The isolation of microsatellite loci in the Mediterranean fruitfly Ceratitis capitata (Diptera: Tephritidae) using a biotin/streptavidin enrichment technique

Molecular Ecology Notes (2001) 1 , 120–122 © 2001 Blackwell Science Ltd Blackwell Science, Ltd PRIMER NOTE The isolation of microsatellite loci in the Mediterranean fruitfly Ceratitis capitata (Diptera: Tephritidae) using a biotin/streptavidin enrichment technique D. G. CASEY and A. M. BURNELL Institute of Bioengineering & Agroecology, Biology Department, National University of Ireland, Maynooth, Co. Kildare, Ireland Abstract The Medfly ( Ceratitis capitata ) is a polyphagous dipteran pest which has spread from North Africa to the countries of the Mediterranean Basin and has also invaded tropical and subtropical regions throughout the world. Colonizing populations typically possess low levels of genetic variability. Microsatellites provide an effective means of investigating the population structure of such genetically depauperate populations, however, microsatellite markers traditionally require a long phase of development in new taxa. We used a biotin/ streptavidin capture technique to isolate microsatellites directly from C. capitata genomic DNA and we describe here the identification of seven polymorphic microsatellite markers in C. capitata . Keywords : Ceratitis capitata , enrichment protocol, Medfly, microsatellite Received 18 November 2000; revision accepted 4 January 2001 The Mediterranean fruit fly (Medfly) Ceratitis capitata , a polyphagous multivoltine pest of great economic importance, invaded Spain from North Africa over 150 years ago (Hagen et al . 1981). The Medfly has since spread to most of the countries of the Mediterranean Basin and has also colonized tropical and subtropical regions throughout the world. To manage this pest, it is important to find genetic markers suitable for determining the geographical origin of C. capitata populations invading new areas. Because of founder effects and genetic bottlenecks, colonizing populations typically possess low levels of genetic variability. Microsatellites provide an effective means of investigating the population structure of such genetically depauperate populations. We have used a biotin/streptavidin capture technique (Refseth et al . 1997; Gardner et al . 1999) to isolate microsatellites directly from C. capitata genomic DNA and we have identified seven polymorphic microsatellite markers that are suitable for the analysis of the genetic structure and gene flow studies in C. capitata populations. C. capitata genomic DNA was isolated using standard phenol/chloroform extraction with RNase (20 µ g/mL) digestion (Maniatis et al . 1989). Five µ g of Medfly genomic DNA were digested in a volume of 50 µ L with 10 units of Mbo I (Promega) for 5 h at 37 ° C, followed by heat inactivation of Mbo I at 65 ° C for 30 min. The oligonucleotides, linker A, 5 ′ -GGGTAGGATGGGGGATGGG-3 ′ (1.6 nmol) and linker B, 5 ′ -GATCCCCATCCCCCATCCTACCC-3 ′ (1.6 nmol) were mixed and heat denatured for 5 min at 95 ° C in a total volume of 60 µ L containing 50 m m Trisacetate pH 7.5, 10 m m magnesium acetate, 50 m m potassium acetate, and allowed to cool slowly overnight to room temperature to generate the double-stranded Mbo I adapter. This adapter (0.53 nmole) was ligated to 5 µ g of Mbo I digested genomic DNA in a volume of 100 µ L containing 30 m m Tris-HCl pH 7.8, 10 m m MgCl 2 , 1 m m ATP, 10 µ g bovine serum albumin (Promega) and 40 units T4 DNA Ligase (Promega). Excess adapter molecules and low molecular weight genomic DNA were removed by centrifuging the ligation reaction through a Micron 50 filter (Amicon®) at 16 100 g for 30 s. Cleaned elutant was recovered by inverting the sample reservoir and spinning at 16 100 g for a further 30 s into a 1.5-mL tube. Adapter ligated DNA was hybridized to 1 µ g (15 nmol) of biotinylated probe in a total volume of 100 µ L containing 50 µ L of 2 × binding and washing (B & W) buffer (10 m m Correspondence: A. M. Burnell. Fax: + 353 1 7083845; E-mail: [email protected] men_038.fm Page 120 Friday, August 24, 2001 8:43 AM PRIMER NOTE 121 © 2001 Blackwell Science Ltd, Molecular Ecology Notes , 1, 120–122 Tris-HCl, pH 7.5; 1 m m EDTA, 2.0 m NaCl: Dynal). The biotynlated probes used were 5 ′ -(AC) 10 GAGC[Biotin]A3 ′ , 5 ′ -(AG) 10 GCAC[Biotin]A-3 ′ and 5 ′ -(TGC) 10 AGCG- [Biotin]A-3 ′ . Following heat denaturation for 5 min at 95 ° C, the hybridization mixture was rapidly cooled to the appropriate hybridization temperature (AC 10 and AG 10 , 50 ° C; TGC 10 , 55 ° C). In a separate tube 100 µ L of Dynabeads® M-280 Streptavidin (Dynal®) were washed three times in 100 µ L of B & W buffer. The hybridization reaction was added to the prepared bead mix and incubated with gentle agitation at the hybridization temperature for 30 min. The captured fragments were washed three times in 100 µ L of 1 × SSC at room temperature followed by three washes in 100 µ L of 1 × SSC at 30 ° C. Captured fragments were eluted from the beads by heating for 5 min at 95 ° C and were purified using a Micron 50 filter (Amicon®). The microsatellite enriched retentate was polymerase chain reaction (PCR) amplified in a 50µ L PCR reaction containing 1 × PCR buffer (Promega), 4 m m MgCl 2 , 10 m m dNTPs, 10 pmol of linker A and 1 unit of Taq polymerase (Promega). PCR was carried out in a Perkin-Elmer 2400 Thermal cycler with one cycle of denaturing at 94 ° C for 5 min followed by 35 cycles of 95 ° C for 45 s, 63 ° C for 45 s and 72 ° C for 90 s, ending with one cycle of 72 ° C for 10 min. PCR products were cloned using the TOPO TA cloning system® (Invitrogen). Recombinant clones were tested for microsatellite repeat sequences by a three-primer PCR amplification test (Gardner et al . 1999). Products from clones that yielded two or more bands in the three-primer test were purified using the StrataPrep™ kit (Stratagene) and were sequenced on a ABI Prism® 310 Genetic analyser. The results of the three-primer tests and DNA sequencing are presented in Table 1. PCR primers were designed for eight C. capitata microsatellite loci and seven of these loci were polymorphic (Table 2). Approximately 20 individuals from five C. capitata populations were Table 1 The results of the PCR three-primer tests and DNA sequencing analyses on recombinant clones of Ceratitis capitata genomic DNA generated using a biotin/streptavidin magnetic enrichment protocol Probe Total(AC)10 (AG)10 (TGC)10 No. of clones tested in three-primer PCR test 19 9 5 33 No. of clones yielding two or more PCR bands 13 3 2 18 (54.5%) No of sequenced clones which contained microsatellites* 13 3 2 18 (100%) *Recombinant clones which yielded two or more bands in the three-primer test were sequenced. Table 2 Characteristics of seven microsatellite loci of Ceratitis capitata Locus Motif Primer sequence (5 ′− 3 ′ ). F:forward, R:reverse Size* (bp) Allele size range (bp) T a ( ° C) D A H O H E GenBank Accession no. dccap1 ( CA ) 2 CTGC ( CA ) 4 F: ACATACACACTGACATCCGCTAAGT R: CCAATAACGACGACAATCACC 152 277–281 56 3 0.63 0.43 AF267491 dccap2 ( TGCCGC ) 2 ( TGC ) 11 CAC ( TGC ) 2 F: GCAACAACAAAGCAAAGCAA R: ATCGGGGTAACGGCTGAGTA 214 288–312 58 4 0.41 0.33 AF267489 dccap4 ( AT ) 4 ( CA ) 8 F: CTAGGGAACCCTGGGGGAGG R: CTTCCCTTTATGCCCGTATGTAT 184 284–344 58 4 0.51 0.45 AF267494 dccap5 ( AC ) 2 TA ( TG ) 3 AT ( TG ) 5 C ( TG ) 6 TC ( TG ) 3 F: GCAATGAAAGCAAGCAACAA R: GCCGTGAAAGGTGAATGAC 223 336–344 56 3 0.16 0.35 AF267287 dccap6 ( AT ) 2 AG ( AT )4(AC)2(AT)2(AC)3F: AGCCTGTTTTGACCAACGTC R: CGTCACTTAGCGGATGTTCAG 164 287–229 58 4 0.58 0.4 AF267493 dccap1.1 (TA)2TG(TA)2CATG(TA)2CAT(AC)2GTC(TG)4F: TGCCAATAACGACGAAATC R: AGCCGAAGAATTGGCATTTA 152 277–279 56 2 0.6 0.44 AF267492 dccap9 (TGCCGC)2(TGC)4TAC(TGC)2CGC(TGC)2F: AGTGTCTGAAAACACAACAGCAAC R: GTTGTATTGTTGCACGAGGATATG 239 306–324 58 4 0.5 0.46 AF267490 The locus name, repeat motif, primer sequence, annealing temperature, sequenced allele size and GenBank accession no. for microsatellite loci isolated are given. The number of distinct alleles (DA) and levels of heterozygosity (HO = observed proportion of heterozygotes, HE = expected proportion of heterozygotes) are based on data from 20 individuals from five populations. men_038.fm Page 121 Friday, August 24, 2001 8:43 AM 122 PRIMER NOTE © 2001 Blackwell Science Ltd, Molecular Ecology Notes, 1, 120–122 assessed. Genomic DNA from single flies was isolated using the DNeasy™ Tissue Kit (Qiagen). Microsatellite loci were amplified in 25 µL PCR reactions containing 50 ng of C. capitata genomic DNA, 1 × PCR buffer (Promega) (10 mm Tris-HCl pH 8.3, 50 mm KCl), 2.5 mm MgCl2, 200 µm of each dNTP, 10 pmol of each primer and 1 unit of Taq polymerase (Promega). Amplifications were carried out in a Perkin-Elmer 2400 Thermal cycler with one cycle of denaturing at 94 °C for 5 min followed by 35 cycles for 45 s at 95 °C, 45 s at the primer-specific annealing temperature (Table 2), 72 °C for 90 s, ending with one cycle of 72 °C for 10 min. Products were electrophoresed on standard sequencing gels (6% acrylamide, 8 m urea, in 1 × TBE) and visualized using the Silver Sequence™ DNA Staining System (Promega). Analyses of genetic diversity were carried out using genepop software (Raymond & Rousset 1995). Numbers of distinct alleles ranged from one to four per locus with observed and expected heterozygosities ranging from 0.32 to 0.63 (Table 2). Null alleles were identified in the locus dccap5. The overall genetic diversity (Nei 1987) found in this study (GD = 0.51) is comparable with values reported in Mediterranean C. capitata populations by Bonizzoni et al. (2000). These seven microsatellite loci are currently being used to analyse gene flow and mutation processes in C. capitata populations from the Mediterranean Basin. Acknowledgements We thank Michael Gardner for providing a copy of his enrichment protocol prior to publication, Unn Refseth for the linker sequence and Thomae Kakouli-Daurte for Ceratitis capitata genomic DNA. The research was supported by the European Community (Project FAIRPL 96–1972). References Bonizzoni M, Malacrida AR, Gugliemino CR, Gomulski LM, Gasperi G, Zheng L (2000) Microsatellite polymorphism in the Mediterranean fruit fly Ceratitis capitata. Insect Molecular Biology, 9, 251–261. Gardner MG, Cooper SJB, Bull CM, Grant WN (1999) Isolation of microsatellite loci from a social lizard Egernia stokesii, using a modified enrichment procedure. Journal of Heredity, 90, 301–304. Hagen KS, William WW, Tassen RL (1981) Mediterranean fruit fly: The worst may be yet to come. California Agriculture, 35, 5–7. Maniatis T, Fritsch EF, Sambrook J (1989) Molecular Cloning: a Laboratory Manual. Cold Spring Harbour Laboratory Press, New York. Nei M (1987) Molecular Evolutionary Genetics. Columbia University Press, New York. Raymond M & Rousset F (1995) genepop (Version 1.2): population genetics software for exact tests and ecumenicism. Journal of Heredity, 86, 248–249. Refseth UH, Fangan BM, Jakobsen KS (1997) Hybridisation capture of microsatellites directly from genomic DNA. Electrophoresis, 18, 1519–1523. men_038.fm Page 122 Friday, August 24, 2001 8:43 AM