Alpha-1-Antitrypsin deficiency, exploring the role of SERPINA1 rare variants and searching for genetic modifiers of associated diseases (Granulomatosis with Polyangiitis)

Deolinda Isabel Fernandes da Silva Mestrado em Bioquímica Departamento de Química e Bioquímica 2014 Orientador Susana Seixas, PhD, IPATIMUP Alpha-1-Antitrypsin deficiency, exploring the role of SERPINA1 rare variants and searching for genetic modifiers of associated diseases (Granulomatosis with Polyangiitis) Nome do Autor, letra Arial Bold tamanho 10, justificado à esquerda 2.º CICLO Todas as correções determinadas pelo júri, e só essas, foram efetuadas. O Presidente do Júri, Porto, ______/______/_________ Agradecimentos “Somos a junção de vários pedaços e perder algum é como uma amputação” Pedro Chagas Freitas O culminar desta etapa deve-se à junção de todos os pedacinhos que fui construindo ao longo desta minha caminhada iniciada bem lá atrás, quando iniciei o percurso escolar, não seria justo resumi-la a estes dois últimos anos apenas, pois seria a perda de muito do que sou. Por isso começo por agradecer à minha FAMÍLIA, Pais, Irmãos, Cunhados e Sobrinhos que sempre estiveram ao meu lado, me apoiaram em todas a minhas decisões, certas ou erradas mas que me trouxeram até aqui, me deram conselhos e me ajudaram em tudo o que precisei. Eles são o meu suporte e é nesta união que busco forças para nunca desmoronar ou desistir. Na realidade não há palavras que possam descrever aquilo que significam ou que fazem por mim, mas aqui fica o meu simples gesto de agradecimento a todos eles. Agradeço à Susana Seixas, minha orientadora, pela oportunidade de desenvolver este projeto no IPATIMUP, por todo o apoio, compreensão e disponibilidade que sempre demostrou ao longo deste ano e por todos os ensinamentos que me transmitiu. Devo ainda agradecer a oportunidade e confiança para o desenvolvimento do projeto em colaboração com o laboratório de Munique. À Sílvia, Patrícia e Andreia, minhas colegas de laboratório, pelas ajudas no trabalho, pelo companheirismo, amizade, simpatia e boa disposição demostrados ao longo deste ano de permanência no instituto. To Dieter Jenne, my advisor in Munich, for his help and availability, for the opportunity to be there and learn so much and know other ways to work, other country and its culture and all the teachings that gave me. To Heike, the lab technician, that followed all my work and taught me all that I needed, and for the friendship. To Natascha, Therese and Lisa, my colleagues in Munich lab, for help in developing the work and for the friendship while I was there. Por último, mas não menos importante, a todos os meus amigos, sem ser necessário enumera-los, que a par da família são muito importantes e que sei que posso sempre contar quando alguma dificuldade surgir. E também a todas as pessoas que conheci ao longo deste trajeto que de uma forma ou de outra me deixaram um ensinamento e me ajudaram a construir enquanto pessoa. FCUP Alpha-1-Antitrypsin deficiency, exploring the role of SERPINA1 rare variants and searching for genetic modifiers of associated diseases (Granulomatosis with Polyangiitis) ii Resumo O estudo do genoma humano em muito tem contribuído para o entendimento das bases moleculares que estão na origem das doenças genéticas. Neste sentido, a criação de bases de dados que reúnem todas as variações genéticas do genoma humano, identificadas até ao momento, tem-se revelado um ponto-chave para perceber como estas influenciam as características humanas atuais, o risco e progressão de doenças, assim como a resposta a diversos tratamentos médicos. A deficiência de alfa-1-antitripsina (DAAT) é uma doença monogénica causada por mutações no gene SERPINA1 que geralmente culminam numa baixa concentração da proteína SERPINA1 no soro. Esta doença afeta um número considerável de indivíduos, sendo mais comum em populações de origem Europeia, onde está associada com um elevado risco de desenvolver patologias respiratórias, como a doença pulmonar obstrutiva crónica (DPOC) ou o enfisema pulmonar. Desde a identificação da DAAT em 1963 foram identificados múltiplos alelos com diferentes implicações na concentração de proteína no soro, e com subsequentes diferenças ao nível das manifestações clínicas da doença. Os alelos mais comuns são os M (M1, M2, M3 e M4) que estão relacionados com níveis normais de proteína (0,9 a 2 g/L), e os alelos S (Glu264Val) e Z (Glu342Lys) cujos níveis de proteína no soro variam entre 50-60% e 10-15% do normal, respetivamente. Estes são também os dois variantes mais associados com a patologia clínica. Os casos mais severos da doença são geralmente verificados em indivíduos homozigóticos para o alelo Z, cuja acentuada deficiência da proteína no soro resulta da acumulação intracelular em polímeros nos hepatócitos. Por esta razão a DAAT é também associada com um risco de doença hepática em consequência dos efeitos tóxicos dos polímeros Z nas células. A polimerização do alelo Z foi também proposta como uma das causas possíveis para a origem de uma resposta auto-imune nos casos de vasculite. A granulomatose com poliangite (GPA) é um síndrome multissistémico prevalente entre pacientes com DAAT e caracterizada por inflamações granulomatosas nos pequenos vasos. Outros mecanismos que têm sido apontados na origem da GPA incluem o desequilíbrio proteolítico entre a proteinase 3 (PR3) e a sua principal inibidora no soro a SERPINA1, bem como uma possível hereditariedade de genes auto-imunes transmitidos conjuntamente com genótipos de DAAT devido à sua proximidade no cromossoma 14q32.1. O gene SERPINA2 localizado 12kb a jusante do gene SERPINA1 possui uma sequência de DNA muito similar a este e embora tenha sido durante muito tempo FCUP Alpha-1-Antitrypsin deficiency, exploring the role of SERPINA1 rare variants and searching for genetic modifiers of associated diseases (Granulomatosis with Polyangiitis) iii considerado um pseudogene, o gene SERPINA2 possui uma forma ativa de função desconhecida que é expressa em diferentes tecidos incluindo nos leucócitos. O principal objetivo deste trabalho foi identificar e caracterizar alelos raros de DAAT na população Portuguesa. No sentido de obter mais informação sobre as bases moleculares e a variabilidade intra-haplotípica de cada variante combinou-se a sequenciação de DNA de uma região de ~8kb do gene SERPINA1 com a genotipagem de dois microssatélites flanqueantes CAn (~7,5kb a jusante) e GTn (~207kb a montante). De entre os 51 casos de DAAT sequenciados foram identificadas 13 mutações patogénicas num total de 14 alelos raros: MMalton (Phe52del; n=18), MPalermo (Phe52del; n=9), I (Arg39Cys; n=7), Q0Ourém (Leu353framStop376; n=4), PLowell (Asp256Val; n=3), MHerleen (Pro369Leu; n=2), MWurzburg (Glu342Lys; n=1), Q0Lisbon (Thr68Ile; n=1), T (Glu264Val; n=1), Q0Gaia (Leu263Pro; n=1), PGaia (Glu162Gly; n=1), Q0Oliveira do Douro (Arg281framStop297; n=1), Q0Vila Real (Met374framStop392; n=1) e Q0Faro (IVSIC+3Tins; n=1). Os últimos cinco alelos são novos e descritos pela primeira vez no presente trabalho. Os alelos Q0Gaia e PGaia resultam ambos de substituições de aminoácidos com repercussões na estrutura da proteína. Os variantes Q0Oliveira do Douro e Q0Vila Real resultam de pequenas deleções nucleotídicas que estão na origem da alteração da matriz de leitura e da inserção de codões de terminação prematura. O alelo Q0Faro afeta o normal processamento do mRNA por alteração de um local de splice. A análise da variação haplotípica permitiu avaliar os alelos anteriormente descritos em populações de ancestralidade Europeia e elucidar a origem dos alelos raros MMalton e MPalermo em bases moleculares distintas M2 e M1, respetivamente. A avaliação do espetro mutacional aponta para o facto de uma percentagem das mutações do gene de SERPINA1 ocorrem em regiões hipermutáveis, enquanto os motivos repetitivos tendem a acumular mutações do tipo inserções e deleções (indels), os dinucleótidos CpG apresentam um número elevado de substituições nucleotídicas preferencialmente de CGTG e de CGCA. Por outro lado, a análise da distribuição das mutações patogénicas e não patogénicas na região codificante do gene de SERPINA1 mostra que as mutações patogénicas se tendem a concentrar em importantes domínios funcionais da molécula, por oposição às mutações não patogénicas que se encontram dispersas uniformemente por toda a sequência de SERPINA1. Numa segunda parte do trabalho procuramos avaliar o gene SERPINA2 como um potencial candidato para a associação observada entre a SERPINA1 e a GPA. Apesar de preliminares, os nossos resultados apontam para uma maior FCUP Alpha-1-Antitrypsin deficiency, exploring the role of SERPINA1 rare variants and searching for genetic modifiers of associated diseases (Granulomatosis with Polyangiitis) iv homogeneidade haplotípica nos controlos face aos casos de GPA, o que levanta a hipótese do haplótipo mais frequentemente associado com alelo Z (SERPINA2/V3) apresentar um fator protetor. No âmbito deste trabalho, foram ainda realizados alguns ensaios experimentais de expressão de SERPINA2 em células humanas, HEK293, e em células de Drosophila Schneider S2. Embora a expressão da SERPINA2 tenha sido obtida em ambos os sistemas celulares, nas células Schneider S2 foram conseguidos níveis de proteína mais elevados em grande parte devido à acumulação intracelular da SERPNA2 nas células HEK293. Palavras-chave: Deficiência de alfa-1-antitripsina, SERPINA1, alelos raros, haplótipos, mutações patogénicas, Granulomatose com poliangite, SERPINA2. FCUP Alpha-1-Antitrypsin deficiency, exploring the role of SERPINA1 rare variants and searching for genetic modifiers of associated diseases (Granulomatosis with Polyangiitis) v Abstract The study of the human genome has greatly contributed to the understanding of the molecular basis of genetic diseases. In this sense, the creation of databases that gather all the genetic variations in the human genome identified so far, has proved a key point to understand how these influence current human traits, disease risk and progression, as well as the response to various clinical treatments. The alpha-1antitrypsin deficiency (AATD) is a monogenic disease caused by mutations in the SERPINA1 gene, which generally culminate in low serum levels of the SERPINA1 protein. The disease affects a considerable number of individuals, being more frequent in populations of European descended, where it is associated with a high risk of developing respiratory diseases, such as chronic obstructive pulmonary disease (COPD) or lung emphysema. Since the description of AATD in 1963 multiple alleles were identified and these were found to correlate with different serum levels and clinical manifestations of the disease. The most common alleles are M (M1, M2, M3 and M4) which are associated with normal protein levels (0.9 to 2 g/L) and the S (Glu264Val) and Z (Glu342Lys) alleles whose protein levels range between 50-60% and 10-15% of the normal, respectively. The last two are also the most commonly associated variants with respiratory complaints. The most severe cases of the disease are usually observed in Z homozygous in which the serum deficiency is determined by the intracellular accumulation of Z polymers in the hepatocytes. For this reason AATD has also been associated with an increased risk of liver disease as a result of toxic effects of the Z polymers within the cells. The polymerization of the Z allele has been proposed to underlie an autoimmune response in the case of vasculitis. Granulomatosis with poliangite (GPA) is a multisystemic syndrome affecting patients with AATD, which is characterized by a small vessels granulomatous inflammation. Other mechanisms that have been suggested to play a role in GPA include the proteolytic imbalance between proteinase 3 (PR3) and its major inhibitor in serum, SERPINA1, and the co-inheritance of autoimmune genes and AATD genotypes mainly due to its close proximity in chromosome 14q32.1. SERPINA2 is located 12kb downstream of the SERPINA1 and share with this a high DNA sequence similarity. Although SERPINA2 has been regarded as a pseudogene for a long time it has an active isoform of unknown function that is expressed in different tissues including in leukocytes. FCUP Alpha-1-Antitrypsin deficiency, exploring the role of SERPINA1 rare variants and searching for genetic modifiers of associated diseases (Granulomatosis with Polyangiitis) xii Abbreviations AAT Alpha-1-antitrypsin AATD Alpha-1-antitrypsin deficiency ANCA Antineutrophil Cytoplasmic Antibody cDNA Complementar DNA CHO Chinese Hamster Ovary COPD Chronic Obstructive Pulmonary Disease DNA Deoxyribonucleic acid EB Elution Buffer EDTA Ethylenediaminetethaacetic acid ELANE2 Elastase ER Endoplasmic Reticulum Fw Forward GPA Granulomatosis with Polyangiitis HEK Human Embryonic Kidney IEF Isoelectric Focusing INDELS Insertions and Deletions Mh MHerleen ML Maximum Likelihood Mm MMalton MPA Microscopic Polyangiitis Mpa MPalermo Mw MWurzburg NCBI National Center for Biotechnology Information NEB Naïve Empirical Bayes NMD Nonsense mRNA Decay PAML Phylogenetic Analysis by Maximum Likelihood FCUP Alpha-1-Antitrypsin deficiency, exploring the role of SERPINA1 rare variants and searching for genetic modifiers of associated diseases (Granulomatosis with Polyangiitis) xiii PBS-T Phosphate buffer solution with Tween 20 PCR Polymerase Chain Reaction Pl PLowell PR3 Proteinase 3 Q0F Q0Faro Q0l Q0Llisbon Q0OD Q0Oliveira do Douro Q0VR Q0Vila Real RCL Reactive Center Loop RNase Ribonuclease RT-PCR Reverse Transcription PCR Rv Reverse SERPIN Serine Proteinase Inhibitors SERPINA1 Alpha-1-antitrypsin SNP Single Nucleotide Polymorphism 1. Introduction FCUP Alpha-1-Antitrypsin deficiency, exploring the role of SERPINA1 rare variants and searching for genetic modifiers of associated diseases (Granulomatosis with Polyangiitis) 2 The understanding of the molecular basis of human diseases has been a major challenge for the scientific community for several decades, as well as the finding of their causes, susceptibility factors and treatment to improve the life quality of the patients. In this sense, the progress achieved in the field of human genetics and the efforts made in the last years to generate a reference human genome sequence (Human Genome Project) and more recently, a database with thousands of sequenced individuals from different geographic regions (1000 Genomes Project) are remarkable1,2. Altogether, these projects allowed to create a detailed catalogue of the human genetic variation, which to date represents a fundamental tool to address how genetics influence current human traits, disease risk and progression and the response to different medical treatments1. The human genome comprises the following categories of sequence variants: single nucleotide polymorphisms (SNPs), insertions and deletions (INDELs) which may range from 1bp to 10kb in length and larger structural variants (also known as copy number variation), which extend from 10 kb to several megabases2. Another class of genetic variants includes minisatellites and microsatellites2, which are tandem repeated DNA sequences of 6 bp to 100bp units and 1 to 5 bp units, respectively3. The most common category of variants involves a mutation in a single base in the DNA (SNPs), whereas other categories include the loss (deletion) or the gain (duplication or insertion) of one or multiple nucleotide(s). Sequence variants may have different repercussions according to their localization in a gene. If a mutation occurs in the coding region of a gene they can (1) have no effect or (2) result in an altered protein product unable to perform its regular function or (3) cause the protein premature termination. Otherwise if a variant occurs in a regulatory region, it may compromise the regular expression of a gene or even inactivate the entire gene. Importantly, mutations might also be classified as a “loss of function” if they drastically affect the normal activity of a gene or as a “gain of function” mutation, if the mutated gene acquires a novel property or function4. However, in most cases the understanding of the impact of the different categories of variants in human health and disease is far from being completed. Genetic diseases affect thousands of individuals around the world and in most cases these are expected to result from a mutation, which occurred in a germ cell and was then transmitted to the following generations. If the mutation has a strong effect and occurs in a single gene the disease will be monogenic (or Mendelian disease) and the inheritance pattern, might be autosomal or X-linked dominant, autosomal or X- FCUP Alpha-1-Antitrypsin deficiency, exploring the role of SERPINA1 rare variants and searching for genetic modifiers of associated diseases (Granulomatosis with Polyangiitis) 3 linked recessive or Y-linked or mitochondrial5. Most of these diseases are detected at low frequencies in the random population (rare diseases less 1%). Once the underlying genetic alteration has been identified, it is easier to understand the molecular pathogenesis of the disease and to design a genetic test for the diagnosis of the disease. Classical examples of monogenic diseases include alpha-1-antitrypsin deficiency (AATD), cystic fibrosis, phenylketonuria and Huntington’s disease, which are all correlated with the occurrence of pathogenic mutations in single genes6,7,8,9. On the other hand, if several mutations with smaller effects occur in multiple genes, the disease is defined as complex or multifactorial and in general, these diseases may affect a larger percentage of the population. In this case, interactions among genes and between genes and the environment are likely to have an important role in the disease phenotype and in the molecular mechanism of the disease, thus making the design of screening tools much more difficult10. Here chronic obstructive pulmonary disease (COPD), antineutrophil cytoplasmic antibodies (ANCA) associated vasculitis, diabetes and Crohn’s disease are some examples of complex diseases associated with genetic variants distributed over multiple loci11-14. Worth of note, in most cases of complex diseases a significant proportion of their heritability still remains unexplained5. 1.1 The SERPIN Superfamily SERPINs (serine proteinase inhibitors) are a superfamily of functional diverse protease inhibitors, sharing a conserved tertiary structure, which is determined by about 350 to 400 amino acids and has a molecular weight of 40-50 KDa15,16. Hundreds of SERPINs were already found in viruses, prokaryotes, plants, and animals where they are involved in many diverse physiological processes17. For example, in vertebrates SERPINs have key roles as protease inhibitors in blood coagulation, fibrinolysis, inflammation, angiogenesis, apoptosis and in complement activation. However, some SERPINs have developed other non-inhibitory functions, and act as molecular chaperones, hormone carriers or as storage proteins15. The archetypical SERPIN structure has three β-sheets (A,B,C), nine α-helices (AI), and a flexible stretch of approximately seventeen residues between β sheet A and C named the reactive center loop (RCL) (Figure 1A), which is normally exposed to the solvent acting as a pseudo-substrate for proteases18. SERPINs ability to inhibit a specific protease is determined by the amino acid composition of the RCL, in particular those located at residues P1-P1’. Once a protease binds to the RCL, it establishes a FCUP Alpha-1-Antitrypsin deficiency, exploring the role of SERPINA1 rare variants and searching for genetic modifiers of associated diseases (Granulomatosis with Polyangiitis) 4 covalent ester linkage between the protease residue Ser-195 and the backbone carbonyl of the P1 residue leading to the cleavage of the P1-P1’ peptide bond. Such event initiates a major conformational rearrangement in SERPINs, and the molecule undergoes a complete transition from a “stressed” to a “relaxed” state (S to R transition). Briefly, immediately after the cleavage, the RCL is rapidly inserted into the β-sheet A (shutter region), caring the protease to the opposite site of the SERPIN molecule, distorting the catalytic domain of the protease and consequently the entire molecule (Figure 1B). This distortion avoids the breakdown of the acyl-enzyme intermediate, resulting in an irreversible SERPIN protease complex16, 19. 1.2 The Alpha-1-antitrypsin (SERPINA1) One of the most studied SERPINs is alpha-1-antitrypsin (SERPINA1 or AAT), a 52-kDa plasma glycoprotein with 394 amino acids synthesized at high levels by hepatocytes, and at lower concentrations by intestinal epithelial cells, neutrophils, lung epithelial cells and macrophages20. The protein is encoded by the SERPINA1 gene located at chromosome 14q32.1, which covers approximately 12.2 kb, and has four coding exons, three untranslated exons and six introns (Figure 2). The untranslated region of SERPINA1 comprises exons IA to IC and controls SERPINA1 expression through three alternative transcription initiation sites (Figure 2). While transcription may start in exons IA or IB in macrophages (middle and beginning of the exon, respectively), the transcription in hepatocytes is initiated only at exon IC (middle of the exon)20. SERPINA1 is an important acute phase protein and the major serine protease inhibitor of human plasma, where it shows strong affinity towards neutrophil elastase (ELANE2) and proteinase 3 (PR3). However, recent studies have shown that SERPINA1 is also an irreversible inhibitor of kallikreins 7 and 14 and it has the ability to inhibit intracellular and cell-surface proteases such as matriptase and caspase-321. This inhibitory activity is mainly conferred by methionine 358 and serine 359 residues which correspond to RCL P1-P1’, respectively. The principal site of SERPINA1 activity is in lung, where the protein protects the fragile connective tissue of the lower respiratory tract from the uncontrolled proteolysis triggered by neutrophils during inflammation6. Importantly, in recent years SERPINA1 has emerged as a complex and multifunctional protein combining inhibitory properties with immunomodulatory and anti- FCUP Alpha-1-Antitrypsin deficiency, exploring the role of SERPINA1 rare variants and searching for genetic modifiers of associated diseases (Granulomatosis with Polyangiitis) 5 inflammatory activities against neutrophils, lymphocytes, macrophages, monocytes, mast cells and epithelial cells22. Mutations in the SERPINA1 gene are the main cause for alpha-1-antitrypsin deficiency (AATD), an autosomal-codominant disorder, characterized by reduced protein serum levels and affecting 1 in 2000 to 1 in 7000 individuals of European descent24. The disease was first described by Laurell and Eriksson in 1963, when they noticed the absence of the SERPINA1 band by plasma protein gel electrophoresis in patients with COPD and lung emphysema25. Indeed, AATD patients have a significant higher risk of developing pulmonary disease, like early-onset emphysema and chronic obstructive pulmonary disease (COPD), which is correlated with the uncontrolled activity of neutrophil elastase in the lungs. Another major clinical manifestation of AATD is liver cirrhosis as a result of the cytotoxic effect of protein accumulation in the hepatocytes26. Presently, there are more than 125 variants of SERPINA1 identified and a considerable large number of those variants may be associated with abnormal protein plasma levels. Accordingly, SERPINA1 alleles are classified as: 1) “deficient” if they are associated with a significant reduction in plasma levels, either because the synthesized protein is misfolded and retained within hepatocytes or because it has poor stability, leading always to reduced secretion; 2) “null” alleles (Q0), if there are no Figure 1: SERPINA1 structure. SERPINA1 comprising three β-sheets and nine α-helices. A –The shutter region (βsheet A) is highlighted in red and the RCL is shown in magenta. B – Stable protease inhibitor complex. (Adapted from Khan et al. 16 Whisstock et al. 23) FCUP Alpha-1-Antitrypsin deficiency, exploring the role of SERPINA1 rare variants and searching for genetic modifiers of associated diseases (Granulomatosis with Polyangiitis) 6 protein traces in the plasma27. While, deficiency variants can be easily identified by isoelectric focusing (IEF) techniques, where different letters are assigned to different gene products according to the migration velocity in the protein electrophoresis gel (M to medium; S to slow; F to fast and Z very slow); null variants are characterized by the absence of a visible band in the IEF gels28. In European populations only the alleles M1, M2, M3, M4, S and Z reach polymorphic frequencies (>1%). The M alleles are considered the normal ones with 100% levels of the plasma protein (0.9 to 2 g/L) and the S and Z alleles, the common deficiency variants, are associated with 50-60% and 10-15% of normal plasma concentrations, respectively. The analysis of the molecular basis of the M, S and Z alleles allowed the reconstruction of the phylogenetic relationships between SERPINA1 common variants (Figure 3). The M1 can be subdivided in two subtypes, the M1Ala213 (ancestral allele) and the M1Val213. The M3 differs from the M1Val213 by an amino acid replacement at codon 376 (Glu376Asp) and the M2 has another substitution at codon 101 (Arg101His). The M4 shares with M2 the Arg101His substitution but lacks the Glu376Asp found in M3 and M2 variants (Figure 3)29. The S allele results from a Glu264Val mutation, in exon III, in a M1Val213 background. The Glu264Val causes the disruption of a salt bridge (Glu264-Lys387), highly conserved among SERPINs and linking the C terminus of the G α-helix to a β-strand in the hydrophobic core of the Figure 2: Schematic representation of SERPINA1. The gene is located in SERPIN 14q32.1 cluster and it is organized in 3 untranslated exons (IA-IC), 4 coding exons (II-V) and 6 introns. FCUP Alpha-1-Antitrypsin deficiency, exploring the role of SERPINA1 rare variants and searching for genetic modifiers of associated diseases (Granulomatosis with Polyangiitis) 7 molecule18. This mutation is known to alter the stability of the molecule and to increase the susceptibility of the protein to polymerize, however it is only associated with disease when it is heterozygous with the Z allele30. Conversely, the Z allele arose by a Glu342Lys substitution in exon V, within a M1Ala213 allele. The Glu342Lys causes the disruption of another crucial salt bridge (Glu342-Lys290), which in turn affects the stability of A β-sheet. Importantly the Z mutation has more serious repercussions in protein folding than the S mutation because it leads to the spontaneous polymerization and accumulation of polymerised fibrils in the endoplasmic reticulum of hepatocytes, with subsequent cell damage18, 31. The polymorphism of SERPINA1 has been widely studied in several populations due to its importance in human health32. The M alleles (M1, M2 and M3) are present in ethnical diverse populations, such as Europeans, Africans and Amerindians, with some differences in their frequencies. The M4 allele has also been reported in multiple samples from diverse geographic regions, but this variant is less studied than the other M subtypes because it is difficult to discriminate using only isoelectric focusing techniques. In contrary to M alleles, S and Z variants are only present in populations of European descent, or in cases of miscegenation with Europeans. The S allele is broadly distributed among the European continent, but its values tend to increase from northeast to southwest reaching the higher frequencies in the Iberian Peninsula, with an increase of more than 70 cases per 1000 individuals. This distribution suggests that the S mutation may have arisen in the north of the Iberian Peninsula in prehistoric times and then spread eastwards by population movements (Figure 4A). This hypothesis is supported by the 8500-16500 years estimate of the S allele obtained for Figure 3: Phylogeny of SERPINA1 common alleles. (Adapted from Seixas et al.32). FCUP Alpha-1-Antitrypsin deficiency, exploring the role of SERPINA1 rare variants and searching for genetic modifiers of associated diseases (Granulomatosis with Polyangiitis) 8 the Portuguese population, which are close to the end of the last glaciations (18000 years ago) and the European population expansion from the glacial refuge in the Iberian Peninsula32, 33. The Z mutation has a different distribution among European populations, the frequency is higher in the north-east, more precisely in Scandinavia and the Baltic region where it can reach average values of about 2-4 %34 while in south populations it varies between 0.19 and 0.30% (Figure 4B). In summary, it has been suggested that the Z mutation occurred in the southern Scandinavia and Baltic regions about 20005000 years ago and spread later throughout the continent during Neolithic times 21, 33, 35, 36, 37. Figure 4 : Distribution of S and Z alleles in the European continent. A – Frequency of S alleles per 1000 inhabitants. BFrequency of Z alleles per 1000 inhabitants (Adapted from Blanco et al.37) FCUP Alpha-1-Antitrypsin deficiency, exploring the role of SERPINA1 rare variants and searching for genetic modifiers of associated diseases (Granulomatosis with Polyangiitis) 15 Europeans the active isoform is more frequent in African and Amerindians the disrupt SERPINA2 form is the most prevalent (Figure 7)53. Furthermore, several genetic variants were identified in the full SERPINA2 including premature stop codons (Leu108framStop and Leu277framStop) and four amino acid replacement variants (Ile280Thr, Leu308Pro, Glu320Lys and Pro387Leu). Previously the Leu308Pro and the Pro387Leu were predicted to alter protein structure based on computational tools53. However, no clear differences were detected between three SERPINA2 variants (V1: Pro308-Lys320; V2: Leu308-Glu320; and V3: Pro308-Glu320) used for the transfection of mammalian cell lines54. Figure 7: Distribution of SERPINA2 non-functional alleles in 52 human populations. (Human Genome Diversity Panel samples) 2. Aims FCUP Alpha-1-Antitrypsin deficiency, exploring the role of SERPINA1 rare variants and searching for genetic modifiers of associated diseases (Granulomatosis with Polyangiitis) 17 The current work will focus on the characterization of SERPINA1 rare variants underlying cases of AATD in Portugal and on the analysis of the functional repercussions, haplotype background and geographical distribution of different SERPINA1 variants. For this purpose we took advantage from our sample collection comprising a few dozens of AATD cases caused by rare SERPINA1 alleles and from publically available databases of genome variation. We combined the DNA sequencing of SERPINA1 with the genotyping of two flanking microsatellites to assess the molecular basis of each rare allele as well as their intrahaplotipic variability. In addition, we compile the published information from SERPINA1 variation and from 1000Genomes and NHLBI GO Exome Sequencing Project to evaluate the distribution of rare alleles in human populations and correlate the level of each mutation with pathogenicity and SERPINA1 patterns of residue conservation. In a second part of the work, we will explore the hypothesis of SERPINA2 as a potential candidate gene for the observed genetic association with GPA. Theoretically, a non-functional SERPINA2 variant could contribute to a higher susceptibility to GPA by increasing the chance of bacterial infections (unopposed bacterial proteases) or by an uncontrolled activity of endogenous proteases. To achieve our goal, we started by increasing the density of sequence variants within SERPINA2 in both GPA cases and controls (ZZ individuals without the disease) on one hand, and on the other hand by further investigating the inhibitory properties of SERPINA2. To this end, we expressed SERPINA2 in novel host cell models (HEK293 and Schneider S2 cells). 3.Material and Methods FCUP Alpha-1-Antitrypsin deficiency, exploring the role of SERPINA1 rare variants and searching for genetic modifiers of associated diseases (Granulomatosis with Polyangiitis) 19 3.1 Severe AATD by rare SERPINA1 variants 3.1.1 Samples Our sample included 51 unrelated individuals and a few relatives (father, mother and/or siblings) requested to perform SERPINA1 genotyping after a first screening of AATD by quantitative analysis of serum levels (radial immunodiffusion or nephelometry). The SERPINA1 genotyping was done previously as a part of the AATD diagnostic service at IPATIMUP, which combines the serum protein analysis by isoelectric focusing55 and the analysis of common mutations (Arg101His, Ala213Val, Glu264Val and Glu342Lys) by multiplex PCR56. All cases were found to carry rare SERPINA1 variants. Blood samples were collected using EDTA as anticoagulant and then frozen separately as serum and cellular fraction (leukocytes and erythrocytes). 3.1.2 DNA extraction DNA was isolated from the frozen blood cellular fraction. DNA was extracted using the Generation Capture Column Kit (Qiagen) according manufacturer’s protocol. 3.1.3 PCR and sequencing The DNA amplification was done in three different PCR reactions as illustrated in Figure 8. Briefly, SERPINA1 gene was subdivided into three different fragments of about 2.6 kb (F1) and 2.7 kb (F2 and F3). The first fragment comprised the promoter region spanning from exons IA to IC, the second fragment included exons II and III, and finally the third fragment included exons IV and V. Fragment 2 and 3 had a small overlap in intron III. FCUP Alpha-1-Antitrypsin deficiency, exploring the role of SERPINA1 rare variants and searching for genetic modifiers of associated diseases (Granulomatosis with Polyangiitis) 20 Amplification of SERPINA1 fragments from genomic DNA was done by long PCR using the cycling conditions described in Table A1 (Appendix) and the following reagents: 0.5 µM of forward and reverse primers, 200 µM of dATP, 200 µM of dTTP, 200 µM of dGTP, 200 µM of dCTP, 4% of DMSO, 1.75mM of MgCl2, 1U of Long PCR Enzyme Mix (Thermo Scientific) and 10x Long PCR Buffer and approximately 120ng of DNA. The sequencing of the three gene fragments was done using ABI BigDye Terminator version 3.1 cycle sequencing chemistry (Life Technologies), and electrophoresis analysis was done on an ABI 3130 automated sequencer. All sequences were assembled and analysed using the Phred-Phrap-Consed package57. All putative polymorphisms and software-derived genotype calls were visually inspected and were individually confirmed using Consed. Details about sequencing primers are presented in Table A1 (Appendix). 3.1.4 PCR and Microsatellite analysis Haplotype characterization of the SERPINA1 rare alleles included the analysis of two different microsatellites. A CAn repeat located 7.5 kb downstream of SERPINA1 and a GTn repeat located 207 kb upstream of SERPINA1, as showed in Figure 9. The amplification of the two microsatellites was done using fluorescently labelled primers as previously described33. Microsatellite amplicons were separated by electrophoresis in a 3130 ABI Sequencer and the analysis was done using Gene Mapper software (Life Technologies). Figure 8: Schematic representation of SERPINA1 amplification. Upper lines show the SERPINA1 orientation in chromosome 14 long arm and lower lines shows the structure of the gene where exons are represented as full boxes and introns by lines. Large arrows indicate the regions surveyed for sequence variation (F1-F3). FCUP Alpha-1-Antitrypsin deficiency, exploring the role of SERPINA1 rare variants and searching for genetic modifiers of associated diseases (Granulomatosis with Polyangiitis) 21 Figure 9: Location of the two microsatellites used in the haplotipic characterization of SERPINA1 rare alleles. 3.1.5 Data analysis Haplotypes were inferred using the program PHASE 2.058, 59. To improve haplotype inference for microsatellite data we used haplotypes derived from twogenerations studies of Portuguese families33. 3.1.6 Characterization of Q0Faro allele The synthesis of cDNA was performed by reverse transcription-polymerase chain reaction (RT-PCR) using the Superscript II RT-PCR system (Life Technologies, Gibco, BRL) and the manufacturers recommended conditions. Then we performed a PCR reaction to further elucidate the basis of the Q0Faro null allele using different primer combinations: IA/IIR; IC/IIR; IA/IIIR. The sequence of the primers are: IA, 5’- TCCTGTGCCTGCCAGAAGAG-3’; IC, 5’- ATCAGGCATTTTGGGGTGACT-3’; IIR, 5’- CCACTAGCTTCAGGCCCTCGCTGAG -3’ IIIR, 5’- GATGATATCGTGGGTGAGAACATTT-3’. The cycling conditions for PCR were: - 94ºC 2min - 94ºC 10s, 58ºC 10s, 68ºC 2min 30s (10 cycles) - 94ºC 10s, 54ºC 10s, 68ºC 2min 30s plus 3s per cycle (30 cycles) - 68ºC 20min. Digestion The DNA digestion was done during 20min at 37ºC with 1U of enzyme (RsaI and ECO91I; Thermo Scientific) per 1µL of amplified products. FCUP Alpha-1-Antitrypsin deficiency, exploring the role of SERPINA1 rare variants and searching for genetic modifiers of associated diseases (Granulomatosis with Polyangiitis) 22 3.1.7 SERPINA1 conservation Ortholog cDNA sequences for SERPINA1 were retrieved from the National Center for Biotechnology Information database (NCBI) (http://www.ncbi.nlm.nih.gov) and Ensembl (http://www.ensembl.org/) for the following mammalian species: human (Homo sapiens), common chimpanzee (Pan troglodytes), gorilla (Gorilla gorilla), orangutan (Pongo abelii), northern white-cheeked gibbon (Nomascus leucogenys), rhesus macaque (Macaca mulatta), baboon (Papio anubis), marmoset (Callithrix jacchus), mouse (Mus musculus), rat (Rattus norvegicus), dog (Canis familiaris), cat (Felis catus), cow (Bos taurus), pig (Sus scrofa), sheep (Ovis aries) opossum (Monodelphis domestica) and zebrafish (Danio rerio) (Table 2). We used CLUSTALW60 implemented in the MEGA561 software to align cDNA sequences. SERPINA1 alignments were used to construct phylogenetic trees using neighbour-joining method with 10000 bootstraps implemented in MEGA5. The ratio of non-synonymous and synonymous substitution rates (dN/dS = ω) was estimated using the maximum likelihood (ML) framework implemented in the program CODEML of Phylogenetic Analysis by Maximum Likelihood (PAML) software62. We used the site model test M3 (discrete selection model) to investigate the conservation and selective pressures that have shaped the evolution of SERPINA1. This model adopts 3 categories of codon positions (sites) and assumes an unconstrained discrete distribution to model heterogeneous ω values among sites and detect codons evolving under different selective forces63. While values of ω>1 are considered as evidence of positive selection, values of ω<1 are regarded as proof of purifying selection (conservation). The Naive Empirical Bayes (NEB) approach is implemented to calculate the posterior probability for each amino acid site and detect conserved, neutral and positive selected codons62. FCUP Alpha-1-Antitrypsin deficiency, exploring the role of SERPINA1 rare variants and searching for genetic modifiers of associated diseases (Granulomatosis with Polyangiitis) 23 Table 2: Accession numbers for SERPINA1 cDNA sequences. 3.2 SERPINA2 3.2.1 Samples DNA samples from ZZ subjects were collect from different populations. These included 24 samples from Portugal, with a diagnosis of emphysema, COPD or AATD disease, 20 samples from Birmingham (England) with a diagnose of emphysema or COPD, and 10 samples from GPA patients, 5 from Birmingham and 5 from Bochum (Germany). 3.2.2 PCR and DNA sequencing The SERPINA2 was amplified in 3 fragments (Figure 10). The first comprising only the exon II, the second containing only exon III and the last fragment spanning exon IV and exon V. The amplification of the 3 fragments from the genomic DNA was carried using the cycling conditions described in Table A2 (Appendix) and the following reagents: 0.5 µM of each oligonucleotide, 200 µM of dATP, 200 µM of dTTP, 200 µM of Species Accession Number Database Homo sapiens NM_000295.4 NCBI Pan troglodytes ENSPTRT00000045369 Ensembl Gorilla gorilla ENSGGOT00000007925 Ensembl Nomascus leucogenys XM_004091842 NCBI Macaca mulatta ENSMMUT00000039542 Ensembl Callithrix jacchus ENSCJAT00000061674 Ensembl Papio anubis XM_003902213 NCBI Mus musculus ENSMUST00000085056 (serpina1a) 1 2 3 ENSMUST00000164454 4 5 Ensembl ENSMUST00000164454 (serpina1b) Rattus norvegicus ENSRNOT00000012577 Ensembl Canis familiaris ENSCAFT00000036554 Ensembl Felis catus XM_006933076.1 NCBI Bos taurus NM_173882 NCBI Sus scrofa ENSSSCT00000002750 Ensembl Ovis aries ENSOART00000016196 Ensembl Monodelphis domestica ENSMODT00000033265 Ensembl Danio rerio NM_001077758 NCBI FCUP Alpha-1-Antitrypsin deficiency, exploring the role of SERPINA1 rare variants and searching for genetic modifiers of associated diseases (Granulomatosis with Polyangiitis) 24 dGTP, 200 µM of dCTP, 1U of Hot Star Taq (DNA polymerase from Qiagen), 10x buffer and about 100ng of DNA reaching 25 µL of final volume. After the amplification was completed the sequencing of the coding regions was done using the primers presented in Table A2 (Appendix). 3.2.3 Cloning of SERPINA2 The cDNA corresponding to the V2 variant (Leu308-Glu320) of SERPINA2 from a previous SERPINA2/pLenti6V5 construct54 was amplified and fused to a stable Histag using the proofreading polymerase (Thermo Scientific), and specific primers (Fw: 5’TTCCTGATGT^TCATCGCTTTCGTCATCATCGCTGAGGCCGAGGATCCCCAGGG AGATGCTGCCCA3’; Rv: 5’CTACTGGCCA^ACCAACCCACCCTAAGTGGTGAA3’). The PCR product was then digested with BsaBI and AgeI enzyme (Bio Labs), respectively, using recommended conditions. The ligation of the insert into the pIEX5 vector (Novagen) was done with T4 DNA ligase (Bio Labs). Later the SERPINA2/pIEX5 construct was used in the SERPINA2 subcloning into the pTT5 vector (collaboration partner) using BamHI enzyme (Bio Labs). Figure 10: Schematic representation of SERPINA2 amplification. Upper lines show SERPINA2 orientation in chromosome 14 long arm cluster and lower lines the structure of the gene where exons are represented as full boxes and introns by lines. Large arrows indicate the regions surveyed for sequence variation (F1-F3). FCUP Alpha-1-Antitrypsin deficiency, exploring the role of SERPINA1 rare variants and searching for genetic modifiers of associated diseases (Granulomatosis with Polyangiitis) 31 Glu162Lys Leu263Pro This category of mutations, causing the substitution of an amino acid in protein sequence, are usually named as non-synonymous or missense mutations. These have different effects depending on the biochemical properties of the residues implicated in the substitution and their location in protein structure. In the particular case of Leu263Pro and Glu162Gly although, we did not proceed for a functional characterization of the mutant alleles (Pro263 and Gly162) the evidences collected so far point to a pathogenic effect of both mutations. First, these mutations were identified in patients with lung emphysema and reduced serum levels of SERPINA1. Second, the two mutations occur in highly conserved residues among SERPINA1 orthologs (Figure 11). Third, the Q0Gaia allele lacked a corresponding protein band in the M region and the PGaia showed a band with similar intensity to S deficient allele (Figure 13). Furthermore, several examples from the literature show that other LeuPro substitutions like Leu263Pro and even ProLeu replacements are associated with severe distortions in protein structure. This is the case of SERPINA1 MProcida (Leu41Pro) and alpha-1-antichymotrypsin (SERPINA3) Bochum-1 (Leu55Pro) alleles, in which the introduction of a proline instead of a leucine distorts A and B SERPIN αhelices, respectively18,64. While in the MProcida allele, the Leu41Pro substitution causes a drastic reduction in SERPINA1 serum levels (~96%)65 due to its intracellular degradation prior to secretion64, in the Bochum-1 variant the Leu55Pro replacement has been correlated to both SERPINA3 deficiency and decreased inhibitory activity18. On the other hand, in the MHeerlen (Pro369Leu) allele the replacement of a proline by leucine was found to disrupt another α-helix causing a severe reduction in Figure 12: Three dimensional structure of SERPINA1. The location of the two novel mutations in SERPINA1 is indicated. The amino acid substitution Leu263Pro (Q0Gaia) is shown in blue and the substitution Glu162Lys (PGaia) is shown in magenta. FCUP Alpha-1-Antitrypsin deficiency, exploring the role of SERPINA1 rare variants and searching for genetic modifiers of associated diseases (Granulomatosis with Polyangiitis) 32 protein levels (~98%), in result of the protein transport blockage between ER and the Golgi apparatus18, 66. As a whole these four mutations seem to produce misfolded proteins possibly recruited for intercellular degradation and poorly secreted from the cells18. Such functional effects on SERPINA1 structure are likely to be correlated with biochemical properties of the two residues, while leucine is a hydrophobic residue displaying a preference for -helices, the proline is a small amino acid with unique properties and the ability to introduce kinks in -helices67. So far no other GluGly mutation has been described for SERPINA1, nevertheless two deficiency alleles were found to involve the GlyGlu substitutions (Gly67Glu and Gly320Glu). Taking into account the different properties of glycine and glutamic acid residues the Glu162Gly mutation is expected to have serious repercussions in SERPINA1 structure. Glycine is a small neutral residue that may adopt many conformations and frequently found in protein positions with space limitations. Conversely, the glutamic acid is a polar and negatively charged amino acid with a larger side chain with a preference to expose its charged chain to the solvent. In particular case of Gly67Glu mutation the B α-helix is affected causing abnormal posttranslational biosynthesis and reduced SERPINA1 secretion68. The implications of the Gly320Glu mutation are not well understood since it was been identified in a null allele also bearing a Z mutation (Glu342Lys). Figure 13: Electrophoretic patterns of PGaia and common SERPINA1 alleles. The phenotypes from samples 1 to 9 are as follows: 1, 4 and 5 - M1; 2 and 6M2Z; 3 and 7SPGaia; 8M1M3 and 9-SZ. FCUP Alpha-1-Antitrypsin deficiency, exploring the role of SERPINA1 rare variants and searching for genetic modifiers of associated diseases (Granulomatosis with Polyangiitis) 33 4.1.1.1.2 Small Deletions Arg281framStop297 (Q0Oliveira do Douro) The null allele Q0Oliveira do Douro results from a 2 bp deletion (GA) in 281 codon (Figure 14A), causing an alteration of the reading frame (frameshift mutation) and a premature termination codon at position 297 (Arg281framStop297) (Figure 14B). The Q0Oliveira do Douro variant was identified in a single Portuguese family with AATD, where the index case was a child heterozygous for the S allele with asthma and AATD. This mutation is likely to affect the mRNA processing or the stability of the truncated protein as indicated by the absence of a corresponding band in the IEF gel. Met374framStop392 (Q0Vila Real) The null allele Q0Vila Real results from a 4 bp deletion (ATGA) affecting 374 and 375 codons (Figure 15A) which causes a frameshift and leads to a premature termination codon at position 392 (Met374framStop392) (Figure 15B) a few bases upstream of the canonical SERPINA1 stop codon (395). The Q0Vila Real variant was identified in an asymptomatic child displaying reduced serum levels of SERPINA1 (heterozygous for the M allele). Like in the previous mutation no protein band could be associated to this allele suggesting an associated mechanism of the mRNA or protein degradation. Figure 14: Q0Oliveira do Douro allele. A – Electropherogram of the index case. The arrow shows the region of GA deletion. B – Reading frames of M and Q0Oliveira do Douro alleles. FCUP Alpha-1-Antitrypsin deficiency, exploring the role of SERPINA1 rare variants and searching for genetic modifiers of associated diseases (Granulomatosis with Polyangiitis) 34 The category of small deletions causing shifts in the gene reading frame and the insertion of a premature termination codon can imply a significant reduction of the mRNA transcripts levels. In general, frameshift mutations occurring in early or mid phases of coding regions are linked to a decreased steady-state of cytoplasmic mRNA. Apparently, premature terminated transcripts interrupt the mRNA pulling process and lack important elements of canonical stop codons, which turn mRNA molecules vulnerable to RNase digestion. This process of mRNA degradation avoiding the accumulation of abnormal transcripts and proteins is called nonsense mRNA decay (NMD). However, if the introduction of premature stop codons happens near the regular termination region the mutant allele might not be target to NMD and be linked to normal mRNA levels69. The two allele described above introduce premature stop codons in different regions of SERPINA1, while the Q0Oliveira do Douro allele carries a premature stop codon in the beginning of exon IV, Q0Vila Real allele has a termination codon four triplets upstream of SERPINA1 termination. Although, we lack experimental data to confirm our hypothesis, we expect Q0Oliveira do Douro to lack the presence of any transcripts due to the degradation by NMD. In contrary the Q0Vila Real we would expect to detect normal transcript levels and possibly an abnormal protein rapidly eliminated by intracellular pathways of protein degradation. Indeed, this is the case of Q0Matawa another SERPINA1 variant resulting from a frameshift mutation causing a premature termination at 376 codon70. Figure 15: Q0Vila Real allele. A – Electropherogram of the index case. The arrow shows the region of ATGA deletion. B – Reading frames of M and Q0Vila Real alleles. FCUP Alpha-1-Antitrypsin deficiency, exploring the role of SERPINA1 rare variants and searching for genetic modifiers of associated diseases (Granulomatosis with Polyangiitis) 35 4.1.1.1.3 Splice site mutation IVS1C+3Tins (Q0Faro) The null allele Q0Faro is characterized by the occurrence of an insertion of a thymine at the +3 position in intron IC (Figure 16). This variant was identified in a single Portuguese family with AATD and the index case was an asymptomatic child displaying reduced SERPINA1 serum levels (heterozygous for M allele). SERPINA1 has different transcription starting sites, which vary according to cell type. Whereas in hepatocytes the transcription starts within the exon IC, mononuclear phagocytes use specific initiation sites located in exons IA and IB. Importantly, mononuclear phagocytes exhibit alternative splicing of exons IA, IB and IC generating 14 transcripts. These mRNAs may be divided into three general isoforms IA-IB-IC-II, IA-IC-II and IA-II (Figure 17A) and two of these isoforms may be further subdivided according to the use of cryptic splice sites located in exon IB and IC (Figure 17B). Transcripts containing IB exon may differ by 18bp at 3’-end of exon and RNA products including IC exon can vary by the presence or absence of an additional CAG triplet in 5’ start (Figure 17B) 32,71. Figure 16. Electropherogram of Q0Faro allele. The arrow shows the insertion of a thymine in intron IC. FCUP Alpha-1-Antitrypsin deficiency, exploring the role of SERPINA1 rare variants and searching for genetic modifiers of associated diseases (Granulomatosis with Polyangiitis) 36 The Q0Faro represents a rare example of a mutation in a 5’ untranslated region (UTR) of SERPINA1, in the donor splice site of exon/intron IC. Only another pathogenic mutation was identified in the same region and in that case it affected the first base of the intron IC. The allele named Q0Porto was found to produce a single transcript in mononuclear phagocytes (IA-II transcript), which did not use the IC donor splice site. Such finding explained the absence of the protein in the serum since in the hepatocytes, the mRNA transcription was abolished. To evaluate whether Q0Faro had a similar effect to those of Q0Porto we performed a characterization of the different transcripts from mononuclear phagocytes in the index case (M1AlaQ0Faro) and the parent carrying the mutated allele (M2Q0Faro). We performed several experiments that included the analysis of the mononuclear phagocytes cDNA by PCR amplification of three different fragments covering: IA-II exons (IA/IIR); IA-II-III exons (IA/IIIR) and IC-II exons (IC/IIR); in a similar methodological approach to the one used for the description of Q0Porto72. Taking into account the M1Val213 molecular base of Q0Faro allele we used Arg101His (exon II) and Ala213Val (exon III) polymorphisms to discriminate the wild type alleles (M1Ala and M2) from the mutated Q0Faro allele. In the index case M1AlaQ0Faro, the Ala213Val polymorphism was used to discriminate between the two alleles and in the M2Q0Faro the Arg101His polymorphism was used instead (Table 4, see also Figure 3). Figure 17: Alternative SERPINA1 transcripts (14n) of mononuclear phagocytes. A – mRNA transcripts resulting from the alternative splice of IA; IB and IC exons. B – mRNA transcripts resulting from the use of cryptic splice sites in 3’-end of exon IB and at 5’ of exon IC. (Figure from Rollini et al.71) FCUP Alpha-1-Antitrypsin deficiency, exploring the role of SERPINA1 rare variants and searching for genetic modifiers of associated diseases (Granulomatosis with Polyangiitis) 37 Table 4: Molecular base of Q0Faro, M1Ala213 and M2 alleles. SERPINA1 polymorphism Allele Arg101His (exon II) Ala213Val (exon III) Q0Faro Arg Val M1Ala213 (index case) Arg Ala M2 (parent) His Val The evaluation of the Q0Faro allele was carried out using two restriction enzymes specific for each polymorphism, for Arg101His we used RsaI which recognizes Arg101 codon and for Ala213Val we used ECO91I which digest Val213 codon. Figure 18A shows the RsaI restriction pattern obtained in the IA/IIR fragment for M1Q0Faro and M2Q0Faro samples. The presence of a 496 bp fragment generated by RsaI (Arg101) in the parent (M2Q0Faro; lane P), together with another fragment of 570 bp (His101) confirms the existence of IA-II transcripts in both wild type (M2) and mutated (Q0Faro) alleles. This finding was also confirmed in the index case (M1AlaQ0Faro), in the IA-IIIR fragment with ECO91I enzyme, which also displays a heterozygous restriction pattern (Figure 18B) consistent with the presence of IA-II transcripts in both alleles. Conversely, the same was not observed in the RsaI restriction pattern for IC/IIR fragment (Figure 18C) where no band corresponding to Q0Faro (Arg101) was in the M2Q0Faro subject (lane P). These results confirm a similar effect of the novel mutation IVS1C+3Tins (Q0Faro allele) to the previously described mutation of the Q0Porto allele (IVS1C-1GA). The insertion of a thymine at +3 base of intron IC and the substitution G to A at +1 base of intron IC both disrupt the donor splice of exon IC. In the hepatocytes these mutations abolish the regular transcription of SERPINA1 and consequently no protein is secreted into the bloodstream. Nevertheless, other cell types like mononuclear phagocytes may secrete SERPINA1 due to the presence of the upstream transcription start site in exon IA and an alternative splicing transcript that does not requires the use of exon/intron IC junction as donor splice site (Figure 19). However, the SERPINA1 produced by those cells is expected to have a residual impact in the protein serum levels not enough to avoid the clinical outcomes of AATD. These mutations located outside of SERPINA1 coding region (exon II-V) highlight the importance of surveying the UTR in particular exon/intron IC region in cases of unexplained AATD. FCUP Alpha-1-Antitrypsin deficiency, exploring the role of SERPINA1 rare variants and searching for genetic modifiers of associated diseases (Granulomatosis with Polyangiitis) 38 Figure 18: Detection of Arg101His and Ala213Val variation in the cDNA from mononuclear phagocytes of the two Q0Faro subjects. A – PCR products amplified with primer pairs IA/IIR and digested with Rsa I restriction enzyme. The restriction enzyme recognizes Arg101 residue and generates a fragment of 496bp; B – PCR products amplified with primer pairs IA/IIIR and digested with ECO91I restriction enzyme. The ECO91I recognizes the Val213 and generates two fragments of 209 and 1079bp; C – PCR products amplified with primer pairs IC/IIR and RsaI enzyme. The restriction enzyme recognizes Arg101 residue and generates a fragment of 465bp . I – Index case; (M1AlaQ0Faro); PParent, (M2Q0Faro); Aamplicon for each primer combination. MWMolecular weight. FCUP Alpha-1-Antitrypsin deficiency, exploring the role of SERPINA1 rare variants and searching for genetic modifiers of associated diseases (Granulomatosis with Polyangiitis) 39 Figure 19: Schematic representation of SERPINA1 alternative splicing as deduced from the exon composition of mRNA species produced by mononuclear-phagocytes in M alleles and Q0Faro and Q0Porto. Mmononuclearphagocytes transcription starting sites; H-hepatocytes transcription starting site. (Adapted from Seixas et al.72). 4.1.1.2 Previously described mutations Phe52del (MPalermo and MMalton) The MPalermo (Mpa) and MMalton (Mm) are two rare variants characterized by a deletion of a phenylalanine codon (TTC) at position 52 (exon II) and while the MPalermo is associated to a M1Val213 molecular base, the MMalton is linked to a M2 allele instead. The Phe52del mutation is associated with severe AATD due to the intracellular accumulation of SERPINA1 in the ER, and to a dramatic reduction in the serum (<10%). This suggests for Phe52del and Glu342Lys (Z allele) a similar pathophysiological model of AATD. Indeed, the Phe52del mutation also favors the formation of loop-sheet polymers, which cause the formation of hepatic inclusions even in heterozygosity with non-deficiency alleles73. At the protein level, the Phe52del mutation causes the removal of a residue with strong hydrophobic aromatic side chains in the core center of the molecule, which is also a highly hydrophobic region. This amino acid removal perturbs the molecular conformation and folding of SERPINA1 and its later maturation in the Golgi apparatus and secretion29,74. FCUP Alpha-1-Antitrypsin deficiency, exploring the role of SERPINA1 rare variants and searching for genetic modifiers of associated diseases (Granulomatosis with Polyangiitis) 40 The Phe52del mutation and the MPalermo and MMalton alleles represent the most widespread rare variants underlying cases of AATD in Portugal (Table 3), which have also been identified elsewhere in Europe. The haplotype characterization of MPalermo and MMalton using the combination of both sequence and microsatellite variation data (Table 5) reinforces the previous findings of an origin of Phe52del mutation in two distinct molecular backgrounds32. In addition, the detection of intrahaplotipic variation among MPalermo sequences but not within MMalton, suggest MPalermo as a more ancient allele because it had already enough time to recombine at the 5’ SERPINA1 region. Arg39Cys (I) The I allele is a mild deficiency variant characterized by a Arg(CGC)Cys(TGC) substitution in codon 39. This amino acid replacement is a functional equivalent of Glu264Val mutation (S allele) since it also disrupts the hydrogen bond stabilizing SERPINA1 G α-helix. Likewise, it is associated to 50-60% of normal serum levels and some level intracellular polymerization in the ER which may contribute to hepatic damage in IZ heterozygous18,75. The Arg39Cys is one of the most prevalent rare mutations in Europe and in our cohort of rare alleles causing AATD in Portugal. The haplotype analysis of I chromosomes showed reduced variation at the sequence level (M1Val213 base allele) and a considerable diversity in the microsatellite located approximately ~207 kb upstream of SERPINA1 (Table 5). These results suggest a single origin of Arg39Cys mutation old enough to have spread throughout Europe and to have recombined with other alleles increasing the linked variation in the CAn microsatellite and in the promoter region of the gene. Leu353framStop376 (Q0Ourém) The Q0Ourém (Q0O) is a rare null variant characterized by an insertion of an extra thymine in a stretch of 5 thymines between codons 352-353, which alters the reading frame starting at codon 353 and ending in codon 376 (Leu353framStop376), with a premature stop codon (TGA). This variant was identified in several families from Central Portugal and differs in its molecular background from another rare variant Q0Mattawa, found in two compound heterozygotes from Canada. Whereas the Q0Ourém has been always associated to M3 allele the Q0Mattawa was identified in a M1Val213 background70. This evidence together with the geographical dispersion of the two alleles suggests an independent origin of the Leu353framStop376 mutation, possibly FCUP Alpha-1-Antitrypsin deficiency, exploring the role of SERPINA1 rare variants and searching for genetic modifiers of associated diseases (Granulomatosis with Polyangiitis) 47 3.1.2 Mutational spectrum of SERPINA1 Nowadays, the availability of large genomic databases comprising the complete sequence or the exome sequence of a few dozen or a thousand individuals from different population backgrounds (1000 Genomes project; NHLBI GO Exome Sequencing Project; ESP; etc), allows an in-depth analysis of the mutational spectrum for a gene of interest. In the particular case of SERPINA1 it was possible to compile a total of 100 mutations including those described in this work, other pathogenic mutation reported in the literature and novel variants identified in control populations (Table 6). Among these 35 mutations were clearly not associated with AATD, and were classified as non-pathogenic. However, in many cases especially in those identified in large genomic databases (25 mutations) we lack information about the association to AATD and therefore those were labelled as possibly or probably damaging according with bioinformatics predictions. Worth to note the Met358Arg substitution is not directly associated to AATD, but since it alters the protease affinity of SERPINA1 causing a gaining of a potent antithrombin activity it was classified as altered function. Nevertheless, this mutation may also considered as pathogenic given it causes serious homeostatic imbalances and it is associated with hemorrhagic fatal disease80. The remaining 39 mutations were identified in clinical cases and are implicated in mild or severe AATD, and thus were classified as pathogenic mutations. Interestingly, in the large genomic surveys of control populations a few pathogenic mutations were detected, which included the Arg39Cys (I allele), the Asp256Val (PLowell), Pro369Leu (MHeerlen) and the Pro396Ser (MWurzburg), which confirms that these are low frequency variants (0.1 – 1%) segregating within populations of European descended. On the other hand, the Q0Ourém (Leu353framStop376), Q0Lisbon (Thr68Ile) and the novel mutations identified in the current work are likely to be confined to Portugal or the Iberian Peninsula and possibly these are also more recent alleles that did not had enough time to spread throughout the European continent. Conversely, the Phe52del (MMalton and MPalermo) mutation, which is the most prevalent rare variant among our cohort of AATD cases was not identified in the genomic databases, possibly suggesting a very low frequency in control populations (>0.1%) and a higher risk of developing clinical symptoms associated to AATD. FCUP Alpha-1-Antitrypsin deficiency, exploring the role of SERPINA1 rare variants and searching for genetic modifiers of associated diseases (Granulomatosis with Polyangiitis) 48 Allele Mutation DNA sequenceb African descended European descended Asian descended Repercussions Project Pro-23Leu CCGCTG 0.000 Possibly damaging ESP ZWrexham Ser-19Leu TCGTTG 0.000 0.000 Non-pathogenic ESP Trp-18Cys TGGTGT 0.000 Probably damaging ESP Leu-13Met CTGATG 0.000 Probably damaging ESP VMunich Asp2Ala GATGCT Non-pathogenic Thr13Ala ACAGCA 0.009 Non-pathogenic HapMap His15Asn CACAAC 0.000 Non-pathogenic ESP His16Arg CATCGT Non-pathogenic 1000GENOMES M5Karlsruhe Ala34Thr GCCACC 0.000 Non-pathogenic ESP Q0Knowloon Tyr38Stop TACTAA AATD: protein absence I Arg39Cys CGCTGC 0.001 0.002 AATD: protein deficiency (60%) ESP, 1000GENOMES MProcida Leu41Pro CTGCCG AATD: protein deficiency (4%) MVarallo Leu41-Phe51delfram Stop70-71 AATD: Protein absence His43Gln CACCAG 1.000 1.000 Non-pathogenic ESP M6Bonn Ser45Phe TCCTTC 0.000 Possibly damaging ESP SLisbon Ser47Arg AGCCGC Non-pathogenic Table 6: SERPINA1 mutation spectrum a FCUP Alpha-1-Antitrypsin deficiency, exploring the role of SERPINA1 rare variants and searching for genetic modifiers of associated diseases (Granulomatosis with Polyangiitis) 49 Allele Mutation DNA sequenceb African descended European descended Asian descended Repercussions Project MMalton MPalermo MNichinan Phe52del TTTttcTCC AATD: protein deficiency (12%) + intrahepatic deposition Phe52Ser TTCTCC 0.000 Probably damaging ESP Siiyama Ser53Phe TCCTTC AATD: protein deficiency (7%) + intrahepatic deposition M6Passau Ala60Thr GCC ACC 0.001 Probably damaging ESP MMineral Gly67Glu GGGGAG Probably damaging Q0Lisbon Thr68Ile ACCATC AATD: Protein absence Asp71Glu GACGAA 0.001 Non-pathogenic Thr72Ala ACTGCT 0.000 Possibly damaging ESP Leu84Arg CTCCGC 0.000 Non-pathogenic ESP ZBristol Thr85Met ACGATG AATD: protein deficiency (60%) Q0Ludwisghafen Ile92Asn ATCAAC AATD: protein absence M2, M4, T, PDuarte Arg101His CGTCAT 0.036 0.165 Non-pathogenic ESP, 1000GENOMES, HapMap Q0Devon ZNewport Gly115Ser GGCAGC 0.005 0.021 AATD: protein deficiency ESP Leu120Phe CTCTTC 0.000 Possibly damaging ESP Table 6: (Cont.) FCUP Alpha-1-Antitrypsin deficiency, exploring the role of SERPINA1 rare variants and searching for genetic modifiers of associated diseases (Granulomatosis with Polyangiitis) 50 Allele Mutation DNA sequenceb African descended European descended Asian descended Repercussions Project Lys129Glu AAGGAG 0.000 Probably damaging ESP Ala142Asp GCCGAC 0.000 Probably damaging ESP V, MNichinan Gly148Arg GGGAGG 0.001 Non-pathogenic ESP M2Obernburg Gly148Trp GGGTGG 0.001 Probably damaging ESP Glu151Lys GAGAAG 0.000 Non-pathogenic ESP Q0Granite Tyr160framStop160 TAcGTG AATD: protein absence Val161Met GTGATG 0.000 0.000 Probably damaging ESP PGaia Glu162Gly GAGGGG Probably damaging Leu172Ser TTGTCG 0.000 Probably damaging ESP Lys193Stop AAATAA AATD: protein absence Q0Trastevere Trp194Stop TGGTGA AATD: protein absence Pro197His CCCCAC 0.000 Probably damaging ESP Glu204Lys GAGAAG Non-pathogenic Asp207Glu GACGAA 0.000 Non-pathogenic ESP Val210Met GTGATG 0.000 Non-pathogenic ESP M1Ala213 Val213Ala GTGGCG 0.459 0.788 Non-pathogenic ESP, 1000GENOMES, HapMap Table 6: (Cont.) FCUP Alpha-1-Antitrypsin deficiency, exploring the role of SERPINA1 rare variants and searching for genetic modifiers of associated diseases (Granulomatosis with Polyangiitis) 51 Allele Mutation DNA sequenceb African descended European descended Asian descended Repercussions Project Val216Met GTGATG 0.000 Probably damaging ESP, 1000GENOMES Q0Bellingham Lys217Stop AAGTAG AATD: protein absence F Arg223Cys CGTTGT 0.001 0.004 AATD: protein deficiency (15%) ESP, 1000GENOMES Cys232Trp TGTTGG Probably damaging Lys233Asn AAGAAT 0.000 Non-pathogenic ESP PLowell Asp256Val GATGTT 0.0004 0.001 AATD: protein deficiency (30%) ESP Gly258Arg GGGAGG 0.000 Probably damaging ESP Q0Cairo Lys259 stop AAATAA AATD: Protein absence His262Tyr CACTAC 0.002 Non-pathogenic ESP Q0Gaia Leu263Pro CTGCCG AATD: structure alteration S, T Glu264Val GAAGTA 0.010 0.041 AATD: protein deficiency (60%) ESP, 1000GENOMES, HapMap His269Gln CACCAA 0.002 Non-pathogenic ESP Asn278Ile AATATT 0.000 Non-pathogenic ESP Q0Oliveira do Douro, Arg281framStop297 CAgaAG AATD: protein absence Ala284Ser GCC TCC 0.004 Non-pathogenic ESP, 1000GENOMES Ile293framStop298 GAT^G AATD: protein absence Table 6: (Cont.) FCUP Alpha-1-Antitrypsin deficiency, exploring the role of SERPINA1 rare variants and searching for genetic modifiers of associated diseases (Granulomatosis with Polyangiitis) 52 Allele Mutation DNA sequenceb African descended European descended Asian descended Repercussions Project Val302Ile GTCATC 0.002 Non-pathogenic ESP, 1000 GENOMES Q0Hong Kong Leu318framStop334 CTC^TC AATD: protein absence Q0New Hope Gly320Glu GGG GAG AATD: protein absence Gly320Arg GGGAGG 0.000 Probably damaging ESP Ala325Pro GCACCA 0.000 Non-pathogenic ESP Pro326Ser CCCTCC 0.000 Non-pathogenic ESP Leu327framStop338 CtGAAG AATD: protein absence SMunich Ser330Phe TCCTTC 0.000 Possibly damaging ESP Val333Met GTGATG 0.000 Possibly damaging ESP King’s His334Asp CATGAT AATD: Delay secretion Lys335Glu AAGGAG 0.003 Possibly damaging 1000GENOMES Wbethesda Ala336Thr GCTACT AATD: protein deficiency (60%) Val337framStop354 GTgCTG AATD: protein absence Ile340Val ATCGTC 0.001 Non-pathogenic Asp341Glu GACGAG Possibly damaging 1000GENOMES PDonauworth, Asp341Asn GACAAC 0.002 Non-pathogenic ESP Table 6: (Cont.) FCUP Alpha-1-Antitrypsin deficiency, exploring the role of SERPINA1 rare variants and searching for genetic modifiers of associated diseases (Granulomatosis with Polyangiitis) 53 Allele Mutation DNA sequenceb African descended European descended Asian descended Repercussions Project Z Glu342Lys GAGAAG 0.005 0.016 AATD: protein deficiency (15%) + intrahepatic deposition ESP, 1000GENOMES Gly349Trp GGGTGG Probably damaging HapMap Q0Mattawa Leu353framStop376 TTT^T AATD: protein absence MPittsburgh Met358Arg ATGAGG Altered function Met358Ile ATGATA 0.000 Non-pathogenic ESP Loffenbach Pro362Thr CCCACC 0.001 Non-pathogenic ESP Pro362Ser CCCTCC Non-pathogenic ESP Q0Bolton Pro362framStop373 CccGA AATD: protein absence Q0Clayton Pro362framStop376 CCC^C AATD: protein absence XChristchurch Glu363Lys GAGAAG 0.002 Non-pathogenic 1000GENOMES MHerleen Pro369Leu CCCCTC 0.000 AATD: protein deficiency (2%) ESP Mwurzburg Pro369Ser CCCTCC 0.001 AATD: protein deficiency (15%) + intrahepatic deposition ESP, 1000 GENOMES Q0Vila Real Met374framStop392 TAatgaTT AATD: protein absence Ile375Val ATTGTT 0.000 Non-pathogenic ESP M3, M2 Glu376Asp GAAGAC 0.107 0.258 Non-pathogenic ESP, 1000 GENOMES, HapMap Table 6: (Cont.) FCUP Alpha-1-Antitrypsin deficiency, exploring the role of SERPINA1 rare variants and searching for genetic modifiers of associated diseases (Granulomatosis with Polyangiitis) 54 a SERPINA1 mutation data was retrieved from ensemble (http://www.ensembl.org/index.html) and specialized literature 26,81 b nucleotide substitution are underlined, deletions are presented as lower case and insertions are preceded by ^ symbol Allele Mutation DNA sequenceb African descended European descended Asian descended Repercussions Project Met385Val ATGGTG 0.000 Non-pathogenic ESP Gln393Leu CAACTA 0.001 Non-pathogenic Q0Isola di Procida Del 17Kb inc exons IIV AATD: Gene deletion Splice site mutations Q0Porto IVS1C+1GA GTAT AATD: protein absence Q0Faro IVS1C+3^insT AATD: abolish mRNA synthesis IVS2+1GT GTTT AATD: protein absence IVS2-1Gdel AgGA AATD: protein absence Table 6: (Cont.) FCUP Alpha-1-Antitrypsin deficiency, exploring the role of SERPINA1 rare variants and searching for genetic modifiers of associated diseases (Granulomatosis with Polyangiitis) 55 Overall, the vast majority of pathogenic mutations are nucleotide substitutions 61% (24/39) either causing amino acid replacements 71% (17/24), or the insertion of a premature termination codon 21% (5/24) or altering the normal of mRNA processing 8% (2/24). The remaining pathogenic mutations 39% (15/39) are small insertions or deletions (indels) leading in most cases to the alteration of reading frame and premature termination (Table 6). Hypermutable Sequences In the human genome mutations events are more prone to occur in short hypermutable segments, defined by specific DNA sequences such as mononucleotide repeats stretches or CpG dinucleotides82,83. Repeated sequences are recognized as an important factor for mutagenesis due to misalignments during the DNA replication. In the coding region of SERPINA1 we identified 7 stretches of 5 or more mononucleotide repeats, however only two could be associated to insertions and deletions. The thymine stretch (T)5 located in 352 and 353 codons is implicated in two independent mutational events of Leu353framStop376 frameshift (Q0Ourém and Q0Mattawa) and the cytosine (C)7 located in codons 360 to 362 is enrolled two different frameshift mutations: Pro362framStop376 and Pro362framStop373 The Phe52del occur in a region that might be considered a repeat stretch as well, the codons 50 to 53 contain a TCT motif repeated 3 times (ATC-TTC-TTC-TCC) that could have facilitated the loss of an entire codon 52 in MMalton and MPalermo alleles32. CpGs are the most hypermutable motifs associated to single nucleotide polymorphisms (SNPs) and mutations in CpGs occurs 10 times more frequently than in any other dinucleotide. This hypermutability is associated to cytosine methylation that once deaminated leads to a nucleotide change to thymine, resulting in CGTG or CGCA substitution depending on the strand the methylated cytosine82,83. In the coding region of SERPINA1 we identified a total of 29 CpGs. Among these 19 (65.5%) were target of at least one mutation event and 11 (57.9%) causing pathogenic or damaging mutations. The remaining single mutations 73 (79.3 %) could not be correlated to any hypermutable motif and probably result from other genomic mechanism of DNA sequence mutability. FCUP Alpha-1-Antitrypsin deficiency, exploring the role of SERPINA1 rare variants and searching for genetic modifiers of associated diseases (Granulomatosis with Polyangiitis) 56 Overall, this analysis shows that in most cases SERPINA1 mutations are determined by other mechanisms of mutagenesis rather than CpG or mononucleotide stretches, like it was observed in loci and genomic regions. However, short repeat motifs seem to play an important role in indels which are associated, in most cases, to pathogenic mutation, while CpG are evenly distributed between pathogenic, damaging and non-pathogenic mutations. FCUP Alpha-1-Antitrypsin deficiency, exploring the role of SERPINA1 rare variants and searching for genetic modifiers of associated diseases (Granulomatosis with Polyangiitis) 63 Our results confirmed SERPINA2 expression in both cellular systems used, however, a stronger signal was obtained in S2 cells, particularly in the purified protein fraction 5 (Figure 22A). Such marked difference between the two systems results from a more efficient protein secretion in Drosophila S2 cells comparing to human HEK293 cells where most of the protein was retained intracellularly. This result is consistent with previous reports of the SERPINA2 recombinant protein expression in mammalian cell lines HeLa and CHO54. The Drosophila Schneider S2 cells seems to be the best system at present to express SERPINA2, however it is necessary to do more expression assays, with different constructs. Another central issue of this work is the poor quality of commercial antibodies against SERPINA2, which displayed low specificity and low yield when compared with the His-tag antibody. Therefore to proceed further in SERPINA2 expression studies it is important to develop a monoclonal antibody for the protein. Previous studies have demonstrated that SERPINA2 is expressed in leukocytes, testis and other tissues53,54 and when translated the protein is mostly retained intracellularly in the ER, nevertheless the inhibitory properties of SERPINA2 and its function in vivo remains unknown. Therefore, to address whether SERPINA2 plays a role in GPA either through an independent mechanism of AATD or through an combined effect with AATD it is extremely important to disclose the association of SERPINA2 variants with Z alleles and to pursue the functional characterization of SERPINA2 in vitro and in vivo. 5.Conclusions FCUP Alpha-1-Antitrypsin deficiency, exploring the role of SERPINA1 rare variants and searching for genetic modifiers of associated diseases (Granulomatosis with Polyangiitis) 65 In our Portuguese cohort of 51 cases with AATD caused by rare variants of SERPINA1, we identified a total of 13 mutations and 14 alleles. Among these 5 were novel and described for the first time in the current work: Q0Gaia (Leu263Pro), PGaia (Glu162Gly), Q0OilveiradoDouro (Arg281framStop297), Q0Vila Real (Met374framStop392) and Q0Faro (IVSIC+3Tins). The amino acid substitutions Leu263Pro and Glu162Gly occur both in two highly conserved residues among SERPINA1 orthologs. However, the Leu263Pro mutation like other replacements in which leucine and proline residues are enrolled, has more serious effects in protein structure (protein absence) than the Glu162Gly substitution (protein deficiency). The two frameshift mutations Arg281framStop297 and Met374framStop392 both result from small deletions leading to premature stop codons in SERPINA1 exons IV and V, respectively. Whereas the Arg281framStop297 mutation is expected to be associated to the lack of transcripts due to their degradation by NMD processes, the Met374framStop392 is expected to be linked to an unstable protein and normal transcripts levels because of its close proximity to the canonical SERPINA1 termination codon. The mutation IVSIC+3Tins disrupts a donor splice site located in the 5’UTR and it is predicted to abolish SERPINA1 expression in hepatocytes but not in mononuclear phagocytes. There, the presence of upstream translation initiation sites and the occurrence of alternative splicing warrant SERPINA1 expression. To our knowledge, this is the fourth example of splice site mutation in SERPINA1 and the second case of a mutation in the 5’UTR associated to severe AATD. The alleles previously described elsewhere in Europe and detected in our cohort AATD cases included: MMalton, MPalermo (Pher52del was found to be the most prevalent rare mutation in Portugal), I, PLowell, MHerleen and Mwurzburg. The remaining rare alleles Q0Ourém and Q0Lisbon seem to be restricted to the Iberian Peninsula. The haplotype characterization of MMalton and MPalermo alleles uncovered the independent origin of the Phe52del mutation in M2 and M1 molecular background, respectively, in contrary to I, PLowell and Q0Ourém alleles, which appear to have had all a single origin. The analysis of intrahaplotipic diversity also showed that the alleles present in different European populations (MPalermo, I and PLowell) tend to display higher variability than alleles confined to a smaller geographic region (Q0Ourém). This finding suggests a more ancient origin of dispersed alleles than the Q0Ourém allele, which was estimated to have arisen in the middle ages. FCUP Alpha-1-Antitrypsin deficiency, exploring the role of SERPINA1 rare variants and searching for genetic modifiers of associated diseases (Granulomatosis with Polyangiitis) 66 In this work, we also used SERPINA1 haplotypes to elucidate the origins of the T allele, which in our case it is likely to result from a recombination event between S (Glu264Val) and M2 or M3 (Glu376Asp) chromosomes. The in-depth analysis of the SERPINA1 mutational spectrum showed that one fourth of the mutations are not randomly distributed and tend to occur in hypermutable motifs. The small deletions leading to Leu353framStop376, Pro362framStop376 and Pro362framStop373 mutations all occur in mononucleotide repeat motifs and the Phe52del mutation occurs in a short trinucleotide repeat sequence. All these mutations might have arisen by a misalignment during DNA replication. CpGs are another hypermutable motif because cytosines once methylated are prone to deamination and modification into a thymine nucleotide. In the SERPINA1 coding sequence more than a half of CpG dinucleotides were found to be mutated. The study of the non-synonymous mutations distribution across SERPINA1 disclosed a clustering of pathogenic mutations in two functional domains of the protein structure: the shutter (6B β-stand and 5A β-stand) and the gate (3B β-stand to G αhelix). In contrary, the non-pathogenic mutations were found to be evenly spread in SERPINA1. The analysis of SERPINA1 residue conservation confirmed that all pathogenic mutations are placed in highly conserved residues, but the location of a mutation in a conserved residue does not necessary corresponds to pathogenic mutation given that 55% of non-pathogenic mutations are still located at conserved residues. The sequencing survey of SERPINA2 in 44 controls and 10 GPA cases, revealed a large homogeneity between Z chromosomes in both Portuguese and Birmingham samples, which were in most cases associated to SERPINA2V3 variant. On the other hand, among GPA cases a considerable lower number of Z chromosomes were associated to the SERPINA2V3 variant. This finding suggests a potential contribution of the loss of SERPINA2/V3 variant into a higher risk of GPA. The Drosophila Schneider S2 cells are so far the best system for SERPINA2 expression since in HEK293 and other mammalian cell lines the protein tend to accumulate intracellularly in the endoplasmic reticulum. 6.References FCUP Alpha-1-Antitrypsin deficiency, exploring the role of SERPINA1 rare variants and searching for genetic modifiers of associated diseases (Granulomatosis with Polyangiitis) 68 1. Gonzaga-Jauregui, C., Lupski, J. R., and Gibbs, R. A. (2012) Human genome sequencing in health and disease, Annu Rev Med 63, 35-61. 2. Mills, R. E., Pittard, W. S., Mullaney, J. M., Farooq, U., Creasy, T. H., Mahurkar, A. A., Kemeza, D. M., Strassler, D. S., Ponting, C. P., Webber, C., and Devine, S. E. (2011) Natural genetic variation caused by small insertions and deletions in the human genome, Genome Res 21, 830-839. 3. Tamaki, K., and Jeffreys, A. J. (2005) Human tandem repeat sequences in forensic DNA typing, Leg Med (Tokyo) 7, 244-250. 4. Alliance, G. (2009) Understanding Genetics: A New York, Mid-Atlantic Guide for Patients and Health Professionals, Washington (DC). 5. Manolio, T. A., Collins, F. S., Cox, N. J., Goldstein, D. B., Hindorff, L. A., Hunter, D. J., McCarthy, M. I., Ramos, E. M., Cardon, L. R., Chakravarti, A., Cho, J. H., Guttmacher, A. E., Kong, A., Kruglyak, L., Mardis, E., Rotimi, C. N., Slatkin, M., Valle, D., Whittemore, A. S., Boehnke, M., Clark, A. G., Eichler, E. E., Gibson, G., Haines, J. L., Mackay, T. F., McCarroll, S. A., and Visscher, P. M. (2009) Finding the missing heritability of complex diseases, Nature 461, 747753. 6. Bals, R., and Köhnlein, T. (2009) Alpha-1-Antitrypsin Deficiency: Pathophysiology, Diagnosis and Treatment, 1st ed., Thieme, Germany. 7. Zemanick, E. T., Harris, J. K., Conway, S., Konstan, M. W., Marshall, B., Quittner, A. L., Retsch-Bogart, G., Saiman, L., and Accurso, F. J. (2010) Measuring and improving respiratory outcomes in cystic fibrosis lung disease: opportunities and challenges to therapy, J Cyst Fibros 9, 1-16. 8. Harding, C. O. (2010) New era in treatment for phenylketonuria: Pharmacologic therapy with sapropterin dihydrochloride, Biologics 4, 231-236. 9. Raymond, L. A., André, V. M., Cepeda, C., Gladding, C. M., Milnerwood, A. J., and Levine, M. S. (2011) Pathophysiology of Huntington's disease: timedependent alterations in synaptic and receptor function, Neuroscience 198, 252-273. 10. Vieira, A. (2011) Engenharia Genética, Principios e Aplicações, 2ª Edição ed. 11. Kim, D. K., Cho, M. H., Hersh, C. P., Lomas, D. A., Miller, B. E., Kong, X., Bakke, P., Gulsvik, A., Agustí, A., Wouters, E., Celli, B., Coxson, H., Vestbo, J., MacNee, W., Yates, J. C., Rennard, S., Litonjua, A., Qiu, W., Beaty, T. H., Crapo, J. D., Riley, J. H., Tal-Singer, R., Silverman, E. K., and ECLIPSE, I. C. G. N., and COPDGene Investigators. (2012) Genome-wide association analysis of blood biomarkers in chronic obstructive pulmonary disease, Am J Respir Crit Care Med 186, 1238-1247. 12. Cartin-Ceba, R., Peikert, T., and Specks, U. (2012) Pathogenesis of ANCAassociated vasculitis, Curr Rheumatol Rep 14, 481-493. 13. Association, A. D. (2012) Diagnosis and classification of diabetes mellitus, Diabetes Care 35 Suppl 1, S64-71. 14. Liu, J. Z., and Anderson, C. A. (2014) Genetic studies of Crohn's disease: past, present and future, Best Pract Res Clin Gastroenterol 28, 373-386. 15. Gettins, P. G. (2000) Keeping the serpin machine running smoothly, Genome Res 10, 1833-1835. 16. Khan, M. S., Singh, P., Azhar, A., Naseem, A., Rashid, Q., Kabir, M. A., and Jairajpuri, M. A. (2011) Serpin Inhibition Mechanism: A Delicate Balance between Native Metastable State and Polymerization, J Amino Acids 2011, 606797. 17. Irving, J. A., Pike, R. N., Lesk, A. M., and Whisstock, J. C. (2000) Phylogeny of the serpin superfamily: implications of patterns of amino acid conservation for structure and function, Genome Res 10, 1845-1864. 18. Stein, P. E., and Carrell, R. W. (1995) What do dysfunctional serpins tell us about molecular mobility and disease?, Nat Struct Biol 2, 96-113. FCUP Alpha-1-Antitrypsin deficiency, exploring the role of SERPINA1 rare variants and searching for genetic modifiers of associated diseases (Granulomatosis with Polyangiitis) 69 19. Huntington, J. A., Read, R. J., and Carrell, R. W. (2000) Structure of a serpinprotease complex shows inhibition by deformation, Nature 407, 923-926. 20. Pott, G. B., Chan, E. D., Dinarello, C. A., and Shapiro, L. (2009) Alpha-1antitrypsin is an endogenous inhibitor of proinflammatory cytokine production in whole blood, J Leukoc Biol 85, 886-895. 21. Janciauskiene, S. M., Bals, R., Koczulla, R., Vogelmeier, C., Köhnlein, T., and Welte, T. (2011) The discovery of α1-antitrypsin and its role in health and disease, Respir Med 105, 1129-1139. 22. Bergin, D. A., Hurley, K., McElvaney, N. G., and Reeves, E. P. (2012) Alpha-1 antitrypsin: a potent anti-inflammatory and potential novel therapeutic agent, Arch Immunol Ther Exp (Warsz) 60, 81-97. 23. Whisstock, J. C., Silverman, G. A., Bird, P. I., Bottomley, S. P., Kaiserman, D., Luke, C. J., Pak, S. C., Reichhart, J. M., and Huntington, J. A. (2010) Serpins flex their muscle: II. Structural insights into target peptidase recognition, polymerization, and transport functions, J Biol Chem 285, 24307-24312. 24. Vaz Rodrigues, L., Costa, F., Marques, P., Mendonça, C., Rocha, J., and Seixas, S. (2012) Severe α-1 antitrypsin deficiency caused by Q0(Ourém) allele: clinical features, haplotype characterization and history, Clin Genet 81, 462-469. 25. C-B, L. (1963) EA: the electrophoretic alpha 1-globulin pattern of serum in alpha 1-antitrypsin deficiency Scandinavian Journal of Clinical and Laboratory Investigation 15, 40. 26. Fra, A. M., Gooptu, B., Ferrarotti, I., Miranda, E., Scabini, R., Ronzoni, R., Benini, F., Corda, L., Medicina, D., Luisetti, M., and Schiaffonati, L. (2012) Three new alpha1-antitrypsin deficiency variants help to define a C-terminal region regulating conformational change and polymerization, PLoS One 7, e38405. 27. Luisetti, M., and Seersholm, N. (2004) Alpha1-antitrypsin deficiency. 1: epidemiology of alpha1-antitrypsin deficiency, Thorax 59, 164-169. 28. Fagerhol, M. K., and Laurell, C. B. (1970) The Pi system-inherited variants of serum alpha 1-antitrypsin, Prog Med Genet 7, 96-111. 29. Canva, V., Piotte, S., Aubert, J. P., Porchet, N., Lecomte-Houcke, M., Huet, G., Zenjari, T., Roumilhac, D., Pruvot, F. R., Degand, P., Paris, J. C., and Balduyck, M. (2001) Heterozygous M3Mmalton alpha1-antitrypsin deficiency associated with end-stage liver disease: case report and review, Clin Chem 47, 1490-1496. 30. Topic, A., Alempijevic, T., Milutinovic, A. S., and Kovacevic, N. (2009) Alpha-1antitrypsin phenotypes in adult liver disease patients, Ups J Med Sci 114, 228234. 31. Schmid, S. T., Koepke, J., Dresel, M., Hattesohl, A., Frenzel, E., Perez, J., Lomas, D. A., Miranda, E., Greulich, T., Noeske, S., Wencker, M., Teschler, H., Vogelmeier, C., Janciauskiene, S., and Koczulla, A. R. (2012) The effects of weekly augmentation therapy in patients with PiZZ α1-antitrypsin deficiency, Int J Chron Obstruct Pulmon Dis 7, 687-696. 32. Seixas, S. (2002) Análise dos padrões de diversidade genética em três regiões funcinalmente relevantes do genoma humano, In Faculdade de Ciências, p 250, Universidade do Porto. 33. Seixas, S., Garcia, O., Trovoada, M. J., Santos, M. T., Amorim, A., and Rocha, J. (2001) Patterns of haplotype diversity within the serpin gene cluster at 14q32.1: insights into the natural history of the alpha1-antitrypsin polymorphism, Hum Genet 108, 20-30. 34. de Serres, F. J., and Blanco, I. (2012) Prevalence of α1-antitrypsin deficiency alleles PI*S and PI*Z worldwide and effective screening for each of the five phenotypic classes PI*MS, PI*MZ, PI*SS, PI*SZ, and PI*ZZ: a comprehensive review, Ther Adv Respir Dis 6, 277-295. FCUP Alpha-1-Antitrypsin deficiency, exploring the role of SERPINA1 rare variants and searching for genetic modifiers of associated diseases (Granulomatosis with Polyangiitis) 70 35. Hutchison, D. C. (1998) Alpha 1-antitrypsin deficiency in Europe: geographical distribution of Pi types S and Z, Respir Med 92, 367-377. 36. Lace, B., Sveger, T., Krams, A., Cernevska, G., and Krumina, A. (2008) Age of SERPINA1 gene PI Z mutation: Swedish and Latvian population analysis, Ann Hum Genet 72, 300-304. 37. Blanco, I., de Serres, F. J., Cárcaba, V., Lara, B., and Fernández-Bustillo, E. (2012) Alpha-1 Antitrypsin Deficiency PI*Z and PI*S Gene Frequency Distribution Using on Maps of the World by an Inverse Distance Weighting (IDW) Multivariate Interpolation Method, Hepat Mon 12, e7434. 38. Kelly, E., Greene, C. M., Carroll, T. P., McElvaney, N. G., and O'Neill, S. J. (2010) Alpha-1 antitrypsin deficiency, Respir Med 104, 763-772. 39. Stoller, J. K., and Aboussouan, L. S. (2005) Alpha1-antitrypsin deficiency, Lancet 365, 2225-2236. 40. Stoller, J. K., Tomashefski, J., Crystal, R. G., Arroliga, A., Strange, C., Killian, D. N., Schluchter, M. D., and Wiedemann, H. P. (2005) Mortality in individuals with severe deficiency of alpha1-antitrypsin: findings from the National Heart, Lung, and Blood Institute Registry, Chest 127, 1196-1204. 41. Gooptu, B., and Lomas, D. A. (2009) Conformational pathology of the serpins: themes, variations, and therapeutic strategies, Annu Rev Biochem 78, 147-176. 42. Society, A. T., and Society, E. R. (2003) American Thoracic Society/European Respiratory Society statement: standards for the diagnosis and management of individuals with alpha-1 antitrypsin deficiency, Am J Respir Crit Care Med 168, 818-900. 43. Qu, D., Teckman, J. H., Omura, S., and Perlmutter, D. H. (1996) Degradation of a mutant secretory protein, alpha1-antitrypsin Z, in the endoplasmic reticulum requires proteasome activity, J Biol Chem 271, 22791-22795. 44. Ghouse, R., Chu, A., Wang, Y., and Perlmutter, D. H. (2014) Mysteries of α1antitrypsin deficiency: emerging therapeutic strategies for a challenging disease, Dis Model Mech 7, 411-419. 45. McBean, J., Sable, A., Maude, J., and Robinson-Bostom, L. (2003) Alpha1antitrypsin deficiency panniculitis, Cutis 71, 205-209. 46. Gross, B., Grebe, M., Wencker, M., Stoller, J. K., Bjursten, L. M., and Janciauskiene, S. (2009) New Findings in PiZZ alpha1-antitrypsin deficiencyrelated panniculitis. Demonstration of skin polymers and high dosing requirements of intravenous augmentation therapy, Dermatology 218, 370-375. 47. Willcocks, L. C., Lyons, P. A., Rees, A. J., and Smith, K. G. (2010) The contribution of genetic variation and infection to the pathogenesis of ANCAassociated systemic vasculitis, Arthritis Res Ther 12, 202. 48. Woywodt, A., Haubitz, M., Haller, H., and Matteson, E. L. (2006) Wegener's granulomatosis, Lancet 367, 1362-1366. 49. Kallenberg, C. G. (2008) Pathogenesis of PR3-ANCA associated vasculitis, J Autoimmun 30, 29-36. 50. Elzouki, A. N., Lindgren, S., Nilsson, S., Veress, B., and Eriksson, S. (1997) Severe alpha1-antitrypsin deficiency (PiZ homozygosity) with membranoproliferative glomerulonephritis and nephrotic syndrome, reversible after orthotopic liver transplantation, J Hepatol 26, 1403-1407. 51. Lewis, M., Kallenbach, J., Zaltzman, M., Levy, H., Lurie, D., Baynes, R., King, P., and Meyers, A. (1985) Severe deficiency of alpha 1-antitrypsin associated with cutaneous vasculitis, rapidly progressive glomerulonephritis, and colitis, Am J Med 79, 489-494. 52. Lyons, P. A., Rayner, T. F., Trivedi, S., Holle, J. U., Watts, R. A., Jayne, D. R., Baslund, B., Brenchley, P., Bruchfeld, A., Chaudhry, A. N., Cohen Tervaert, J. W., Deloukas, P., Feighery, C., Gross, W. L., Guillevin, L., Gunnarsson, I., Harper, L., Hrušková, Z., Little, M. A., Martorana, D., Neumann, T., Ohlsson, S., FCUP Alpha-1-Antitrypsin deficiency, exploring the role of SERPINA1 rare variants and searching for genetic modifiers of associated diseases (Granulomatosis with Polyangiitis) 71 Padmanabhan, S., Pusey, C. D., Salama, A. D., Sanders, J. S., Savage, C. O., Segelmark, M., Stegeman, C. A., Tesař, V., Vaglio, A., Wieczorek, S., Wilde, B., Zwerina, J., Rees, A. J., Clayton, D. G., and Smith, K. G. (2012) Genetically distinct subsets within ANCA-associated vasculitis, N Engl J Med 367, 214-223. 53. Seixas, S., Suriano, G., Carvalho, F., Seruca, R., Rocha, J., and Di Rienzo, A. (2007) Sequence diversity at the proximal 14q32.1 SERPIN subcluster: evidence for natural selection favoring the pseudogenization of SERPINA2, Mol Biol Evol 24, 587-598. 54. Marques, P. I., Ferreira, Z., Martins, M., Figueiredo, J., Silva, D. I., Castro, P., Morales-Hojas, R., Simões-Correia, J., and Seixas, S. (2013) SERPINA2 is a novel gene with a divergent function from SERPINA1, PLoS One 8, e66889. 55. Rocha, J., Pinto, D., Santos, M. T., Amorim, A., Amil-Dias, J., CardosoRodrigues, F., and Aguiar, A. (1997) Analysis of the allelic diversity of a (CA)n repeat polymorphism among alpha 1-antitrypsin gene products from northern Portugal, Hum Genet 99, 194-198. 56. Rieger, S., Riemer, H., and Mannhalter, C. (1999) Multiplex PCR assay for the detection of genetic variants of alpha1-antitrypsin, Clin Chem 45, 688-690. 57. Nickerson, D. A., Tobe, V. O., and Taylor, S. L. (1997) PolyPhred: automating the detection and genotyping of single nucleotide substitutions using fluorescence-based resequencing, Nucleic Acids Res 25, 2745-2751. 58. Stephens, M., Smith, N. J., and Donnelly, P. (2001) A new statistical method for haplotype reconstruction from population data, Am J Hum Genet 68, 978-989. 59. Stephens, M., and Donnelly, P. (2003) A comparison of bayesian methods for haplotype reconstruction from population genotype data, Am J Hum Genet 73, 1162-1169. 60. Thompson, J. D., Higgins, D. G. & Gibson, T. J. (1997) CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice., Nucleic Acids Res. 22, 4673-4680. 61. Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M., and Kumar, S. (2011) MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods, Mol Biol Evol 28, 2731-2739. 62. Yang, Z. (2007) PAML 4: phylogenetic analysis by maximum likelihood, Mol Biol Evol 24, 1586-1591. 63. Yang, Z., Nielsen, R., Goldman, N., and Pedersen, A. M. (2000) Codonsubstitution models for heterogeneous selection pressure at amino acid sites, Genetics 155, 431-449. 64. Takahashi, H., Nukiwa, T., Satoh, K., Ogushi, F., Brantly, M., Fells, G., Stier, L., Courtney, M., and Crystal, R. G. (1988) Characterization of the gene and protein of the alpha 1-antitrypsin "deficiency" allele Mprocida, J Biol Chem 263, 15528-15534. 65. Cox, D. W., and Billingsley, G. D. (1989) Rare deficiency types of alpha 1antitrypsin: electrophoretic variation and DNA haplotypes, Am J Hum Genet 44, 844-854. 66. Poller, W., Merklein, F., Schneider-Rasp, S., Haack, A., Fechner, H., Wang, H., Anagnostopoulos, I., and Weidinger, S. (1999) Molecular characterisation of the defective alpha 1-antitrypsin alleles PI Mwurzburg (Pro369Ser), Mheerlen (Pro369Leu), and Q0lisbon (Thr68Ile), Eur J Hum Genet 7, 321-331. 67. BETTS, M. J., and RUSSELL, R. B. (2003) Amino Acid Properties and Consequences of Substitutions In Bioinformatics for Geneticists (Sons, J. W. a., Ed.). 68. Curiel, D. T., Vogelmeier, C., Hubbard, R. C., Stier, L. E., and Crystal, R. G. (1990) Molecular basis of alpha 1-antitrypsin deficiency and emphysema FCUP Alpha-1-Antitrypsin deficiency, exploring the role of SERPINA1 rare variants and searching for genetic modifiers of associated diseases (Granulomatosis with Polyangiitis) 72 associated with the alpha 1-antitrypsin Mmineral springs allele, Mol Cell Biol 10, 47-56. 69. Lee, J. H., and Brantly, M. (2000) Molecular mechanisms of alpha1-antitrypsin null alleles, Respir Med 94 Suppl C, S7-11. 70. Curiel, D., Brantly, M., Curiel, E., Stier, L., and Crystal, R. G. (1989) Alpha 1antitrypsin deficiency caused by the alpha 1-antitrypsin Nullmattawa gene. An insertion mutation rendering the alpha 1-antitrypsin gene incapable of producing alpha 1-antitrypsin, J Clin Invest 83, 1144-1152. 71. Rollini, P., and Fournier, R. E. (2000) Differential regulation of gene activity and chromatin structure within the human serpin gene cluster at 14q32.1 in macrophage microcell hybrids, Nucleic Acids Res 28, 1767-1777. 72. Seixas, S., Mendonça, C., Costa, F., and Rocha, J. (2002) alpha1-Antitrypsin null alleles: evidence for the recurrence of the L353fsX376 mutation and a novel G-->A transition in position +1 of intron IC affecting normal mRNA splicing, Clin Genet 62, 175-180. 73. Lomas, D. A., Elliott, P. R., Sidhar, S. K., Foreman, R. C., Finch, J. T., Cox, D. W., Whisstock, J. C., and Carrell, R. W. (1995) alpha 1-Antitrypsin Mmalton (Phe52-deleted) forms loop-sheet polymers in vivo. Evidence for the C sheet mechanism of polymerization, J Biol Chem 270, 16864-16870. 74. Curiel, D. T., Holmes, M. D., Okayama, H., Brantly, M. L., Vogelmeier, C., Travis, W. D., Stier, L. E., Perks, W. H., and Crystal, R. G. (1989) Molecular basis of the liver and lung disease associated with the alpha 1-antitrypsin deficiency allele Mmalton, J Biol Chem 264, 13938-13945. 75. Mahadeva, R., Chang, W. S., Dafforn, T. R., Oakley, D. J., Foreman, R. C., Calvin, J., Wight, D. G., and Lomas, D. A. (1999) Heteropolymerization of S, I, and Z alpha1-antitrypsin and liver cirrhosis, J Clin Invest 103, 999-1006. 76. Hernández Pérez, J. M., Ramos Díaz, R., Fumero García, S., and Pérez Pérez, J. A. (2014) Description of Alpha-1-Antitrypsin Deficiency Associated With PI*Q0ourém Allele in La Palma Island (Spain) and a Genotyping Assay for its Detection, Arch Bronconeumol. 77. Seixas, S., Lopes, A. I., Rocha, J., Silva, L., Salgueiro, C., Salazar-de-Sousa, J., and Batista, A. (2001) Association between the defective Pro369Ser mutation and in vivo intrahepatic 1-antitrypsin accumulation, J Med Genet 38, 472-474. 78. Creighton, T. E. (1992) Proteins: Structures and Molecular Properties, 2nd ed., W. H. Freeman. 79. Hayes, V. M., and Gardiner-Garden, M. (2003) Are polymorphic markers within the alpha-1-antitrypsin gene associated with risk of human immunodeficiency virus disease?, J Infect Dis 188, 1205-1208. 80. Vidaud, D., Emmerich, J., Alhenc-Gelas, M., Yvart, J., Fiessinger, J. N., and Aiach, M. (1992) Met 358 to Arg mutation of alpha 1-antitrypsin associated with protein C deficiency in a patient with mild bleeding tendency, J Clin Invest 89, 1537-1543. 81. Dickens, J. A., and Lomas, D. A. (2011) Why has it been so difficult to prove the efficacy of alpha-1-antitrypsin replacement therapy? Insights from the study of disease pathogenesis, Drug Des Devel Ther 5, 391-405. 82. Cooper, D. N., and Krawczak, M. (1990) The mutational spectrum of single base-pair substitutions causing human genetic disease: patterns and predictions, Hum Genet 85, 55-74. 83. Cooper, D. N., Krawczak, M., and Antonarakis, S. E. (1995 ) The Nature and Mechanisms of Human Gene Mutation, The Metabolic and Molecular Bases of Inherited Disease, 259-291. 84. Hedges, S. B., Dudley, J., and Kumar, S. (2006) TimeTree: A public knowledgebase of divergence times among organisms, Bioinformatics 22, 2971-2972.