Molecular targets involved in the goose barnacle Pollicipes pollicipes (Cirripedia) larvae metamorphosis and settlement
Full text
Molecular targets involved in the goose barnacle Pollicipes pollicipes (Cirripedia) larvae metamorphosis and settlement Miguel Soares Rocha Mestrado em Biologia Molecular e Celular Departamento de Biologia 2014-2015 Orientador Isabel Cunha, Ph.D., CIIMAR Co-orientador Filipe Pereira, Ph.D., CIIMAR !
FCUP Molecular targets involved in the goose barnacle Pollicipes pollicipes (Cirrepedia) larvae metamorphosis and settlement i Todas as correções determinadas pelo júri, e só essas, foram efetuadas. ! O Presidente do Júri, Porto, ______/______/_________
FCUP Molecular targets involved in the goose barnacle Pollicipes pollicipes (Cirrepedia) larvae metamorphosis and settlement ii ! Dissertação de candidatura ao grau de Mestre em Biologia Celular e Molecular submetida à Faculdade de Ciências da Universidade do Porto. O presente trabalho foi desenvolvido sob a orientação científica da Doutora Isabel Cunha, com co-orientação pelo Doutor Filipe Pereira, no BBE (Blue Biotechnology and Ecotoxicology), CIIMAR (Centro Interdisciplinar de Investigação Marinha e Ambiental). Dissertation for applying to a Master’s Degree in Cell and Molecular Biology, submitted to the Faculty of Sciences of the University of Porto. The present work was developed under the scientific supervision of Isabel Cunha, Ph.D., co-supervised by Filipe Pereira, Ph.D., at BBE (Blue Biotechnology and Ecotoxicology), CIIMAR (Centro Interdisciplinar de Investigação Marinha e Ambiental). !
FCUP Molecular targets involved in the goose barnacle Pollicipes pollicipes (Cirrepedia) larvae metamorphosis and settlement iii Acknowledgements Firstly, I would like to thank my scientific supervisor Isabel Cunha for all the help and advises given throughout this year. Always full of ideas and passionate about the work, I thank you for pushing me to go further. To my co-supervisor Filipe Pereira, a “geneious” and a true friend, always supported me when I most needed. Thank you for your patience, help and friendship. You organize the best scientific meetings! To my colleagues at BBE, who made sure every day was productive and amusing at the same time. You made sure the laboratory had a permanent good vibe. Especially to my beach companion and friend, Paulo Antas. To my friends, who knew exactly when and how I needed to relax. Thank you for keeping me sane. To my mother, without you I would not had the possibility to do this work. Not only for paying the tuitions, but also and foremost for the daily support given. To my sister, who despite being a massive annoyance, can be extremely funny and knows how to make me laugh. To my father, that even being more than a thousand miles away cares a lot about me, and always makes everything he can to help me. To the project MARBIOTECH (reference NORTE-07-0124FEDER-000047) within the SR&TD Integrated Program MARVALOR - Building research and innovation capacity for improved management and valorization of marine resources, supported by the Programa Operacional Regional do Norte (ON.2 – O Novo Norte) and also by NOVOMAR (reference 0687-NOVOMAR-1-P), supported by the European Regional Development Fund. This research was partially supported by the Strategic Funding UID/Multi/04423/2013 through national funds provided by FCT – Foundation for Science and Technology and European Regional Development Fund (ERDF), in the framework of the programme PT2020. Finally, but definitely not least, to my girlfriend that knows me better than anyone and gives me unconditional support and love. You gave me motivation through all the adversities and your smile always kept me going.
FCUP Molecular targets involved in the goose barnacle Pollicipes pollicipes (Cirrepedia) larvae metamorphosis and settlement iv
FCUP Molecular targets involved in the goose barnacle Pollicipes pollicipes (Cirrepedia) larvae metamorphosis and settlement v Abstract On one hand, biofouling is economically a universal nuisance; on the other hand, biological adhesives are a class of materials with huge research potential, industrial and biotechnological applications. However, many aspects of the fouling and adhesion mechanisms are not yet fully understood and barnacles are a model organism for both types of study. Barnacles are globally distributed crustaceans colonizing intertidal and subtidal rocky shores. They are also important fouling organisms that adhere to underwater surfaces through singular cement proteins, inspiring biomimetic research. The aim of this dissertation is to study adhesion in the goose barnacle Pollicipes pollicipes, a species present on the exposed Portuguese rocky shores and also an important economic resource, as it is prized as a delicacy, having a future aquaculture potential. We have found that different culturing temperatures did not affect P. pollicipes larvae survival rate, interfering only indirectly through its effect on larval development, allowing us to reduce time to obtain samples. From the temperatures tested, only at 22 ºC larvae succeeded to reached the cypris stage, being possibly the ideal temperature for their development and metabolism. Morphometric analyses were performed on the different larval stages, and it has been determined that the carapace width (CW) and the carapace length (CL) are good indicators for nauplii staging. The sequencing of the coding regions of cement protein genes (CP-100K, CP-52K and CP-19K) and a gene involved in larval settlement (Settlement-inducing protein complex – SIPC) was achieved. The complete CP-100K cDNA sequence was obtained, and partials cDNA sequences were attained for the other genes of interest. Several polymorphic positions were identified, which may prove useful for phylogenetic and population studies. Furthermore, errors were detected in P. pollicipes ESTs available on public databases. qPCR optimization assays were performed in order to set the grounds for expression studies of the target genes sequenced, at different developmental stages and tissues. We have successfully designed specific and efficient primers which allowed performing the assays, although no stable reference genes were yet identified. Normalizing data with cDNA content of the samples was the method used on a preliminary quantitative transcription study performed. These preliminary results indicated that those CPs genes are expressed in the post-larvae and at the adults’ peduncle, and that SIPC gene was expressed during most of the P. pollicipes developmental stages studied and adults’ tissues, except in the egg masses and nauplius II. Overall, our findings contribute to the elucidation of settlement, fixation
FCUP Molecular targets involved in the goose barnacle Pollicipes pollicipes (Cirrepedia) larvae metamorphosis and settlement vi and metamorphosis processes in P. pollicipes, setting the bases for a deeper understanding of biofouling and bioadhesion in goose barnacles.
FCUP Molecular targets involved in the goose barnacle Pollicipes pollicipes (Cirrepedia) larvae metamorphosis and settlement vii ! Resumo Por um lado, a incrustação de animais representa um prejuízo económico global; por outro lado, os adesivos biológicos são uma classe de materiais com um imenso potencial de pesquisa e de aplicações industriais e biotecnológicas. No entanto, muitos aspetos relativos aos mecanismos de fixação e adesão não estão ainda completamente compreendidos, e os cirrípedes são organismos modelo para o estudo de ambos. Os cirripedes são crustáceos distribuídos globalmente e que colonizam as regiões intertidal e subtidal das costas rochosas. São também importantes organismos incrustantes que aderem a superfícies subaquáticas através de proteínas do cimento únicas, que inspiram a pesquisa biomimética. O foco desta tese será estudar a adesão do cirrípede Pollicipes pollicipes (nome comum: percebes), uma espécie incrustante presente na costa rochosa portuguesa, também um importante recurso económico dado que é considerado um petisco, e com potencial para aquacultura. Foram testadas diferentes temperaturas de cultivo das larvas de P. pollicipes, tendo sido observado que a temperatura não afeta a sua taxa de sobrevivência, apenas interferindo indiretamente no desenvolvimento larvar, permitindo reduzir o tempo de obtenção de amostras. Das temperaturas testadas, apenas a 22 ºC as larvas atingiram a fase de cypris, sendo esta possivelmente a temperatura ideal para o seu desenvolvimento e metabolismo. Foram feitas análises morfométricas nas diferentes fases larvares tendo sido determinado que a largura e o comprimento da carapaça são bons indicadores para a distinção da fase naupliar. Sequenciaram-se as regiões codificantes de genes das proteínas do cimento (CP100K, CP-52K e CP-19K) e de um gene envolvido na fixação larvar (Complexo proteico de indução da fixação - SIPC). Foi obtida a sequência completa de cDNA de CP-100K e sequências parciais dos outros genes. Várias posições polimórficas foram identificadas o que pode ser útil para estudos populacionais e filogenéticos. Além disso, foram detectados erros nos ESTs de P. pollicipes disponíveis em bases de dados públicas. Foram realizados ensaios de otimização de qPCR com o intuito de realizar estudos de expressão dos genes-alvo sequenciados, em diferentes etapas de desenvolvimento e tecidos. Foram desenhados primers específicos e eficientes que permitiram a realização dos ensaios, embora não tenham sido ainda identificados genes de referência estáveis. Assim, neste estudo preliminar de transcrição quantitativa, os dados foram normalizados de acordo com a quantidade de cDNA das amostras. Os resultados preliminares indicaram que estes genes de
FCUP Molecular targets involved in the goose barnacle Pollicipes pollicipes (Cirrepedia) larvae metamorphosis and settlement viii CPs são expressos nas pós-larvas e no pedúnculo do adulto, e que o gene SIPC é expresso na maioria das etapas de desenvolvimento e dos tecidos de adulto do P. pollicipes, excepto nas lamelas e em nauplius II. No geral, os trabalhos realizados contribuem para a elucidação dos processos de estabelecimento, fixação e metamorfose de P. pollicipes, fornecendo bases para um entendimento mais profundo da incrustação e da bioadesão dos cirripedes.
FCUP Molecular targets involved in the goose barnacle Pollicipes pollicipes (Cirrepedia) larvae metamorphosis and settlement xv Figure 25 – Chart representing the expression levels of CP-52K in different tissues and larval stages tested by qPCR. ............................................................................... 37 Figure 26 – Chart representing the expression levels of CP-100K in different tissues and larval stages tested by qPCR. ............................................................................... 38 Figure 27 – Chart representing the expression levels of SIPC in different tissues and larval stages tested by qPCR. ............................................................................... 38
FCUP Molecular targets involved in the goose barnacle Pollicipes pollicipes (Cirrepedia) larvae metamorphosis and settlement xvi List of Tables Table 1 - List of designed PCR primers used in this study. ...................................... 62 Table 2 - List of designed qPCR primers used in this study. .................................... 63 Table 3 - List of polymorphisms identified in the coding regions of the target genes sequenced. ....................................................................................................... 65 Table 4 - List of heterozygoties detected in the coding region of CP-100K. ............ 65 Table 5 - Similarity of barnacle cDNA sequences between different species. .........32 Table 6 - Similarity of barnacle AA sequences between different species. ..............33 Table 7 - Efficiencies of the genes of interest obtained in the qPCR assays…….....35
FCUP Molecular targets involved in the goose barnacle Pollicipes pollicipes (Cirrepedia) larvae metamorphosis and settlement xvii List of Abbreviations A – adenine AA – amino acid Ala – alanine Asp – aspartate BLAST – Basic Local Alignment Search Tool bp – base pair C – cytosine cDNA – complementary deoxyribonucleic acid CDS – coding DNA sequence CL – carapace length CP – cement protein Ct – threshold cyle CW – carapace width Cys – cysteine Dº – day degrees DEPC – Diethylpyrocarbonate DNA – deoxyribonucleic acid dNTP – nucleoside triphosphate DOPA – 3,4-dyhydroxy phenylalanine EDTA – Ethylenediaminetetraacetic acid EST – expressed sequence tag G – guanine GAPDH – Glyceraldehyde 3-phosphate dehydrogenase gDNA – genomic deoxyribonucleic acid Glu – glutamate Gly – glycine His – histidine IH – Instituto Hidrográfico Lys – lysine MgCl2 – magnesium chloride mRNA – messenger ribonucleic acid NaCl – sodium chloride PCR – polymerase chain reaction qPCR – real-time polymerase chain reaction
FCUP Molecular targets involved in the goose barnacle Pollicipes pollicipes (Cirrepedia) larvae metamorphosis and settlement xviii rDNA – ribosomal deoxyribonucleic acid RNA – ribonucleic acid RT – reverse transcription SDS – sodium dodecyl sulfate Ser – serine SIPC – settlement inducing protein complex STE – Sodium Chloride-Tris-EDTA T – thymine TAE – Tris-acetate-EDTA Thr – threonine TL – total length Val – valine
FCUP Molecular targets involved in the goose barnacle Pollicipes pollicipes (Cirrepedia) larvae metamorphosis and settlement 1 Introduction ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! !
FCUP Molecular targets involved in the goose barnacle Pollicipes pollicipes (Cirrepedia) larvae metamorphosis and settlement 2 The importance of barnacles Barnacles are dominant hard macro-fouling organisms, with six planktonic larval dispersive stages (nauplius), a benthonic stage (cypris) and a sessile adult form. Attachment to foreign materials in adulthood is essential to their survival, as it is closely linked with other physiological functions (e.g., metamorphosis, biomineralization and molting) (Kamino, 2006a). This firm attachment, that always occurs underwater and in large numbers, is secured by a unique molecular system of adhesion, as the cement produced is a particular mixture of insoluble compounds produced only by barnacles (Yule & Walker, 1987). This underwater attachment is especially interesting because there is little man-made technology capable of bonding materials in water (Kamino & Thomopoulos, 2012), as most chemically synthesized adhesives are incompatible with water. In addition, it is still a challenge to control hydrophobic interactions in aqueous conditions. The process by which they are able to attach to foreign materials remains irreproducible so far (Kamino, 2008), which provides a platform for biomimetic and bioinspired research. Furthermore, these gregarious animals (Elbourne, Veater, & Clare, 2011; Knight-Jones & Stevenson, 1950), colonize man-made marine structures causing severe economic damage, particularly in shipping (Schultz, Bendick, Holm, & Hertel, 2010), but in general to all maritime industry. The existing methods to control this occurrences use primarily paints on surfaces with added biocide, which are toxic to the marine environment (Omae, 2003). Hence, it is necessary to develop new and more environmental friendly approaches and to improve existing ones, in order to control barnacle biofouling, such as fouling-release coatings (Bultman & Griffith, 1980), inhibitors of settlement and even inhibitors of cement formation or hardening. Therefore, research on barnacles is important to understand underwater adhesion and combat fouling, two opposing aspects of the same phenomenon. P. pollicipes (Gmelin, 1789) is a goose barnacle (Crustacea: Pedunculata) that grows in clusters of different sizes, and is used as food in the Iberian Peninsula (the most exploited by man of the genus Pollicipes), having a high market value (Cruz, Castro, & Hawkins, 2010). It is abundant on exposed rocky shores (ranging from the shallow subtidal to mid-intertidal zone), and distributed in Western Europe and on the North African coasts of the eastern Atlantic from France to Senegal (Barnes, 1996). The natural stocks are under tight governmental control in the case of Spain, and the development of cultivation methodologies would help to preserve them. In this particular case, understanding adhesion is important in order to be
FCUP Molecular targets involved in the goose barnacle Pollicipes pollicipes (Cirrepedia) larvae metamorphosis and settlement 3 able to induce settlement and attachment into artificial surfaces, and set the bases for the industrial cultivation of the species. ! ! P. pollicipes life cycle !P. pollicipes is a simultaneous hermaphrodite, for which the norm is internal cross-fertilization through copulation, breeding mainly from April to September on Portuguese shores. During this period, more adults carry fertilized eggs, which is positively correlated with the warmer temperature of sea water; though light and feeding are also considered cues for reproduction (Cruz & Hawkins, 1998). Since P. pollicipes mobility is very reduced after attachment, gregariousness is paramount for reproduction. In addition, even being hermaphrodites, selffertilization does not occur because sperm and ovaries mature alternately (Cruz & Hawkins, 1998). In a given moment, one specimen is either a “functional male” or a “functional female” (Anderson, 1994). After fertilization, the ovaries disrupt, needing time to recuperate. However, when in breeding season, ovaries are able to recover faster, at the same time or even before the eggs complete development. This allows the production of several broods during the season, though not continuously (Cruz & Hawkins, 1998). Asynchronous broods are produced by adults, being estimated that the annual number of broods per individual fluctuate from 1 (crowded animals) to 4 (large, uncrowded animals) (Cruz & Araújo, 1999). The development of embryos derived from the egg masses (lamellae) occurs inside the mantle cavity of adults, hatching as stage I nauplii. Larger animals (and therefore probably older) have a higher probability of carrying egg masses (Page, 1986). The life cycle of P. pollicipes has six planktonic naupliar stages in which the larvae live freely on the water, followed by a cypris stage where the larvae metamorphoses into a sessile organism that settles on the base of an adult’s peduncle (Kugele & Yule, 1996; Molares, Tilves, & Pascual, 1994a) (Figure 1). Each stage of larval development is associated with metamorphosis, which involves casting of carapace and changes in size and shape.
FCUP Molecular targets involved in the goose barnacle Pollicipes pollicipes (Cirrepedia) larvae metamorphosis and settlement 4 !! Figure 1 - P. pollicipes life cycle. The life cycle is composed of two distinct phases: planktonic phase and sessile phase. The planktonic phase is composed of six feeding nauplius stages and one non-feeding cyprid stage; the sessile phase includes a juvenile and adult stages. Scale bar: 100 µm. The cypris settlement stage is essential for the development of adults, as cypris search for and choose an adequate settlement place, close to other conspecifics, where adult will live all life-long. Cyprids do not feed, they are devoid of a functional digestive system and lack of feeding activity, living upon reserve materials (Lewis, 1975; Molares, Tilves, & Pascual, 1994a), giving them a limited time to find a suitable settlement site. Cyprids already possess adhesive-secreting cells located within cement glands, connected by cement ducts that widen into muscular cement sacs (the temporary storage location throughout cement secretion). The cement ducts extend to the adhesive disc at the tip of the antennules, where the first adhesive is secreted, allowing the cyprid larva to attach and begin metamorphosis (Harrison & Sandeman, 1999; Okano, Shimizu, Satuito, & Fusetani, 1996). Furthermore, cyprids adhesion is a bi-phasic system: one phase is composed of phospoproteins and the other of lipids, both contained in two separate granules within the cement glands. Firstly, the lipids are secreted, theoretically to displace water from the surface interface, thus creating a conductive environment for the introduction, curing and crosslinking of the proteins, while modulating the protein’s spreading and protecting them from excessive hydration and bacterial biodegradation (Aldred et al., 2014). After post-settlement metamorphosis, the cement glands are regenerated and function throughout life (Anderson, 1994). It is suggested that external cues induce the settlement of cyprids, such as chemical communication between larvae-larvae and adult-larvae (e. g., settlementNauplii Cyprid Juvenile Adult ! ! ! ! ! ! ! ! !
FCUP Molecular targets involved in the goose barnacle Pollicipes pollicipes (Cirrepedia) larvae metamorphosis and settlement 5 inducing protein complex – SIPC) that act only in close proximity (Crisp & Meadows, 1962; Matsumura et al., 1998) and via larval sense of vision using the compound eyes (nauplii VI and cypris) to locate adults (Matsumura & Qian, 2014). Once cypris settles in the peduncle of a healthy adult, it metamorphoses into juvenile, moves down towards the base of the adult, where it will fix permanently to the substratum and develop into an adult also.!! ! Underwater attachment and cement proteins (CPs) !Bioadhesion is a phenomenon in which organisms are capable of attach (temporarily or permanently) to foreign substrates, through various techniques. It is imperative for adult barnacles to remain attached to the chosen substrate, since dislodgment equals death. Therefore, biological adhesives usually result from evolutionary processes, controlled by diverse factors, such as the organism’s mode of attachment, bioenergetics and the evolution of cells specialized in biosynthesis and secretion of adhesives, in order to resist under hostile physical conditions (Kamino, 2013). Consequently, a particular biological adhesive, in order to meet the requirements of the organism, will have a specific design, both at the molecular and macroscopic level (Kamino, 2013). The material that grants adult acorn barnacles the ability to attach its base to an underwater substratum is a permanent adhesive called cement and it is a multi-protein complex insoluble in water (Kamino, 2006a; Kamino et al., 2000), as represented in Figure 2. In the case of goose barnacles, the attachment is not so permanent, as they have the capacity to move slightly sideward. This may occur to accommodate new juveniles in the base of the turf, but also to re-attach in the case of slight detach (Kamino, 2013). Underwater attachment is a multifunctional process that can be divided into surface functions and bulk functions (Waite, 1987). Surface functions involve the displacement of the water layer, cement spreading and coupling to diverse materials, while the bulk functions comprise self-assembly Figure 2 - Schematic representation of the cement multi protein complex produced by barnacles, identifying the different components that constitute it. Adapted from Kamino, 2006b.
FCUP Molecular targets involved in the goose barnacle Pollicipes pollicipes (Cirrepedia) larvae metamorphosis and settlement 6 and protection from microbial degradation (Waite, 1987). It is suggested that each component of this multi-protein complex can account for the different surface and bulk function. The gland responsible for the cement synthesis is composed of two cell types (α and β granules) and in adult goose barnacles, it is localized in the upper portion of the soft tissue (peduncle) with ducts that lead to the base of the animal (Aldred et al., 2014), which is consistent with the region where the cement proteins’ (CP’s) mRNAs are expressed (Kamino, Nakano, & Kanai, 2012; Urushida et al., 2007). The location of these proteins is at the adhesive joint between the base of the barnacle and the substratum (Kamino et al., 2000). Until now, more than 10 proteins were identified as cement components in barnacles, of which six have been purified and characterized (originally in Megabalanus rosa and subsequent from other species): CP-16K, CP-19K, CP-20K, CP-52K, CP-68K and CP-100K (ordered according to their molecular weight) (Kamino, 2006b; 2008; 2010). Biological and biochemical studies indicate that the molecular system behind this attachment is unique in adult barnacles, differing from mussel and tubeworms (Kamino, 2010), in which the molecular systems are characterized by post-translational modifications, especially 3,4-dihydroxy phenylalanine (DOPA) (Sagert, Sun, & waite, 2006). In the case of barnacles, the “DOPA-system” is not involved (Kamino, Odo, & Maruyama, 1996). In fact, little post-translational modifications occur in the CPs of barnacles, as in the cases of CP-19K and -20K none were identified (the molecular weight of the purified protein agrees with the estimated from the cDNA sequences) and CP-52K has only limited glycosylation (Kamino, 2013). In the case of CP-20K, a defined conformation as been already identified (Suzuki, Mori, Kamino, & Yamazaki, 2005), whilst CP-52K and -100K probably have specific conformations as well; this is relevant, given that the conformation of proteins is critical for surface coupling and/or self-assembly (Kamino et al., 2012). Among underwater adhesive proteins, all the CPs are unique, as no homologous have been found in available databases. In addition, there are only low similarities in their primary structure and they are characterized by a biased amino acid composition (Kamino et al., 2012). Furthermore, CPs can be divided into three types: hydrophobic proteins (CP-100K and -52K); hydrophilic proteins rich in charged amino acids His, Asp/Glu and Cys – CP-20K; and hydrophilic proteins rich in Ser, Thr, Gly, Ala, Val, and Lys residues that cover more than 60% of the total amino acids – CP-68K and -19K (Kamino, 2013). Due to their insoluble nature and the fact that are the most abundant CPs (Kamino et al., 2000), CP-100K
FCUP Molecular targets involved in the goose barnacle Pollicipes pollicipes (Cirrepedia) larvae metamorphosis and settlement 13 unspecific products. The design of the PCR primers had several criteria taken into account: 1) the potential primers were designed in the most conserved regions and avoided variable positions in the last five 3’ end positions, as it is the region that affects the binding of the DNA polymerase the most; 2) primers size should vary between 17 and 30 base pairs; 3) primers were designed with a predicted melting temperature between 55 to 62 °C and tested to avoid primer-dimer and hairpin interactions, in the OligoCalc website (Kibbe, 2007); 4) primer pairs were designed with close melting temperatures; 5) target regions should not be longer than 1000 base pairs (due to the characteristics of the Taq DNA polymerase used on the PCR reactions). Due to the limitation on the amplicon’s length, target genes with longer sequences were amplified in partially overlapping regions. Furthermore, a positive and a negative control are required for every PCR to validate results. In the present work the chosen positive control was the gene that codifies for 18S protein, a component of the small eukaryotic ribosomal subunit 40S. The 18S primers were design based on the cDNA sequence available of the 18S rRNA of P. pollicipes sequence, generating an amplicon of 106 bp. In the cases where no P. pollicipes EST’s were available (CP-20K), primers were designed using a strategy for PCR amplification of distantly related gene sequences based on consensus-degenarate hybrid oligonucleotide, using BlockMaker (http://blocks.fhcrc.org/blocks/makeblocks.html) and CODEHOP (Consensus-Degenarate Hybrid Oligonucleotide Primer; http://blocks.fhcrc.org/codehop.html) free online software. The input of CODEHOP is a set of local multiple alignments (blocks) of a group of related protein sequences in Blocks Database format, such as in BlockMaker output. CODEHOP performs exclusively at the amino acid level and tries to identify all theoretically possible nucleic acid coding variants resulting from the degenerate genetic code (Rose, Henikoff, & Henikoff, 2003). For CP-16K and CP-68K it was not possible to design primers, neither specific nor degenerate, because no P. pollicipes ESTs were available in order to make it possible to design them. All the PCR primers designed during the course of this work are listed in Table 1, in Annex. Polymerase chain reaction (PCR), DNA extraction from agarose gel and DNA sequencing !The five DNA gene regions, CP-19K, -20K, -52K, -100K and SIPC, were amplified using the functional PCR primers described in Table 1 (in Annex) and 18S as a positive control. The 18S was chosen as the positive control for the PCR
FCUP Molecular targets involved in the goose barnacle Pollicipes pollicipes (Cirrepedia) larvae metamorphosis and settlement 14 because the P. pollicipes DNA sequence was available for this gene and its repetitive arrangement within the genome provides excessive amounts of template DNA for PCR. All regions were successfully amplified except CP-20K, in which no degenerate PCR primer pair was effective. PCR was carried out by combining 5 µL of PCR Master Mix (2X) (Thermo Fisher Scientific), 2 µL of primer mix (2 µM of each primer) and 1 µL of template cDNA in a 10 µL final volume (completed with 2 µL of water DNase, RNaseand protease-free, Invitrogen). PCR was performed as follows: an initial denaturation step of 95 °C for 3 minutes, followed by 35 cycles of 30 seconds at 95 °C, 30 seconds at the lower annealing temperature of the primer pair and 90 seconds at 72 °C and a final extension step of 15 minutes at 72 °C. All amplifications were performed using BioRad MyCycler equipment (BioRad). Negative controls were used throughout all amplification processes. Agarose gel electrophoresis was performed using gels containing 1.5% agarose (w/v) in TAE buffer (40 mM Tris acetate pH 8.0; 1 mM EDTA) and 0.1 µg mL-1 GelRed (Biotium) for DNA staining. The molecular marker used was 1 KB Plus DNA Ladder (Thermo Fischer Scientific) and 3 µL of samples were loaded into gel with 6X loading dye (1.5% (w/v) glycerol; 200µg mL-1 Orange G). The gels ran at 90-110V for 50-90 minutes. The fragments were visualized under UV light in a UV Transilluminator (Cleaver) equipped with a camera (Canon PowerShot G). Extraction and purification of DNA from agarose gels was performed using the illustra GFX PCR DNA and Gel Band Purification kit (GE Healthcare Life Sciences) according to manufacturer’s instructions. The purified PCR products were sent for sequencing to GATC Biotech, Germany, and the results analyzed using Geneious software (Kearse et al., 2012). The cDNA sequences and amino acid sequences (translated from the cDNA) obtained for the target genes were aligned with the public available sequences of the phylogenetic closest species (A. amphitrite, B. improvisus, F. albicostatus and M. rosa) using Geneious alignment software (Kearse et al., 2012). ! Real-time quantitative PCR (qPCR) !Gene specific real-time primers were designed using Beacon Designer™ 7.51 (PREMIER Biosoft International). Beacon Designer™ designed the qPCR primers following some basic principles: 1) primers size should vary between 17 and 30 base pairs; 2) primers were designed to avoid primer-dimer and hairpin interactions; 3) primer pairs were designed with close melting temperatures. In
FCUP Molecular targets involved in the goose barnacle Pollicipes pollicipes (Cirrepedia) larvae metamorphosis and settlement 15 addition, the qPCR primers should ideally be designed to span an exon-exon junction, with one of the amplification primers potentially spanning the actual exonintron boundary, at the intron side. On one hand, if one primer is designed to span an exon-intron boundary, the possible contaminating and intron-containing gDNA is not amplified, as the primer cannot anneal to the template; on the other hand, since cDNA does not contain any introns, the template is efficiently primed and amplified. Furthermore, if the primers flank a long intron, amplification will only occur in cDNA, as the short extension time of the reaction is not sufficient for the amplification of the longer genomic target to take place. This safeguard prevents false positives and the misleading quantification of contaminating gDNA along with the cDNA in the results (Bustin, 2004). This strategy increases the probability of having an intron in the sequence between primer pairs. The primers for the target genes and 18S were designed based on the sequencing results. For the other reference genes (β-actin, Elongation Factor, GAPDH, TATA-binding protein and Tubulin), primers were designed on conserved regions (see Table 2 in Annex for complete qPCR primers list), following a method similar to the previously used in the initial PCR primers design. Using the sequences of M. ajax, Artemia franciscana, Daphnia magna and Lepeophtheirus salmonis as queries, we found the existing P. pollicipes ESTs through BLAST (Altschul et al., 1990). ESTs were found for β-actin and Elongation Factor. The reference genes sequences of P. pollicipes closest species are then aligned with P. pollicipes ESTs, (for the available reference genes) and the conserved regions are the input on Beacon Designer™. Since P. pollicipes genome is scarcely sequenced or annotated, the location of introns was unknown. For that reason, primers were designed to amplify sequences of 200-250 bp, longer than the qPCR standards, in order to increase the probability of having an intron in the sequence between primer pairs. In addition, the RNA samples used in these assays were treated with RNase-free DNase (Qiagen) in order to remove contaminating gDNA as a safeguard. Then, the software organized the chosen primer pairs by quality, enabling the primer selection. For the initial optimization steps, to determine the primer pairs efficiency, the template used was a pool of total cDNAs from nauplii II, post-larvae, lamellae and adult tissues (prosome and peduncule). For every reaction, the cDNA pool was originally diluted 2-fold, followed by five successively 5-fold dilutions, thus obtaining 6 consecutively diluted samples (with the respective duplicates). In the case of 18S the initial pool was diluted 250-fold, and in the case of GAPDH, CP-19K, and -100K the initial pool was not diluted. All genes were tested under the same conditions,
FCUP Molecular targets involved in the goose barnacle Pollicipes pollicipes (Cirrepedia) larvae metamorphosis and settlement 16 except for the annealing temperature, which was specific for each primer pairs (calculated with Beacon Designer™). All qPCR assays were performed on iCycler iQ™5 (BioRad), using PerfeCTa® SYBR® Green SuperMix (Quanta Biosciences). We tested these primers by qPCR but found that they had low efficiencies. Therefore, we decided to design new pair of primers as previously explained but to amplify a shorter target region of 100-150 bp (qPCR standard). The calibration curves for each target gene were then obtained and analyzed. Besides efficiency, there are other parameters that need to be taken into account when analyzing a calibration curve. The Ct is the intersection between an amplification curve and a threshold line, and its absolute value (number of cycles) can be helpful in comparing the amount of template among different samples (as the Ct value increases with a decreasing amount of template). However, this comparison is only valid when all other factors (such as reagents, instruments and assays) are equal, as it is the case of the present work. The equation below describes the exponential amplification of PCR: Cn = Ci x (1 + E)n Cn = copy number at cycle n Ci = initial copy number n = number of cycles E = efficiency of target amplification When maximum efficiency is attained (E = 1) the fold increase will be 2 at each cycle, meaning that each template available is amplified, and the number of copies doubles with each cycle. With low efficiencies, the PCR products generated at each cycle is decreased, and the amplification plot is delayed. In addition, it is necessary to take into account the R2 value, as it is a critical parameter to evaluate PCR efficiency. R2 is a statistical term that gives indication on how good a certain value is at predicting another in the amplification plot. The ideal value for R2 is 1, as it would mean that a certain Ct value could accurately predict the quantity of amplified copies of the target. If R2 is 0, it is not possible to predict the quantity of amplified copies of the target using a Ct value. Usually, an R2 value >0.99 gives good confidence in correlating two values. qPCR was carried out by combining 10 µL PerfeCTa® SYBR® Green SuperMix (2X) (Quanta Biosciences), 0.6 µL of primer mix (10 µM of each primer) and 2 µL of template cDNA in a 20 µL final volume (completed with 7.4 µL of water DNase, RNaseand protease-free, Invitrogen). qPCR was performed as follows: an initial denaturation step of 95 °C for 3 minutes, followed by 40 cycles of 15 seconds
FCUP Molecular targets involved in the goose barnacle Pollicipes pollicipes (Cirrepedia) larvae metamorphosis and settlement 17 at 95 °C, 30 seconds at the lower annealing temperature of the primer pair and 30 seconds at 72 °C; then a denaturation step of 95 ºC for 75 seconds followed by 81 cycles of 10 seconds, in which the set point temperature (55 ºC) increases 0.5 ºC per cycle after cycle 2, reaching a maximum temperature of 95 ºC, in order to obtain the melting curve. In the qPCR assays a cDNA pool of each sample was employed. As there were no replicate samples, no statistical analyses were performed. Blanks and negative controls were used throughout all amplification processes to control gDNA contamination of the samples. A standardization procedure was required in order to be able to compare the expression levels of each target gene (relative quantification) and analyze the changes in expression level of mRNA, interpreted as cDNA. This procedure enables us to report a ratio for the expression of the target genes divided by the expression of the reference genes, thus allowing comparison of the former ones, even not knowing its absolute level of expression. Those are selected based on the stability of their level of expression under the conditions of the experiment, a condition that we could only suspect of, and could not be sure about. We searched for genes whose sequences were available on the public databases and that are often used as reference genes on other experiments, due to their stability, hoping they would be similar in ours. Expression levels of the selected genes were quantified in order to access the possibility of using them as reference genes. The selection of the reference genes was made according to: 1) primer efficiency between 80%-110%; 2) determination of the most stable genes using geNorm software (Vandesompele et al., 2002). geNorm software ranks the tested genes based on their stability measure (M), determining the most stable genes for normalization. The M value represents the mean pair-wise variation between a gene and all other candidates. The gene with the highest M value is excluded from the analysis, and this calculation is repeated in a stepwise method until the best two genes are found. The threshold value for considering a gene to be a suitable for data normalization is suggested to be ≤ 1.5. However, it was not possible to normalize the results using the reference genes, since they were not stable according to geNorm (all reference genes had M > 1.5). Therefore, normalization was calculated using the cDNA quantity employed in each sample. To analyze the results, the 2-ΔΔCt method was used. !
FCUP Molecular targets involved in the goose barnacle Pollicipes pollicipes (Cirrepedia) larvae metamorphosis and settlement 18 !
FCUP Molecular targets involved in the goose barnacle Pollicipes pollicipes (Cirrepedia) larvae metamorphosis and settlement 19 ! ! ! ! ! Results ! ! ! ! ! ! ! ! ! ! !
FCUP Molecular targets involved in the goose barnacle Pollicipes pollicipes (Cirrepedia) larvae metamorphosis and settlement 20 P. pollicipes larvae developmental and morphometric analyses In Figure 3, the results of larvae counting throughout development are shown at 3 temperatures. The number of individuals decreases over time, which is expected due to normal mortality, and the culture grown at 16ºC lasts longer (30 days) than any other, while at 24 ºC the culture time is the lowest (19 days). Larvae survival rate was described through a linear model that correlates survival with development (Figure 4). It shows that in the range of temperatures tested the survival of larvae was independent of temperature; the effect of temperature was on the developmental rate. Time is expressed using day-degrees (Do), which allows expressing the time in terms of development. The effect of temperature is included in the X axis itself as an index of development (Kamler, 2012). The following equation exemplifies how to calculate Do: Dº = Δ t x T (1) where is developmental time in days and T is the temperature in ºC. A linear equation (2) describes the relation between survival rate and larval development: Survival rate = -0.2438 (day degrees) + 116.91 (2) where survival rate is expressed in percentage (%). This suggests that temperature does not affect the survival rate of P. pollicipes larvae, as far as development is considered.! 0 10000 20000 30000 40000 50000 60000 2 4 6 8 10 13 14 16 19 21 23 25 27 30 Number!of!individuals Age!(days) 16ºC 22ºC 24ºC Figure 3 – Total number of P. pollicipes larvae throughout developmental time, under different culturing temperatures.
FCUP Molecular targets involved in the goose barnacle Pollicipes pollicipes (Cirrepedia) larvae metamorphosis and settlement 21 In order to describe survival along time (natural days) as a function of temperature, we have to combine equations (1) with eq. (2), in eq. (3): Survival Rate = -0.2438 x Δ t (days) x T (ºC) + 116.91 (3) where survival rate is expressed percentage (%), ∆" is developmental time in days and T is the temperature in ºC. At all tested temperatures, Nauplii I are present only in the first two days of culture and nauplii II develop in the first or second day of culture (Figure 5). Until the appearance of nauplius III ate the fourth culture day development appeared similar for all cultures. However, later temperature had a significant role to play on the subsequent larval developmental stages. Due to the delay in development, the larvae grown at 16 ºC lasted longer (until day 30 of culture), with larvae ranging from nauplius IV to VI found only at day 30. Despite the longer culture time, cypris stage was never reached. In the cultures grown at higher temperatures (22 ºC and 24 ºC) development occurred faster and the duration of each larval stage and culture time was shorter (Figure 5). In both cases, nauplius IV and V appeared at the same culture day (eighth day), earlier than at 16 ºC. Nonetheless, in the 22 ºC culture, the cypris stage was reached at the last culture day. It was the only culture in which the cypris stage was reached, as at 24 ºC the larvae only reached nauplius VI. Morphometric measurements were performed on the different naupliar stages, in order to establish correlations between the size of some structures and the naupliar developmental stages. The structures measured in nauplius included total length (TL), carapace width (CW), carapace length (CL), furcal length (FL) from the anterior part of the carapace up to the furcal ramus and fronto-lateral horns length (see Figure 6 to detailed nauplius morphology). In the case of cyprids, 00 20 40 60 80 100 120 0100 200 300 400 500 % Day degrees (ºD) Survival Rate Figure 4 - Chart representing the P. pollicipes larvae survival rate along development (day degrees), using data obtained at three temperatures: 16 ºC, 22 ºC and 24 ºC.
FCUP Molecular targets involved in the goose barnacle Pollicipes pollicipes (Cirrepedia) larvae metamorphosis and settlement 22 only the CW and CL were measured, along with the attachment antenulles length (structure present just in cyprids, not shown in the results).! Measurements were performed in at least 50 individuals of each larval stage, and the means values obtained for each measured structure was plotted at Figure 7. It is observable that the CW, CL, TL and the FL increase along the naupliar stages, but not valid in the case of cyprids, due to their drastic change in shape after metamorphosis. The size of the fronto-lateral horns throughout naupliar development does not seem to be relevant to distinguish the larval stages, as there is little difference between the measured values. A chart representing CW against CL was made in order to verify if this relationship was a good indicator for the differentiation of the naupliar stages based on morphometric values (Figure 8). In the initial developmental stages, ranging from nauplius I to III, the most distinguishable characteristic is the CW, which increases with each molt, while CL remains nearly unaltered. There is only a slight overlapping between the naplius II and III CW values. With the molt to nauplius IV and until the nauplius VI stage is reached, a progressive increase in both CL and Fronto-lateral horn Labrum Cephalic shield Furcal ramus Dorsal thoracic spine Naupliar eye Cephalic shield Thoraco-abdominal process Figure 7 – Comparison of the mean values of the measured structures at different P. pollicipes larval development stages. Figure 6 – Stage V nauplius larvae morphology, with detailed and labeled structures (adapted from Molares et al, 1994). 0 100 200 300 400 500 600 Carapace. width. (µm) Carapace. length.(µm) Total.length.(µm) Furcal.length.(µm) Fronto?lateral. horns.length.(µm) Size%(µm) Nauplius. I Nauplius. II Nauplius. III Nauplius. IV Nauplius. V Nauplius. VI Cypris
FCUP Molecular targets involved in the goose barnacle Pollicipes pollicipes (Cirrepedia) larvae metamorphosis and settlement 29 TG and in the sequencing results CT; regarding Ppol100K1948, there was a T in the EST that after sequencing turned out to be a C. These small errors prevented the primer binding and subsequent amplification. New reverse primers were designed based on the sequencing results, enabling the amplification of the complete CP-100K sequence. A detailed table of all the polymorphisms can be found in Table 3, in Annex. Additionally, four heterozygous positions were detected across CP-100K coding sequence, three of them leading to an amino acid change. An example is showed in Figure 16; for a complete list see Table 4 in Annex. Nonetheless, when using gDNA as template, amplification of CP-100K coding sequence was only achieved with fragment 3, 4 and 5 (the 3’ region). !In the case of CP-52K, two fragments with a total length of 750 bp in the coding sequence were successfully amplified and sequenced using cDNA as template (Figure 17). The fragment is located on the 3’ region of the target gene, and also allowed the identification of some polymorphisms (Figure 20). No amplification was achieved with gDNA. Regarding CP-20K, the only target gene for which the designed primers were degenerate, no amplification was accomplished, neither in cDNA nor gDNA. Different annealing temperatures, DNA polymerases and amplification cycles were tested but without success. The only primer pair designed for CP-19K, based on the single EST available, successfully amplified the target region using cDNA as template, enabling the sequencing of about 550 bp. Again, no amplification was accomplished when using Figure 16 – Example of a heterozygous position on CP-100K fragment 3 on cDNA (top image) and gDNA (bottom image). The two alternative bases (indicated by the red circles) originate two different amino acids: threonine and serine. Image generated with Geneious software. Figure 17 – Schematic representation of CP-52K protein cDNA sequence of P. pollicipes. The purple bars correspond to the overlapping fragments amplified by PCR and the green arrows represent the primers. Image generated with Geneious software. ! !
FCUP Molecular targets involved in the goose barnacle Pollicipes pollicipes (Cirrepedia) larvae metamorphosis and settlement 30 gDNA as template. In addition, some polymorphisms were detected, as shown in Figure 18. The sequencing results can be found in Figure 20. !Finally, both SIPC’s primer pairs amplified the respective target regions, allowing sequencing of two fragments: fragment 1 (392 bp) and fragment 2 (264bp) (Figure 19). While these two fragments were easily amplified with cDNA, the amplification was unsuccessful when using as template gDNA. Polymorphic positions were also found in both fragments (Table 3, in Annex). Sequencing results available in Figure 20. ! ! ! ! ! ! ! ! ! Figure 18 – Geneious alignment of the sequencing result of CP-19K with the EST of P. pollicipes collected from public databases. The purple bars correspond to the fragment amplified by PCR, the green arrows represent the primers and the red circles indicate the identified polymorphic positions. Image generated with Geneious software. Figure 19 - Schematic representation of SIPC protein cDNA sequence of P. pollicipes. The purple bars correspond to the fragments amplified by PCR and the green arrows represent the primers. Image generated with Geneious software.
FCUP Molecular targets involved in the goose barnacle Pollicipes pollicipes (Cirrepedia) larvae metamorphosis and settlement 31 A) B)! C)!! D) ! E) ! Figure 20 – Sequencing results of the target genes, with the nucleotides translation. A) Partial cDNA sequence of CP-19K gene; B) Partial cDNA sequence of CP-52K gene; C) Full cDNA sequence of CP-100K gene; D) cDNA sequence of the SIPC fragment 1; E) cDNA sequence of SIPC fragment 2. Images generated with Geneious software.
FCUP Molecular targets involved in the goose barnacle Pollicipes pollicipes (Cirrepedia) larvae metamorphosis and settlement 32 Sequence alignments !The new cDNA and amino acid (AA) sequences of the target genes were aligned with the sequences of phylogenetic closely related species available in public databases. The pairwise identity between sequences is shown on Table 5 (cDNAs) and Table 6 (amino acid). Regarding the cDNA sequences, we found cDNA sequences of CP-19K available for three species: M. rosa, B. improvisus and F. albicostatus. The alignments showed some similarity between the species’ sequences and the obtained for P. pollicipes, which ranged from 56.1% to 59.6%. For CP-52K, only the M. rosa cDNA sequence was available, and the similarity between the two sequences was 52.6%. Regarding CP-100K, there were available sequences for M. rosa and A. amphitrite, which also had a relatively high similarity with the sequence obtained from P. pollicipes – 54.7% and 61.2%, respectively. Concerning SIPC, A. amphitrite, B. improvisus and M. rosa sequences were available and were aligned with both P. pollicipes SIPC fragments sequenced. The P. pollicipes SIPC fragment 1 (closer to the 5’ end of the CDS) had a lower similarity with the other sequences – between 53.8% and 55.2% – than the fragment 2 (closer to the 3’ end of the CDS), in which the values ranged from 68.9% and 74.4%. This result indicates a higher conservation of the 3’ end of the SIPC gene. It is noteworthy to mention that the SIPC cDNA sequences of B. improvisus and M. rosa are roughly the same size (2600 bp long), but the A. amphitrite is considerably longer (4600 bp). Table 5 - Similarity of barnacle cDNA sequences between different species. CP-19K CP-52K CP-100K SIPC 1 SIPC 2 P. pollicipes vs. M. rosa 56.1% 52.6% 54.7% 53.8% 73.1% P. pollicipes vs. A. amphitrite Not available Not available 61.2% 55.2% 68.9% P. pollicipes vs. B. improvisus 58.6% Not available Not available 54.9% 74.4% P. pollicipes vs. F. albicostatus 59.6% Not available Not available Not available Not available In terms of AA sequences, the low similarity values were found in all comparisons. The alignments made with the translated cDNA sequences of CP-19K had similarities ranging from 36.9% (for M. rosa) to 38.2% (for F. albicostatus). In the
FCUP Molecular targets involved in the goose barnacle Pollicipes pollicipes (Cirrepedia) larvae metamorphosis and settlement 33 case of CP-52K, the similarity with the M. rosa protein sequence was very low – 12.9%. Regarding the CP-100K AA sequences, there is a higher similarity between the AA sequences of the P. pollicipes and A. amphitrite (44.7%) than with the M. rosa (34.7%). It is important to mention that the alignments showed conserved regions between the different proteins sequences, even in the case of CP-52K, where the similarities were lower. However, the case of SIPC is singular, as there is no direct relation between the similarities of the cDNA sequences alignments and those of the AA sequences. When comparing the different AA sequences, it was striking that there are almost no similarities between the P. pollicipes, M. rosa and B. improvisus. Only the SIPC fragment 2 had some similarities with the AA sequence of B. improvisus, but it is a misleading result. The sequence of fragment 2 aligned in the beginning of the B. improvisus CDS, which makes no sense because that fragment does not possess an initiation codon. This suggests nearly inexistent sequence conservation between them. Nevertheless, when aligning with the A. amphitrite AA sequence, the similarities increased, reaching 37.9% in fragment 1 and 68.2% in fragment 2. This indicates that the P. pollicipes SIPC protein is more similar to the one produced by A. amphitrite. Table 6 - Similarity of barnacle AA sequences between different species.! CP-19K CP-52K CP-100K SIPC 1 SIPC 2 P. pollicipes vs. M. rosa 36.9% 12.9% 34.7% 29.6% 68.2% P. pollicipes vs. A. amphitrite Not available Not available 44.7% 37.9% 68.2% P. pollicipes vs. B. improvisus 37.6% Not available Not available 20% 73.3% P. pollicipes vs. F. albicostatus 38.2% Not available Not available Not available Not available Real-time quantitative PCR (qPCR) optimization assays !The qPCR primers were firstly tested by conventional PCR to ensure that they amplified the target region specifically. The amplification was confirmed by agarose gel electrophoresis and sequencing (Figure 21). All the primer pairs amplified specifically, except for the TATA-binding protein primers in which no amplification was achieved. For this reason, the TATA-binding protein was not used.
FCUP Molecular targets involved in the goose barnacle Pollicipes pollicipes (Cirrepedia) larvae metamorphosis and settlement 34 After the early tests, it was notorious that the applied initial cDNA pool concentration should not be equal for all interest genes, due to different threshold cycles (Cts) values obtained. The Ct values obtained with 18S were very low, the sample with highest concentration had a Ct value under 10 cycles, meaning that the initial amount of template was too high. Therefore, the cDNA pool used for the 18S expression studies was initially diluted 250-fold. In contrast, GAPDH, CP-19K, and - 100K presented very high Ct values, the sample with the highest concentration had a Ct value above 25 cycles, which indicated that the amplification reaction was entering delayed in the exponential phase, due to low template concentration. In these cases, the initial cDNA pool was not diluted, in order to have the maximal concentration possible. After these adjustments, the amplification plots obtained with the serial dilutions for these interest genes presented a more acceptable range of Ct values, ranging from 10 to 25, respectively from the most concentrated to the most diluted samples. In terms of specific amplification of the target regions, no problems were encountered on all the designed qPCR primers, either target or reference. The obtained melting curves had a single peak, which indicates that a single product is being amplified. Figure 22 shows an example of the obtained melting curve of Elongation Factor, a reference gene. CP-100K CP-19K SIPC 18S β-actin EF C+ CP-52K Tubulin GAPDH Figure 21 - Amplified cDNA fragments of the targets of the genes of interest separated on 2% agarose gel electrophoresis. The red squares indicate the amplified product.
FCUP Molecular targets involved in the goose barnacle Pollicipes pollicipes (Cirrepedia) larvae metamorphosis and settlement 35 In all the studied genes, the qPCR assays performed, a solid R2 value (always above 0.98) was obtained, which gives credibility to the amplification plots, as it allows correlating the values between the Ct and the quantity of amplified copies of the target. Generally, efficiency values between 80% and 110% are considered acceptable, and the efficiencies obtained for most of the genes of interest were within this range, except for GAPDH and Tubulin reference genes. Consequently, these genes were excluded (see Table 7 for detailed efficiency values). Table 7 – Efficiencies of the genes of interest obtained in the qPCR assays. ! ! ! Target gene Efficiency 18S 83.9% -actin 92.4% Elongation factor 95.4% GAPDH 69.8% Tubulin 52.1% CP-19K 99.8% CP-52K 89% CP-100K 101.8% SIPC 98.6% Figure 22 – Melting curve obtained for the reference gene Elongation Factor in qPCR reaction.
FCUP Molecular targets involved in the goose barnacle Pollicipes pollicipes (Cirrepedia) larvae metamorphosis and settlement 36 Having determined and optimized every parameter, qPCR assays were performed. For each developmental stage/tissue tested, one pool of cDNA was employed containing tissue from numerous individuals, due to the limited availability of biological samples and also for resources optimization. This means that in the present assays no replicate samples were used. These were only the very first preliminary assays performed, that will need to be repeated in a near future, in that case under optimal conditions. Nonetheless, the relative expression pattern of each target gene was determined in a pooled sample, not in an individual, which already incorporates some variability of the reality, although being a snapshot. In addition, in order to be able to compare the expression levels of each target gene and analyze changes in their expression patterns, it is necessary a standardization procedure, usually using reference genes. We used geNorm software to analyze their level of expression and to determine which was the most stable. However, the three genes chosen as possible reference genes had an M > 1.5, which excluded them as calibrators (Figure 23). Due to this, normalization was calculated using the cDNA quantity employed in each sample. In the case of CP-19K, it is clear that there is expression of this gene in postlarvae and in the peduncle of adults (Figure 24). In the larval stages, lamellae and prosome there is no expression of this gene. Figure 23 –geNorm software calculation of the stability measure (M) of the candidate reference genes EF, β-actin and 18S. All genes had an M > 1.5, thus no normalization factor could be calculated.
FCUP Molecular targets involved in the goose barnacle Pollicipes pollicipes (Cirrepedia) larvae metamorphosis and settlement 37 In the assays concerning CP-52K, it was also evident that there was only expression of this gene in the pools of post-larvae and adult peduncle, as the other tested samples showed no expression (Figure 25). CP-100K, the last cement protein gene tested, only displayed expression in the post-larvae and peduncle pool samples, similarly to the other CPs genes (Figure 26). In this case, the expression level appears to be higher in the peduncle. Figure 24 – Chart representing the expression levels of CP-19K in different tissues and larval stages tested by qPCR. Figure 25 – Chart representing the expression levels of CP-52K in different tissues and larval stages tested by qPCR. 0.00 0.50 1.00 1.50 2.00 2.50 CP(19K 0.00 100.00 200.00 300.00 400.00 500.00 600.00 700.00 800.00 900.00 1000.00 CP(52K
FCUP Molecular targets involved in the goose barnacle Pollicipes pollicipes (Cirrepedia) larvae metamorphosis and settlement 38 ! ! ! ! ! ! Regarding the expression pattern of SIPC, it seems to be expressed in all the tested pools, except in the lamellae and Nauplius II stage (Figure 27). The adult peduncle looks to be the pool with the highest expression level of all the tested samples. Figure 26 – Chart representing the expression levels of CP-100K in different tissues and larval stages tested by qPCR. Figure 27 – Chart representing the expression levels of SIPC in different tissues and larval stages tested by qPCR. 0.00 0.50 1.00 1.50 2.00 2.50 3.00 3.50 4.00 4.50 5.00 CP(100K 0.00 0.02 0.04 0.06 0.08 0.10 0.12 SIPC
FCUP Molecular targets involved in the goose barnacle Pollicipes pollicipes (Cirrepedia) larvae metamorphosis and settlement 45 than the respective proteins. As previously described, as taxonomic distance increases, the similarities between both cDNA sequences and AA sequences tend to decline (Jonker et al., 2014). qPCR optimization assays We were able to design qPCR primers that bind specifically to the respective target for all genes of interest, with the exception of CP-20K. Primers for five reference genes, including the 18S gene, used as positive control in the PCRs, were also designed successfully. The specificity of the designed primers was assured through the melting curves obtained in the assays. In most cases the amplification efficiencies obtained were acceptable for qPCR assays, having been excluded only two reference genes (GAPDH and Tubulin) due to low efficiency. However, when evaluating the reference genes stability using geNorm, it was clear that these genes could not be used as calibrators for the calculation of the relative expression of the target genes. This was probably due to the fact that the study included individuals in very different developmental stages, from eggs to early nauplii and to adults, in which the expression level of the selected reference genes may have great variations, as they are themselves involved in growth, namely cells structure (β-actin) and protein synthesis (18S and EF). Taking this into account, it is necessary to find and sequence suitable reference genes with a more stable expression pattern over the P. pollicipes development to be used as reference genes, in this and other studies that involve transcription studies in very different developmental stages. This has been achieved for B. amphitrite, in which the transcripts that encoded for cytochrome b and NADH dehydrogenase subunit I were considered stable throughout development (Bacchetti De Gregoris et al., 2009). The cement protein genes analyzed have only displayed expression in postlarvae and in the adults’ peduncle. CP-19K is known to be involved in surface coupling and both CP-52K and CP-100K are believed to be bulk cement proteins, so it is logical that the expression of these genes are observed in the stages already adhered to the substratum (Kamino, Nakano, & Kanai, 2012; Urushida et al., 2007). In the lamellae and naupliar stages II it makes sense that these genes do not present any expression, since the eggs produce no cement and the nauplii II is a planktonic stage far from settlement and fixation, where there is no need of cement production. However, on what concerns nauplii VI and cypris, we have hypothesized that at least some cement proteins could start to have transcription on these stages. On what concerns cypris, it is known that they produce a temporary adhesive, the so-called “footprints”, in order to temporary attach to substrata, while moving to find an
FCUP Molecular targets involved in the goose barnacle Pollicipes pollicipes (Cirrepedia) larvae metamorphosis and settlement 46 adequate fixation place, and chemically communicate with adults and other cypris (Dreanno et al., 2006). In the light of our results, it seems that none of the studied cement proteins are involved in this temporary adhesive. The fact of no cement proteins expression has been observed in the adult prosome is also in accordance with the previous knowledge about the localization of the cement gland in goose barnacles. This gland is situated in the upper portion of the peduncle, tangled with the ovary, just below the prosome (Aldred et al., 2014), corroborating the fact that these cement produced in the cement gland. Comparing juvenile (post-larvae) and adults’ prosome expression, it is seems possible to conclude that CP-52K has an higher expression rate in juveniles than in adults, while the opposite occurs with CP100K. Since juveniles settle on adults’ peduncle cuticule and move down to the substratum during development, we may hypothesize that CP-52K may confer a more temporary attachment character to juveniles’ cement, while CP-100K confers attachment permanency to adults’ cement. In the case of SIPC, there was expression of this gene on every tested sample, except in the lamellae and nauplius II, where the expression was residual. These results are coherent with the previous results, which state that SIPC acts as a contact pheromone, involved in chemical communication, and is expressed both in adults’ cuticule (present in the peduncle and prosome) and in cypris’ “footprints” (Dreanno et al., 2006; Matsumura & Nagano, 1998). Since the post-larvae are juvenile adults and have cuticules, we conclude that SIPC is also expressed at this developmental stage. Regarding nauplius VI, the expression of this gene may be an anticipatory response to the metamorphosis into cypris. The protein may start to be expressed earlier, stored and made active later at cypris stage e.g. through posttranscriptional processes. However, we shall not discharge the hypothesis that SIPC may have a function already at nauplius VI stage, as for instance induction of synchronous and gregarious settlement of these larvae down from the plankton to the rocky shores. The absence of expression in the egg masses and nauplius II is an expected result, since at these early developmental stages there are no apparent need of cues to induce settlement. It is also necessary to take into consideration that the current optimization assays were performed using only one cDNA pool (of numerous individuals) per sample, instead of biological replicates. The limited availability of biological samples and the preliminary character of the study were the reasons for the employed methodology, which allows to have a snapshot of the genes expression patterns throughout development but hinders any statistical treatment of the data or comparison among them. Therefore, it is possible to understand if a gene is
FCUP Molecular targets involved in the goose barnacle Pollicipes pollicipes (Cirrepedia) larvae metamorphosis and settlement 47 expressed in a determined developmental stage, but it is not possible to determine if differences in the expression levels are statistically relevant. Nevertheless, and since this was only intended to be a preliminary qPCR optimization study, it was possible to have an indication on the target genes expression in the different developmental stages and also on the adequacy of the reference genes to normalize gene expression in this specific experiment and species. In order to be able to have more reliable and robust data with which it would be possible to compare the expression levels among different target genes and developmental stages with certainty, biological replicates would need to be employed in the study. That will allow us to deliver more trustworthy results of the target genes expression patterns in future works.
FCUP Molecular targets involved in the goose barnacle Pollicipes pollicipes (Cirrepedia) larvae metamorphosis and settlement 48
FCUP Molecular targets involved in the goose barnacle Pollicipes pollicipes (Cirrepedia) larvae metamorphosis and settlement 49 ! Conclusions and future remarks
FCUP Molecular targets involved in the goose barnacle Pollicipes pollicipes (Cirrepedia) larvae metamorphosis and settlement 50 Barnacles are ideal for bioadhesion and antifouling studies. Nevertheless, the goose barnacle P. pollicipes has been unjustifiably overlooked, as it is an important species of some fouling communities, with significant differences from its non stalked counterparts, the acorn barnacles. However, this animal presents much research potential, since apart from its bioadhesion capabilities, it is also considered a delicacy in the Iberian Peninsula with a future potential to be cultivated commercially. Therefore, it is important to investigate its settlement and adhesion mechanisms. We have focused investigation on four cue points: - To optimize the larvae culturing conditions; - To identify efficiently the different naupliar stages; - To characterize the cement proteins and SIPC involved in settlement and fixation; - To optimize qPCR conditions in order to perform quantitative transcription studies. The effect of temperature on larvae development and survival rates was assessed. It was concluded that temperature does not affect the larvae survival rate and it influences larval development. Best development results were obtained on cultures grown at 22 ºC, where larvae reached successfully the cypris stage. In addition, from the morphometric analysis carried out, it was concluded that the traits carapace width (CW) and carapace length (CL) provided good results on nauplii staging, as the larvae formed discrete clusters according to their developmental stage, when analyzed according to these two dimensions. Moreover, additional research must be done in order to be able to culture adult P. pollicipes both for aquaculture and experimental purposes, as there are many other factors influencing cypris and juveniles’ development and survival. In a near future, we intend to test the potential effects of natural allelopathic compounds, extracted from cyanobacteria and fungi, to induce/inhibit larval settlement. That potential will be assessed using quantitative transcription assays optimized for the target genes sequenced and others involved in the process and not included in this study. We were able to sequence CP-100K, CP-52K, CP-19K and SIPC. In the case of CP-100K we were able to obtain the first complete cDNA sequence, and on the other genes, we attained partial cDNA sequences, except for CP-20K. The attained sequences provide useful data to design functional primers and to perform gene expression studies. Our work also demonstrated that the ESTs sequences available on public databases for these genes are not fully correct. In addition, several polymorphic regions were identified, which may be useful data to understand the
FCUP Molecular targets involved in the goose barnacle Pollicipes pollicipes (Cirrepedia) larvae metamorphosis and settlement 51 evolution of cement protein genes, as these regions may be useful for phylogenetic and population studies. This work sets the grounds for the complete sequencing of cement protein genes in P. pollicipes. In future work, full sequencing of CDS of the target genes, now only partially sequenced (CP-19K, CP-52K and SIPC), is an objective, as well as other cement proteins not studied here and already identified in other barnacle species. For that purpose, 5’-RACE and/or 3’-RACE shall be carried out, as these techniques are specially designed for the amplification of regions with unknown sequences, simply requiring a short sequence within the target mRNA and a single specific primer (Frohman, Dush, & Martin, 1988; Ohara, Dorit, & Gilbert, 1989). In addition, it would be advantageous to obtain the gDNA sequences of these genes, in order to identify possible existing introns, whose localization would be useful in the design of more efficient qPCR primers. It was performed the first similarity analysis of adhesive proteins and SIPC across stalked barnacles (P. pollicipes) and acorn barnacles, comparing cDNA and amino acid sequences. It was an effort to understand the possible homologies among the proteins involved in the fouling of these animals, which unraveled different degrees of conservation in these species. However, more data is required in order to determine the evolutionary processes that occurred in the barnacle taxa, and even with other fouling animals. For this study, complete CDS sequences are advantageous. Concerning the qPCR, we were able to design primers with good efficiencies and specific for target and some reference genes, that can be used in future experiments. However, none of the proposed reference genes had a stable expression through the different P. pollicipes developmental stages, which did not allow us to use them to calculate a normalization factor to normalize relative expression of the target genes. Therefore, it is still required to identify suitable reference genes appropriate for this assay that requires the use of different stages of P. pollicipes, with very different growth and protein synthesis rates. We recommend to look for genes not involved in these processes. Nonetheless, it was possible to perform a preliminary optimization assay using cDNA quantity of the samples in normalization. cDNA pooled samples were used, due to the preliminary character of the assay, which does not allow us to perform statistical analyses, but gives us an indication of the expression patterns of the target genes in the different tissues and developmental stages. The CP genes – CP-19K, CP-52K and CP-100K – are expressed in the adults’ peduncle and in the post-larvae, which lead us to conclude that these proteins are part of the permanent
FCUP Molecular targets involved in the goose barnacle Pollicipes pollicipes (Cirrepedia) larvae metamorphosis and settlement 52 cement, and not of the temporary adhesive produced by cypris. We suspect that CP52K, more expressed in juveniles than in adults, may be related to the more semitemporary character of juveniles’ attachment, while CP-100K may be a typical permanent adhesion protein, as it is more expressed in adults. The SIPC gene was expressed in every developmental stage and adult tissue, except for the egg masses and nauplius II. This result agrees with previous works describing this protein as a contact pheromone present in cypris footprints and adults cuticle. However, in order to obtain more robust data, once fully optimized, qPCR assays will be performed with biological replicates. This would provide a deeper insight in the pattern of cement protein production and adhesion process control.
FCUP Molecular targets involved in the goose barnacle Pollicipes pollicipes (Cirrepedia) larvae metamorphosis and settlement 53 ! ! ! ! ! ! References ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! !
FCUP Molecular targets involved in the goose barnacle Pollicipes pollicipes (Cirrepedia) larvae metamorphosis and settlement 54 Aldred, N., Hartshorn, C. M., Lee, Y. J., Cicerone, M. T., Orihuela, B., Clare, A. S., (2014). Synergistic roles for lipids and proteins in the permanent adhesive of barnacle larvae. Nature Communications, 5, 1–9. Aldred, N., Høeg, J. T., Maruzzo, D., & Clare, A. S. (2013). Analysis of the Behaviours Mediating Barnacle Cyprid Reversible Adhesion. PLoS ONE, 8(7), e68085. Altschul, S. F., Gish, W., Miller, W., Myers, E. W., & Lipman, D. J. (1990). Basic local alignment search tool. Journal of Molecular Biology, 215(3), 403–410. Anderson, D. T. (1994). Barnacles: structure, function, development and evolution. Bacchetti De Gregoris, T., Borra, M., Biffali, E., Bekel, T., Burgess, J. G., Kirby, R. R., & Clare, A. S. (2009). Construction of an adult barnacle (Balanus amphitrite) cDNA library and selection of reference genes for quantitative RT-PCR studies. BMC Molecular Biology, 10(1), 62–12. http://doi.org/10.1186/1471-2199-10-62 Barnes, M. (1996). Pedunculate cirripedes of the genus Pollicipes. Oceanography and Marine Biology: an Annual Review. Bultman, J. D., & Griffith, J. R. (1980). FOULING RELEASE COATINGS. Naval Engineers Journal, 92(2), 129–132. http://doi.org/10.1111/j.15593584.1980.tb05264.x Bustin, S. A. (2004). AZ of quantitative PCR. Clare, A. S. (2010). Toward a Characterization of the Chemical Cue to Barnacle Gregariousness. In Chemical Communication in Crustaceans (pp. 431–450). New York, NY: Springer New York. http://doi.org/10.1007/978-0-387-77101-4_22 Crisp, D. J. (1973). Mechanisms of adhesion of fouling organisms. Marine Corrosion and Fouling, pp. 691–709 (R. F. Acker, B. F. Brown, D. R. DePalma, & W. P. Iverson, Eds.) Crisp, D. J., & Meadows, P. S. (1962). The Chemical Basis of Gregariousness in Cirripedes. Proceedings of the Royal Society B: Biological Sciences, 156(965), 500–520. http://doi.org/10.1098/rspb.1962.0052 Cruz, T., & Araújo, J. (1999). Reproductive Patterns of Pollicipes pollicipes (Cirripedia: Scalpellomorpha) on the Southwestern Coast of Portugal. Journal of Crustacean Biology, 19(2), 260. http://doi.org/10.2307/1549232 Cruz, T., & Hawkins, S. J. (1998). Reproductive Cycle of Pollicipes Pollicipes at Cabo De Sines, South-West Coast of Portugal. Journal of the Marine Biological Association of the United Kingdom, 78(02), 483–496. http://doi.org/10.1017/S0025315400041576 Cruz, T., Castro, J. J., & Hawkins, S. J. (2010). Recruitment, growth and population size structure of Pollicipes pollicipes in SW Portugal. Journal of Experimental
FCUP Molecular targets involved in the goose barnacle Pollicipes pollicipes (Cirrepedia) larvae metamorphosis and settlement 61 ! ! ! ! ! Annex ! !
FCUP Molecular targets involved in the goose barnacle Pollicipes pollicipes (Cirrepedia) larvae metamorphosis and settlement 62 Table 1 - List of designed PCR primers used in this study. Target gene Primer name Sequence (5’-3’) Annealing temperature * Expected amplicon length in reference cDNA (bp) Successful PCR amplification in cDNA 18S Ppol18S348F TAGTGGCTGACCGTGGCTC 61.6 ºC 106 Yes Ppol18S453R TTACGCGCCTGCTGCCTTC 61.6 ºC CP19K Ppol19K1F TCGGCCCTTCTCCTCTGG 60.8 ºC 628 Yes Ppol19K628R TCGCCCCTCAGCCAGTGA 60.8 ºC CP20K Ppol20K137F SMCCCSTGCTACCACTGC 60.8-62.9 ºC 333 No Ppol20K470R GCTGCACTCACAGCCGCA 60.8 ºC Ppol20K137F SMCCCSTGCTACCACTGC 60.8-62.9 ºC 353 No Ppol20K490R CGCATCACAAGCGCCGCA 60.8 ºC CP52K Ppol52K14F TTCGCCACACAGTCCTCTC 59.5 ºC 1131 No Ppol52K1145R AGTTGTTAAAGCTGTCCGAGGA 60.1 ºC Ppol52K37F TCCTCGGACAGCTTTAACAAC 59.5 ºC 750 Yes Ppol52K787R TTCCGACAACCGTGCAGAG 59.5 ºC Ppol52K38F ATGTTACTTCGCCCGGTGCT 60.5 ºC 1107 No Ppol52K1145R AGTTGTTAAAGCTGTCCGAGGA 60.1 ºC Ppol52K98F TCCAGGCCGTACTTCCCC 60.8 ºC 1047 No Ppol52K1145R AGTTGTTAAAGCTGTCCGAGGA 60.1 ºC Ppol52K101F GAACCATCCCAGCCGCC 59.8 ºC 262 Yes Ppol52K363R TGATCCCGCGGATTTGACTG 60.5 ºC Ppol52K346F GCAAATCAGCAGGATCACCC 60.5 ºC 305 Yes Ppol52K651R CCGTTGTCTACCACCAGC 58.4 ºC Ppol52K346F GCAAATCAGCAGGATCACCC 60.5 ºC 422 No Ppol52K768R CAGTAGACAAGACGCCAGTTT 59.5 ºC CP100K Ppol100K35F CTGGCCCGACCATGCCG 61.8 ºC 893 No Ppol100K927R TCCGCTGCGTGTTCGCAG 60.8 ºC Ppol100K35F CTGGCCCGACCATGCCG 61.8 ºC 823 Yes Ppol100K858R AGCCCCGTCATCCTCTCAA 59.5 ºC Ppol100K796F ACGCTCTCCTCCCGCGG 61.8 ºC 513 Yes Ppol100K1308R ACGACGGTCGGGTCGAAG 60.8 ºC Ppol100K796F ACGCTCTCCTCCCGCGG 61.8 ºC 1153 No Ppol100K1948R AAAATCGATGTCGAACGGCTG 59.5 ºC Ppol100K1221F TTCTCCGTGTGGCGGTGTC 61.6 ºC 682 Yes Ppol100K1903R GGCACCGTGTTGACGAACT 59.5 ºC Ppol100K1803F GCGGACTGCAGCAGTTCT 58.4 ºC 1053 Yes Ppol100K2855R CAGGCCCGATTGGATGCC 60.8 ºC Ppol100K2718F GGGGAGCTGACCTCGTACT 61.6 ºC 928 Yes Ppol100K3645R CTACATGATAACACCACGCCA 59.5 ºC
FCUP Molecular targets involved in the goose barnacle Pollicipes pollicipes (Cirrepedia) larvae metamorphosis and settlement 63 Ppol100K2718F GGGGAGCTGACCTCGTACT 61.6 ºC 944 No Ppol100K3661R AATATAATTTTATTTGCTACATGATAACA 57.6 ºC SIPC PpolSIPC113F TCCTCTTCACGTCGCCCAAG 62.5 ºC 392 Yes PpolSIPC504R GGTACCTGGGCTTGTCCGT 61.6 ºC PpolSIPC4027F TCAACCAGCAGCGCAACAG 59.5 ºC 264 Yes PpolSIPC4290R TTTGGATCACCACGCAGCC 59.5 ºC * Annealing temperatures calculated using OligoCalc (Kibbe, 2007). ! Table 2 - List of designed qPCR primers used in this study. Target gene Primer name Sequence (5’-3’) Annealing temperature * Expected amplicon length in reference cDNA (bp) Successful PCR amplificatio n Primer efficienc y 18S Ppol18S1292 F AGGATTGACAGACCGATA G 55 ºC 226 Yes 76.7% Ppol18S1518 R GAACATCTAAGGGCATCA C Ppol18S1282 F GGACACCGTAAGGATTGA CAG 54.2 ºC 121 Yes 83.9% Ppol18S1403 R GCCAGAGTCTCGTTCGTT ATC β-actin Ppolβactin275F ATCGTGCGTGACATCAAG 53.8 ºC 178 Yes 75.4% Ppolβactin453R AGGAAGGAAGGCTGGAAC 56.3 ºC Ppolβactin274F AATCGTGCGTGACATCAA G 55.7 ºC 95 Yes 92.4% Ppolβactin369R CTCTTCTCCAGCGAGGTG Elongati on Factor PpolEF654F GCTGTCGGCGTCATCAAG 58.4 ºC 238 Yes 86.4% PpolEF892R CAATGCGATATAAGCCAC TGAG 60.1 ºC PpolEF218F GGTCAAGTCTGTGGAGAT G 54 ºC 131 Yes 95.4% PpolEF349R TTGTTCTTGGAGTCGGAT G GAPDH GAPDHpF CCCCCTGGACTACATGGT Gtayatgttyaa 69.2-72.1 ºC 843 Yes Untested GAPDHpR CAGCTGGATGCCGgcyttng crtc 68.5-73.8 ºC PpolGAPDH1 5F TGTTCAAGTATGACTCCAC 53 ºC 238 Yes 48.8% PpolGAPDH2 43R GAGATGACCACCTTCTTG 53.8 ºC PpolGAPDH3 69F TCCACGACAACTTCACCAT C 55.5 ºC 79 Yes 69.8% PpolGAPDH4 48R TCCGTCCACCGTCTTCTG TATATBPpF GCTGCAAGCTGGACCTGa 68.5-73 ºC
FCUP Molecular targets involved in the goose barnacle Pollicipes pollicipes (Cirrepedia) larvae metamorphosis and settlement 64 binding protein araarathgc 423 No X TBPpR TTGAAGCTCTTCAGGATGg grtadatrtt 64.6-69.1 ºC Tubulin tubulinF GAGCACTCCGACTGCgcntt yatggt 69.5-72.8 ºC 420 Yes Untested tubulinR CCTTGAAGCCGGTGggrcac cartc 70.7-74 ºC Ppoltubulin57 F AGATCGTTTCCTCCATCAC 55 ºC 220 Yes 71.5% Ppoltubulin27 7R GTCGCACTTGACCATCTG 56.3 ºC Ppoltubulin10 6F CGTTGATCTGACCGAGTT C 58 ºC 171 Yes 52.1% Ppoltubulin27 7R GTCGCACTTGACCATCTG 56.3 ºC CP-19K Ppol19K220F CCCATCGCCAAACTGAAG G 59.5 ºC 152 Yes 80.1% Ppol19K372R TCCGCTCGTTGTGGTCAC 58.4 ºC Ppol19K60F GAACAGTGGTCCGCTTGG 54.8 ºC 185 Untested Unknown Ppol19K245R CCGTTGTCCTTCAGTTTG G 53.2 ºC Ppol19K477F AAAGGTGGTGAAGTTGGA AGAC 55.5 ºC 80 Yes 99.8% Ppol19K557R CCGTTGTGGGTGCTGGAG CP-52K Ppol52K333F CAGAAGGTTGATCCATCC 53.8 ºC 218 Yes 78.6% Ppol52K551R GGTAACGGTAGCAGTAAC Ppol52K460F GTCTTCCTCGCCTTCTTC 55 ºC 109 Yes 89% Ppol52K569R CGGTAACGGTAGCAGTAA C CP-100K Ppol100K114 6F GCTGTTCATCAGACTCAC 53.8 ºC 199 Yes 67.9% Ppol100K134 5R CCTCGGTGTATATGTTCTG 55 ºC Ppol100K284 0F GCTTCGTCATCATCTTGTA C 51.3 ºC 204 Untested X Ppol100K304 4R TAGAGTGGCAGGTCCTTC 51.4 ºC Ppol100K303 2F ACCTGCCACTCTACATCC 55.4 ºC 92 Yes 101.8% Ppol100K312 4R TGCCGTTGATTCTCTGAA G SIPC PpolSIPC94F ACCCTCAGTCTCTCACTC 56.3 ºC 241 Yes 93.9% PpolSIPC335 R GGCTTGTCCGTTTGAATC 53.8 ºC PpolSIPC229 F CACCTGGACCTCAGCATT G 54.2 ºC 86 Yes 98.6% PpolSIPC315 R TGTCAGCAGCGTGAATGG • Annealing temperatures calculated using Beacon Designer™ (PREMIER Biosoft International). !
FCUP Molecular targets involved in the goose barnacle Pollicipes pollicipes (Cirrepedia) larvae metamorphosis and settlement 65 Table 3 - List of polymorphisms identified in the coding regions of the target genes sequenced. Gene Position Nucleotide in our results Nucleotide in the ESTs A.a. in our results A.a. in the ESTs CP-100K 186 C T Asparagine Asparagine 818-819 CT TG Proline Leucine 821 G C Glycine Alanine 1890 C T Phenylalanine Phenylalanine 2034 C T Alanine Alanine 2370 G A Proline Proline 2399 C A Alanine Aspartic acid 2537 A T Histidine Leucine CP-52K 103 G A Alanine Threonine 193 A G Isoleucine Valine 371 G A Arginine Lysine 391 G A Valine Methionine 396 G A Lysine Lysine CP-19K 91 C G Proline Alanine 189 G C Glycine Glycine 309 G T Glutamine Histidine 344 A G Aspartic acid Glycine 389 G A Serine Asparagine 469 G A Aspartic acid Asparagine 477 A T Glutamine Histidine 495 A G Glutamic acid Glutamic acid 501 G A Glutamine Glutamine 516 T C Glycine Glycine SIPC 306 C T Histidine Histidine 4026 T A Phenylalanine Isoleucine 4059 A G Isoleucine Valine 4088 A G Valine Valine ! Table 4 - List of heterozygoties detected in the coding region of CP-100K.! Gene Heterozygotic positions Possible nts and codon position Amino acid change CP-100K 1827 C or A; 3rd Alanine 2536 A or T; 1st Threonine or serine 2869 G or A; 1st Valine or isoleucine 3145 G or A; 1st Glycine or serine