, A d. Reina Me - cedes 6, 41012 Se ille, Spain. Phone: 34 954 557 107. Fax: 34 954 557 104. E-mail: [email p o ec ed]. 7054 on July 4, 2017 by USE/BCTA.GEN UNIVERSITARIAh p://mcb.asm.o g/Downloaded om As ele ance o he THO complex in ansc ip ion depends on he ansc ibed DNA sequence, in es iga ion o he ea u es ha make ansc ip ion o a pa icula DNA sequence depen- den on Hp 1 can p o ide some clues o unde s anding i s p ecise unc ion. We ha e ound ha ansc ip ional impai - men in hp 1 occu s p ima ily in long ansc ip ion uni s as well as in DNA sequences wi h a high G⫹C con en used o he GAL1 p omo e . The ele ance o hese esul s o unde - s anding he unc ional ole o he THO complex is discussed. MATERIALS AND METHODS Yeas s ains and plasmids. The wo isogenic yeas s ains used in his s udy we e W303-1A (MATaade2-1 can1-100 his3-11,15 leu2-3,112 p1-1 u a3-1) and U768-4C (MATaade2-1 can1-100 his3-11,15 leu2-3,112 p1-1 u a3-1 hp 1⌬:: HIS3). All plasmids used a e monocopy CEN-based plasmids and a e lis ed in Table 1. Analysis o gene exp ession and ecombina ion. Fo he analysis o GAL1- d i en exp ession, mid-log phase cells we e inocula ed wi h 3% glyce ol–2% lac a e syn he ic medium a an op ical densi y a 600 nm (OD 600 ) o 0.1. A e 16 h o incuba ion a 30°C, 2% galac ose was added and incuba ion was con in- ued o ano he 8ha 30°C. Acid phospha ase ac i i y and mRNA le els we e de e mined as desc ibed p e iously (11). I is impo an ha all ansc ip ion analyses shown in his s udy, wi h ew excep ions, we e made in monocopy CEN-based plasmids, which a e los a highe equencies in hp 1 e sus wild- ype s ains (11). Howe e , since in all expe imen s cells we e g own unde he selec ion condi ions o he plasmid, mo e han 90% o he hp 1 cells s ill con ained plasmids. The e o e, all obse ed ansc ip ional e ec s a e no caused by plasmid loss. Fo exp ession analysis o EGT2,CDC48,KAR2,OLE1, and GOG5 cells we e g own in yeas ex ac -pep one-dex ose (YEPD)- ich medium o an OD 600 o 1.0 and subsequen ly sampled. DNA p obes o No he n expe imen s we e ob ained by PCR ampli ica ion using he ollowing pai s o p ime s: TCATTTC GATACTCGGCCTAG and GCAGCATCAGAGCTAGTTGTG o EGT2; AAACCACTTTTGGACGCCTC and TCTTGTCTCTCTTTGGAGCT o CDC48; TTCAACAGACTAAGCGCTGG and CAATTTCAATACGGGTGG ACA o KAR2; ATGCCAACTTCTGGAACTAC and CCGAAAGTAACAAT GGCAGT o OLE1; and TTGAAAACAGGTCATGCAGG and TGGGCTT GTTGCTTCTTTTG o GOG5. Recombina ion equencies we e calcula ed as he median o six independen cul u es as p e iously published (43). Mapping o MNase clea age si es. Yeas sphe oplas s and mic ococcal nucle- ase (MNase) diges ions we e pe o med acco ding o Fedo and Ko nbe g (19) wi h he modi ica ions o Cha´ ez e al. (13). Sphe oplas s p epa ed om mid-log phase cul u es ans o med wi h p416GAL1lacZ and g own in he app op ia e selec i e medium con aining 2% glucose o 2% galac ose we e lysed and imme- dia ely diges ed wi h 6.25 o 800 mU o MNase. Fo naked DNA con ols, genomic DNA was ex ac ed as p e iously desc ibed (28) and diges ed wi h 0.003 o 1.6 mU o MNase unde he same condi ions. MNase-clea ed genomic DNA was diges ed wi h ei he EcoRI ( o he en- dogenous GAL1 gene) o ClaI ( o he GAL::lacZ usion) and esol ed in 1.5% aga ose. As in e nal size ma ke s, we used genomic DNA diges ed wi h SacIo XbaI ( o he GAL1 p omo e used o lacZ). Fo he analysis o he endogenous GAL1 gene, he p obe used was he 196-bp GAL1 agmen loca ed immedia ely downs eam o he EcoRI si e and ob ained by PCR wi h he oligonucleo ides ATTCGACAGGTTATCAGCAAC and TTAAACTTCTTTGCGTCCATC. Fo he analysis o GAL1::lacZ he p obe used was he 202-bp lacZ agmen immedia ely ups eam o he ClaI si e and ob ained by PCR wi h he oligonu- cleo ides TCGTTGCTGCATAAACCG and TCGATAATTTCACCGCCG. Miscellaneous. Se ial dele ions o he PHO5::lacZ usion cons uc s we e cons uc ed using a double-s anded nes ed dele ion ki om Ame sham Pha - macia. Published me hods we e used o RNA and DNA hyb idiza ions (13, 44). RESULTS T ansc ip ion impai men h ough lacZ caused by hp 1⌬is no dependen on pa icula lacZ sequences bu on hei dis- ance om he p omo e . T ansc ip ion o he Esche ichia coli lacZ gene in S. ce e isiae is se e ely impai ed in hp 1 mu an s TABLE 1. Plasmids Plasmid Desc ip ion Sou ce o e e ence pRS416 YCp ec o based on he URA3 gene 54 p416GALI-lacZ pRS416 con aining he lacZ egion used o he GAL1 p omo e 35 pSCh202 pRS416 con aining he PHO5 egion used o he GAL1 p omo e 11 pSCh212 pSCh202 wi h lacZ ansc ip ionally used o he 3⬘end UTR a o PHO5 11 pRS314-L YCp ec o pRS314, based on he TRP1 gene and con aining wo 598-bp LEU2 in e nal agmen s epea ed in di ec o ien a ion, sepa a ed by a polylinke 43 pSCh211 pSCh212 wi h lacZ in opposi e o ien a ion This s udy pSCh211⌬17-1 pSCh202 wi h a ⬃0.4-kb agmen o he 3⬘end o lacZ used o he 3⬘end UTR o PHO5 This s udy pSCh229 pSCh202 wi h he i s 439 bp o lacZ ORF used o he 3⬘end UTR o PHO5 This s udy pSCh226 pSCh202 wi h he HpaI-BssHII 447-bp agmen o lacZ inse ed in he 3⬘end UTR o PHO5 This s udy pSCh251 pSCh202 wi h a 393-bp agmen o GAL1 ( om posi ion 843 o 1236 o he ORF) inse ed in he 3⬘end UTR o PHO5 This s udy pSCh215 pRS416 con aining a 439-bp agmen o he 5⬘end o lacZ used o he GAL1 p omo e This s udy pSCh213 pRS416 con aining he 447-bp HpaI-BssHII agmen o lacZ used o he GAL1 p omo e This s udy pSCh216 pRS416 con aining he 352-bp P uII-EcoRI agmen o lacZ used o he GAL1 p omo e This s udy pSCh218 pSCh202 con aining he i s 439-bp agmen o he 5⬘end o lacZ inse ed be ween he GAL1 p omo e and he PHO5 ORF This s udy pSCh219 pSCh202 con aining he 447-bp HpaI-BssHII agmen o lacZ inse ed be ween he GAL1 p omo e and he PHO5 ORF This s udy pSCh220 pSCh202 con aining he 352-bp P uII-EcoRI agmen o lacZ inse ed be ween he GAL1 p omo e and he PHO5 ORF This s udy pSCh221 pRS314-L con aining he i s 439 bp o lacZ ORF inse ed be ween he epea s This s udy pSCh222 pRS314-L con aining he 447-bp HpaI-BssHII agmen o lacZ inse ed be ween he epea s This s udy pSCh223 pRS314-L con aining he 352-bp P uII-EcoRI agmen o lacZ inse ed be ween he epea s This s udy pSCh205 pRS314-L con aining he en i e lacZ gene inse ed be ween he epea s 11 pSCh227 pRS416 con aining he 3.7-kbp EcoRV agmen o LYS2 used o he GAL1 p omo e This s udy pSCh230 pRS314-L con aining he 3.7-kbp EcoRV agmen o LYS2 inse ed be ween he epea s This s udy pSCh255 pRS416 con aining he en i e LAC4 coding egion used o he GAL1 p omo e This s udy pSCh254 pRS314-L con aining he en i e LAC4 coding egion inse ed be ween he epea s This s udy pSCh247 pRS416 con aining he en i e YAT1 coding egion used o he GAL1 p omo e This s udy pSCh248 pRS314-L con aining he en i e YAT1 coding egion inse ed be ween he epea s This s udy a UTR, un ansla ed egion. VOL. 21, 2001 Hp 1-DEPENDENT TRANSCRIPTION ELONGATION 7055 on July 4, 2017 by USE/BCTA.GEN UNIVERSITARIAh p://mcb.asm.o g/Downloaded om a he elonga ion le el. T ansc ip ion h ough PHO5 is no app eciably a ec ed in hp 1 cells, bu i becomes sensi i e o hp 1 when lacZ is used o PHO5 in a single ansc ip ion uni (11). In o de o ind ou which s uc u al elemen s o se- quence mo i s p esen in lacZ a e esponsible o his an- sc ip ional elonga ion impai men , we cons uc ed se ial dele- ions o he lacZ gene in he PHO5::lacZ ansc ip ional usion unde con ol o he GAL1- egula ed p omo e . The esul ing dele ions we e in oduced in o bo h wild- ype and hp 1 cells. Yeas ans o man s g own in galac ose-con aining medium we e hen assayed o acid phospha ase ac i i y. Exp ession was clea ly lowe in he ans o man s ha bo ing PHO5-lacZ usions han in hose con aining only PHO5, in bo h wild- ype and hp 1 cells (Fig. 1A). The p esence o a lacZ agmen as sho as 1 kb downs eam o PHO5 educed PHO5 exp ession o 40% in wild- ype cells. Howe e , he educ ion was consid- e ably s onge in hp 1, eaching ansc ip ion alues below 10% o hose o PHO5 alone (Fig. 1A). E en he sho es usion, encompassing ⬇0.4 kb o he 5⬘end o lacZ, showed educed le els o phospha ase ac i i y in he wild- ype (65%) and, o a g ea e deg ee, hp 1 (35%) cells (Fig. 1A). Se ial dele ions we e also made in a PHO5::lacZ usion ca ying lacZ in an opposi e o ien a ion. A simila p o ile o phospha ase ac i i ies was ob ained (Fig. 1B). Al hough all usions showed lowe exp ession le els han PHO5 alone, he nega i e ansc ip ional e ec was clea ly s onge in hp 1 han in wild- ype cells. A ⬇0.4-kb lacZ agmen , o example, was enough o educe he phospha ase ac i i y o unde 15% o he le el shown by PHO5 alone in hp 1 s ains (Fig. 1B). Thus, he wo end agmen s o lacZ we e able o impai ansc ip ion in hp 1 cells. The p e ious esul s sugges ha he e is no a pa icula lacZ sequence esponsible o he ansc ip ional elonga ion impai men caused by hp 1⌬. On he con a y, ansc ip ional impai men could occu h ough any lacZ egion. To con i m his and o show ha he nega i e e ec o hp 1⌬on acid phospha ase exp ession eally akes place a he ansc ip ional a he han pos ansc ip ional le el, we pe o med No he n analyses o selec ed PHO5::lacZ- agmen cons uc s. We in- se ed h ee di e en ⬇0.4-kb agmen s o lacZ co esponding o he wo ends and he cen e o he gene (plasmids pSCh229, pSCh226, and pSCh251; Table 1) immedia ely downs eam o aPHO5 gene unde GAL1 con ol. Galac ose-induced an- sc ip ion o he esul ing usion cons uc s was analyzed in wild- ype and hp 1 cells. The esul s shown in Fig. 2 indica e a subs an ial dec ease in he accumula ion o ull-leng h mRNA o he h ee usion cons uc s in hp 1 cells (13 o 25% o he wild- ype le els), whe eas only a mino e ec was obse ed wi h PHO5 alone. In addi ion o he ull-leng h PHO5-lacZ mRNA, a sho e ansc ip exhibi ing he same size as PHO5 was de ec ed in hp 1. The p esence o his sho e ansc ip sugges s ha hp 1 cells ansc ibe poo ly h ough lacZ se- quences,downs eam o he PHO5 open eading ame (ORF). The same esul s we e ob ained when he lacZ agmen s we e loca ed in he opposi e o ien a ion (da a no shown). To con- i m ha his phenomenon was due o lacZ i sel and no o he 3⬘end o PHO5, we eplaced he lacZ segmen wi h a 416-bp agmen o he 5⬘end o GAL1, a gene whose exp ession is no a ec ed in hp 1 cells (67) (see Fig. 9A). No he n analysis o he esul ing PHO5::GAL1⌬ usion was ca ied ou in wild- ype and hp 1 cells (Fig. 2). A weake educ ion in accumula- ion o ull-leng h mRNA was measu ed in hp 1 (60% o wild- ype le els), and no sho ansc ip was de ec ed. This con i ms ha he ansc ip ional de ec s o he PHO5-lacZ usion cons uc s we e mainly due o he p esence o lacZ agmen s in he ansc ip ion uni s. Al oge he , hese esul s sugges ha he longe dis ance be ween he p omo e and lacZ sequences he g ea e he ansc ip ional elonga ion impai men . To es his possibili y, we inse ed ups eam o PHO5 he same h ee lacZ agmen s FIG. 1. Exp ession pa e ns o se ial dele ions o GAL1p ::PHO5-lacZ usion cons uc s. Acid phospha ase ac i i ies unde induced condi ions o wild- ype (W303-1A) and hp 1 (U768-4C) s ains ans o med wi h lacZ-dele ed a ian s o plasmids pSCh212 (A) o pSCh211 (B) ha con ain he en i e lacZ coding sequence used o PHO5 in he same and opposi e o ien a ions, espec i ely, unde he GAL1 p omo e . The a e age alue and s anda d de ia ion o ou di e en ans o man s is shown o each s ain. Ve ical lines ac oss he lacZ sequences indica e he end poin s o he dele ion cons uc s analyzed. 7056 CHA ´VEZ ET AL. MOL.CELL.BIOL. on July 4, 2017 by USE/BCTA.GEN UNIVERSITARIAh p://mcb.asm.o g/Downloaded om used p e iously. The esul ing ansc ip ional usions exhibi ed simila ansc ip ion le els and pa e ns in wild- ype and hp 1 cells (Fig. 3). The e o e, he dis ance be ween lacZ and he p omo e can modula e he nega i e e ec o he lacZ ag- men s on ansc ip ion in hp 1 cells. T ansc ip ion h ough long DNA sequences is nega i ely a ec ed by hp 1⌬.The da a shown in Fig. 1 indica e ha he longe he cons uc s con aining lacZ agmen s a e, he lowe he ansc ip ional yield exhibi ed in bo h wild- ype and hp 1 cells. To e alua e he in luence o ansc ip leng h on he ansc ip ional e ec o hp 1, we pu he same h ee abo e- men ioned lacZ agmen s immedia ely downs eam o he GAL1 p omo e . The kine ics o accumula ion o hese h ee sho lacZ agmen s was iden ical in wild- ype and hp 1 cells (Fig. 4A). Full-leng h mRNA accumula ed sho ly a e induc- ion in bo h s ains and a simila le els in all h ee cons uc s, in con as wi h he clea di e ence be ween he wild ype and hp 1 shown by he en i e lacZ (Fig. 4A). The same esul s we e ob ained when he lacZ agmen s we e cloned in he opposi e o ien a ion (da a no shown). These esul s s ongly sugges ha sho ansc ip ion uni s a e no impai ed by hp 1, e en i hey con ain DNA agmen s ha hinde ansc ip ion in a di e en con ex . We ha e p e iously shown ha in hp 1 and o he mu an s a ec ed in he THO complex, he abili y o a gi en DNA segmen , like lacZ, o impai ansc ip ional elonga ion co e- la es wi h hype ecombina ion o a di ec - epea sys em con- aining ha segmen . This hype ecombina ion is ansc ip ion dependen (11, 42, 44). We es ed, he e o e, he ecombina- ion equency o di ec - epea sys ems con aining ei he one o he h ee lacZ agmen s used in he p e ious expe imen s lanked by wo leu2 epea s. In ag eemen wi h he absence o e ec o he hp 1 mu a ion on ansc ip ion o such lacZ ag- men s, we did no de ec a signi ican s imula ion o ecombi- na ion when he agmen s we e loca ed be ween he leu2 epea s (Fig. 4B). Again, in his case he e was a clea di e - ence be ween he sho lacZ agmen s and he en i e lacZ, which s imula es ecombina ion be ween di ec epea s up o 200- old in hp 1 cells (11) (Fig. 4B). The p e ious esul s sugges ha ansc ip leng h is an impo an ea u e in de e mining he equi emen o Hp 1 in ansc ip ion. To con i m his, we cons uc ed compa able ansc ip ion and ecombina ion sys ems con aining only yeas long DNA sequences. We andomly chose a agmen om a long yeas ORF, a 3.7-kb agmen o he S. ce e isiae LYS2 gene. We ei he used i o he GAL1 p omo e o inse ed i FIG. 2. T ansc ip ion analysis o GAL1p ::PHO5, h ee di e en GAL1p ::PHO5-lacZ usion cons uc s, and a GAL1p ::PHO5-GAL1 usion in wild- ype (W303-1A) and hp 1 (U768-4C) cells. (A) No he n blo analyses o PHO5-con aining mRNAs d i en om he GAL1 p omo e . Plasmids used we e pSCh229, pSCh226, and pSCh211⌬17-1 (ca ying ⬇0.4 kb o he 5⬘end, middle pa , and 3⬘end o lacZ used o PHO5, espec i ely), pSCh202 (ca ying he PHO5 gene), o pSCh251 (ca ying ⬇0.4 kb o he 5⬘end o GAL1 used o PHO5). Mid-log phase cells we e cul u ed in 3% glyce ol–2% lac a e syn he ic comple e (SC)-U a medium and dilu ed in o iden ical esh media o an OD 600 o 0.3 and incuba ed o 16 h. Galac ose (Gal) was hen added and samples we e aken o No he n analysis a di e en imes, as speci ied. A 0.9-kb EcoRV PHO5 in e nal agmen and a 589-bp 28S DNA in e nal agmen ob ained by PCR ( RNA) we e used as DNA p obes. (B) Kine ics o induc ion o mRNAs as de e mined by quan i ica ion o No he n blo s in a Fuji FLA3000. The mRNA alues a e gi en in a bi a y uni s (A.U.) wi h espec s o RNA le els. Fo any gi en cons uc , RNA le els a e ela ed o he wild- ype (w ) le els a 90 min, which was se a 100 o each panel. VOL. 21, 2001 Hp 1-DEPENDENT TRANSCRIPTION ELONGATION 7057 on July 4, 2017 by USE/BCTA.GEN UNIVERSITARIAh p://mcb.asm.o g/Downloaded om be ween he leu2 epea s o ansc ip ional and ecombina- ional analyses, espec i ely. The new cons uc s we e in o- duced in wild- ype and hp 1 cells (Fig. 5). Full-leng h mRNA om he GAL1p ::LYS2 ansc ip ional usion accumula ed sho ly a e ans e ing wild- ype cells o galac ose. Howe e , only a smea o incomple e ansc ip was de ec ed in simila No he n expe imen s pe o med wi h hp 1 samples (Fig. 5A), a e y simila pa e n o ha ob ained o he en i e 3-kb-long lacZ in hp 1 (11) (Fig. 4A). As expec ed o a DNA sequence ha canno be p ope ly ansc ibed in hp 1 cells, LYS2 p o- mo ed a s ong hype ecombina ion in hp 1 when loca ed be ween leu2 epea s (L-LYS2 sys em). The ecombina ion equency eached in hp 1 (5%) is 60 imes highe han he wild- ype le els, bu s ill 3- o 10- old lowe han ha o anal- ogous sys ems con aining lacZ (11) (Fig. 4B). This esul sup- po s ou hypo hesis o he in luence o ansc ip leng h on hp 1 sensi i i y o ansc ip ion. I he con ibu ion o Hp 1 o he accumula ion o long ansc ip s ini ia ing a he GAL1 p omo e is no es ic ed o he a i icial cons uc ha we ha e analyzed, we should expec he genome-wide e ec o hp 1 o be mo e d ama ic on long genes han on sho ones in highly exp essed genes. To es his idea we analyzed he e ec o hp 1⌬on ansc ip ion o i e endogenous ch omosomal genes wi h sizes anging om 0.5 o 3.1 kb. They we e selec ed because hey ha e high and com- pa able exp ession le els in YEPD- ich medium in wild- ype cells (be ween 10 and 14 mRNAs pe cell, acco ding o Hol- s ege e al. [24]). The longes genes, EGT2,CDC48, and KAR2, showed signi ican ly lowe exp ession le els in hp 1 han in he wild ype. The sho es ones, OLE1 and GOG5, exhibi ed e en highe exp ession le els in hp 1 han in he wild ype (Fig. 6). As we a e no con olling ansc ip ion, such as wi h he eg- ula able GAL1 p omo e in hese expe imen s, we canno ex- clude he possibili y ha such highe exp ession le els a e an indi ec e ec o hp 1. The co ela ion be ween ansc ip size and he hp 1:wild- ype ansc ip a io is no pe ec . This may e lec he ac s ha (i) each ORF is unde he con ol o a di e en p omo e , (ii) he ORFs a e in di e en ch omosomal loca ions, and (iii) he di e en DNA sequence con ex o each gene may a ec i s ansc ip ion pa e n. These esul s a e consis en wi h ansc ip leng h being a leas one ea u e pa ially esponsible o impai ing ansc ip ion d i en om s ong p omo e s in hp 1 cells. T ansc ip ion o GⴙC- ich DNA sequences is se e ely im- pai ed by hp 1⌬.Al hough he leng h o a gene is an impo an ea u e in luencing he sensi i i y o i s ansc ip ion o he hp 1 mu a ion, he e a e se e al pieces o e idence indica ing ha i canno be he only ea u e. Fi s , eplacemen o he lacZ agmen s by GAL1 in he PHO5 ansc ip ional usion cons uc s la gely supp essed he hp 1 e ec (Fig. 2). In addi- ion, he wo se s o PHO5 usions ha we cons uc ed, in which lacZ agmen s we e loca ed ei he a he 3⬘o he 5⬘ end, sha e he same leng h bu beha e di e en ly in hp 1 cells. Finally, al hough bo h lacZ and LYS2 a e hype ecombino- genic when lanked by di ec epea s, lacZ is signi ican ly mo e ecombinogenic han LYS2 (Fig. 3B and 4B). The e o e, we decided o explo e o he ea u es o lacZ, he mos hp 1-sen- si i e sequence de ec ed so a , in o de o iden i y addi ional elemen s in luencing ansc ip ional impai men by hp 1. The mos e iden di e ence be ween lacZ and he bulk o S. ce e isiae genes is he G⫹C con en . The majo i y o yeas genes show a G⫹C con en o a ound 40%, whe eas ha o lacZ is 56.2%. In o de o in es iga e whe he he G⫹C con- en in luences he ansc ip ional impai men o lacZ in hp 1 cells, we used he Kluy e omyces lac is LAC4 gene, a yeas ho- mologue o lacZ wi h 40% G⫹C (1). We placed LAC4 unde GAL1 con ol, c ea ing a GAL1p ::LAC4 usion simila o hose p e iously used in his wo k. T ans o man s o wild- ype and hp 1 isogenic s ains we e used o de e mine he kine ics o accumula ion o mRNA. The esul s p esen ed in Fig. 7A show ha accumula ion o LAC4 ull-leng h mRNA was only mod- e a ely diminished in hp 1 cells (50% o he wild- ype le el a e 90 min o induc ion). None heless, in he same back- g ound and a e an iden ical induc ion ime, lacZ ull-leng h mRNA was almos absen (Fig. 4A) (11). The o e all compa - ison o LAC4 and lacZ ansc ip ional beha io s showed ha ansc ip ion h ough LAC4 was a leas i e old mo e e icien han ha h ough lacZ in hp 1 cells. Thus, wo ansc ip ion uni s, iden ical in leng h and di e ing in G⫹C con en , we e di e en ially a ec ed by hp 1. This indica es ha , in addi ion o ansc ip leng h, he G⫹C con en o a DNA sequence may be an impo an ea u e in luencing ansc ip ional impai men by hp 1. To de e mine he e ec o LAC4 in ecombina ion, we placed he en i e LAC4 ORF be ween he leu2 di ec epea s. FIG. 3. T ansc ip ion analysis o h ee di e en GAL1p ::lacZ⌬- PHO5 usion cons uc s in wild- ype (W303-1A) and hp 1 (U768-4C) cells. (A) No he n blo analyses o PHO5-con aining mRNAs d i en om he GAL1 p omo e . Plasmids used we e pSCh218, pSCh220, and pSCh219 (ca ying ⬇0.4 kb o he 5⬘end, middle pa , and 3⬘end o lacZ used o PHO5, espec i ely). As a con ol we used pSCh202 (ca ying he PHO5 gene; da a no shown), which ga e iden ical esul s as hose shown in Fig. 2. The ansc ip le els o each cons uc wi h espec o PHO5 we e simila o hose o he wild ype shown in Fig. 2. O he de ails we e as desc ibed o Fig. 2. (B) Quan i ica ion o No h- e n analyses. 7058 CHA ´VEZ ET AL. MOL.CELL.BIOL. on July 4, 2017 by USE/BCTA.GEN UNIVERSITARIAh p://mcb.asm.o g/Downloaded om The esul ing L-LAC4 sys em exhibi ed a high equency o ecombina ion in hp 1 cells (90- old abo e wild- ype le els [Fig. 7B]). This equency was eigh old lowe han ha shown by L-lacZ bu was compa able o he equency eached by L-LYS2 (Fig. 3B and 4B). An inc ease in ansc ip ion e i- ciency is accompanied he e o e by a lowe ecombina ion equency. I is impo an ha he L-LAC4 sys em shows a hype ecombina ion pheno ype, because he size o he ull ansc ip in his sys em is app oxima ely 5 kb. Indeed, and consis en wi h ou hypo hesis, we ha e shown by No he n analysis (Fig. 7C) ha ansc ip ion o he L-LAC4 sys em is impai ed in hp 1 cells. To u he in es iga e he in luence o G⫹C con en on ansc ip ion o a DNA sequence, ega dless o whe he com- ing om bac e ia o yeas , we decided o analyze a yeas gene wi h a G⫹C con en compa able o ha o lacZ. YAT1, a 2-kb long ORF, is he gene in he S. ce e isiae genome wi h he highes G⫹C con en (58%). We placed YAT1 unde GAL1 con ol in a ansc ip ional sys em simila o hose used in he p e ious expe imen s. No he n analysis showed ha high le - els o YAT1 ull-leng h mRNA we e eached a e galac ose induc ion in he wild ype, bu only a minimal accumula ion was de ec ed in hp 1 cells (Fig. 8A). In ag eemen wi h his ansc ip ional impai men , a ecombina ion sys em bea ing YAT1 as in e ening sequence (L-YAT1) displayed an ex- emely high equency o ecombina ion in hp 1 (12%) ha was 173 imes he equency eached in he wild ype (Fig. 8B). FIG. 4. T ansc ip ion and ecombina ion analyses o se e al GAL1p ::lacZ usion cons uc s in wild- ype (W303-1A) and hp 1 (U768-4C) cells. (A) No he n analyses o lacZ-con aining mRNAs ansc ibed om he GAL1 p omo e . Plasmids used we e pSCh215, pSCh213, and pSCh216 (ca ying ⬇0.4 kb o he 5⬘end, middle pa , and 3⬘end o lacZ, espec i ely) o p416GAL1-lacZ (ca ying he en i e lacZ ORF). O he de ails we e as desc ibed o Fig. 2. (B) Recombina ion equencies o leu2-based di ec - epea sys ems con aining he same sho lacZ agmen s used in he p e ious No he n expe imen s. Plasmids used we e pSCh221, pSCh222, and pSCh223 (ca ying ⬇0.4 kb o he 5⬘end, middle pa , and 3⬘ end o lacZ, espec i ely) o pSCh205 (ca ying he en i e lacZ ORF). A schema ic diag am o he ecombina ion p oduc s ob ained wi h he di ec - epea LEU2 ecombina ion sys ems used is shown a he op o panel B. The LEU2 p omo e (P m) and ansc ip ional e mina o (Te ) as well as he RNA (a ow) p oduced by he sys em a e indica ed. The median ecombina ion equency o six independen alues is gi en in each case. All median equencies we e calcula ed in duplica e wi h wo independen ans o man s. Recombinan s we e selec ed in SC-Leu-T p. Da a om he L-lacZ sys em con aining he en i e lacZ gene (bo om) a e aken om Cha´ ez and Aguile a (11). FIG. 5. T ansc ip ion and ecombina ion analyses o LYS2 se- quences in wild- ype and hp 1 cells. (A) No he n blo analyses o LYS2 mRNAs in s ains ans o med wi h plasmid pSCh227 con aining a 3.7-kb agmen o he LYS2 coding sequence unde he con ol o he GAL1 p omo e . (B) Recombina ion equencies o s ains ans- o med wi h plasmid pSCh230 ha bo ing a leu2-based di ec epea sys em con aining as in e ening sequence he same 3.7 kb agmen o LYS2 used o he ansc ip ion assays. O he de ails a e as desc ibed o Fig. 4. VOL. 21, 2001 Hp 1-DEPENDENT TRANSCRIPTION ELONGATION 7059 on July 4, 2017 by USE/BCTA.GEN UNIVERSITARIAh p://mcb.asm.o g/Downloaded om This le el o hype ecombina ion is compa able o ha o L-lacZ (Fig. 4B) and highe han he le els o L-LYS2 (Fig. 5B) and L-LAC4 (Fig. 7B). Thus, ansc ip ion h ough a medium- size G⫹C- ich gene is clea ly hp 1 sensi i e, indica ing ha G⫹C con en can modula e he Hp 1 dependency o gene ansc ip ion. Nucleosome posi ioning is lacking in lacZ sequences. The o ganiza ion o DNA in a p ope nucleosome-posi ioned ch o- ma in s uc u e has been shown o be a o ed by A⫹T- ich mo i s (27) and p e en ed by G⫹C- ich sequences (62). In o de o es whe he he e is a ela ionship be ween ch oma in s uc u e and ansc ip ional e iciency in hp 1 cells, we de e - mined whe he he ch oma in s uc u e o G⫹C- ich se- quences such as lacZ was di e en om ha o low-G⫹C- con en sequences. We pe o med MNase sensi i i y assays o he GAL1p ::lacZ usion cons uc and he GAL1 endogenous genes, in which ansc ip ion was s ongly and poo ly impai ed in hp 1 cells, espec i ely (11, 17, 67) (Fig. 9A). As p e iously shown (19), clea and speci ic nucleosome posi ioning along he endogenous GAL1 gene was obse ed (Fig. 9B). Such a pa e n o MNase sensi i i y was iden ical o bo h wild- ype and hp 1⌬cells. The mo e di use pa e n o MNase diges ion unde induced condi ions in bo h wild- ype and hp 1 cells e- lec s he des abiliza ion o ch oma in s uc u e caused by an- sc ip ion (9). In e es ingly, he pa e n o MNase sensi i i y o lacZ shows no nucleosome o ganiza ion in ei he wild- ype o hp 1⌬cells unde bo h induced and ep essed condi ions o ansc ip ion. Nucleosome posi ioning is only limi ed o he GAL1 p omo e (Fig. 9C). Indeed, a lack o nucleosome po- si ioning is also obse ed o e he bac e ial sequences up- s eam o he GAL1 p omo e , h ough which ansc ip ion has also been shown o be impai ed in hp 1 mu an s (44). Ou esul s, he e o e, show ha lacZ adop s a andom nucleoso- mal o ganiza ion in yeas and ha hp 1 has no e ec on nu- cleosome posi ioning. DISCUSSION In his wo k we ha e in es iga ed why ansc ip ion o DNA sequences like E. coli lacZ is especially sensi i e o hp 1.We ha e shown ha 0.4-kb lacZ agmen s used o PHO5 unde he GAL1 p omo e a e su icien o inc ease he Hp 1 depen- dency o ansc ip ion, bu no when hey a e ansc ibed alone. Such an e ec is posi ion dependen : he longe he dis ance be ween he lacZ sequence and he GAL1 p omo e , he s onge he impai men o ansc ip ion caused by hp 1. In addi ion, we see ansc ip ion o long yeas DNA sequences like LYS2 used o he GAL1 p omo e is nega i ely a ec ed by hp 1. We ha e also shown ha ansc ip ion o K. lac is LAC4, a euka yo ic homologue o lacZ ha is equal in leng h bu wi h a much lowe G⫹C con en , exhibi s a milde Hp 1 depen- dency in S. ce e isiae, whe eas YAT1,anS. ce e isiae G⫹C- ich gene sho e han lacZ, is d ama ically a ec ed by hp 1. Taken FIG. 6. T ansc ip ion analyses o i e yeas endogenous genes, EGT2,CDC48,KAR2,OLE1, and GOG5, ha ing high le els o ex- p ession and di e en ansc ip sizes, in wild- ype and hp 1 cells. To al RNA was isola ed om mid-log phase cells, g own in YEPD b o h, and used o No he n analyses. In e nal agmen s o each gene and o he 23S DNA, ob ained by PCR, we e used as DNA p obes. The hp 1:wild- ype ansc ip a io was ob ained om he mRNA le els ha we e quan i ied in a Fuji FLA3000 and no malized wi h espec o he RNA le els. FIG. 7. T ansc ip ion and ecombina ion analyses o LAC4 in wild- ype and hp 1 cells. (A) No he n analyses o LAC4 mRNAs in s ains ans o med wi h he plasmid pSCh255, which con ains he en i e LAC4 coding sequence unde he con ol o he GAL1 p omo e . (B) Recombina ion equencies o cells ans o med wi h plasmid pSCh254, which ha bo s he leu2-based di ec - epea L-LAC4 cons uc con ain- ing LAC4 as he in e ening egion. (C) No he n analyses o he L-LAC4 epea cons uc in wild- ype and hp 1 cells. O he de ails a e as desc ibed o Fig. 4. 7060 CHA ´VEZ ET AL. MOL.CELL.BIOL. on July 4, 2017 by USE/BCTA.GEN UNIVERSITARIAh p://mcb.asm.o g/Downloaded om oge he , hese esul s indica e ha bo h leng h and G⫹C con en a e impo an elemen s in luencing gene ansc ip ion in i o and ha Hp 1 is an impo an ac o con olling an- sc ip ion o ei he long o G⫹C- ich DNA sequences used o a s ong p omo e such as GAL1p . Hp 1 is equi ed o p ope ansc ip ion o long DNA sequences. We ha e shown ha ansc ip ion o long DNA sequences is comp omised in hp 1 cells, whe eas sho e se- quences a e ei he una ec ed o mildly in luenced. This con- clusion is suppo ed by he inapp eciable e ec o hp 1 on ansc ip ion o sho lacZ agmen s di ec ly used o he GAL1 p omo e , whe he o no ups eam o PHO5, whe eas he same lacZ agmen s do con e hp 1 dependency when used downs eam o PHO5 (Fig. 2 and 3). This conclusion is also suppo ed by he ma ked nega i e e ec o hp 1 on an- sc ip ion o he 3.7-kb-long LYS2 agmen unde con ol o he GAL1 p omo e (Fig. 5). The ansc ip ional analysis o i e highly ansc ibed ch omosomal genes showed a nega i e e ec o hp 1 on ansc ip ion o he h ee longes ones, EGT2 (3.3 kb), CDC48 (2.7 kb), and KAR2 (2.1 kb), bu no nega i e e ec on he o he wo, OLE1 (1.6 kb) and GOG5 (1.1 kb) (Fig. 6). Fu he expe imen s would be equi ed o know whe he hese esul s a e also alid o poo ly exp essed genes. P ocessi i y de ec s o an RNA polyme ase can be mo e easily de ec ed wi h ansc ip ion o long a he han sho DNA empla es. Compa ison be ween long and sho an- sc ip s is in ac a common me hod o quan i y he e ec o ansc ip ion ac o s on RNAPII-media ed elonga ion (66). Consequen ly, a leng h-dependency e ec o hp 1 on ansc ip- ion is expec ed i Hp 1 con ols elonga ion. The longe he ansc ip ion uni , he highe he p obabili y o RNAPII each- ing a DNA egion equi ing he unc ion o Hp 1. E en in he wild- ype s ain, long ansc ip ion uni s a e less e icien ly exp essed han sho ones, as we ha e obse ed by compa ing FIG. 8. T ansc ip ion and ecombina ion analyses o YAT1 in wild- ype and hp 1 cells. (A) No he n blo analyses o YAT1 mRNAs in cells ans o med wi h plasmid pSCh247 con aining he en i e YAT1 coding sequence unde he con ol o he GAL1 p omo e . (B) Re- combina ion analyses o cells ans o med wi h plasmid pSCh248, which ha bo s he leu2-based di ec - epea sys em con aining he en- i e YAT1 gene as in e ening sequence. O he de ails a e as desc ibed o Fig. 4. FIG. 9. MNase diges ion pa e n o he GAL1 gene and he GAL1p ::lacZ usion in wild- ype and hp 1 s ains unde ep ession and ac i a ion condi ions. (A) No he n blo analysis o GAL1 mRNAs. (B) Nucleosome posi ioning o e he GAL1 gene. (C) MNase diges ion pa e n o he GAL1p ::lacZ usion. A scheme o he analyzed egions o GAL1 and lacZ indica ing he posi ion o nucleosomes and he mos ele an egula o y elemen s is shown. As e isks indica e he MNase hy- pe sensi i e si es associa ed wi h he ac i a ion o ansc ip ion o GAL1. VOL. 21, 2001 Hp 1-DEPENDENT TRANSCRIPTION ELONGATION 7061 on July 4, 2017 by USE/BCTA.GEN UNIVERSITARIAh p://mcb.asm.o g/Downloaded om he exp ession le els o se e al PHO5::lacZ usion cons uc s ha di e in he size o he lacZ agmen (Fig. 1). Thus, i is possible ha he absence o Hp 1 enhances elonga ion de ec s al eady p esen in he wild ype, he occu ence o such de ec s being mo e likely as he DNA sequence o be ansc ibed becomes longe . T ansc ip ion o GⴙC- ich DNA sequences is Hp 1 depen- den . Ou esul s suppo a co ela ion be ween G⫹C con en and HPR1 unc ion. This conclusion is based on h ee se s o da a. Fi s , al hough mos es ed genes a e ei he sligh ly o no a ec ed by hp 1 (Fig. 7) (11, 67), ansc ip ion o lacZ (56% G⫹C) in Saccha omyces is s ongly a ec ed and di ec - epea sys ems con aining lacZ sequences ha a e ansc ibed exhibi hype ecombina ion in hp 1 cells (11). Second, ansc ip ion o LAC4, a 40% G⫹C- ich lacZ o hologue o K. lac is, is a leas i e imes mo e e icien han lacZ in hp 1 cells (Fig. 7A), and di ec epea s lanking LAC4 ecombine a equencies eigh - old lowe han hose con aining lacZ (Fig. 7B). Finally, YAT1, a 2-kb-long gene om Saccha omyces wi h a 58% G⫹C con- en , is s ongly a ec ed by hp 1 bo h in ansc ip ion and in ecombina ion (Fig. 8). As a as we know, nei he a di ec in luence o he G⫹C con en o he empla e on ansc ip ion elonga ion e iciency no he equi emen o auxilia y ac o s o ansc ip ion o G⫹C- ich genes has been desc ibed. The only sequence ea- u es ha ha e been shown o a ec elonga ion a e hose o speci ic ansc ip ional pausing si es (59). Some pause si es iden i ied in bac e ia a e G⫹C ich, like he ops signals in E. coli (4), bu o he s a e no . I is, he e o e, unlikely ha G⫹C- ich genes exhibi , in gene al, a highe p obabili y o con aining a pause signal. None heless, a high G⫹C con en migh a ec ansc ip ional elonga ion by s abilizing seconda y s uc u es in he nascen RNA ha can unc ion as pausing signals. A leas in he case o T7 phage, a lowe numbe o hyd ogen bonds in he RNA hai pins elimina es some pauses (32), sugges ing ha a high G⫹C con en migh con ibu e o s onge RNA-media ed elonga ion impai men s. AG⫹C- ich nascen RNA migh also o m mo e s able RNA-DNA hyb ids wi hin he empla e. Twel e-nucleo ide- long RNA-DNA hyb ids nega i ely a ec RNAPII p ocessi i y in i o (29). Ano he class o RNA-DNA hyb ids a e R-loops, p oduced by he associa ion o nascen mRNA wi h ups eam empla e DNA. I has been p oposed ha hese R-loops a e o med du ing ansc ip ion o he G⫹C- ich human immuno- globulin swi ch egion in i o (15), and hey ha e been de- ec ed a e in i o ansc ip ion (58). The clea age o R-loops by speci ic nucleases migh ini ia e class-swi ch ecombina ion (58), p o iding a mechanism o explain ansc ip ion-associ- a ed ecombina ion. No hing is known abou he in luence o RNA-DNA s uc u es on RNAPII-dependen ansc ip ion (20). Howe e , i has been p oposed ha R-loops o med du - ing RNA ansc ip ion elonga ion in E. coli cons i u e oad- blocks o he nex ansc ibing RNA polyme ase (25). Molecula ea u es making ansc ip ion elonga ion Hp 1 dependen . Unless Hp 1 plays mo e han one unc ion, we should expec a common mechanis ic equi emen du ing an- sc ip ion o long e sus G⫹C- ich genes equi ing i s ac ion. I is no e iden which kind o ansc ip ion-impai ing signal migh link long and G⫹C- ich DNA sequences. One possibili y would be he exis ence o sho e G⫹C- ich egions hinde ing ansc ip ion wi hin long genes. Howe e , we can exclude his possibili y wi h he esul s o his wo k. Conside ing a 300-bp- long window ( he minimal lacZ agmen con e ing an e ec o hp 1 in ansc ip ion), he maximum G⫹C con en is 46% o LYS2, 45.5% o LAC4, and 59% o lacZ. Sho e o longe windows show simila esul s. In addi ion, no di e ence in he G o C con en is ound on he cDNA s ands. As LYS2 is no mo e G⫹C- ich han LAC4, leng h is he mos likely eason he wo genes beha e di e en ly in hp 1 mu an s. Con- sis en ly, when LAC4 is loca ed be ween he leu2 epea s in he L-LAC4 cons uc , he ansc ip ion uni con aining LAC4 be- comes longe and ansc ip ion becomes signi ican ly a ec ed in hp 1 cells (Fig. 7). Al e na i ely, he link be ween long and G⫹C- ich se- quences migh be un ela ed o he DNA sequence i sel . T an- sc ip ion o long and G⫹C- ich sequences may p oduce some kind o ansc ip ional e en ha would be o e come by he ac ion o Hp 1. Gene ic analyses ha e p o ided some hin s as o he na u e o his kind o e en . Se e al mu an s ha e been desc ibed ha display syn he ic pheno ypes wi h hp 1 (2, 67). The ac ha opoisome ase mu an s ( op1, op2, and op3) become sick in an hp 1 backg ound may es ablish a link wi h DNA opology (2, 48). Fo example, he accumula ion o neg- a i e supe coiling impai s ansc ip ional elonga ion o bac e- ial genes in i o (30), and posi i e supe coiling diminishes RNAPII-dependen ansc ip ion in yeas cells. R-loops a e o med in he absence o DNA opoisome ase I in E. coli (16), and hey ha e been p oposed o impai ansc ip ion elonga- ion (25). Elonga ion by RNAPII al e s empla e opology (8), p oducing an accumula ion o posi i e and nega i e supe coil- ing ahead o and behind he RNAPII, espec i ely (33). I is, he e o e, expec ed ha posi i e supe coiling will be s onge a he 3⬘ egion o long ansc ip ion uni s. Examples o DNA sequences ha impai ansc ip ion elonga ion mo e e icien ly in dis al loca ions ha e been epo ed (63). The s ong e ec o hp 1 on ansc ip ion o long DNA sequences ag ees wi h his iew. Ch oma in s uc u e is ano he sou ce o s ess a ec ing RNAPII-media ed ansc ip ion elonga ion ha equi es he ac ion o speci ic auxilia y ac o s ( e iewed in e e ence 39). Some mu a ions esul ing in a poo g ow h pheno ype wi h hp 1 a e in ac ela ed o ch oma in s uc u e, like SIN1-2 o hose causing his one imbalance (67). The o ganiza ion o DNA in a p ope , nucleosome-posi ioned ch oma in s uc- u e is a o ed by some A⫹T- ich mo i s (27) and is p e en ed by some G⫹C- ich sequences (62). A G⫹C- ich sequence migh , he e o e, be biased agains a p ope ch oma in s uc- u e. The lacZ gene is in ac unable o suppo s ably o ganized ch oma in in S. ce e isiae (Fig. 9). T ansc ip ion o G⫹C- ich genes migh hen be impai ed in hp 1 due o an abe an ch oma in s uc u e. I hese hypo heses a e ue, he loca ion o a G⫹C- ich egion in he 3⬘ egion o a gene should p oduce a s onge e ec , since i would combine wo sou ces o ansc ip ional s ess in he same place: supe helici y and abe an ch oma in s uc u e. Indeed, nega i e supe coiling can induce changes o DNA s uc u e in CG sequences, wi h his al e ed s uc u e being able o p oduce ansc ip ional elonga ion blocks (41). Ou esul s wi h he PHO5::lacZ usion cons uc s suppo his iew, since he loca ion o he G⫹C- ich lacZ agmen s a he 7062 CHA ´VEZ ET AL. MOL.CELL.BIOL. on July 4, 2017 by USE/BCTA.GEN UNIVERSITARIAh p://mcb.asm.o g/Downloaded om