Analysis of expression of the argC and argD genes in the cyanobacterium Anabaena sp. strain PCC 7120.

Vol. 176, No. 20 JOURNAL OF BACTERIOLOGY, Oc . 1994, p. 6397-6401 0021-9193/94/$04.00+0 Copy igh © 1994, Ame ican Socie y o Mic obiology Analysis o Exp ession o he a gC and a gD Genes in he Cyanobac e ium Anabaena sp. S ain PCC 7120 BELEN FLORIANO, ANTONIA HERRERO, AND ENRIQUE FLORES* Ins i u o de Bioquimica Vege al y Fo osin esis, Uni e sidad de Se illa-Consejo Supe io de In es igaciones Scien i icas, E-41080 Se illa, Spain Recei ed 14 June 1994/Accep ed 8 Augus 1994 A cloned DNA agmen om Anabaena sp. s ain PCC 7120 ha complemen s an a ginine auxo ophic mu an om he same o ganism was ound o include an open eading ame encoding a 427- esidue polypep ide ha is homologous o N-ace ylo ni hine amino ans e ase om Bacillus sub ilis, Esche ichia coli, and Saccha omyces ce e isiae. The gene encoding N-ace ylo ni hine amino ans e ase in bac e ia has been named a gD. The exp ession o Anabaena sp. s ain PCC 7120 a gD, as well as o a gC, was analyzed a he mRNA le el. Bo h genes we e ansc ibed as monocis onic mRNAs, and hei exp ession was no a ec ed by exogenously added a ginine. P ime ex ension analysis iden i ied ansc ip ion s a poin s o bo h genes which we e p eceded by sequences simila o ha o he E. coli RNA polyme ase c 70 consensus p omo e . A second ansc ip ion s a poin o he a gD gene ha is no p eceded by a c 70 consensus p omo e was de ec ed in dini ogen-g own cul u es. The cyanobac e ia a e a pho o ophic g oup o eubac e ia cha ac e ized by hei abili y o ca y ou oxygenic pho osyn- hesis. Some ilamen ous cyanobac e ia a e able o ix molec- ula ni ogen wi hin specialized cells called he e ocys s which di e en ia e a semi egula in e als along he ilamen unde condi ions o ni ogen dep i a ion and ae obiosis (22). This de elopmen al p ocess has b ough much a en ion o he mechanisms modula ing gene exp ession in cyanobac e ia. The RNA polyme ase om he ege a i e cells o he he e ocys - o ming cyanobac e ium Anabaena sp. s ain PCC 7120 has been cha ac e ized and ound o con ain as he p incipal U ac o a subuni o 52 kDa (20). The sequence o he sigA gene encoding ha c ac o shows ha i s deduced polypep ide, SigA, esembles he p incipal o ac o s om Esche ichia coli and Bacillus sub ilis (2). The s ain PCC 7120 RNA polyme ase SigA is able o ecognize in i o p omo e sequences simila o hose ecognized by he E. coli RNA polyme ase u70 (19, 20). The ope a ion o his ype o p omo e in Anabaena sp. s ain PCC 7120 in i o has ecen ly been shown (7). The ansc ip- ional s a poin s ( sp) o only a ela i ely small numbe o genes in Anabaena spp. ha e been de e mined. Some o hose genes bea p omo e s which show some esemblance o he E. coli C70 consensus p omo e , bu o he s do no (19). In o de o ex end ou knowledge o he s uc u e o cyanobac e ial p o- mo e s, mo e genes, bo h cons i u i e and subjec ed o some kind o ansc ip ional egula ion, should be s udied. In his epo , we p esen he analysis o exp ession o wo genes ha u ned ou o be cons i u i ely exp essed in ege a i e cells o Anabaena sp. s ain PCC 7120. These a e he a gC and a gD genes in ol ed in he biosyn hesis o a ginine. Me hods. Anabaena sp. s ain PCC 7120 and i s de i a i e a ginine auxo ophic mu an s s ains CS335 and CS336 we e g own pho oau o ophically as desc ibed p e iously (9). Con- juga ion o s ain CS335 wi h s ains o E. coli ca ying plas- * Co esponding au ho . Mailing add ess: Ins i u o de Bioquimica Vege al y Fo osin esis, Uni e sidad de Se illa-C.S.I.C., Facul ad de Biologia, Apa ado 1113, E-41080 Se illa, Spain. Phone: 34-5-455.70. 86. Fax: 34-5-462.01.54. Elec onic mail add ess: [email p o ec ed]. P esen add ess: John Innes Ins i u e, Colney Lane, No wich NR4 7UH, Uni ed Kingdom. mids wi h cloned s ain PCC 7120 DNA was pe o med by he me hod o Wolk e al. (23) as desc ibed p e iously (9). The gene al subcloning s a egy used o he a gD gene was as p e iously desc ibed o he a gC gene (9). DNA manipula- ions and cons uc ion o plasmids o complemen a ion o s ain CS335 and o sequencing we e ca ied ou by s anda d p ocedu es (1, 17). Sequencing was ca ied ou by he me hod o Sange e al. (18) wi h exonuclease III-gene a ed dele ions o wi h he aid o syn he ic oligonucleo ides. The collec ion o E. coli a g mu an s ha was used o es complemen a ion by s ain PCC 7120 DNA has been epo ed be o e (9). To al DNA om s ain PCC 7120 was isola ed as desc ibed by Cai and Wolk (3). T ans e o elec opho e ically sepa a ed DNA agmen s o nylon memb anes (Hybond-N+ om Ame sham o GeneSc een Plus om DuPon ) and hyb idiza ion unde high-s ingency condi ions we e ca ied ou as ecommended by he memb ane manu ac u e s. RNA was isola ed om exponen ially g owing cul u es o Anabaena sp. s ain PCC 7120 as desc ibed by Golden e al. (10). A e elec opho esis, ans e o RNA o nylon memb anes (Hybond-N' om Ame sham o GeneSc een Plus om DuPon ) and hyb idiza- ion we e ca ied ou as ecommended by he memb ane manu ac u e s. P obes used in he Sou he n and No he n (RNA) blo analyses we e labelled wi h 32P by using a andom p imed DNA labeling ki (Boeh inge Mannheim) and [cL-32P] dCTP. The 5' ends o he a gC and a gD ansc ip s we e iden i ied by p ime ex ension (1) wi h a ian myeloblas osis i us e e se ansc ip ase (Boeh inge Mannheim). A o al o 50 ,g o RNA was used in each eac ion. The oligonucleo ides used as p ime s, which we e labelled wi h 32P by using polynu- cleo ide kinase and [,y-32P]dATP, a e desc ibed below. Iden i ica ion o he Anabaena sp. s ain PCC 7120 a gD gene. We ha e cloned p e iously by complemen a ion o s ain PCC 7120 a ginine auxo ophs wo genes in ol ed in he biosyn hesis o a ginine in Anabaena sp. s ain PCC 7120 (9). One o hose genes has been iden i ied as a gC encoding N-ace ylglu ama e semialdehyde dehyd ogenase (9). The iden- i ica ion o he second gene cloned is p esen ed he e. S a ing om cosmid pCSB335-2, which ca ies ca. 31 kb o s ain PCC 7120 DNA (Fig. 1A) and complemen s he a ginine auxo o- phic s ain CS335, we subcloned DNA agmen s ha comple- 6397 6398 NOTES A H S A R Bs R X E R I %'le I~~~ I I I I I a gD a gD B H C Hp I I l Hp P C a gC FIG. 1. Res ic ion maps o he genomic egions s ain PCC 7120 con aining he a gD (A) and a gC op map o panel A, only he wo HindIII si es expanded egion a e shown. Res ic ion endonuclea A,AccI; B, BglII; Bs, Bs XI; C, ClaI; E, EcoRI; H, H P, P uII; R, EcoRV; S, Spel; X, XbaI. men ed his auxo oph. Fo subcloning, agmen s om a pa ial diges ion o pCSB335-2 wi h Sau3AI we e liga ed o EB BamHI-diges ed posi i e selec ion ec o pRL178 (8). This ec o is bom + and he e o e can be ans e ed om E. coli o 3 kb Anabaena sp. s ain PCC 7120 by conjuga ion (23), hus pe mi ing he es ing o complemen a ion o he auxo ophic ecipien s ain by cloned DNA agmen s. (Howe e , pRL178 is unable o eplica e in cyanobac e ia; complemen a ion H he e o e elies upon ecombina ion be ween he cloned DNA agmen and he cyanobac e ial genome.) F om a comple- 0.5 kb men ing Sau3AI agmen , dele ions wi h exonuclease III we e gene a ed, and a agmen ha included mos o he 2.4-kb HindIII-EcoRV agmen shown in Fig. 1A and ha was able o complemen s ain CS335 was iden i ied. The sequence o 2,259 bp o DNA in his egion o he s ain PCC 7120 genome was de e mined. H Analysis o he sequenced segmen showed he p esence o U an open eading ame (ORF) o 1,284 nucleo ides s a ing 0.5 kb wi h a GTG codon. A pu a i e ibosome binding si e (AG GAGG) is ound 7 nucleo ides (n ) ups eam o he pu a i e o Anabaena sp. ansla ion s a si e (Fig. 2A). Downs eam o he s op codon, (B) genes. In he an in e ed epea ha is capable o o ming a s em-loop ha delim he s uc u e and ha bea s se e al T (U in mRNA) esidues in i s idIIbIb Hpa ipai 3' end is ound (Fig. 2A). The ee ene gy o o ma ion o his 'd s uc u e, which could ac as a ho-independen ansc ip ion e mina o , is -26.3 kcal/mol (-110.0 kJ/mol). The polypep- ide deduced om ha ORF consis s o 427 amino acids and A (5' egion) CCATATCTACGGTAGCTAAGGTAATAACTGTCATGTAAGCTGCATCTTCCCATGACCAACCCTCAAACAAAGCGATACCACAAAGTACCGAGAATTAATAC ~sp (BGli0) -35 ACCACCGAGAGCGATCGCCCCGGCCATTAACTCTTTTTGGATGCGTTGGTATTTCTGTTCAAGAGTT)AATACAAAATTATTTTCCACTATTGCCRCAGG -lo ap (BGll and BG11o) TTTGAGGATATATAATGTTAAG=CTCAAGAGAAAGTAAGAAACACAATAAATAAAAATTTATTTTTAAGAAACTCTAGGAAACTAGTAAGTAAGTATACAA RBS GTG AGC CTA CAA ACT CTC ATT GAG CAA WCC ACG AAC CCC CCA GAG TCA GGT TCT GCT Me se leu gin h leu ile glu gin ala h asn p o p o glu se gly se ala (3' egion) GAA ATC AAC ACC GCC TTA AAA TTA CTG GAA AAA GCA TTA GCA ACT GTG ACA GCG TAA ATCATAGACTGCTGGCAAAAATAGCG glu ile asn h ala leu lys leu leu glu lys ala leu ala h al h ala OCH B (5' egion) AAGCTTGTGTGTTTTCCATCTGTGAATAAAAATTTTATTTTTTATTGGGAAAATTGTCTGGGATTAGCATTAAGCACTCTATCATTTTTGTCCTATTGCCCT -35 -10 ap (BGll and BGl1O) TCGGATAATTTATTTTTTGGTGTTCCCTAAGGTAAATTCAGT&TACAAATGCTGAA&CCATT ATG AAT AAA CCG AAA ATT TTT ATT GAT RBS Me Asn Lys P o Lys Ile Phe Ile Asp GGG GAA GCG GGA ACT ACA GGC TTA CAG ATT TAC TCA CGC CTC AAC GAG CGA GAT GAT ATT GAG CTA GTT AGT ATT GCA Leu AsnGlu A g Asp Asp Ile Glu Leu Val Se Ile Ala Gly Glu Ala Gly Th Th Gly Leu Gln Ile Ty Se A g FIG. 2. Nucleo ide sequences o he 5' ends o he a gD (A) and a gC (B) genes o Anabaena sp. s ain PCC 7120, he egions ups eam o hese genes, he 3' end o he a gD gene, and he egion downs eam o his gene (A). Some pu a i e ansc ip ion s a poin s ( sp) ound wi h RNA isola ed om cul u es g own on BG11 and/o BG 10 medium a e indica ed (bold ace and unde lined). Pu a i e -35 and -10 p omo e sequences ound ups eam om he sps used in bo h BG11 and BG110 medium a e indica ed in bold ace. Pu a i e ibosome binding si es (RBS) a e unde lined. Wi hin he coding sequence o he genes, he segmen s complemen a y o he oligonucleo ides used o p ime ex ension analysis a e unde lined. In he egion downs eam o he 3' end o he a gD gene, sequences ha may be in ol ed in he o ma ion o a s em-loop s uc u e a e unde lined. AAAAAATATCCCAAATGTAGGGTGCGTCAGTGTGATATACCCTAACTATAGGCAGAAATTATTCATGCTGACGCAACCTACCCAACTACCAAACCATCGATT J. BA=-1RIOL. NOTES 6399 has a p edic ed molecula weigh o 46,110. A sea ch o p o eins wi h simila sequences in he a ailable da abases e ealed ha he deduced polypep ide had homology o nu- me ous amino ans e ases om e y di e se biological sou ces. The p o eins mos simila o he s ain PCC 7120 polypep ide we e he N-ace ylo ni hine amino ans e ase en- zymes om B. sub ilis (16), Saccha omyces ce e isiae (12), and E. coli (12). These p o eins a e o a size simila o ha o he deduced s ain PCC 7120 polypep ide and show iden i ies o 44% (B. sub ilis), 41% (S. ce e isiae), and 41% (E. coli) wi h ha polypep ide. The gene encoding N-ace ylo ni hine amino ans e - ase (EC 2.6.1.11) in bac e ia has been named a gD. The A gD p o ein ca alyzes he ans o ma ion o N-ace ylglu ama e semialdehyde in o N-ace ylo ni hine by means o a ansami- na ion. This is he ou h s ep in he pa hway o biosyn hesis o a ginine om glu ama e (4). The iden i ica ion o he se- quenced gene om Anabaena sp. s ain PCC 7120 as a gD is consis en wi h he pheno ype o mu an s ain CS335, which was able o g ow on o ni hine (which is syn hesized om N-ace ylo ni hine [4]) bu no on glu ama e (9). Amino ans- e ases ca alyze he e e sible ans e o amino g oups om amino acids o oxo acids by using py idoxal phospha e as a co ac o . Py idoxal phospha e in e ac s wi h he £-amino g oup o a Lys esidue o o m a Schi base. A sea ch o unc ional domains in s ain PCC 7120 A gD by using he p og am MOTIFS o he Gene ics Compu e G oup package (6) iden- i ied a pu a i e py idoxal phospha e binding si e in which Lys-277 would be in ol ed in Schi base o ma ion. The a gC and a gD genes a e no clus e ed in he genome o Anabaena sp. s ain PCC 7120. Sou he n blo analysis o o al DNA isola ed om s ain PCC 7120 diges ed wi h HindIII showed a single s ong hyb idiza ion band o abou 5 kb when he HindIII agmen ca ying he s ain PCC 7120 a gD gene (Fig. 1A) was used as a p obe and a single hyb idiza ion band o 2.6 kb when a p obe o he a gC gene ( he 1.6-kb ClaI agmen [Fig. 1B]) was used (da a no shown). An addi ional, sligh ly hyb idizing band o 2.6 kb ha migh co espond o sequences encoding ano he amino ans e ase was obse ed wi h he a gD p obe. I appea s, he e o e, ha a gC and a gD a e single-copy genes in Anabaena sp. s ain PCC 7120, which is consis en wi h he ac ha s ain PCC 7120 mu an s al e ed in hose genes ha e been eadily isola ed (9). No e idence o clus e ing o he a gC and a gD genes in he s ain PCC 7120 genome has been ound. Thus (i) none o he cosmids ca ying s ain PCC 7120 DNA ha we e able o complemen he a gC mu an (s ain CS336) was able o complemen he a gD mu an (s ain CS335) and, con e sely, he CS335-complemen ing cosmids we e unable o comple- men s ain CS336 (9); and (ii) no c oss-hyb idiza ion be ween pCSB335-2 and CS336-complemen ing cosmids was obse ed (no shown). This da a oge he wi h a compa ison o he es ic ion map o he inse o cosmid pCSB335-2 (Fig. 1A) wi h hose o he inse s o cosmids isola ed om comple- men ed exconjugan s o he a gC mu an (s ain CS336) (9) sugges ha he HindIII agmen s con aining he a gC and a gD genes a e a leas 9 kb apa in he genome o s ain PCC 7120. Wi h ega d o o he a ginine biosyn hesis (a g) genes, he DNA sequences lanking a gD ha we e de e mined (ca. 400 bp 5' o he gene and ca. 500 bp 3' o he gene) do no seem o encode any p o ein ela ed o a ginine biosyn hesis, and an ORF ha is ound 60 bp downs eam o a gC (accession numbe X65511 in he EMBI'GenBank/DDBJ nucleo ide sequence da a lib a ies) would code o a p oduc un ela ed o a ginine me abolism. (This ORF, o which only 178 codons we e sequenced, has 56% iden i y in an o e lap o 174 amino A 1.5 kb-p B 1.1 kb- + --M - - < ^: A T~ Lwo H,21 i AS , Q >P2-w M -7.4 -5.3 -2.8 -1.9 -1.6 -1.0 -0.6 -0.4 -0.3 -1.9 -1.6 1.0 -0.6 0.4 FIG. 3. No he n blo analysis o he exp ession o he a gD (A) and a gC (B) genes in Anabaena sp. s ain PCC 7120. To al RNA isola ed om cells g own in medium BG11 supplemen ed o no wi h 5 mM L-a ginine was used (25 pug in each lane). The posi ion and sizes (in kilobases) o some RNA molecula weigh s anda ds a e indica ed. acids wi h o389 o E. coli, an ORF which is loca ed be ween wo genes in ol ed in he biosyn hesis o en e obac e ial common an igen [5].) Addi ionally, in complemen a ion assays o a collec ion o s ains o E. coli mu a ed in di e en a ginine biosyn hesis genes, we did no obse e complemen a ion o any E. coli mu an by he a gD-ca ying cosmid pCSB335-2, whe eas he a gC-ca ying cosmid pCSB336-24 (9) was able o complemen only an E. coli a gC mu an (da a no shown). (In his s udy, no a gD mu an o E. coli was es ed because E. coli a gD mu an s a e leaky.) These esul s sugges ha in he genome o Anabaena sp. s ain PCC 7120, nei he a gC no a gD is lanked by o he a g genes. Analysis o a gC and a gD mRNAs. RNA was isola ed om cul u es o Anabaena sp. s ain PCC 7120 g own on BG11 medium supplemen ed o no wi h 5 mM L-a ginine, which is an amino acid ha is eadily aken up by cells o s ain PCC 7120 (13). No he n blo analysis was pe o med by using as a p obe an EcoRV agmen o 0.9 kb ha con ains he 3' egion o a gD (Fig. 1A) o an HpaI agmen o 0.6 kb in e nal o he a gC gene (Fig. 1B). Single hyb idizing RNAs o abou 1.5 kb (Fig. 3A) and 1.1 kb (Fig. 3B) we e obse ed wi h he a gD and a gC p obes, espec i ely. Because he a gD and a gC genes consis o 1,284 and 966 bp, espec i ely, bo h genes appea o be ansc ibed as monocis onic mRNAs. No di e ence be- ween he RNA p epa a ions isola ed om cul u es supple- men ed wi h a ginine and hose om cul u es no supple- VOL. 176, 1994 6400 NOTES men ed wi h a ginine was obse ed. In he case o he a gC mRNA, he lack o e ec o exogenously added 5 mM L- a ginine was co obo a ed by p ime ex ension analysis (da a no shown). The lack o ep ession o he a gC and a gD genes by a ginine is consis en wi h epo ed da a on he ac i i ies o a ginine biosyn hesis enzymes inAnabaena a iabilis and o he cyanobac e ia (15). The e o e, in he cyanobac e ia, he only egula o y mechanism ound o da e o ope a e o a ginine biosyn hesis is eedback inhibi ion o N-ace ylglu ama e phos- pho ans e ase (14), a egula o y mechanism ha is ypical in o ganisms ha , like he cyanobac e ia, exhibi he cyclic pa h- way o o ni hine syn hesis (4). P omo e s uc u e. The 5' endpoin s o mRNAs o he a gC and a gD genes in Anabaena sp. s ain PCC 7120 we e de e - mined by p ime ex ension analysis. The p ime s used a e depic ed in Fig. 2A and B o a gD and a gC, espec i ely. An ex ension p oduc ha can ep esen a ansc ip ion s a poin ( sp) was ound 103 bp ups eam om he s a o he a gD gene when RNA isola ed om cul u es g own in BG11 (in he p esence o ni a e) o BG110 (wi h no sou ce o combined ni ogen) was used (Fig. 4A; see also Fig. 2A). Wi h RNA isola ed om BG110-g own cul u es, an addi ional, la ge ex ension p oduc was obse ed (Fig. 4A; see also Fig. 2A). This ex ension p oduc could ep esen a sp loca ed 158 bp ups eam om he s a o he a gD gene, hough he possibil- i y ha i o igina ed om deg ada ion o a la ge RNA canno be uled ou . Wi h ega d o a gC, an ex ension p oduc ha can ep esen a sp was ound 20 bp ups eam om he s a o he gene (Fig. 4B; see also Fig. 2B). Simila esul s o p ime ex ension assays o a gC we e ob ained wi h RNA isola ed om cul u es g own in ei he BG11 o BG110 medium (Fig. 4B). Se e al 5' endpoin s co esponding o smalle RNAs a e no iceable o he eac ions shown in Fig. 4A and B. They could be due o pa ial RNA deg ada ion o incomple e ex ension o he p ime s. Ups eam om he pu a i e a gC sp and om he pu a i e main sp o a gD, sequences ha esemble he consensus sequence o p omo e s ecognized by he E. coli RNA poly- me ase u70 (TTGACA[16 o 18 n ]TATAAT[5 o 9 n ]- sp) a e ound. These sequences ead as ollows: 'lT lATT(18 n )TA AAAT(5 n )- sp (a gC) and TTGCCA(16 n )TAATGT(4 n )- sp (a gD) (Fig. 2). (O e lapping wi h he pu a i e -10 box o he a gD p omo e , he sequence TATAAT, which ep esen s a pe ec P ibnow box, is ound; howe e , his hexame is sepa a ed by only 14 n om he pu a i e -35 box o he p omo e .) The e o e, hese a gC and a gD p omo e s, which a e cons i u i e, may be ecognized by he Anabaena sp. s ain PCC 7120 RNA polyme ase ca ying he p incipal a ac o , SigA, which has been shown o ecognize p omo e s simila o he E. coli RNA polyme ase u 70 consensus p omo e (19). I is in e es ing ha an RNA species mo e abundan in dini ogen- ixing (BG110 medium) han in ni a e-g own (BG11 medium) cul u es o Anabaena sp. s ain PCC 7120 was de ec ed wi h he a gD p ime (Fig. 4A). We canno exclude ha a BG110-speci ic RNA can also exis o a gC, since he a gC mRNA was di icul o de ec and a low-abundance ex ension p oduc could ha e been unno iced. In s ain PCC 7120, some genes, e.g., sigA o glnA, ha e been shown o be ansc ibed om se e al p omo e s (2, 21). I is possible ha genes ha a e exp essed in bo h he e ocys s and ege a i e cells a e ansc ibed om di e en p omo e s in he wo cell ypes. Al hough a numbe o genes ha a e exp essed speci - ically in he e ocys s ha e been in es iga ed (e.g., ni ogen ixa ion genes), a consensus sequence o p omo e s unc ional in he e ocys s has no ye been de i ed. A ginine biosyn hesis laiT C T T C T C A A 4- C T T A T G C A A T T C A G T T C T 'c A - - T C 0 A T T A A G T C A s.. G 4-, B FIG. 4. Iden i ica ion o he 5' ends o heAnabaena sp. s ain PCC 7120 a gD (A) and a gC (B) ansc ip s. RNA p epa ed om cells g own on BG11 o BG110 medium was used in p ime ex ension expe imen s. The p ime -ex ended p oduc s we e coelec opho esed wi h a sequencing ladde gene a ed wi h he same oligonucleo ide p ime . The a ows on he igh o each panel indica e he posi ions o pu a i e sps. The nucleo ide sequences a ound hese pu a i e sps a e also p esen ed (no e ha he sequence o he s ands complemen a y o hose p esen ed in Fig. 2 a e shown). enzymes, including N-ace ylo ni hine amino ans e ase (A gD), a e p esen in Anabaena spp. in he e ocys s as well as in ege a i e cells (11). We do no know, howe e , whe he he uppe band ound wi h RNA p epa a ions om cul u es g own in BG110 medium co esponds o he e ocys -localized mRNA molecules. This RNA species was also de ec able, al hough in educed amoun s, wi h RNA p epa a ions om BG11-g own cul u es, bu i should be no ed ha BG11-g own cul u es o J. BAc- ERIOL. VOL. 176, 1994 Anabaena sp. s ain PCC 7120 a e no comple ely de oid o he e ocys s. Nucleo ide sequence accession numbe . The sequence e- po ed in his no e o 2,259 bp o DNA o he s ain PCC 7120 genome will appea in he EMBL/GenBank/DDBJ da a lib a - ies unde accession numbe X78854. This wo k was suppo ed by g an PB90-0114 om Di ecci6n Gene al de In es igaci6n Cien i ica y Tecnica, Spain. B.F. was he ecipien o a ellowship om Plan de Fo maci6n de Pe sonal In es- igado (Minis e io de Educaci6n y Ciencia), Spain. REFERENCES 1. Ausubel, F. M., R. B en , R. E. Kings on, D. D. Moo e, J. G. Seidman, J. A. Smi h, and K. S uhl (ed.). 1994. Cu en p o ocols in molecula biology. G eene Publishing and Wiley-In e science, New Yo k. 2. B ahamsha, B., and R. Haselko n. 1991. Isola ion and cha ac e - iza ion o he gene encoding he p incipal sigma ac o o he ege a i e cell RNA polyme ase om he cyanobac e ium Anabaena sp. s ain PCC 7120. J. Bac e iol. 173:2442-2450. 3. Cai, Y., and C. P. Wolk. 1990. Use o a condi ionally le hal gene in Anabaena sp. s ain PCC 7120 o selec o double ecombinan s and o en ap inse ion sequences. J. Bac e iol. 172:3138-3145. 4. Cunin, R., N. Glansdo , A. Pie a d, and V. S alon. 1986. Biosyn- hesis and me abolism o a ginine in bac e ia. Mic obiol. Re . 50:314-352. 5. Daniels, D. L., G. Plunke , V. Bu land, and F. R. Bla ne . 1992. Analysis o he Esche ichia coli genome: DNA sequence o he egion om 84.5 o 86.5 minu es. Science 257:771-778. 6. De e eux, J., P. Haebe li, and 0. Smi hies. 1984. A comp ehensi e se o sequence analysis p og ams o he VAX. Nucleic Acids Res. 12:387-395. 7. Elhai, J. 1993. S ong and egula ed p omo e s in he cyanobac- e iumAnabaena PCC 7120. FEMS Mic obiol. Le . 114:179-184. 8. Elhai, J., and C. P. Wolk. 1988. A e sa ile class o posi i e- selec ion ec o s based on he non iabili y o palind ome-con ain- ing plasmids ha allows cloning in o long polylinke s. Gene 68:119-138. 9. Flo iano, B., A. He e o, and E. Flo es. 1992. Isola ion o a ginine auxo ophs, cloning by mu an complemen a ion, and sequence analysis o he a gC gene om he cyanobac e ium Anabaena species PCC 7120. Mol. Mic obiol. 6:2085-2094. 10. Golden, S. S., J. B usslan, and R. Haselko n. 1987. Gene ic enginee ing o he cyanobac e ial ch omosome. Me hods Enzy- mol. 153:215-231. 11. Gup a, M., and N. G. Ca . 1981. Enzymology o a ginine me ab- olism in he e ocys - o ming cyanobac e ia. FEMS Mic obiol. Le . 12:179-181. 12. Heimbe g, H., A. Boyen, M. C abeel, and N. Glansdo . 1990. Esche ichia coli and Saccha omyces ce e isiae ace ylo ni hine ami- no ans e ases: e olu iona y ela ionship wi h o ni hine amino- ans e ases. Gene 90:69-78. 13. He e o, A., and E. Flo es. 1990. T anspo o basic amino acids by he dini ogen- ixing cyanobac e iumAnabaena PCC 7120. J. Biol. Chem. 265:3931-3935. 14. Hoa e, D. S., and S. L. Hoa e. 1966. Feedback egula ion o a ginine biosyn hesis in blue-g een algae and pho osyn he ic bac- e ia. J. Bac e iol. 92:375-379. 15. Hood, W., and N. G. Ca . 1971. Appa en lack o con ol by ep ession o a ginine me abolism in blue-g een algae. J. Bac e- iol. 107:365-367. 16. O'Reilly, M., and K. M. De ine. 1993. Sequence and analysis o he ci ulline biosyn he ic ope on a gC-F om Bacillus sub ilis. EMBL/ GenBank/DDBJ nucleo ide sequence da a lib a ies accession numbe Z26919. 17. Samb ook, J., E. F. F i sch, and T. Mania is. 1989. Molecula cloning: a labo a o y manual, 2nd ed. Cold Sp ing Ha bo Labo- a o y, Cold Sp ing Ha bo , N.Y. 18. Sange , F., S. Nicklen, and A. R. Coulson. 1977. DNA sequencing wi h chain- e mina ing inhibi o s. P oc. Na l. Acad. Sci. USA 74: 5463-5467. 19. Schneide , G. J., J. D. Lang, and R. Haselko n. 1991. P omo e ecogni ion by he RNA polyme ase om ege a i e cells o he cyanobac e ium Anabaena 7120. Gene 105:51-61. 20. Schneide , G. J., N. E. Tume , C. Richaud, G. Bo bely, and R. Haselko n. 1987. Pu i ica ion and cha ac e iza ion o RNA poly- me ase om he cyanobac e ium Anabaena 7120. J. Biol. Chem. 262:14633-14639. 21. Tume , N. E., S. J. Robinson, and R. Haselko n. 1983. Di e en p omo e s o he Anabaena glu amine syn he ase gene du ing g ow h using molecula o ixed ni ogen. Na u e (London) 306: 337-342. 22. Wolk, C. P. 1982. He e ocys s, p. 359-386. In N. G. Ca and B. A. Whi on (ed.), The biology o cyanobac e ia. Blackwell Scien i ic Publica ions, Ox o d. 23. Wolk, C. P., A. Vonshak, P. Kehoe, and J. Elhai. 1984. Cons uc- ion o shu le ec o s capable o conjuga i e ans e om Esch- e ichia coli o ni ogen- ixing ilamen ous cyanobac e ia. P oc. Na l. Acad. Sci. USA 81:1561-1565. NOTES 6401