Dissecting the thymic microenvironment - the impact of defective T cell development in the maintenance of the cortical thymic epithelium

! 1! DISSECTING THE THYMIC MICROENVIRONMENT THE IMPACT OF DEFECTIVE T CELL DEVELOPMENT IN THE MAINTENANCE OF THE CORTICAL THYMIC EPITHELIUM PEDRO MIGUEL MENDES RODRIGUES Dissertação de Mestrado em Bioquímica Universidade do Porto Faculdade de Ciências Instituto de Ciências Biomédicas Abel Salazar 2012 ! ! PEDRO MIGUEL MENDES RODRIGUES DISSECTING THE THYMIC MICROENVIRONMENT THE IMPACT OF DEFECTIVE T CELL DEVELOPMENT IN THE MAINTENANCE OF THE CORTICAL THYMIC EPITHELIUM Dissertação de Candidatura ao grau de Mestre em Bioquímica da Universidade do Porto: Orientador – Doutor Nuno Lages Alves Categoria – Investigador Auxiliar Afiliação – Cell Activation and Gene Expression Group, Instituto Biologia Molecular e Celular, Universidade do Porto 2012 ! ! "We must not wait for things to come, believing that they are decided by irrescindable destiny. If we want it, we must do something about it" Erwin Schrodinger ! ! ! Table of Contents ABSTRACT ....................................................................................................................................... IX RESUMO ............................................................................................................................................ X LIST OF ABBREVIATIONS .......................................................................................................... XI LIST OF FIGURES ........................................................................................................................ XIII INTRODUCTION ............................................................................................................................. 1 THE IMMUNE SYSTEM ...................................................................................................... 3 THE THYMUS AS A T LYMPHOCYTE SCHOOL .......................................................................... 4 THYMIC ORGANOGENESIS ................................................................................................ 5 THYMIC EPITHELIAL CELLS - THE EDUCATORS OF THYMOPOIESIS ................................................ 7 HOW DOES THE TEC MICROENVIRONMENT INSTRUCT T CELL DEVELOPMENT? ............................. 10 INTERLEUKIN-7: A CRITICAL THYMOPOIETIC CYTOKINE .......................................................... 13 TEC-THYMOCYTE CROSSTALK GOVERNS THE EPITHELIAL DEVELOPMENT .................................... 15 AIMS ........................................................................................................................ 18 MATERIAL AND METHODS ..................................................................................................... 19 MICE ........................................................................................................................ 21 GENOTYPING .............................................................................................................. 21 ISOLATION OF THYMIC STROMAL CELLS ............................................................................. 22 FLOW CYTOMETRIC ANALYSIS ......................................................................................... 22 GENE EXPRESSION ........................................................................................................ 23 FETAL THYMIC ORGAN CULTURE ..................................................................................... 23 IMMUNOHISTOLOGICAL ANALYSIS ..................................................................................... 24 IN VIVO ANTI-CD3ε TREATMENT .................................................................................... 24 STATISTICAL ANALYSIS .................................................................................................. 24 RESULTS .......................................................................................................................................... 25 A PRELUDE ON THE ONTOGENY OF IL7HI/YFP+ TECS ................................................................. 27 THYMOCYTE-DERIVED SIGNALS MODULATE THE HOMEOSTASIS OF IL7HI/YFP+ TECS ........................... 30 THE PROGRESSIVE THYMOCYTE-INDUCED DECLINE OF IL7HI/YFP+ TECS IS INDEPENDENT FROM THE MATURATION OF MTECS ................................................................................................ 33 DP THYMOCYTES DEVOID OF TCR EXPRESSION ARE NOT SUFFICIENT TO INDUCE THE DECAY OF IL7HI/YFP+ TECS ....................................................................................................................... 37 ! ! DISCUSSION AND FINAL REMARKS ...................................................................................... 41 REFERENCES .................................................................................................................................. 49 SUPPLEMENTAL INFORMATION ............................................................................................ 61 ACKNOWLEDGMENTS ................................................................................................................ 69 ! ! ! ix Abstract Thymic epithelial cells (TECs) are master regulators of T cell development. The differentiation of TECs into functionally distinct cortical (cTECs) and medullary (mTECs) subpopulations relies on reciprocal instructive signals from developing thymocytes, a bi-directional interaction known as "thymic-crosstalk". Both TEC subsets derive from a common bipotent progenitor and differentiate through compartment-specific progenitors. Albeit the cellular and molecular mechanisms regulating mTEC development have been partially clarified, little is known about the signals that control cTEC differentiation. Exploiting IL-7 reporter mice, in which yellow fluorescent protein (YFP) expression identifies cells that co-express high levels of Il7 (IL7hi/YFP+ TECs), we previously showed that IL7hi/YFP+ TECs gradually diminish with age in a thymocyte-dependent manner, segregate from mTECs and are conversely sustained when T cell development is profoundly abrogated at very early stages of differentiation. In this thesis, we study the lineage relationship between IL7hi/YFP+ TECs and other well-characterized TEC subtypes and the impact of distinct molecular interactions between thymocytes and TECs in the differentiation of the thymic epithelium. We demonstrate that IL7hi/YFP+ TECs emerge early during thymic ontogeny, define a CD205+BP1+CD40lo cTEC subset that gradually decline during thymic development, co-express the cortical-associated thymopoietic factors Ccl25, Dll4, Il7, Psmb11 and segregate from mature mTECs expressing Ctts, Tnfrsf11a and Aire. Furthermore, we show that the decline in IL7hi/YFP+ TECs induced by lympho-stromal interactions dissociates from the RANK- and LTβR- mediated maturation of medullary epithelium, suggesting that IL7hi/YFP+ TECs do not represent a direct progeny of mTECs. Studies in Rag2-/- IL-7 reporter mice, displaying a block at the DN3 stage of T cell development, indicate that IL7hi/YFP+ TECs are prominently maintained during fetal and postnatal life, suggesting that their homeostasis is regulated by thymocyte-derived signals beyond β-selection. In vivo analysis of anti-CD3-treated Rag2-/- mice show that induction of DP thymocytes devoid of TCR expression moderately affect IL7hi/YFP+ TECs while fostering mTEC differentiation.! Together, our results indicate that IL7hi/YFP+ TECs are a determinant of the cortical lineage and provide evidence that the homeostasis of the cortical epithelium is controlled by TCR-MHC interactions between thymocytes and TECs occurring during thymocyte selection.! ! ! Chapter I | Introduction ! 3 The Immune System The immune system has evolved to protect the organism from a universe of external and internal threats. The environment contains a wide range of pathogenic microbes and allergenic substances that challenge the host through a large spectrum of mechanisms. To resolve these challenges, the immune system uses a complex myriad of cells and molecules that respond to foreign antigens whilst avoiding harm the host-tissues [1]. Immunologic defences are divided into two main branches distinguished by the speed and specificity of the response. The innate immunity, an ancient defence mechanism, initiates an immediate response against foreign pathogens that is largely non-specific and does not generate immunological memory. The innate immune system provides the first line of defence using chemical mediators and physical barriers, as well as cellular components, which become activated during an inflammatory response. The adaptive immunity, unlike the innate immune response, relies on the clonal expansion of antigen-specific B and T lymphocytes. A hallmark of this response is the ability to induce immunological memory, with the formation of long-lived cells that persist in a quiescent state and ensure a rapid response upon re-exposure to the same antigen. Nonetheless, despite the differences between innate and adaptive immune responses, the interplay between elements of both systems provides an effective defensive network [2]. All the components of the immune system are generated from a pool of multipotent hematopoietic stem cells (HSC), in a highly orchestrated process termed hematopoiesis. This event begins early during embryogenesis and has the fetal liver and bone marrow as the major niches of hematopoiesis. After expansion, some HSC migrates into distinct anatomical locations, such as the thymus, in order to commit and develop into a specific hematopoietic lineage [3]. Despite the benefits, a misguided immune response can not only compromise the ability of our system to respond against pathogens but also the immunological tolerogenicity to self-antigens, increasing the chance of developing allergic or autoimmune syndromes. Thus, the instruction and maintenance of an immunological self-tolerant state is ensured by the coordinated action of central and peripheral mechanisms [4]. Central tolerance plays an important role purging auto-reactive cells from the newly developing Chapter I | Introduction ! 4 lymphocyte repertoire (disclosed later in this thesis). However, this mechanism is not perfect and allows the escape of some auto-reactive lymphocytes into the periphery [5]. Therefore, peripheral tolerance provides a downstream control mechanism that include anergy and clonal deletion of auto-reactive lymphocytes as well their suppression by a specialized subset of T cells, the regulatory T cells (Treg) [5]. The Thymus as a T Lymphocyte School The word “thymus” is thought to derive from a Greek word θυµοЅ, meaning “heart” or “soul”. The ancient Greeks were the first to originally describe this organ and they believe it was the place of the “soul” because its anatomical position lies above the heart. Along centuries the thymus was considered an enigmatic organ, surrounded by many questions regarding to its function. Although during the 1950s, the thymus was recognized as a lymphocyte producing-organ, the immunologists were sceptical about a possible immunological function of this organ and it was considered as a redundant “lymphocyte graveyard” [6]. However, the importance of the thymus was only documented in 1961 by Jacques Miller's studies on virus induced-leukaemia in young thymectomyzed mice. His observations lead to the recognition of the thymus as a non-redundant specialized organ of the immune system with a crucial role in the development of T cells [6,7]. Anatomically, the thymus is a bilobated organ that is located in the superior anterior mediastinum. Histologically, each lobe is composed by two distinct regions that includes an outer cortex and inner medulla [8]. The unique capacity of this organ to support T cell development, or thymopoiesis, relies on an organized tridimensional network of thymic stromal cells that provides the essential molecular cues for maturation, expansion and selection of T cell precursors, also known as thymocytes. The thymic stroma is heterogeneous and is composed of dendritic cells, macrophages, fibroblasts, endothelial cells and thymic epithelial cells (TECs) [9]. TECs are the major constituent of the thymic stroma and are categorized into cortical (cTECs) and medullary (mTECs), according to their spatial location, morphology and functional proprieties. These subsets are responsible for supporting distinct stages of T cell development. Chapter I | Introduction ! 5 Whereas cTECs support early stages of T cell development, mTECs guide later stages of T cell development [10–12]. Throughout life, the thymus contributes with a permanent output of naive T cells, reaching a peak of activity during the early adulthood in mice [13]. Nevertheless, the size and function of this organ starts progressively degenerating with age, concomitantly with the disruption of the normal cortical and medullary thymic architecture. Consequently, the capacity of the thymus to support thymopoiesis becomes gradually compromised, thereby contributing to a reduced immune surveillance. This phenomenon is known as thymic involution and is thought to be an important contributor for the immunosenescenceassociated problems, by leading to an indirect increase in the susceptibility to infectious diseases, neoplastic and autoimmune disorders during elderly [14,15]. Thymic Organogenesis Thymic organogenesis is a tightly coordinated process, that comprises a series of morphogenetic and differentiation events and relies on the interaction of cells from all three embryonic germ layers (endoderm-derived epithelium, ectodermderived neural crest (NC) mesenchyme, mesoderm-derived hematopoietic cells) [16]. The murine thymus develops from the ventral region of the third pharyngeal pouches of the foregut endodermal tube. Although the signals that initiate the thymic development take place around embryonic day 9.5 of gestation (E9.5), the first morphological signs are only visible at E10.5 with the budding and outgrowth of the thymic anlage [16]. Between E11.5-E12, the first wave of lymphoid progenitor cells colonizes the thymic anlage, entering through the mesenchymal layer in response to chemoattractive factors [17]. The following stages of thymic organogenesis require detachment, patterning and differentiation of different thymic stromal cell subsets and migration of the thymus into its final anatomical position (Figure 1) [18,19]. During embryogenesis, the thymic primordium becomes delimited by a NC- derived mesenchyme, which contributes to the formation of the capsule and the thymic blood vasculature [8,20]. In addition, the surrounding NC mesenchymal cells influence the proliferation and homeostasis of TECs through the production of fibroblast growth factors (FGF), such as FGF7 and FGF10 [18,21,22], as well as Chapter I | Introduction ! 6 retinoic acid (RA) and insulin-like growth factor (IGF)-1 and -2 [23,24]. In addition, whereas the mesenchyme does not appear to be required for the initial thymic fate induction [8,25], the positioning of the organ and its separation from the pharynx relies on signals provided by NC-derived mesenchyme [26]. In the past, there were some conflicting interpretations about the precise contribution of the endodermal and ectodermal layers for the development of the thymic epithelium. Two different hypotheses had been proposed, one arguing in favour of a dual origin with participation of both endoderm and ectoderm layers, whereas the other one defends an exclusively endodermal origin for thymic epithelium. However, it is currently accepted that TECs originate solely from a unique germ layer, the endoderm [8,18,27]. The early organogenesis of the thymus is intimately connected with the formation of the parathyroid gland, which arises from the dorsal part of the third pharyngeal pouch, developing as a shared structure. Differentiation into parathyroid and thymus specific domains is driven by the spatial-specific expression of two transcription factors Glial cells missing homolog 2 (Gcm2) and Forkhead box N1 (Foxn1), respectively [28]. Foxn1, a gene encoded by the nude locus, exhibits a vital role during thymic organogenesis by governing the Figure 1 - A schematic overview of thymic organogenesis: The thymic anlage is formed from an outgrowth of the 3rd pharyngeal pouch. The surrounding NC-derived mesenchyme influences the thymic anlage growth and separation off the pharynx (Adapted from [18]) Chapter I | Introduction ! 7 differentiation of TECs [29,30] in a cell-autonomous manner [31]. The expression of Foxn1 is first detectable in the ventral region of the third pharyngeal pouches as early as E11 [28], although the molecular mechanisms that initiate and control Foxn1 gene expression remain elusive. Some evidence suggests that Bone morphogenetic protein 4 (Bmp4) and Wingless-related MMTV integration (Wnt) signals might regulate Foxn1 expression in TECs in vitro [32,33], even though the role of these proteins in vivo remains to be proven. Thymic Epithelial Cells - The Educators of Thymopoiesis The partitioning of TECs into two specialized subpopulations, cTECs and mTECs, is essential to guide distinct stages of thymopoiesis. In recent years, TECs have been extensively studied with the purpose of gaining a better understanding about the precursor-progeny relationship and the cellular and molecular mechanisms behind the establishment of a functionally competent TEC microenvironment. Despite the high level of heterogeneity observed among the thymic epithelium, the two TECs subtypes can be identified based on the phenotypically expression of specific markers [34,35]. Whereas cTECs are defined by the expression of cytokeratin-8 and -18 (K8+ and K18+), Ly51+ (also known as BP1) and CD205+ (also known as DEC-205) [34–36], mTECs are commonly associated with the expression of cytokeratin-5 and -14 (K5+ and K14+), CD80+, mouse thymic stroma 10 (MTS10+), ERTR5+, the tight junction components claudin-3 and -4 (Cld3+ and Cld4+) and the ability to bind lectin Ulex europaeus agglutinin 1 (UEA1+) (Figure 2) [34,35,37]. Yet, both TEC lineages share common markers such as, the expression of Foxn1, Epithelial Cell Adhesion Molecule (EpCAM) and the Major Histocompatibility Complex Class II (MHCII) [35]. As aforementioned, TECs can diverge, not only in their phenotypic traits and spatial location but also in their functional properties to promote distinct stages of T cell development. cTECs mediate early stages of T cell development by providing an array of thymopoietic factors, including CCL25, IL-7, DLL4, β5t and TSSP, which are involved in the attraction, commitment, expansion and positive selection of immature thymocytes [12,34,35]. In contrast, mTECs are critical to regulate later stages of thymopoiesis, particularly negative selection, through the expression of Airedependent and -independent tissue-restricted self-antigens (TRA) [38,39]. Chapter I | Introduction ! 8 The concept that both TEC lineages arise from a common bipotent progenitor came with the identification of a particular TEC population co-expressing both cortical and medullary markers, namely K5+K8+ [40]. During fetal development, K5+K8+ TECs are widely predominant within the thymic epithelium, whereas in adulthood, this population represents a minor subpopulation located close to the cortico-medullary junction [40,41], emphasizing the idea of a common progenitor pool for K5+K8- mTECs and K5-K8+ cTECs. In line with the previous observations, a subpopulation of embryonic TECs was identified based on the reactivity to the monoclonal antibody MTS24 [42,43]. MTS24+ TECs, which also co-express K5+K8+, in contrast to MTS24- TECs, were shown to have the ability to generate a fully competent thymic microenvironment, compartmentalized into cortex and medulla [42,43]. In addition, MTS24+ TECs also were shown to have the capacity to support thymopoiesis when transplanted into the kidney capsule of nude mice, suggesting that MTS24+ TECs represent a putative TEC progenitor [42]. Yet, a subsequent study showed that MTS24- TECs also had the potential to generate a functional thymus, depending on the embryonic stage [44]. Whilst the evidence for the existence of a bipotent progenitor have been ascertained [45,46], the paucity of specific markers has significantly hampered the identification and localization of these cells in the embryonic and postnatal thymus. The current model for TEC development suggests that cTEC and mTEC lineages originate from a bipotent precursor and develop through compartmentintermediate progenitors [10,12]. The first key evidence supporting this idea was based on the formation of multiple small clusters of mTECs derived from a single progenitor distinguished on the basis of different MHCII haplotypes in chimeric thymi [47]. Along this line, cTECs and mTECs committed progenitors have been identified during early ontogeny (E12). While mTEC progenitors are defined on the basis of the expression of tight junction components Cld3 and Cld4 [48], committed cTEC progenitors are established accordingly with the differential expression of CD205 and CD40 [49]. Moreover, the co-expression of a cTEC specific proteosomal subunit β5t along with CD205 was also associated with committed cTEC progenitors [50]. By E12, β5t+ TECs tend to be clustered in the ventral and outer region of the thymic epithelium, in a distinct anatomical location from those containing mTEC progenitors expressing Cld3/4+ [48,50]. Thus, one can envisage the existence of landmarked spatial niches for cTEC/mTEC progenitors determined early during thymic organogenesis. Chapter I | Introduction ! 9 TEC differentiation can be temporally divided in two distinct phases, which occurs through a thymocyte-independent and -dependent mechanism [41]. The compartmentalization of distinct TEC microenvironments, particularly the expansion of thymic medullary regions beyond E15, is not a cell-autonomous process and depends on thymocyte-derived signals, a symbiotic relationship named "TEC-Thymocyte Crosstalk" [51]. In adult mice with a profound arrest in early T cell development, at the DN1-DN2 stage (Rag2-/-Il2rg-/- mice; human CD3ε trangenic mice [Tge26] and Ikaros-/- mice), the thymic architecture is severely compromised, with little organization and lack of epithelial maturation [35,41,52]. Phenotypically, the thymus from these immunodeficient mice resemble a fetal thymus at E12-E14, with an abundance of TECs co-expressing K5+K8+ [41], suggesting that in the absence of developing thymocytes, TECs progenitors might be arrested in an immature stage. Still, the initial patterning of TECs seems to be a thymocyte-independent process [41,53], occurring presumably either in a cell-autonomous fashion or through interaction with nonhematopoietic cells during early embryonic development. Nevertheless, the ablation of perithymic mesenchyme from a fetal thymus during the E12 does not preclude the differentiation into cTEC and mTEC lineages [21,36], suggesting that beyond E12, the compartmentalization of TECs does not require sustained interactions with mesenchyme. cTECs CD205 + Ly51 + K8 + mTECs MTS10 + UEA1 + CD80 + Aire + Maturation Figure 2 - A model for TEC differentiation: A common bipotent thymic epithelial progenitor cell (TEPC) has the potential to generate both cortical thymic epithelial cells (cTECs) and medullary TEC (mTECs), through compartmentspecific intermediate progenitors, cortical TEC progenitor (cTEPC) and medullary TEC progenitor (mTEPC), respectively (Adapted from [22]) . Chapter I | Introduction ! 10 How does the TEC Microenvironment Instruct T Cell Development? While most hematopoietic lineages differentiate within the bone marrow (BM), the generation of a diverse and self-restricted repertoire of T lymphocytes requires specialized niches exclusively found in the thymus. During their migration throughout distinct regions of the thymic microenvironment, developing thymocytes undergo a sequence of differentiation, proliferation and maturation events (Figure 3). In fact, thymopoiesis is a tightly regulated phenomenon during which several checkpoints purge the production of T cells bearing non-functional or auto-reactive T cell receptors (TCRs) [11,54,55]. As a result, only 1-3% of thymocytes are able to survive and migrate into the peripheral secondary lymphoid organs [54]. The earliest thymic progenitors that colonize the thymus display a limited selfrenewal capacity. Therefore, in order to sustain T cell production, a continual input of BM progenitors is required [11]. Nevertheless, two recent reports demonstrated that, under particular conditions, neonatal thymi harbour thymocytes with a self-renewal capacity that are able to reconstitute the peripheral T-cell pool in the absence of intrathymic competition [56,57]. The entry of BM progenitors into the thymus does not seem to be a continuous process, but rather a temporally regulated event that is suggested to occur in discrete waves [58]. The initial seeding of hematopoietic precursors occurs prior to the vascularisation of the thymic primordium, through interaction with the surrounding mesenchymal layer [8,17]. However, in the postnatal thymus, once the vasculature is well developed, T cell progenitors enter across blood vessels located nearby the cortico-medullary junction (CMJ) [17,54,55]. The capacity of hematopoietic progenitors to migrate into the thymus is mediated by a chemotactic gradient, established by the expression of CC-chemokine ligand 21 (Ccl21), Ccl25 and CXC-chemokine ligand 12 (Cxcl12) within the thymus and the correspondent interaction with their receptors CC-chemokine receptor 7 (Ccr7), Ccr9 and CXC-chemokine receptor 4 (Cxcr4) expressed by hematopoietic progenitor cells. In addition, the expression of adhesion molecules by the thymic endothelium, such as P-selectin, also facilitates the colonization process [54,55,59]. Chapter I | Introduction ! 11 Within the thymus, the earliest thymic seeding progenitors are uncommitted cells that retain both myeloid, NK, B and T cell lineage potential [60]. In order to be instructed into the T cell lineage, these cells undergo a developmental pathway that comprises different stages of maturation prior to the expression of CD4 or CD8. The most immature thymocytes are named double-negative (DN), due to the lack of expression of CD4 and CD8. While they migrate from the cortico-medullary region into the subcapsular zone, DN thymocytes sequentially progress across four distinct sub-stages, from DN1 to DN4, which can be monitored on the basis of the expression of CD25 and CD44. The migration of DN thymocytes occurs under the influence of a chemokine gradient, in particular to Cxcl12, Ccl19 and Ccl21. Moreover, during their migration to the subcapsular zone, the stromal production of stem cell factor (SCF), also known as Kit ligand, and Interleukin-7 (IL-7), are essential to support the survival and proliferation of these developing DN thymocytes [11,54,55]. The irreversible commitment towards the T cell lineage takes place at DN3 stage and is promoted by the Notch-signalling pathway, via Dll4-Notch1 interaction [61,62]. Simultaneously, the recombination activating gene (RAG) enzymes promote the rearrangement of the TCRγ, TCRδ and TCRβ locus. The productive rearrangement, assembly and signalling through the γδ-TCR allow the differentiation of DN3 thymocytes towards γδ T cell lineage [59]. With regard to αβ T cell differentiation, rearranged TCRβ chain assembles with an invariant pre- TCRα chain and CD3 signalling molecules on the cell surface, to form the pre-TCR complex. Nevertheless, only thymocytes bearing a functional pre-TCR are allowed to further develop into double positive (DP) thymocytes (CD4+CD8+), a process known as β-selection. After passing β-selection, thymocytes initiate the TCRα locus rearrangement, which leads to the expression of a fully assembled αβ-TCR [11,54,55] and progress through a transient state as immature CD8 single positive (ISP) thymocytes (Figure 3) [11]. Subsequently, the newly generated DP thymocytes are screened for the ability of their TCR to recognize self-peptide- MHC complexes (pMHC) with low avidity, a process known as positive selection [63]. Only positively selected thymocytes receive signals to survive, which allow them to differentiate further into CD4 or CD8 single positive (SP) thymocytes. cTECs are the master regulators of positive selection due to the generation of MHC-bound peptides presented through distinct pathways, which are mediated Chapter I | Introduction ! 18 stage-specific requirement of DN thymocyte-derived signals for the proper development of a cortical microenvironment [49]. However, the precise nature of such signals and how DN thymocytes shape cTEC maturation remains largely unknown. Aims The thymic epithelial microenvironment undergoes a series of morphological and architectural modifications throughout development, which are accompanied by a prominent reduction in the number of TECs, particularly in cTECs [105,106]. Interestingly, it has been demonstrated that cTECs have the potential to rejuvenate the cortical compartment upon thymic injury [107]. Yet, the cellular and molecular basis that governs the development and maintenance of the cortical microenvironment remain open questions. In this thesis, we aim at defining novel checkpoints in the differentiation of the thymic cortical epithelium. Using state-of-the-art research mouse models (IL-7 reporter mice in immunocompetent and genetically altered background), together with in vitro thymic organotypic cultures and in vivo functional assays, we study (1) the lineage relationship between IL7hi/YFP+ TECs and other well-characterized TEC subtypes and (2) the impact of distinct molecular interactions between thymocytes and TECs in the control of the homeostasis of the cortical epithelium. The development of approaches to promote the functional rejuvenation of the thymus has been one of the biggest challenges in clinical immunology. Comprehending the mechanisms behind TEC development will aid in the elaboration of tailor-made therapeutic strategies aimed at repairing and improving thymic functioning in different pathophysiological conditions, including aged-associated thymic involution, immunodeficiencies and infection. ! Material and Methods Chapter II ! Chapter II | Material and Methods ! 21 Mice! These studies used transgenic mice (B6.Cg-Tg(Il7-EYFP)5Pas) carrying a bacterial artificial chromosome (BAC) encoding YFP under the control of the Il7 promoter (Figure 5), inserted by homologous recombination downstream of the ATG start codon located at the end of the exon 1 of Il7 locus. In these mice, the expression of YFP is purportedly controlled by the same molecular mechanism that drives the expression of endogenous Il7. IL-7 reporter mice were backcrossed onto C57BL/6 background wild type (WT), Rag2-/- mice [108] and Marilyn Rag2-/- mice [109] (kindly provided by Jocelyne Demengeot, Instituto Gulbenkian de Ciência, PT) for more than 9 generations. Figure 5 – BAC sequence scheme comprising Il7 gene, its promoter and YFP insertion in the gene. For fetal studies, the day of the vaginal plug detection was designated embryonic day E0.5. Mice were housed under specific pathogen-free conditions and all animal experiments were conducted accordingly to the guidelines of the Portuguese National Authority for Animal Health (DGV) and European Union directive 2010/63/EU by FELASA-accredited researchers. Genotyping! In the adopted breeding scheme, transgenic mice were crossed with immunocompetent and Rag2-/- C57BL/6 mice, resulting in a progeny of both transgenic and WT littermates. Tails were digested in buffer (100 mM Tris pH 8.5; 5 mM EDTA; 0.2% SDS; 200 mM NaCl) with 0.4 mg/ml proteinase K (Eurobio) and the DNA was isolated using a standard mouse tail DNA isolation protocol. Transgenic mice were distinguished by standard PCR, using specific primers for the Il7-YFP junction sequence (Forward: 5’ tacacccacctcccgcagaccatggtgagcaagggcgaggagctgttc 3’; Reverse: 5’ gcaccagagagcagcgcttaccatttacttgtacagctcgtccatgcc 3’). PCR reaction comprised 5 minutes at 95ºC for initial denaturation of DNA, and 35 cycles of 30 seconds at 95ºC and 1 minute at 72ºC for annealing and amplifica- Chapter II | Material and Methods ! 22 tion, followed by a final step of 5’ at 72ºC for extension. For Rag2-/- genotype, a set of three primers was used to discriminate WT and KO alleles (Forward: 5’ gggaggacactcacttgccagta 3’; Reverse: 5’ agtcaggagtctccatctcactga 3’ and neo- Forward: 5’ cggccggagaacctgcgtgcaa 3’). PCR reaction comprised 4 minutes at 94ºC for initial denaturation of DNA, 35 cycles of 20 seconds at 94ºC, 30 seconds at 72ºC and 30 seconds at 74ºC, followed by an additional final step of 5 minutes at 74ºC for extension. Isolation of Thymic Stromal Cells! Thymic lobes were dissected at indicated time points (for early developmental stages, by micro-dissection) and stromal cells were isolated as previously described [110]. Thymic fragments were digested for 30 minutes at 37ºC in trypsin (Sigma) supplemented with 1% collagenase (Sigma) and 0,02% DNaseI (Roche). Fragments were mechanically disrupted by ressuspension every 5 minutes with a syringe to obtain cell suspensions. For later time points (adult stages), thymic stromal cells were enriched by an additional selection procedure that depletes hemotopoietic cells using MACS CD45 MicroBeads (Miltenyi Biotec) and autoMACS separation columns according to the manufacturer’s instructions. Cell numbers were calculated using counting chamber (Hycor Biomedical). Flow Cytometric Analysis! Cell suspensions were stained with anti-CD8 (FITC); anti-CD4, anti-CD80, anti- CD40 and anti-Ly51 (PE); anti-CD205 (biotin) antibodies (Abs) and streptavidin (PE-Cy7) (Becton Dickinson); anti-I-A/I-E (Alexa780); anti-CD45.2 (PerCPCy5.5); anti-EpCAM and anti-CD8 (APC) Abs and anti-EpCAM (eFluor 450) Abs (Ebioscience). For cell cycle analysis, staining with propidium iodide (PI) solution (Sigma) was done after fixation with cold pure ethanol for 1 hour at 4ºC followed by over-night incubation at -20ºC. After PBS-washing, cells were incubated for 30 minutes at 37ºC with PI staining solution (50 µg/ml PI in PBS with 0.05% Triton X- 100). Analysis was done using both FACSCantoII and FACSAria (BD Biosciences) and FlowJo software. Cell sorting was performed using FACSAria (BD Biosciences. Chapter II | Material and Methods ! 23 Gene Expression! For quantitative PCR (qPCR), total RNA from sorted cells was purified with an RNeasyMicroKit (Qiagen). The quantity of total RNA was assessed using ND-1000 spectrophotometer (Thermo Scientific). cDNA synthesis was performed by reverse transcription of the extracted RNA, using SuperScript III first-strand synthesis system for RT-PCR (Invitrogen) and Random Hexamers (Fermentas) according to the manufacturer’s instructions. qPCR were performed either using TaqMan Universal Master Mix (Applied Biosystems) and primers Hprt, 18s, Il7, Dll4, Ccl25, Psmb11, Aire and Tnfrsf11a (RANK) (Applied Biosystems) or iQ™ SYBR® Green Supermix (Bio-Rad) with primers specific for β -actin (forward: 5' cgtgaaaagatgacccagatca 3'; reverse: 5' tggtacgaccagaggcatacag 3'), Ctss (Cathepsin S) (forward: 5' ccattgggatctctggaagaaaa 3'; reverse: 5' tcatgcccacttggtaggtat 3'), Tnfsf11 (RANKL) (forward: 5' cacacctcaccatcaatgctgc 3'; reverse: 5 gaagggttggcacacctgaatgc 3') and Cd40lg (CD40L) (forward: 5' gtgaggagatgagaaggcaa 3'; reverse: 5 cactgtagaacggatgctgc 3') (Sigma). Il7 probes used were located between exons 1 and 2, in order to detect only endogenous Il7. All the samples were analysed as triplicates and the delta-delta-Ct method was used to calculate relative levels of target mRNA normalized to 18s/Hprt or β - actin. All procedures were performed according to the manufacturer’s protocols. Real-time PCR was performed on an iCycler iQ5 Real-Time PCR thermocycler (Bio- Rad). Data were analysed using iQ5 Optical System software (Bio-Rad). Fetal Thymic Organ Culture! E14 fetal thymi were dissected and thymic lobes were separated. Usually, three or four lobes were used per condition in order to normalize the intrathymic variations. A gel foam sponge was used to support thymic lobes on 0.8 µm Isopore membrane filter (Millipore), cultured in 6 well plates with 1ml DMEM medium (GIBCO) supplemented with 10% FCS, 1% L-Glutamine 200 mM (GIBCO) and 360 mg/L of 2-deoxyguanosine (Sigma) for 4 days. The agonistic anti-RANK (αRANK) (5 µg/ml; R&D Systems) or/and the agonistic anti-LTβR mAB AC.H6 (10 µg/ml; kindly provided by Jeff Browning, Biogenidec, US) was added on day 4. For the blocking experiment, the antagonistic anti-RANKL (Prepotech) was added to Fetal Thymic Organ Culture (FTOC) at a final concentration of 10 µg/ml on day 0 Chapter II | Material and Methods ! 24 and 4. FTOCs were maintained for 8 days. TECs were isolated (as described above) and analysed by flow cytometry. Immunohistological Analysis! Thymic lobes were fixed in 4% paraformaldehyde (Electron Microscopy Sciences) in PBS, washed twice with PBS and incubated in 50% sucrose-PBS solution before being embedded in OCT compound (Sakura) and frozen. 8 µm sections, obtained in the Ultramicrotome Leica Reichert SuperNova, were collected in Superfrost/Plus slides (Fisher Scientific) and stored at -20ºC. After rehydration and blocking (10% BSA in PBS solution), samples were stained with rabbit anti-GFP, biotinylated CD205, rat anti-MHC Alexa647 as primary antibodies, Alexa Fluor 488 donkey anti-rabbit IgG, Alexa Fluor 647 goat anti-rat and streptavidin Alexa 555 as secondary antibodies (Invitrogen). Vectashield mounting medium with 4',6-diamidino-2-phenylindole (DAPI) (Vector Laboratories) was used to prepare the slides. Analysis was performed in an AxioImager Z1 (Carl Zeiss). Images were processed with Fiji Software. In Vivo Anti-CD3ε Treatment! 3-4 days old neonatal Rag2-/- mice (less than 3 days) were injected intraperitoneally with purified anti-CD3ε monoclonal antibody (mAb) (10 µg/g body weight; Clone 1452C11; Kindly provided by Benedita Rocha, Hospital Necker, France). Mice thymi were collected 5 or 12 days after injections. For in vitro studies, fetal thymic lobes from Rag2-/- fetus (day 14 of gestation) were used to establish FTOC with or without 10 µg/ml anti-CD3ε mAb for 5 days. In both procedures, TECs were isolated, counted and analysed by flow cytometry according the procedures described above. Statistical Analysis! Statistical analysis of the results was performed using the GraphPad Prism Software. The two-tailed Mann-Whitney test was used to analyse the differences between groups. A 95% confidence interval was applied in the calculations and samples with p values under 0.05 were considered significant. ! Results Chapter III ! ! Chapter III | Results ! 27 A Prelude on the ontogeny of IL7hi/YFP+ TECs Previous studies using IL-7 reporter mice identified a particular population of TECs that expresses high levels of Il7 transcripts [89,90]. IL7hi/YFP+TECs appear early during fetal development and gradually diminish along gestation concomitantly with hematopoietic colonization of the thymus. In addition, IL7hi/YFP+TECs segregate from mature CD80+ mTECs throughout development indicating that they may constitute a specialized cortical subset [90]. To better define the identity of IL7hi/YFP+TECs within the cortical epithelium, we performed a combinatory phenotypic-temporal analysis throughout thymic organogenesis employing two different cTEC-associated markers, CD205 and BP1 [35]. TECs were identified based on the expression of MHCII and EpCAM and the lack of CD45 markers accordingly to the gating strategy described in Figure S1. In line with previous results, IL7hi/YFP+TECs emerged early during fetal development, in which they represented the majority of the thymic epithelium and gradually disappeared with age (Figure 6.A and Figure S2, top panel). The maturation of TECs could be monitored by the progressive expression of high levels of MHCII along thymic development (Figure 6.A). During early stages of thymic organogenesis, both IL7hi/YFP+ TECs and YFPneg TECs revealed a similar phenotypic pattern, with the majority of cells of both subsets expressing cortical traits (CD205+BP1+). However, from E16.5 onwards, while IL7hi/YFP+TECs retained a cortical-related phenotype, a subset of medullary epithelium (CD205-BP1-) started to emerge within YFPneg TECs (Figure 6.Bi). In addition, we analysed the epithelial compartment on the basis of the expression of the costimulatory molecule CD40, which was recently associated with TECs exhibiting a genetic profile linked to the mTEC lineage [49]. During thymic ontogeny, IL7hi/YFP+TECs progressively acquired the expression of CD40 while retaining the expression of CD205 (Figure 6.Bii). Noticeably, and in contrast to IL7hi/YFP+TECs, the increment in the expression of CD40 by YFPneg TECs was accompanied by the expression of a medullary-associated marker CD80 (Figure 6.Biii), suggesting that YFPneg TECs might harbour a putative mTEC precursor. Chapter III | Results ! 34 LTβR and RANK-mediated signals are the major mediators in the initial phase of mTEC differentiation during embryogenesis, CD40 signals exert their effect beyond post-natal life. Given that IL7hi/YFP+ TECs disappeared as mTECs emerged, we investigated whether signalling through TNFSF members, particularly by LTβR and RANK, impacted in the maintenance of IL7hi/YFP+ TECs. To address this possibility, we used an in vitro organotypic cultures named Fetal Thymic Organ Culture (FTOC). In this technique, the colonization of the thymus with BM- progenitors is blocked. Still, a complete programme of T cell development is supported, eliciting the normal differentiation of the thymic microenvironment into mature cTECs and mTECs [111]. Since RANK has been described as the most important TNFSF member involved in the optimal differentiation of CD80+Aire+ mTECs [100,102], we started by analysing its influence in the dynamics of IL7hi/YFP+ TECs. E14 FTOC was established in the presence or absence of thymocytes. In order to remove the endogenous contribution of thymocyte-derived signals in the development of the thymic epithelium, FTOCs were treated with 2-deoxyguanosine (dGuo). The effect of inhibiting RANK-mediated signals was addressed by addition of a blocking anti- RANKL antibody (anti-RANKL, αRANKL) to FTOC. In dGuo-treated FTOC, in which thymocytes were selectively depleted, IL7hi/YFP+ TECs were markedly maintained and the formation of mTECs was impaired (Figure 11, left panel). After 8 days of FTOC, the medullary epithelium started to develop and both the intensity of YFP activity and the frequency of IL7hi/YFP+ TECs diminished (Figure 11.A, middle panel), resembling the phenotype observed during later stages of fetal thymic development in vivo. Yet, although inhibition of RANK-mediated signals in FTOC completely blocked the formation of mTECs (Figure 11.A, right panel), the thymocyte-induced decay in IL7hi/YFP+ TECs was still observed (Figure 11.A, right panel). These changes in IL7hi/YFP+ TECs became clear when the mean fluorescent intensities (MFI) of this subset for the different conditions were represented (Figure 11.B and C). ! Chapter III | Results ! 35 To confirm that RANK-derived signals do not affect the homeostasis of IL7hi/YFP+ TECs, we performed a complementary experiment in which the effect of direct stimulation of RANK signalling pathway in TECs was examined. An exogenous activator of RANK (agonistic anti-RANK, αRANK) was added to E14 thymocytedepleted FTOC (dGuo-treated FTOC). RANK stimulation led to the appearance of CD80+ mTECs with a concomitant reduction in the frequency of IL7hi/YFP+ TECs. Yet, in contrast to FTOC, RANK activation did not induce the decay in the intensity of YFP expression in IL7hi/YFP+ TECs (Figure 12.A, middle panel) suggesting that IL7hi/YFP+ TECs are not responding to RANK and therefore, may not define a direct progeny of RANK-induced mTECs. As previously alluded (Figure 7, bottom panel), despite the early expression of RANK detected already in TECs at E14, its expression levels were steadily increased from E17 onwards, namely in YFPneg TECs. To test a possible correlation between the amounts of RANK transcripts and the responsiveness of TECs to Figure 11 - Blockade of thymocyte-derived RANKL does not influence the thymocyte-mediated decline of IL7hi/YFP+ TECs. E14 thymic lobes were left untreated (FTOC) and treated with deoxyguanosine (dGuo FTOC), in the presence or absence of blocking antibody for RANKL ( α RANKL) A) TECs were analyzed for the expression of YFP (top panel) and BP1 and CD80 (middle and bottom panels) (representative experiment). The middle panel shows total TEC gate, whereas the bottom panel represents an overlay of YFPneg (gray) and IL7hi/YFP+ (green) TECs. B) Histogram representation of the YFP expression for the different conditions represented in A. C) Data represents the average of the fold difference in the Mean Fluorescence Intensity (MFI) of YFP (left). The MFI of the expression of YFP in IL7hi/YFP+ TECs from thymi treated with dGuo was set as 1. The percentage of IL7hi/YFP+ TECs and CD80+ TECs after FTOCs is represented on the middle and right graph, respectively. (*) indicates that the differences between groups are statistical significant (p<0.05). 0 4 8 0 20 40 60 80 0.0 0.5 1.0 +dGuo FTOC MHCII YFP + αRANKL 0.88 97.7 0.5 98.7 BP1 (cTEC) CD80 (mTEC) 0.52 98.5 4.8 94.1 2.99 96.1 0.5 98.7 A +dGuo FTOC + αRANKL FTOC YFP B +dGuo FTOC FTOC + αRANKL C MFI YFP (fold difference) % Il7hi/YFP+ TECs % CD80+ TECs 78.2 21.7 37.5 62.2 36.8 63 * * Chapter III | Results ! 36 RANK signals, RANK-stimulated dGuo-treated FTOC were established with E17 lobes. In accordance with the prior observations, no change was observed in the intensity of YFP expression in Il7hi/YFP+ TECs upon activation with agonistic αRANK (Figure S4, middle panel). These results indicate that IL7hi/YFP+ TECs are continually unresponsive to RANK-derived signals. A recent study has described the existence of a synergistic effect between LTβR and RANK in the formation of the thymic medulla during embryogenesis. In particular, LTβR-mediated signals enhance the expression of RANK in mTECs leading to an increase in the responsiveness of the thymic epithelium to thymocyte-derived RANKL [98]. Since RANK signalling per se did not affect the homeostasis of IL7hi/YFP+ TECs, we tested whether the cooperative action of LTβR and RANK-derived signals modulated IL7hi/YFP+ TECs. E14 dGuo-treated FTOC were cultured in the presence of αRANK, an agonistic antibody anti-LTβR (αLTβR) or the combination of both. Stimulation through the LTβR alone did not affect either the dGuo + αRANK B FTOC +dGuo +αRANK 0.6 2.4 0.1 6.5 7.8 92.2 0.2 A C 97.1 97.1 97.1 YFP 0.0 0.5 1.0 0 20 40 60 0 4 8 12 % CD80+ TECs % IL7hi/YFP+ TECs +dGuo FTOC dGuo + αRANK MFI YFP (fold difference) +dGuo MHCII YFP BP1 (cTEC) CD80 (mTEC) 25.5 74.5 46.2 53.8 64 36 99.8 93 99.3 97.1 99.9 FTOC * * Figure 12 - Thymocyte-mediated decrease in IL7hi/YFP+ TECs is independent of mTEC differentiation induced by RANK signaling. E14 thymic lobes were left untreated (FTOC) and treated with deoxyguanosine (dGuo FTOC), in the presence or absence of an agonistic antibody for RANK ( α RANK) A) TECs were analyzed for the expression of YFP (top panel) and BP1 and CD80 (middle and bottom panels) (representative experiment). The middle panel shows total TEC gate, whereas the bottom panel represents an overlay of YFPneg (gray) and IL7hi/YFP+ (green) TECs. B) Histogram representation of the YFP expression for the different conditions represented in A. C) Data represents the average of the fold difference in the Mean Fluorescence Intensity (MFI) of YFP (left). The MFI of YFP expression in IL7hi/YFP+ TECs from thymi treated with dGuo was set as 1. The percentage of IL7hi/YFP+ TECs and CD80+ TECs after FTOC is represented on the middle and right graph, respectively. (*) indicates that the differences between groups are statistical significant (p<0.05). Chapter III | Results ! 37 intensity of IL7hi/YFP+ TECs or the mTEC development (data not shown). The combined αRANK and αLTβR stimulation induced an increase in CD80+ mTECs comparatively with αRANK activation. Still, in these circumstances, despite changes in the frequency of IL7hi/YFP+ and YFPneg TECs, the YFP expression driven by the activity of Il7 promoter was maintained in IL7hi/YFP+ TECs (Figure S5). Collectively, our data indicate that IL7hi/YFP+ TECs are regulated by thymocytedependent interactions that dissociate from RANK- and LTβR-mediated maturation of mTECs. DP thymocytes devoid of TCR expression are not sufficient to induce the decay of IL7hi/YFP+ TECs During early T cell development, the progression of immature DN3 thymocytes into the DP stage is largely dependent on the expression of a functional pre-TCR, a complex composed by a rearranged TCRβ chain plus an invariant pre-TCRα chain coupled to accessory CD3 molecules [11]. Cell-autonomous signalling through the pre-TCR governs the β-selection developmental checkpoint [112], a process that ensure that only thymocytes bearing a productive in frame TCRβ chain are able to survive and differentiate beyond the DN3 stage [59]. In line with previous observations [90], our findings highlight that IL7hi/YFP+ TECs are negatively influenced by signals provided by thymocytes that progress beyond the βselection stage. Given the importance of this checkpoint during T cell development, we evaluated whether the TEC-thymocyte crosstalk during βselection might contribute to the gradual decay of IL7hi/YFP+ TECs during thymic development. To do this, we took advantage of pre-TCR activation model using Rag2-/- mice treated with anti-CD3ε mAb. In these mice, anti-CD3ε activation mimics the pre-TCR signal transduction events that occur during β-selection in normal mice, consequently promoting the generation of DP thymocytes that are however, devoid of pre-TCR/TCR expression [113]. Neonatal Rag2-/- mice were intraperitoneally injected with anti-CD3ε mAb, being the treatment subsequently reinforced with a new injection of antibody 5 days later. Upon anti-CD3ε mAb administration, Rag2-/- thymi revealed a great expansion either in size (Figure S6.A) and thymic cellularity (Figure S6.B), reaching comparable number of thymocytes on day 12 post-treatment as Chapter III | Results ! 38 observed in age-matched immunocompetent thymi. In Rag2-/- treated mice, DN3 thymocytes transverse the β-selection into the DP stage but were not positively selected due to the lack of TCR expression (Figure S6.C). Of note, a significant increase in the absolute numbers of DN, ISP8 and DP subsets was observed 12 days after anti-CD3ε mAb stimulation in comparison to day 5 post treatment (Figure S6.D). Next, we characterized the impact of the abnormal crosstalk between DP thymocytes devoid of TCR and TECs in the differentiation of the thymic epithelium. We observed that the thymocyte-induced decay in IL7hi/YFP+ TECs, measured both by the drop in the frequency and in the intensity of the YFP reporter activity, was attenuated in anti-CD3ε treated thymi comparatively to agematched immunocompetent thymi (Figure 13.A, middle and right panel). Treated mice revealed a conspicuous improvement of the thymic epithelial microenvironment, with the emergence of CD80+ mTECs within the YFPneg compartment (Figure 13.A, middle panel). The transcriptional profile of these newly generated mTECs revealed an increased expression of medullary-related Ctss, Tnfrs11a and Aire (Figure S7). Still, despite the evident increased of CD80+ mTECs in treated mice, their representation did not reach the levels observed in age-matched immunocompetent mice (Figure 13.A, middle and right panel; Figure 13.C, right graph), suggesting that anti-CD3ε mAb treatment only partially restored mTEC differentiation. To confirm that the expansion of Aire+CD80+ mTECs was not due to a direct consequence of anti-CD3ε mAb stimulation in thymic epithelium, E15 thymic lobes were place in a dGuo-treated FTOC and supplemented with anti-CD3ε mAb. The development of CD80+ mTECs was not induced in this situation (Figure S8), demonstrating that the TEC- thymocyte crosstalk that occurred during DN-DP transition was responsible for promoting mTEC development. Together, our data indicate that induction of DP thymocytes that lack TCR expression do not substantially curtail IL7hi/YFP+ TECs and suggest that TCR-MHC interactions between thymocytes and TECs during thymocyte selection define a novel checkpoint in the control of the homeostasis of the cortical epithelium. Chapter III | Results ! 39 ! Given the development of Aire+ CD80+ mTECs that occurred concomitantly with the emergence of DP thymocytes, we next sought to investigate the molecular mechanisms behind this phenomenon. The expression level of TNFSF members involved in mTEC development, particularly RANKL and CD40L, was analysed by qPCR in different purified thymocyte populations isolated from Rag2-/- anti-CD3ε treated mice. In line with previous observations [100], Tnfsf11 (RANKL) was expressed predominantly in CD4+ SP thymocytes, although its expression was also detected within DN thymocytes (Figure S9.A). Upon anti-CD3ε treatment, DN, ISP8 and DP thymocytes from Rag2-/- mice expressed similar levels of Tnfsf11 (Figure S9.A). Furthermore, in contrast to the higher levels of Cd40lg (CD40L) expressed by CD4+ SP thymocytes, the expression of this transcript was hardly found in DN, ISP8 and DP thymocytes isolated from treated mice (Figure S9.B). Overall, these results suggest that differentiation of medullary epithelial compartment following anti-CD3ε treatment is not associated with an increase in the expression levels of RANKL and CD40L by DP thymocytes. Figure 13 - DP thymocytes deficient in TCR expression do not profoundly affect IL7hi/YFP+ TECs. Neonatal Rag2-/- mice were injected intraperitoneally at the third day after birth with 10µg/g of purified anti-CD3 ε mAb and analysed twelve days after treatment. A) TECs were analyzed for the expression of YFP (top panel) and BP1 and CD80 (middle and bottom panels) (representative experiment). The middle panel shows total TEC gate, whereas the bottom panel represents an overlay of YFPneg (gray) and IL7hi/YFP+ (green) TECs. B) Histogram representation of the YFP expression for the different conditions represented in A. C) Data represents the average of Mean Fluorescence Intensity (MFI) of YFP (left), the frequency of IL7hi/YFP+ TECs (middle) and the percentage of CD80+ TECs after anti-CD3 ε mAb administration, comparing with an age-matched immunocompetent mice. (*) indicates that the differences between groups are statistical significant (p<0.05). 0 20 40 60 0 20 40 60 1500 2000 2500 B A Control 0 . 4 8 0.25 0.7 98.5 Immuno-competent Control αCD3 Treated αCD3 Treated 17.7 4.3 76.9 5 . 0 1 3.1 2.9 93.1 58.7 26.2 14.3 19.3 27.7 52.3 Immunocompetent 3.4 94.4 1.7 Rag2 -/- C MFI YFP % CD80+ TECs % IL7hi/YFP+ TECs YFP MHCII YFP BP1 (cTEC) CD80 (mTEC) 37.9 62.1 56.8 43.2 81.6 18.4 *** Immuno-competent Control αCD3 Treated **** Chapter III | Results ! 40 Next, we characterized the spatial alterations that occurred within the thymic microenvironment upon anti-CD3ε treatment. Thymic sections from either control or treated Rag2-/- mice were analysed by immunohistochemistry using a panel of specific antibodies against hematopoietic and TEC markers. Cortical and medullary TECs were identified on the basis of the differential expression of MHCII, which is more expressed by mTECs [47,114], CD205 and MTS10, which represent a cortical and medullary-associated marker, respectively [34,35]. In line with the results obtained from flow cytometry analysis, Rag2-/- epithelium revealed a predominant cortical-associated phenotype (MHCII+ and CD205+) (Figure 14, middle panel), although with the presence of few scattered MTS10+ mTECs (Figure 14, right panel). The emergence of ISP8 and DP thymocytes in treated mice, identified by CD8 immunostaining (Figure 14, left panel), was accompanied by the segregation of thymic epithelium, with the development of small MHCII+ and MTS10+ medullary islets (Figure 14, middle and right panel). Yet, the spatial distribution of medullary areas in treated mice differed from those observed in immunocompetent mice, with smaller medullary foci in treated thymi (Figure S10). These observations indicate that anti-CD3ε treatment elicits a partial differentiation of TECs in Rag2-/- mice. Figure 14 - Anti-CD3 ε treatment improves TEC compartmentalization in Rag2-/- mice. Representative immunohistochemical analysis of thymic sections obtained either from non-treated and αCD3ε treated Rag2-/- IL-7 reporter mice. Sections were stained with the following antibodies: YFP, green; CD8, red (left panel); YFP, green; CD205, red; MHCII, blue (middle panel); DAPI, blue; YFP, green; MTS10, red (right panel). YFP CD8 50 µm 50 µm 50 µm DAPI YFP MTS10 (mTECs) 50 µm 50 µm YFP CD205 MHCII 50 µm Rag2-/- mice αCD3 Treated Rag2-/- mice Control ! ! Discussion and Final Remarks Chapter IV ! ! Chapter IV | Discussion and Final Remarks ! 43 The development of cTECs constitutes a primitive hallmark event in the establishment of a functionally competent thymic niche, essential for attraction, lineage specification and subsequent selection of T cell precursors [12,34,35]. However, little is known with regard to the underlying mechanisms regulating cTEC homeostasis. In this thesis, taking advantage of IL-7 reporter mice, we performed an extensive cellular and molecular characterization of IL7-expressing TECs during thymic ontogeny to gain insights into this poorly understood issue. The partitioning of the thymic epithelial microenvironment into two specialized subpopulations of cTECs and mTECs is a highly dynamic process initiated early during fetal development and proceeding throughout post-natal life [8,22]. Our analyses indicate that IL7hi/YFP+ TECs emerge early during thymic organogenesis, retain a cortical-associated phenotype while continually segregating from mature YFPneg mTECs. Furthermore, IL7hi/YFP+ TECs are markedly sustained in immunodeficient Rag2-/- mice, in which T cell development is blocked at the DN3 stage, indicating that their homeostasis is regulated by thymocyte-derived signals beyond the DN3 stage. A recent report has proposed a conceptual model that defines distinct stages of cTEC differentiation based on the differential expression of CD205 and CD40 markers [49]. Our findings demonstrate that IL7hi/YFP+ TECs express early cTEC-associated marker CD205 already at E13.5, and progressively acquire the expression of CD40 throughout thymic ontogeny. Moreover, although the thymocyte-TEC crosstalk dynamically regulates IL7hi/YFP+ TECs, in Rag2-/- mice the sequential acquisition of CD205 and CD40 markers by this population is still observed (data not shown). This indicates that while the initial programming of cTEC development occurs in a thymocyte-independent manner, the differentiation of thymocytes until the DN3 stage permits IL7hi/YFP+ TECs to mature through differential stages of cTEC development, culminating with the expression of CD205 and CD40. However, due to the paucity of suitable markers to identify further transitional stages of cTEC differentiation, one cannot exclude that maturation of IL7hi/YFP+ TECs might progress beyond the stage of CD205+CD40+ expression. As such, it is acceptable to propose that our mice model may provide a useful platform to delineate new transitional stages of cTEC development. Genetic profiling revealed that IL7hi/YFP+ TECs express cortical-associated thymopoietic factors, namely Ccl25 (thymic homing), Dll4 (T cell commitment), IL- 7 (survival and proliferation) and β5t (positive selection), but not medullary- ! Chapter V | References ! 51 1 Delves, P. J. and Roitt, I. M. (2000) The immune system: First of two parts. The New England Journal of Medicine. 343, 37–49 2 Parkin, J. and Cohen, B. (2001) An overview of the immune system. Lancet. 357, 1777–89 3 Kondo, M. et al. (2003) Biology of hematopoietic stem cells and progenitors: implications for clinical application. Annual Review of Immunology. 21, 759–806 4 Sakaguchi, S. et al. (2008) Regulatory T cells and immune tolerance. Cell. 133, 775–87 5 Bluestone, J. A. (2011) Mechanisms of tolerance. Immunological Reviews. 241, 5–19 6 Miller, J. F. (2002) The discovery of thymus function and of thymus-derived lymphocytes. Immunological Reviews. 185, 7–14 7 Miller, J. F. (1961) Immunological function of the thymus. Lancet. 2, 748– 749 8 Gordon, J. and Manley, N. R. (2011) Mechanisms of thymus organogenesis and morphogenesis. Development. 138, 3865–78 9 Boyd, R. L. et al. (1993) The thvmic microenvironment. Immunology Today. 14, 445–459 10 Boehm, T. and Bleul, C. C. (2006) Thymus-homing precursors and the thymic microenvironment. Trends in Immunology. 27, 477–84 11 Ciofani, M. and Zúñiga-Pflücker, J. C. (2007) The thymus as an inductive site for T lymphopoiesis. Annual Review of Cell and Developmental Biology. 23, 463–93 12 Anderson, G. et al. (2007) Generating intrathymic microenvironments to establish T-cell tolerance. Nature Reviews Immunology. 7, 954–63 13 den Braber, I. et al. (2012) Maintenance of peripheral naive T cells is sustained by thymus output in mice but not humans. Immunity. 36, 288–97 14 Gill, J. et al. (2003) Thymic generation and regeneration. Immunological Reviews. 195, 28–50 15 Lynch, H. E. et al. (2009) Thymic involution and immune reconstitution. Trends in Immunology. 30, 366–373 Chapter V | References ! 52 16 Manley, N. R. (2000) Thymus organogenesis and molecular mechanisms of thymic epithelial cell differentiation. Seminars in Immunology. 12, 421–8 17 Itoi, M. et al. (2001) Two distinct steps of immigration of hematopoietic progenitors into the early thymus anlage. International Immunology. 13, 1203–11 18 Blackburn, C. C. and Manley, N. R. (2004) Developing a new paradigm for thymus organogenesis. Nature Reviews Immunology. 4, 278–89 19 Rodewald, H.-R. (2008) Thymus organogenesis. Annual Review of Immunology. 26, 355–88 20 Foster, K. et al. (2008) Contribution of neural crest-derived cells in the embryonic and adult thymus. Journal of Immunology. 180, 3183–9 21 Jenkinson, W. E. et al. (2003) Differential requirement for mesenchyme in the proliferation and maturation of thymic epithelial progenitors. The Journal of Experimental Medicine. 198, 325–32 22 Nowell, C. S. et al. (2007) Thymus organogenesis and development of the thymic stroma. Methods in Molecular Biology. 380, 125–62 23 Sitnik, K. M. et al. (2012) Mesenchymal cells regulate retinoic acid receptordependent cortical thymic epithelial cell homeostasis. Journal of Immunology. 188, 4801–9 24 Jenkinson, W. E. et al. (2007) PDGFRalpha-expressing mesenchyme regulates thymus growth and the availability of intrathymic niches. Blood. 109, 954–60 25 Holländer, G. et al. (2006) Cellular and molecular events during early thymus development. Immunological Reviews. 209, 28–46 26 Foster, K. E. et al. (2010) EphB – ephrin-B2 interactions are required for thymus migration during organogenesis. Proceedings of the National Academy of Sciences of the United States of America. 107, 13414–13419 27 Gordon, J. et al. (2004) Functional evidence for a single endodermal origin for the thymic epithelium. Nature Immunology. 5, 546–53 28 Gordon, J. et al. (2001) Gcm2 and Foxn1 mark early parathyroid- and thymus-specific domains in the developing third pharyngeal pouch. Mechanisms of Development. 103, 141–3 Chapter V | References ! 53 29 Corbeaux, T. et al. (2010) Thymopoiesis in mice depends on a Foxn1- positive thymic epithelial cell lineage. Proceedings of the National Academy of Sciences of the United States of America. 107, 16613–8 30 Su, D. et al. (2003) A domain of Foxn1 required for crosstalk-dependent thymic epithelial cell differentiation. Nature Immunology. 4, 1128–35 31 Blackburn, C. C. et al. (1996) The nu gene acts cell-autonomously and is required for differentiation of thymic epithelial progenitors. Proceedings of the National Academy of Sciences of the United States of America. 93, 5742–6 32 Tsai, P. T. et al. (2003) BMP4 acts upstream of FGF in modulating thymic stroma and regulating thymopoiesis. Blood. 102, 3947–53 33 Balciunaite, G. et al. (2002) Wnt glycoproteins regulate the expression of FoxN1, the gene defective in nude mice. Nature Immunology. 3, 1102–8 34 Anderson, G. and Takahama, Y. (2012) Thymic epithelial cells: working class heroes for T cell development and repertoire selection. Trends in Immunology. 33, 256–63 35 Alves, N. L. et al. (2009) Thymic epithelial cells: the multi-tasking framework of the T cell “cradle”. Trends in Immunology. 30, 468–74 36 Anderson, G. et al. (2009) A roadmap for thymic epithelial cell development. European Journal of Immunology. 39, 1694–9 37 Irla, M. et al. (2010) Control of central self-tolerance induction by autoreactive CD4+ thymocytes. Trends in Immunology. 31, 71–9 38 Anderson, M. S. et al. (2002) Projection of an immunological self shadow within the thymus by the aire protein. Science. 298, 1395–401 39 Seach, N. et al. (2008) The Lymphotoxin Pathway Regulates Aire- Independent Expression of Ectopic Genes and Chemokines in Thymic Stromal Cells. Journal of Immunology. 180, 5384–5392 40 Klug, D. B. et al. (1998) Interdependence of cortical thymic epithelial cell differentiation and T-lineage commitment. Proceedings of the National Academy of Sciences of the United States of America. 95, 11822–7 41 Klug, D. B. et al. (2002) Cutting edge: thymocyte-independent and thymocyte-dependent phases of epithelial patterning in the fetal thymus. Journal of Immunology. 169, 2842–5 Chapter V | References ! 54 42 Bennett, A. R. et al. (2002) Identification and characterization of thymic epithelial progenitor cells. Immunity. 16, 803–14 43 Gill, J. et al. (2002) Generation of a complete thymic microenvironment by MTS24(+) thymic epithelial cells. Nature Immunology. 3, 635–42 44 Rossi, S. W. et al. (2007) Redefining epithelial progenitor potential in the developing thymus. European Journal of Immunology. 37, 2411–8 45 Bleul, C. C. et al. (2006) Formation of a functional thymus initiated by a postnatal epithelial progenitor cell. Nature. 441, 992–6 46 Rossi, S. W. et al. (2006) Clonal analysis reveals a common progenitor for thymic cortical and medullary epithelium. Nature. 441, 988–91 47 Rodewald, H.-R. et al. (2001) Thymus medulla consisting of epithelial islets each derived from a single progenitor. Nature. 414, 763–8 48 Hamazaki, Y. et al. (2007) Medullary thymic epithelial cells expressing Aire represent a unique lineage derived from cells expressing claudin. Nature Immunology. 8, 304–11 49 Shakib, S. et al. (2009) Checkpoints in the development of thymic cortical epithelial cells. Journal of Immunology. 182, 130–7 50 Ripen, A. M. et al. (2011) Ontogeny of thymic cortical epithelial cells expressing the thymoproteasome subunit β5t. European Journal of Immunology. 41, 1278–87 51 van Ewijk, W. et al. (1994) Crosstalk in the mouse thymus. Immunology Today. 15, 214–7 52 van Ewijk, W. et al. (2000) Stepwise development of thymic microenvironments in vivo is regulated by thymocyte subsets. Development. 127, 1583–91 53 Jenkinson, W. E. et al. (2005) Development of functional thymic epithelial cells occurs independently of lymphostromal interactions. Mechanisms of Development. 122, 1294–9 54 Takahama, Y. (2006) Journey through the thymus: stromal guides for T-cell development and selection. Nature Reviews Immunology. 6, 127–35 55 Love, P. E. and Bhandoola, A. (2011) Signal integration and crosstalk during thymocyte migration and emigration. Nature Reviews Immunology. 11, 469–77 Chapter V | References ! 55 56 Peaudecerf, L. et al. (2012) Thymocytes may persist and differentiate without any input from bone marrow progenitors. The Journal of Experimental Medicine. DOI: 10.1084/jem.20120845 57 Martins, V. C. et al. (2012) Thymus-autonomous T cell development in the absence of progenitor import. The Journal of Experimental Medicine. DOI: 10.1084/jem.20120846 58 Foss, D. L. et al. (2001) The importation of hematogenous precursors by the thymus is a gated phenomenon in normal adult mice. The Journal of Experimental Medicine. 193, 365–74 59 Carpenter, A. C. and Bosselut, R. (2010) Decision checkpoints in the thymus. Nature Immunology. 11, 666–73 60 Luc, S. et al. (2012) The earliest thymic T cell progenitors sustain B cell and myeloid lineage potential. Nature Immunology. 13, 412–9 61 Koch, U. et al. (2008) Delta-like 4 is the essential, nonredundant ligand for Notch1 during thymic T cell lineage commitment. The Journal of Experimental Medicine. 205, 2515–23 62 Hozumi, K. et al. (2008) Delta-like 4 is indispensable in thymic environment specific for T cell development. The Journal of Experimental Medicine. 205, 2507–13 63 Klein, L. et al. (2009) Antigen presentation in the thymus for positive selection and central tolerance induction. Nature Reviews Immunology. 9, 833–44 64 Gommeaux, J. et al. (2009) Thymus-specific serine protease regulates positive selection of a subset of CD4+ thymocytes. European Journal of Immunology. 39, 956–64 65 Murata, S. et al. (2007) Regulation of CD8+ T Cell Development by Thymus- Specific Proteasomes. Science. 316, 1349–1353 66 Nakagawa, T. et al. (1998) Cathepsin L: Critical Role in Ii Degradation and CD4 T Cell Selection in the Thymus. Science. 280, 450–453 67 Nitta, T. et al. (2009) CCR7-mediated migration of developing thymocytes to the medulla is essential for negative selection to tissue-restricted antigens. Proceedings of the National Academy of Sciences of the United States of America. 106, 17129–33 Chapter V | References ! 56 68 Takahama, Y. et al. (2008) Modest cortex and promiscuous medulla for thymic repertoire formation. Trends in Immunology. 29, 251–5 69 Derbinski, J. et al. (2001) Promiscuous gene expression in medullary thymic epithelial cells mirrors the peripheral self. Nature Immunology. 2, 1032–9 70 Koble, C. and Kyewski, B. (2009) The thymic medulla: a unique microenvironment for intercellular self-antigen transfer. The Journal of Experimental Medicine. 206, 1505–13 71 Matloubian, M. et al. (2004) Lymphocyte egress from thymus and peripheral lymphoid organs is dependent on S1P receptor 1. Nature. 427, 355–60 72 Ueno, T. et al. (2002) Role for CCR7 ligands in the emigration of newly generated T lymphocytes from the neonatal thymus. Immunity. 16, 205–18 73 Namen, A. E. et al. (1988) B cell precursor growth-promoting activity: Purification and characterization of a growth factor active on lymphocyte precursors. The Journal of Experimental Medicine. 167, 988–1002 74 von Freeden-Jeffry, U. et al. (1995) Lymphopenia in interleukin (IL)-7 genedeleted mice identifies IL-7 as a nonredundant cytokine. The Journal of Experimental Medicine. 181, 1519–26 75 Surh, C. D. and Sprent, J. (2008) Homeostasis of naive and memory T cells. Immunity. 29, 848–62 76 Fry, T. J. and Mackall, C. L. (2002) Interleukin-7: from bench to clinic. Blood. 99, 3892–3904 77 Meier, D. et al. (2007) Ectopic lymphoid-organ development occurs through interleukin 7-mediated enhanced survival of lymphoid-tissue-inducer cells. Immunity. 26, 643–54 78 Mazzucchelli, R. and Durum, S. K. (2007) Interleukin-7 receptor expression: intelligent design. Nature Reviews Immunology. 7, 144–54 79 Rochman, Y. et al. (2009) New insights into the regulation of T cells by gamma(c) family cytokines. Nature Reviews Immunology. 9, 480–90 80 Iwanami, N. et al. (2011) Genetic evidence for an evolutionarily conserved role of IL-7 signaling in T cell development of zebrafish. Journal of Immunology. 186, 7060–6 81 Mackall, C. L. et al. (2011) Harnessing the biology of IL-7 for therapeutic application. Nature Reviews Immunology. 11, 330–42 Chapter V | References ! 57 82 Hong, C. et al. (2012) Intrathymic IL-7: the where, when, and why of IL-7 signaling during T cell development. Seminars in Immunology. 24, 151–8 83 Park, J.-H. et al. (2010) Signaling by intrathymic cytokines, not T cell antigen receptors, specifies CD8 lineage choice and promotes the differentiation of cytotoxic-lineage T cells. Nature Immunology. 11, 257–64 84 Huang, J. et al. (2001) Cutting edge: histone acetylation and recombination at the TCR gamma locus follows IL-7 induction. Journal of Immunology. 167, 6073–7 85 Maki, K. et al. (1996) Interleukin 7 receptor-deficient mice lack γδ T cells. Proceedings of the National Academy of Sciences of the United States of America. 93, 7172–7177 86 Durum, S. K. et al. (1998) Interleukin 7 Receptor Control of T Cell Receptor γ Gene: Role of Receptor-associated Chains and Locus Accessibility. The Journal of Experimental Medicine. 188, 2233–2241 87 Kim, G. Y. et al. (2011) Seeing is believing: illuminating the source of in vivo interleukin-7. Immune Network. 11, 1–10 88 Bolotin, E. et al. (1999) Serum levels of IL-7 in bone marrow transplant recipients: relationship to clinical characteristics and lymphocyte count. Bone Marrow Transplantation. 23, 783–8 89 Alves, N. L. et al. (2009) Characterization of the thymic IL-7 niche in vivo. Proceedings of the National Academy of Sciences of the United States of America. 106, 1512–7 90 Alves, N. L. et al. (2010) Cutting Edge: a thymocyte-thymic epithelial cell cross-talk dynamically regulates intrathymic IL-7 expression in vivo. Journal of Immunology. 184, 5949–53 91 Zamisch, M. et al. (2005) Ontogeny and Regulation of IL-7-Expressing Thymic. Journal of Immunology. 174, 60–67 92 Akiyama, T. et al. (2005) Dependence of self-tolerance on TRAF6-directed development of thymic stroma. Science. 308, 248–51 93 Burkly, L. et al. (1995) Expression of relB is required for the development of thymic medulla and dendritic cells. Nature. 373, 531–536 94 Kajiura, F. et al. (2004) NF-kappa B-inducing kinase establishes selftolerance in a thymic stroma-dependent manner. Journal of Immunology. 172, 2067–75 Chapter V | References ! 58 95 Boehm, T. et al. (2003) Thymic medullary epithelial cell differentiation, thymocyte emigration, and the control of autoimmunity require lymphoepithelial cross talk via LTbetaR. The Journal of Experimental Medicine. 198, 757–69 96 Zhu, M. et al. (2007) Lymphotoxin β Receptor is Required for the Selection of Autoreactie T Cells in Thymic Medulla. Journal of Immunology. 179, 8069–8075 97 Akiyama, T. et al. (2008) The tumor necrosis factor family receptors RANK and CD40 cooperatively establish the thymic medullary microenvironment and self-tolerance. Immunity. 29, 423–37 98 Mouri, Y. et al. (2011) Lymphotoxin signal promotes thymic organogenesis by eliciting RANK expression in the embryonic thymic stroma. Journal of Immunology. 186, 5047–57 99 Ohigashi, I. et al. (2011) Effects of RANKL on the thymic medulla. European Journal of Immunology. 41, 1822–7 100 Hikosaka, Y. et al. (2008) The cytokine RANKL produced by positively selected thymocytes fosters medullary thymic epithelial cells that express autoimmune regulator. Immunity. 29, 438–50 101 Roberts, N. A. et al. (2012) Rank signaling links the development of invariant γδ T cell progenitors and Aire(+) medullary epithelium. Immunity. 36, 427–37 102 Rossi, S. W. et al. (2007) RANK signals from CD4(+)3(-) inducer cells regulate development of Aire-expressing epithelial cells in the thymic medulla. The Journal of Experimental Medicine. 204, 1267–72 103 Dunn, R. J. et al. (1997) Thymic Overexpression of CD40 Ligand Disrupts Normal Thymic Epithelial Organization. Journal of Histochemistry & Cytochemistry. 45, 129–141 104 Irla, M. et al. (2008) Autoantigen-specific interactions with CD4+ thymocytes control mature medullary thymic epithelial cell cellularity. Immunity. 29, 451–63 105 Gray, D. H. D. et al. (2006) Developmental kinetics, turnover, and stimulatory capacity of thymic epithelial cells. Blood. 108, 3777–85 106 Chinn, I. K. et al. (2012) Changes in primary lymphoid organs with aging. Seminars in Immunology. DOI: 10.1016/j.smim.2012.04.005 Chapter V | References ! 59 107 Rode, I. and Boehm, T. (2012) Regenerative capacity of adult cortical thymic epithelial cells. Proceedings of the National Academy of Sciences of the United States of America. 109, 3463–8 108 Shinkai, Y. et al. (1992) RAG-2-deficient mice lack mature lymphocytes owing to inability to initiate V(D)J rearrangement. Cell. 68, 855–67 109 Lantz, O. et al. (2000) Gamma chain required for naïve CD4+ T cell survival but not for antigen proliferation. Nature Immunology. 1, 54–8 110 Gray, D. H. D. et al. (2002) Analysis of thymic stromal cell populations using flow cytometry. Journal of Immunological Methods. 260, 15–28 111 Hare, K. J. et al. (1999) In vitro models of T cell development. Seminars in Immunology. 11, 3–12 112 Yamasaki, S. and Saito, T. (2007) Molecular basis for pre-TCR-mediated autonomous signaling. Trends in Immunology. 28, 39–43 113 Levelt, C. N. et al. (1993) Restoration of early thymocyte differentiation in T-cell receptor beta-chain-deficient mutant mice by transmembrane signaling through CD3 epsilon. Proceedings of the National Academy of Sciences of the United States of America. 90, 11401–5 114 Yang, S. J. et al. (2006) The quantitative assessment of MHC II on thymic epithelium: implications in cortical thymocyte development. International Immunology. 18, 729–39 115 Flomerfelt, F. A. et al. (2010) Tbata modulates thymic stromal cell proliferation and thymus function. The Journal of Experimental Medicine. 207, 2521–32 116 Senoo, M. et al. (2007) p63 Is essential for the proliferative potential of stem cells in stratified epithelia. Cell. 129, 523–36 117 Lee, H. W. et al. (2008) RANKL stimulates proliferation, adhesion and IL-7 expression of thymic epithelial cells. Experimental & Molecular Medicine. 40, 59–70 118 Marrella, V. et al. (2012) Anti-CD3{varepsilon} mAb improves thymic architecture and prevents autoimmune manifestations in a mouse model of Omenn syndrome: therapeutic implications. Blood. 120, 1005–1014 119 Surh, C. D. et al. (1992) Growth of Epithelial Cells in the Thymic Medulla Is Under the Control of Mature T Cells. Journal of Experimental Medicine. 176, 611–616 Chapter VI | Supplemental Information ! 66 Figure S8 - The emergence of mTECs in Rag2-/- treated mice does not occur due to a direct effect of anti-CD3 ε mAb stimulation in the thymic epithelium. E14 thymic lobes were placed in dGuo-treated FTOC, in the presence or absence of anti-CD3 ε mAb. TECs were analysed for the expression of BP1 and CD80. Figure S9 - Anti-CD3 ε treatment does not affect the expression levels of thymocyte-derived RANKL and CD40L. Different thymocyte subsets from control, anti-CD3 ε treated and immunocompetent mice were purified by cell sorting and analysed for the expression of Tnfsf11 (RANKL) and Cd40lg (CD40L). Values were normalized to ß-actin. ! Figure S10 - Thymic microenvironment from 2 weeks old immunocompetent mice. Representative immunohistochemical analysis of thymic sections obtained from immunocompetent IL-7 reporter mice. Sections were stained with the following antibodies: YFP, green; CD8, red (left panel), YFP, green; CD205, red; MHCII, blue (middle panel), DAPI, blue; YFP, green; MTS10, red (right panel). 0.03 13.9 85.1 0.12 6.37 93 BP1 (cTEC) CD80 (mTEC) +dGuo +αCD3ε! YFP CD8 50 µm DAPI YFP MTS10 (mTECs) 50 µm YFP CD205 MHCII 50 µm Immuno-competent 0.000 0.001 0.002 0.003 0.004 0.005 0.000 0.001 0.002 0.003 0.01 0.02 0.03 0.04 Relative mRNA levels (Arbitrary Units) Relative mRNA levels (Arbitrary Units) Immunocompetent DN DP SP4 SP8 Immunocompetent DN DP SP4 Rag2 -/- DN DN ISP8 DP αCD3 Treated Rag2 -/- DN DN ISP8 DP αCD3 Treated Tnfsf11 (RANKL) Cd40lg (CD40L) Chapter VI | Supplemental Information ! 67 ! Figure S11 - The strength of TCR-MHC interactions during thymocyte selection modulates the homeostasis of IL7hi/YFP+ TECs. A) CD4/CD8 profile of the thymic hematopoietic fraction isolated from control Rag2-/-, female and male Marilyn Rag2-/- mice. B) TECs were analyzed for the expression of YFP (top panel) and BP1 and CD80 (middle and bottom panels). Middle panel (total TECs) and bottom panel (overlay of YFPneg (gray) and Il7hi/YFP+ (green) TECs. C) Fold difference in the Mean Fluorescence Intensity (MFI) of YFP expression (left), percentage of Il7hi/YFP+ (middle) and CD80+ (right) TECs. (*) indicates that the differences between groups are statistical significant (p<0.05). 0 20 40 60 0 10 20 30 40 50 1000 1500 2000 2500 Marilyn - Male Female Male Marilyn Rag2 -/- B Control YFP MHCII 63 37 BP1 CD80 0.89 98.3 84.7 15.2 7.61 57.5 4.63 90.9 31.7 26.8 30.8 53.2 94.2 2.12 Marilyn - Female Control C % CD80+ TECs % IL7hi/YFP+ TECs MFI YFP ** 92.4 7.55 3.3 34.5 40.2 0.51 4.5 13.8 * Marilyn Rag2 -/- Control 88.4 0.2 0.1 0.2 Female 9.9 1.6 85.4 1.2 Male 29.2 0.4 45.3 15.1 A CD4 CD8 ! ! ! Acknowledgments Chapter VII ! ! Chapter VII | Acknowledgments ! 71 Esta dissertação não é apenas resultado de um empenho individual, mas sim fruto de um conjunto valioso de esforços que me permitiram ultrapassar todas as adversidades encontradas e assim chegar ao fim de mais uma etapa. Gostaria de por este meio expressar a minha mais sincera gratidão para com aqueles que, diretamente ou indiretamente, contribuíram para que isto se tornasse numa realidade. Em primeiro lugar, desejo manifestar o meu mais sincero agradecimento ao Nuno Alves pela forma incansável como me orientou, pela constante disponibilidade, pela confiança que depositou em mim e principalmente pelas oportunidades proporcionadas. Olhando em retrospectiva, toda a minha evolução e aquilo que aprendi ao longo deste ultimo ano foi em grande parte graças a ti. Não tenho palavras para agradecer pelo inestimável apoio e motivação transmitidos ao longo desta jornada, assim como por todas as criticas e discussões científicas que não só contribuíram para estimular o meu interesse pelo conhecimento, mas também para ultrapassar as minhas próprias limitações. À Ana Rosalina, que apesar das nossas incompatibilidades no passado, sou-lhe profundamente grato pela disponibilidade e apoio, pelos conselhos e duvidas esclarecidas, assim como pelos resultados facultados. À Catarina Meireles, o meu sincero obrigado pela boa disposição e toda a ajuda técnica disponibilizada. Ao Alexandre Carmo e Alexandra Moreira por me terem aceite no grupo e pela oportunidade de aprender e contribuir. A todos os membros do CAGE deixo uma palavra de agradecimento pela simpatia e disponibilidade com que me receberam. É imperativo agradecer a todas as pessoas que indiretamente proveram um contributo importante para o trabalho aqui apresentado. À Catarina Leitão por todo o apoio prestado na citometria e pela amabilidade. A toda a equipa do biotério responsável pela logística e manutenção dos nossos ratinhos, Isabel Duarte, Sofia Lama e Liliana Silva. À Paula Magalhães pela ajuda disponibilizada nos quantitativos. À Paula Sampaio pelo auxílio e autorização dada para trabalhar com o microscópio. I wish to thank Dr. Benedita Rocha (Hospital Necker) and Dr. Jeff Browning (Biogenidec) for kindly providing the antibodies fundamental in this thesis, anti- CD3ε and anti-LTβR, respectively. I also want to thank the recent but very important contribution of Dr.Jocelyne Demengeot (Instituto Gulbenkian de Ciência) with the Marilyn Rag2-/- mice. To Prof. James Di Santo (Institute Pasteur) Chapter VII | Acknowledgments ! 72 for the indirect scientific support on this project. Aos meus amigos, que ao longo destes anos me agraciaram com toda a amizade e apoio, quer fosse nos bons e maus momentos. Ao Elísio, pelos momentos vividos, pelas conversas, pelos jantares, pelas férias, pelos momentos tensos e principalmente pela amizade, um especial obrigado por tudo o que tens feito por mim. Ao Filipe e Tiago, apesar de longínquos os tempos em que "esquinar" fazia parte do nosso vocabulário, um obrigado por terem sempre estado presentes. Aqueles que sofreram dos sintomas que só a escrita de uma tese provoca, particularmente à Cátia, Jéssica, Ana Rita, Andreia Gomes, um obrigado especial não só por todos os momentos de convivência e descontração, mas também pelos situações awkwards que só voces são capazes de proporcionar. À Rita, o meu sincero agradecimento por tudo e que o futuro te sorria. À Andreia pelo apoio incondicional. Obrigado por teres estado sempre ao meu lado e pela paciência com que lidaste e acalmaste o meu (mau) feitio que vinha ao de cima nos momentos mais críticos. Obrigada por seres uma fonte de inspiração. Aos meus avós, pais e irmão, porque nem todas as palavras escritas nesta tese são suficientes para vos agradecer por todos os sacrifícios e privações que passaram e que me permitiram chegar tão longe. À medida que trilho o meu próprio caminho almejando chegar cada vez mais longe, carrego comigo todos os ensinamentos e exemplos de vida que me incutiram e graças aos quais fizeram a pessoa que sou hoje. É a vocês que devo tudo e apesar de muitas vezes ausente, sei que serão sempre o meu porto de abrigo, prontos para ajudar a superar todos os obstáculos e partilhar todas as alegrias. É um privilegio e orgulho ter-vos como família. Um muito obrigado por acreditarem em mim. “What we call the beginning is often the end. And to make an end is to make a beginning. The end is where we start from" - T.S. Eliot