TBK1 mutation spectrum in an extended European patient cohort with frontotemporal dementia and Amyotrophic Lateral Sclerosis

RESEARCH ARTICLE OFFICIAL JOURNAL www.hgvs.org TBK1 Mutation Spectrum in an Extended European Patient Cohort with Frontotemporal Dementia and Amyotrophic Lateral Sclerosis Julie van der Zee,1,2†Ilse Gijselinck,1,2†Sara Van Mossevelde,1,2,3 Federica Perrone,1,2 Lubina Dillen,1,2 Bavo Heeman,1,2 Veerle B¨ aumer,1,2 Sebastiaan Engelborghs,2,4 Jan De Bleecker,5Jonathan Baets,1,2,3 Ellen Gelpi,6Ricardo Rojas-Garc´ ıa,7 Jordi Clarim´ on,7,8 Alberto Lle´ o,7,8 Janine Diehl-Schmid,9Panagiotis Alexopoulos,9Robert Perneczky,9,10,11 Matthis Synofzik,12,13 Jennifer Just,12,13 Ludger Sch¨ ols,12,13 Caroline Graff,14,15 H˚ akan Thonberg,14,15 Barbara Borroni,16 Alessandro Padovani,16 Albena Jordanova,1,2,17 Stayko Sarafov,18 Ivailo Tournev,19 Alexandre de Mendonc¸a,20,21 Gabriel Miltenberger-Milt´ enyi,20,21 Frederico Sim˜ oes do Couto,20,21 Alfredo Ramirez,22,23,24 Frank Jessen,22,24,25 Michael T. Heneka,25,26 Estrella G´ omez-Tortosa,27 Adrian Danek,28,29 Patrick Cras,2,3 Rik Vandenberghe,30,31 Peter De Jonghe,1,2,3 Peter P. De Deyn,2,4 Kristel Sleegers,1,2 Marc Cruts,1,2 Christine Van Broeckhoven,1,2∗and Belgian Neurology Consortium and European Early-Onset Dementia Consortium1‡ 1Center for Molecular Neurology, VIB, Antwerp, Belgium; 2Institute Born-Bunge, University of Antwerp, Antwerp, Belgium; 3Department of Neurology, Antwerp University Hospital, Edegem, Belgium; 4Department of Neurology and Memory Clinic, Hospital Network Antwerp (ZNA) Middelheim and Hoge Beuken, Antwerp, Belgium; 5Department of Neurology, University Hospital Ghent and University of Ghent, Ghent, Belgium; 6Neurological Tissue Bank of the Biobanc - Hospital Clinic-Institut d’Investigacions Biomediques August Pi i Sunyer (IDIBAPS), Barcelona, Spain; 7Department of Neurology, IIB Sant Pau, Hospital de la Santa Creu i Sant Pau, Universitat Aut` onoma de Barcelona, Barcelona, Spain; 8Center for Networker Biomedical Research in Neurodegenerative Diseases (CIBERNED), Madrid, Spain; 9Department of Psychiatry and Psychotherapy, Technische Universit¨ at M¨ unchen, M¨ unchen, Germany; 10Neuroepidemiology and Ageing Research Unit, School of Public Health, The Imperial College of Science, Technology and Medicine, London, UK; 11West London Cognitive Disorders Treatment and Research Unit, West London Mental Health Trust, London TW8 8DS, UK; 12Department of Neurodegeneration, Hertie Institute for Clinical Brain Research and Centre of Neurology, T¨ ubingen, Germany; 13German Research Center for Neurodegenerative Diseases (DZNE), T¨ ubingen, Germany; 14Department of Neurobiology, Care Sciences and Society (NVS), KI-Alzheimer Disease Research Center, Karolinska Institutet, Stockholm, Sweden; 15Department of Geriatric Medicine, Genetics unit, Karolinska University Hospital, Stockholm, Sweden; 16Neurology Unit, University of Brescia, Brescia, Italy; 17Department of Biochemistry, Molecular Medicine Center, Medical University-Sofia, Sofia, Bulgaria; 18Department of Neurology, Medical University-Sofia, Sofia, Bulgaria; 19Department of Cognitive Science and Psychology, New Bulgarian University, Sofia, Bulgaria; 20Hospital Santa Maria, Lisbon, Portugal; 21Faculty of Medicine and Institute of Molecular Medicine, University of Lisbon, Lisbon, Portugal; 22Department of Psychiatry and Psychotherapy, University of Bonn, Bonn, Germany; 23Institute of Human Genetics, University of Bonn, Bonn, Germany; 24Department of Psychiatry and Psychotherapy, University of Cologne, Cologne, Germany; 25German Center for Neurodegenerative Diseases (DZNE), Bonn, Germany; 26Clinical Neuroscience Unit, Department of Neurology, University of Bonn, Bonn, Germany; 27Department of Neurology, Fundaci´ on Jim´ enez D´ ıaz, Madrid, Spain; 28Department of Neurology, Ludwig-Maximilians-Universit¨ at M¨ unchen, Munich, Germany; 29German Center for Neurodegenerative Diseases (DZNE), Munich, Germany; 30Department of Neurosciences, Faculty of Medicine, KU Leuven, Leuven, Belgium; 31Department of Neurology, University Hospitals Leuven, Leuven, Belgium Communicated by Lars Bertram Received 10 October 2016; accepted revised manuscript 15 December 2016. Published online 23 December 2016 in Wiley Online Library (www.wiley.com/humanmutation). DOI: 10.1002/humu.23161 Additional Supporting Information may be found in the online version of this article. †These authors contributed equally to this work and are shared first author. ‡The Belgian Neurology (BELNEU) consortium and European Early-Onset (EU EOD) consortium side authors are listed in the Acknowledgements. Contract grant sponsors: Belgian Science Policy Office Interuniversity Attraction Poles Program; Flemish Government (Flanders Impulse Program on Networks for Dementia Research, Methusalem Excellence Program); the Research Foundation Flanders (FWO); the University of Antwerp Research Fund; Fondazione Cassa di Risparmio di Pistoia e Pescia (grants 2014.0365, 2011.0264, and 2013.0347); the Cassa di Risparmio di Firenze (grant 2014.0310); Fondo di Ateno 2014; Ricerca Corrente; Italian Ministry of Health; Else Kr¨ oner-Fresenius-Stiftung (EKMS 018); Swedish Brain Power; Swedish Research Council (grant numbers 521-2010-3134, 2015-02926); Gun and Bertil Stohne; Gamla tj¨ anarinnor; Demensfonden; Sweden Alzheimer Foundation (AF-556561); King Gustaf V and Queen Victoria’s Foundation of Freemasons; StratNeuro at Karolinska Institute (KI). ABSTRACT: We investigated the mutation spectrum of the TANK-Binding Kinase 1 (TBK1) gene and its associated phenotypic spectrum by exonic resequencing of TBK1 in a cohort of 2,538 patients with frontotemporal dementia (FTD), amyotrophic lateral sclerosis (ALS), or FTD plus ALS, ascertained within the European EarlyOnset Dementia Consortium. We assessed pathogenicity of predicted protein-truncating mutations by measuring loss of RNA expression. Functional effect of in-frame ∗Correspondence to: Christine Van Broeckhoven, Neurodegenerative Brain Diseases Group, VIB Center for Molecular Neurology, University of Antwerp – CDE, Universiteitsplein 1, Antwerp B-2610, Belgium. E-mail: christine.vanbroeckhoven@molgen. vib-ua.be C 2016 The Authors. ∗∗Human Mutation published by Wiley Periodicals, Inc. This is an open access article under the terms of the Creative Commons Attribution-NonCommercial-NoDerivs License, which permits use and distributioninanymedium, provided the original work is properly cited, the use is non-commercial and no modifications or adaptations are made. amino acid deletions and missense mutations was further explored in vivo on protein level and in vitro by an NFκBinduced luciferase reporter assay and measuring phosphorylated TBK1. The protein-truncating mutations led to the loss of transcript through nonsense-mediated mRNA decay. For the in-frame amino acid deletions, we demonstrated loss of TBK1 or phosphorylated TBK1 protein. An important fraction of the missense mutations compromised NFκB activation indicating that at least some functions of TBK1 are lost. Although missense mutations were also present in controls, over three times more mutations affecting TBK1 functioning were found in the mutation fraction observed in patients only, suggesting high-risk alleles (P= 0.03). Total mutation frequency for confirmed TBK1 LoF mutations in the European cohort was 0.7%, with frequencies in the clinical subgroups of 0.4% in FTD, 1.3% in ALS, and 3.6% in FTD-ALS. Hum Mutat 38:297–309, 2017. Published 2016 Wiley Periodicals, Inc.∗∗ KEY WORDS: TANK-Binding Kinase 1; TBK1; frontotemporal dementia; FTD; amyotrophic lateral sclerosis; ALS; mutations; NFκB luciferase reporter assay Introduction Multiple lines of evidence have now strongly established that frontotemporal lobar degeneration (FTLD) and amyotrophic lateral sclerosis (ALS) share a common molecular etiology and are part of a disease continuum. Up to 50% of frontotemporal dementia (FTD) patients develop signs of motor neuron disease (MND) at some stage in the disease course with about 15% meeting the diagnostic criteria of ALS; conversely, over 30% of ALS patients show signs of FTD [Lomen-Hoerth et al., 2002]. Neuropathologically, the majority of thesepatientsdisplayaccumulationofTDP-43aggregatesin affected brain regions and motor neurons. Furthermore, common genetic factors underlying FTLD and ALS, such as the chromosome 9 openreading frame 72 (C9orf72, MIM# 614260) [DeJesus-Hernandez et al., 2011; Renton et al., 2011; Gijselinck et al., 2012], valosin containingprotein(VCP,MIM#601023) [Wattsetal.,2004;Johnson et al., 2010], TAR DNA-binding protein (TARDBP, MIM# 605078) [Kabashi et al., 2008; Sreedharan et al., 2008; Borroni et al., 2009; Gelpi et al., 2014], and Fused in sarcoma RNA-binding protein (FUS, MIM# 137070) [Kwiatkowski et al., 2009; Van Langenhove et al., 2010] genes, are key pathological genes in both diseases. Of these, the G4C2repeat expansion in C9orf72 is the most frequent genetic cause of the FTD–ALS spectrum, accounting for up to 29%, 50%,and88% ofFTD,ALS,andFTD-ALSpatient series,respectively [Cruts et al., 2013]. Also, loss-of-function (LoF) of the TANK-binding kinase 1 (TBK1, MIM# 604834) was causally associated with ALS and FTD [Cirulli et al., 2015; Freischmidt et al., 2015; Gijselinck et al., 2015; Le Ber et al., 2015; Pottier et al., 2015; Williams et al., 2015]. TBK1 is a multifunctional kinase regulating a number of cellular processes, including the innate immune system and inflammation, autophagy, and cell proliferation, by phosphorylating a wide range of substrates [Cl´ ement et al., 2008; Pilli et al., 2012; Larabi et al., 2013]. Of interest, these substrates include optineurin (OPTN) and p62, two autophagic proteins that are also genetically implicated in the FTD-ALS spectrum. Furthermore, TBK1 homodimerization and autophosphorylation at the serine 172 residue is necessary for its activation. One of the downstream effects of TBK1 activation is the upregulation of interferon (IFN)-stimulated genes by activation of the nuclear factor of the kappa light polypeptide gene enhancer in B-cells (NFκB) complex. Frameshift, out-frame, splice-site, and nonsense mutations generating premature termination codons (PTC) in TBK1 have been demonstrated to result in LoF through loss of mutant transcript and protein [Freischmidt et al., 2015; Gijselinck et al., 2015; Pottier et al., 2015]. In addition to these clear pathogenic mutations, a small number of in-frame single amino acid deletions have been found, some of which cosegregated with disease that led to loss of protein, whereas others did not [Freischmidt et al., 2015; Gijselinck et al., 2015]. Furthermore, numerous rare missense mutations have been identified, in both patient and control subjects [Cirulli et al., 2015; Freischmidt et al., 2015; Gijselinck et al., 2015; Le Ber et al., 2015; Pottier et al., 2015; Williams et al., 2015]. Prediction of their pathogenic effect may be ambiguous, certainly in the absence of supportive cosegregation. One report was able to demonstrate functional deficits for a number of missense mutations by testing their effect in vitro on the IFNβpathway and on the interaction with adaptor protein OPTN [Freischmidt et al., 2015], indicating that at least some missense mutations may be disease-causing. In the previous study, we reported the identification of TBK1 LoF mutations in a Belgian discovery cohort of FTD (n=460), FTD-ALS (n=22), and ALS (n=147) patients, yielding mutation frequencies of 1.1% in FTD, 3.4% in ALS patients, and 4.5% in FTDALS [Gijselinck et al., 2015]. In the present study, we expanded the TBK1 genetic screen with a European replication cohort of 1,755 patients with FTD (n=1,271), ALS (n=407), or FTD-ALS (n= 77). In addition to the protein-truncating mutations that led to loss of transcript, we also assessed the pathogenic effect of in-frame deletions and missense mutations on protein level and function, the latterusinganinvitroluciferase assaymeasuringtheeffectofmutant TBK1 on NFκB activation in the IFN pathway. Taken together, this study reports on the mutation frequency and mutation spectrum of TBK1 in an extended European study population of 2,538 patients with FTD (n=1,873), ALS (n=554), or FTD-ALS (n =111). Materials and Methods European Study Population The patient and control cohorts under study were ascertained through the Belgian Neurology (BELNEU) consortium or the European Early-Onset Dementia (EU EOD) consortium, as described in previous studies [van der Zee et al., 2013, 2014; Gijselinck et al., 2015; Van Mossevelde et al., 2015]. DNA and medical/demographic information was included on 2,538 patients, comprising 1,873 patients diagnosed with FTD, 111 with concomitant FTD-ALS, and 554 patients with ALS. Patients originated from Austria, Belgium, Bulgaria, Czech Republic, Germany, Greece, Italy, Portugal, Spain, and Sweden (Table 1). Patients were evaluated and diagnosed with FTD according to the Lund and Manchester group criteria [Neary et al., 1998], and for ALS, according to the revised El Escorial criteria [Brooks et al., 2000]. Clinical diagnoses of behavioral variant FTD (bvFTD) was based on the international consensus criteria by Rascovsky et al. (2011), and of primary progressive aphasia (PPA) on the classification of Gorno-Tempini et al. (2011). A positive family history was defined for index patients with firstor second-degree relatives with symptoms of dementia or MND. In the FTD group, 34%(635/1,873)had apositive familyhistory,in theFTD-ALSgroup 298 HUMAN MUTATION, Vol. 38, No. 3, 297–309, 2017 Table 1. Descriptives of the EU EOD Patient Cohorts FTD FTD-ALS ALS Total EU EOD cohorts and PI 1,873 111 554 2,538 Belgium (n=783) Van Broeckhoven ( =Belgian discovery cohort) 460 22 147 629 Van Broeckhoven 142 12 0 154 Spain (n=548) Clarimon 76 7 92 175 Pastor 126 3 12 141 Ruiz 95 0 0 95 Sanchez 53 8 0 61 Gelpi 12 8 16 36 G´ omez-Tortosa 38 2 0 40 Italy (n=442) Borroni 165 12 24 201 IRCCS Brescia 01 110 0 0 110 Nacmias 74 5 0 79 Frisoni 48 1 0 49 Fabrizi 0 2 1 3 Germany (n=317) Diehl-Schmid 153 3 0 156 Ramirez 60 0 21 81 Synofzik 0 0 78 78 Danek 1 1 0 2 Portugal (n=195) Mendonc¸a 130 4 0 134 Santana 57 4 0 61 Bulgaria (n=134) Jordanova 0 2 132 134 Sweden (n=60) Graff 55 4 1 60 Czech Republic (n=30) Matˇ ej 18 8 4 30 Greece (n=26) Fraidakis 0 1 25 26 Austria (n=3) Kovacs 0 2 1 3 Of the 783 Belgian patients and 1,074 Belgian controls included in the present European study population,TBK1mutation screening data on 629 patients and 1,044 control individuals were previously published as part of the Belgian discovery cohort [Gijselinck et al., 2015; Van Mossevelde et al., 2015]. Novel patients and control subjects reported in this study are part of the European replication cohort. Together, the Belgian discovery cohort and the European replication cohort constitute the European study population. P.I., principle investigator. 29% (32/111) and in the ALS group 8% (46/554). As control group, 2,183 ageand origin-matched European control individuals, with no personal or family history of neurodegenerative or psychiatric diseases, were included. Of the 783 Belgian patients and 1,074 Belgian controls included in the present European study population (Table 1), TBK1 mutation screening data on 629 patients and 1,044 control individuals was generated and published as part of the Belgian discovery cohort [Gijselinck et al., 2015; Van Mossevelde et al., 2015]. Novel patients (n=1,755) and control subjects (n=1,109) reported in this study are part of the European replication cohort. Together, the Belgian discovery cohort and the European replication cohort constitute the European study population (Table 1). For all participants, informed consent for participation in the genetic studies was obtained according to sampling protocols that were approved by the local Ethics Committees of the collaborating medical centers. The protocols for the genetic studies were approved by the Ethics Committee of the University of Antwerp, Belgium. Exonic Resequencing All coding exons of TBK1 (NM 013254.3) were sequenced on a MiSeq platform using the MiSeq V2 chemistry (Illumina, San Diego, CA), except for exon 4, which was sequenced by Sanger sequencing using the BigDye RTerminator Cycle Sequencing kit v3.1 (Applied Biosystems, Foster City, CA). Detailed technical procedures were previously described [Gijselinck et al., 2015]. Reported variants follow cDNA numbering according to reference sequence NM 013254.3. In addition, for intronic variants, the genomic reference sequence NC 000012.12 was used. Nucleotide positions refer to cDNA sequence and nucleotide numbering uses +1 as the A of the ATG translation initiation codon in the reference sequence, with the initiation codon as codon 1. Protein numbering is given according to reference sequence NP 037386.1. Variants identified in this study have been submitted to the Alzheimer Disease & Frontotemporal Dementia Mutation Database (AD&FTDMDB, http://www.molgen.vib-ua.be/FTDMutations) and Locus Specific Database [Cruts et al., 2012]. Transcript Analysis When the required biomaterials were available, transcript analysis was performed for patients with a TBK1 mutation (Fig. 1). For the c.288delT (p.Val97Phefs∗2) and the c.1340+1G>A (p.Ala417∗) carriers, total RNA was isolated from whole blood using the PAXgene Blood RNA kit (PreAnalytiX; Qiagen, Valencia, CA) in accordance with the manufacturer instructions. First-strand cDNA was synthesized from total RNA with random hexamers primers using the Invitrogen ThermoScript RT-PCR kit (Invitrogen, Carlsbad, CA). For transcript analysis of the c.235 237delACA (p.Thr79del) and c.379C>T (p.Arg127∗) carriers, total RNA was extracted from blood mononuclear cells (p.Arg127∗)orfrontal cortical brain tissue (p.Thr79del) from the carriers. First-strand cDNA was synthesized with oligodT and random hexamers primers, using the SuperScript III First-Strand Synthesis System for RT-PCR kit (Invitrogen). cDNA of these samples was amplified using the universal amplification protocol (Applied Biosystems). For p.Val97Phefs∗2, exon 4 was amplified with flanking PCR primers positioned in exons 3 and 5. For p.Ala417∗,predictedtoleadtoexon 11 skipping, cDNA was amplified with primers positioned in exons 10 and 13. For p.Arg127∗, exon 5 was amplified with PCR primers in exon 3 and exon 6. All PCR products were Sanger sequenced to evaluate whether the mutant transcript was present based on the coding mutation and whether alternative transcripts were formed. Genotypes of cDNA sequences were compared with genomic DNA sequences. Primer sequences will be provided upon request. For quantification of the transcripts created by the p.Thr79del mutation, semiquantitative real-time PCR (qPCR) was performed using SYBR Green assays on the ViiATM 7 Real-Time PCR System (Applied Biosystems). A qPCR amplicon was designed, spanning exons 19 and 20 (primers 5’- CATGACCCCAATTTATCCAAGTTC3’ and 5’- CATCTCTTCCTTTAATTTCTTCATACCA-3’), detecting the TBK1 refgene transcript variant NM 013254 using PrimerExpress Software (Applied Biosystems) and quantified against three housekeeping genes, HPRT,GAPDH,andSDHA.Relative expression levels were calculated by comparing normalized quantities between patient and control samples using qbase+software (Biogazelle, Ghent, Belgium). Protein Analysis Protein lysates from the TBK1 p.Thr79del carrier and control frontal cortex tissue were prepared for Western blot with 0.1% RIPA and sonicated on ice, cleared at 20,000 g for 15 min at 4°Candsupernatants used for immunoblotting (Fig. 1). Protein concentrations were measured by a BCA assay (Pierce, Rockford, IL), and 30 μgof HUMAN MUTATION, Vol. 38, No. 3, 297–309, 2017 299 Figure 1. Transcript and protein analysis of TBK1 LoF and single amino acid deletion mutations. A: gDNA and cDNA sequence traces around the c.288delT (p. Val97Phefs∗2) mutation, showing reduced expression of the mutant transcript on cDNA extracted from blood. B: gDNA and cDNA sequence traces around the c.379C>T (p.Arg127∗) mutation, showing the absence of the mutant transcript on cDNA extracted from blood. C: Sizing of cDNA fragments generated with primers in TBK1 exon 10 and exon 13 of the c.1340+1G>A (p.Ala417∗) carrier on cDNA extracted from blood. Sequence traces from the low-expressed aberrant transcript demonstrates skipping of exon 11. D: Transcript and protein analysis on brain frontal cortex from the c.235_237delACA (p.Thr79del) carrier and four age-matched control brains. The graph on the left shows the relative expression in the patient sample (blue) compared with the control samples (black) measured by quantitative real-time PCR (qRT-PCR). In the middle, Western blot analysis is shown of protein extracts from the patient carrier compared with control individuals. The upper band represents TBK1 (84 kDa) and the lower band represents the housekeeping protein GAPDH (37 kDa). The graph on the right shows the quantification in the patient sample (blue) and control samples (black) of the TBK1 signal normalized to the signal of GAPDH. Error bars represent the SD. E: Western blot analysis of phosphorylated TBK1 (Ser172, p-TBK1) (upper band, 84 kDa) in HEK293T cells overexpressing the in-frame single amino acid deletions (p.Thr79del, p.Asp167del, and p.Glu643del) compared with wild type, relative to GAPDH (lower band, 37 kDa). Mock and kinase dead (p.Ser172Ala, KD) were used as negative control. cDNA numbering according to reference sequence NM_013254.3, in addition, for intronic variants, the genomic reference sequence NC_000012.12 was used. Nucleotide positions refer to cDNA sequence and nucleotide numbering uses +1 as the A of the ATG translation initiation codon in the reference sequence, with the initiation codon as codon 1. Protein numbering according to reference sequence NP_037386.1. 300 HUMAN MUTATION, Vol. 38, No. 3, 297–309, 2017 Table 2. TBK1 Predicted LoF Mutations in the European Study Population FTD FTD-ALS ALS cDNA Predicted protein n=1,873 n=111 n=554 Cohorts of the European study population Protein-truncating mutations leading to loss of transcript c.4C>T p.Gln∗2 1 Belgian discovery cohort c.86delA p.Lys29Argfs∗15 1 European replication cohort c.288delT p.Val97Phefs∗2 1 European replication cohort c.349C>T p.Arg117∗1 European replication cohort c.379C>T p.Arg127∗1 European replication cohort c.992+1G>T p.Gly272 Thr331del 1 Belgian discovery cohort c.1192delT p.Ser398Profs∗11 1 Belgian discovery cohort c.1335G>A p.Trp445∗1 European replication cohort c.1340+1G>A p.Ala417∗1 European replication cohort c.1385 1388delCAGA p.Thr462Lysfs∗3 1 European replication cohort c.1551 1552insTT p.Ser518Leufs∗32 1 Belgian discovery cohort In-frame deletions leading to loss-of-protein or protein function c.235 237delACA p.Thr79del 1 European replication cohort c.499 501delGAT p.Asp167del 1 Belgian discovery cohort c.1927 1929delGAA p.Glu643del 3 1 2 Belgian discovery cohort Predicted in-frame deletions with unknown effect c.228+1G>A p.Lys30 Glu76del 1 European replication cohort c.992+4992+7delAGTA p.Gly272 Thr331del 1 European replication cohort All listed mutations were absent from 2,183 screened control individuals and dbSNP build 138. The respective cohorts of the European study populationinwhichmutations were identified are indicated in the last column. Mutations and carriers identified in the Belgian discovery cohort were previously published by our group [Gijselinck et al., 2015; Van Mossevelde et al., 2015]. Novel mutations and carriers reported in this study are part of the European replication cohort. cDNA numbering was according to the reference sequence NM_013254.3. In addition, for intronic variants, the genomic reference sequence NC_000012.12 was used. Nucleotide positions refer to cDNA sequence and nucleotide numbering uses +1 as the A of the ATG translation initiation codon in the reference sequence, with the initiation codon as codon 1. Protein numbering according to reference sequence NP_037386.1. protein were separated on 4%–12% Nupage Bis–Tris gels (Invitrogen),electroblottedonto a PVDF membrane (HybondP;Amersham Biosciences, GE Helthcare, Little Chalfont, UK), and probed with a monoclonal antibody against TBK1 (Abcam, Cambridge, MA; 1:1,000, 84 kDa). Immuno-detection was performed with specific secondary antibodies conjugated to horseradish peroxidase and the ECL-plus chemiluminescent detection system (Amersham Biosciences). TBK1 signal intensities were quantified against GAPDH (Genetex, Irvine, CA; 1:10,000, 37 kDa), using ImageQuantTL software (GE Healthcare Life Sciences, Little Chalfont, UK). TBK1 Cloning and Overexpression in HEK293T Cells TBK1 plasmids containing a missense mutation or a single amino acid deletion were generated by in vitro mutagenesis using the KAPA HiFi HotStart DNA polymerase (Kapa Biosystems, Wilmington, MA) starting from the TBK1 wild-type gateway pDONR vector (NM 013254.3) (GeneCopoeia, Rockville, MD). The p.Ser172Ala mutant (kinase dead) generating a TBK1 protein lacking kinase activity, and the mock plasmid containing no TBK1, were used as negative controls. The gateway-compatible pCR3 vector (Life Technologies, Carlsbad, CA) was used as expression vector. Each TBK1 plasmid was transiently transfected in HEK293T cells using Lipofectamine 2000 (Life Technologies). Protein lysates of these TBK1 overexpression cells were used for Western blotting with an antibody against TBK1 (Abcam; 1:1,000, 84 kDa) and GAPDH (Genetex; 1:10,000, 37 kDa). Autophosphorylation activity of the single amino acid deletions was determined by Western blot analysis with p-TBK1 antibody (phospho S172) (Abcam; 1:500, 84 kDa). NFκB Reporter Assay Each TBK1 plasmid was transiently transfected in human embryonic kidney cells (HEK293T) using X-tremeGENE 9 DNA Transfection Reagent (Sigma–Aldrich, St Louis, MO), together with the NFκB luciferase reporter vector (Affymetrix, Santa Clara, CA) containing an inducible Firefly luciferase reporter gene to monitor theactivationoftheNFκB signal transduction pathway and the pTK-GLuc plasmid that encodes the Gaussia luciferase gene (New England Biolabs, Ipswich, MA) for normalization. Firefly luciferase activities (LAF) and Gaussia luciferase activities (LAG) were measured in fivefold by the use of a Dual-Glo Luciferase Assay System (Promega, Madison, WI) and a BioLux Gaussia Luciferase Assay Kit (New England Biolabs) on a Veritas Microplate Luminometer (Promega). To correct for transfection efficiency and DNA uptake, the relative luciferase activity (RLA) was calculated as RLA = LAF/LAG. This experiment was repeated three times. Differences in relative luciferase activities between mutant and wild-type TBK1 plasmids were calculated by a linear mixed model using the statistical packages lme4 and nlme in R and corrected for multiple testing using Bonferroni correction. Neuropathology of TBK1 p.Thr79del Carrier Neuropathological work-up was performed at the Neurological Tissue Bank of the Biobanc-Hospital Clinic-IDIBAPS (Barcelona, Spain), according to standardized procedures. In brief, fragments of frontal cortex and cerebellum were immediately frozen at –80°C, whereas the remaining brain tissue was fixed in 10% buffered formaldehyde solution for 4 weeks. For histopathological evaluation, 5 μm thick sections were cut from formalin-fixed and paraffinembedded tissue from multiple brain areas including frontal, temporal, parietal and occipital cortices, motor cortex, anterior cingulate gyrus, anterior and posterior basal ganglia, anterior, medial and posterior thalamic nuclei, hippocampus and parahippocampal gyrus, amygdala, n. basalis Meynert, midbrain, pons, medulla oblongata, cerebellar vermis, and dentate nucleus, as well as cervical, thoracic, and lumbar segments of spinal cord. Sections were stained with hematoxylin-eosin, Luxol fast blue, and for immunohistochemistry using the following monoclonal (mc) and polyclonal (pc) primary antibodies on an automated HUMAN MUTATION, Vol. 38, No. 3, 297–309, 2017 301 immunostainer (DAKO autostainer plus; DAKO, Glostrup, Denmark) after heator chemically induced epitope retrieval with formic acid: anti-bA4-amyloid (DAKO; mc, clone 6F/3D, dilution 1:400), antiphosphorylated tau (Thermo Scientific, Rockford, IL; mc, clone AT8, dilution 1:200), antiubiquitin (DAKO; pc, dilution 1:400), anti-alpha-synuclein (Novocastra, Newcastle, UK; mc, clone KM51, dilution 1:500), anti-TDP-43 (Abnova, Taipei, Taiwan; mc, clone 2E2-D3, dilution 1:500), antineurofilaments (Novocastra; clone RT97, dilution 1:800), anti-RD3 (Millipore, Temecula, CA; mc, clone 8E6/C11, dilution 1:1,000), anti-RD4 (Millipore; mc, clone 1E1/A6, dilution 1:50), anti-alpha-internexin (Invitrogen; mc, clone 2E3, dilution 1:800), and anti-alpha-B-crystallin (Novocastra; mc, clone G2JF, dilution 1:100). Statistical Analysis Missense mutation frequencies were compared between patients and controls using a Fisher exact test. Significance level was set at P<0.05. Results Protein-Truncating Mutations In the Belgian discovery cohort, we have reported four TBK1 LoF mutations (Table 2) [Gijselinck et al., 2015]. In this study, massive parallel exonic resequencing of the TBK1 coding region was performed in the EU replication cohort of 1,755 patients, among which 1,271 FTD, 407 ALS patients, and 77 FTD-ALS, together with 1,109 European control individuals. In the patients, seven additional predicted LoF mutations were identified, including three small out-frame deletions, three nonsense mutations, and one splice donor-site mutation (Table 2). These mutations introduce a PTC and are expected to result in loss of transcript due to nonsense-mediated mRNA decay (NMD). No PTC or splice-site mutations were observed in the control subjects. We had already confirmed NMD for two PTC mutations, c.1192delT (p.Ser398Profs∗11) and c.1551 1552insTT (p.Ser518Leufs∗32) [Gijselinck et al., 2015]. In addition, for the predicted in-frame exon-skipping mutation c.992+1G>T (p.Gly272 Thr331del) affecting exon 8, we demonstrated cryptic splicing activation and reduction of transcript and protein in brain [Gijselinck et al., 2015]. In the present study, we demonstrated NMD for three more mutations. For c.288delT (p.Val97Phefs∗2), we showed a strong but incomplete reduction of the mutant transcript, for c.379C>T (p.Arg127∗) a complete absence of the mutant transcript (Fig. 1A and B). For the previously reported splice donor-site mutation in intron 11 (c.1340+1G>A), we confirmed out-of-frame skipping of exon 11 leading to a PTC (p.Ala417∗) (Fig. 1C) [Freischmidt et al., 2015]. For three of the mutation carriers in the EU replication cohort, c.288delT (p.Val97Phefs∗2), c.1340+1G>A (p.Ala417∗), and c.1385 1388delCAGA (p.Thr462Lysfs∗3), we identified an additional affected relative with the mutation. In addition to these proven loss-of-transcript mutations, we identified two novel predicted in-frame exon-skipping mutations. These splice donor-site mutations in intron 3 (c.228+1G>A) and intron 8 (c.992+4 7delAGTA) are predicted to result in a deletion of 47 (p.Lys30 Glu76del) and 60 amino acids (p.Gly272 Thr331del). No cells or tissues from the carriers were available for transcript and protein analysis; therefore, we were unable to demonstrate the effect of these two mutations, and as a consequence, they were not considered further when calculating TBK1 mutation frequencies. In-Frame Deletions We have observed two in-frame, single amino acid deletions in the BE discovery cohort and one additional in-frame deletion in the EU replication cohort (Table 2). All three, c.235 237delACA (p.Thr79del), c.499 501delGAT (p.Asp167del), and c.1927 1929delGAA (p.Glu643del), were absent from control subjects, and no other amino acid deletion mutations were observed in the control cohort. The p.Thr79del mutation was identified in a Spanish patient. The two other mutations, p.Asp167del and p.Glu643del, had been detected in Belgian patients [Gijselinck et al., 2015]. The p.Glu643del mutation was present in one index patient and five affected relatives and an additional five unrelated index patients [Gijselinck et al., 2015; Van Mossevelde et al., 2015]. In contrast to the protein-truncating mutations, the p.Glu643del mutation did not affect transcript levels but produced 50% loss of TBK1 protein in vivo [Gijselinck et al., 2015]. In this study, we obtained comparable results for the Spanish mutation, p.Thr79del, with loss of expression only at the protein level observed in brain (Fig. 1D). The p.Asp167del behaved differently. Here, TBK1 protein expression in brain was preserved [Gijselinck et al., 2015]. In vitro TBK1 protein expression of p.Thr79del and p.Glu643del mutations overexpressed in HEK293T cells was reduced but not completely absent (Supp. Fig. S1), whereas phospho-TBK1 was completely absent for p.Thr79del and p.Asp167del, and almost completely absent for p.Glu643del (Fig. 1E). We further investigated the effect of the three in-frame deletions on NFκB activation, using an NFκB in vitro luciferase reporter assay. Results showed that all three amino acid deletion mutations severely disrupted NFκB activation (Fig. 2). The two single amino acid deletions located in the KD, p.Thr79del and p.Asp167del, resulted in a complete loss of NFκB activation. The p.Glu643del mutation that maps to the scaffold dimerization domain (SDD; residues 408–657) [Larabi et al., 2013], showed a highly significant reduction of about 70%. Taken together, the in vivo protein expression and in vitro experiments demonstrated that, in addition to the protein-truncating LoF mutations, in-frame deletions also lead to TBK1 LoF through loss-of-protein and/or protein function. In conclusion, in the European replication cohort, we identified seven LoF protein-truncating mutations and one LoF in-frame deletion mutation in a total of eight index patients, resulting in a mutation frequency of TBK1 LoF mutations of 0.5% (8/1,755) overall and 0.2% in FTD patients (3/1,271), 0.5% in ALS patients (2/407), and 3.9% in FTD-ALS patients (3/77). Meta-analysis of the Belgian discovery cohort and the EU replication cohort resulted in a total mutation frequency for TBK1 LoF mutations in the overall European study population of 0.7% (19/2,538), comprising 0.4% FTD patients (8/1,873), 1.3% ALS patients (7/554), and 3.6% FTD-ALS patients (4/111). TBK1 Missense Mutations In the present study, we also investigated the prevalence and functional effect of missense mutations in the European study population. In the patient cohort, we identified 25 missense mutations in 26 patients, of which 16 were found only in patients (Table 3). In the control cohort, we identified 15 missense mutations in 16 individuals that were absent in patients (Table 3). We tested all 40 missense mutations using the NFκB reporter assay (Table 3; Fig. 2). In the patient-only group, we found seven missense mutations in seven patients that showed an effect on NFκB induction (7/16 carriers, 44%). Six missense mutations showed a 70% decrease in 302 HUMAN MUTATION, Vol. 38, No. 3, 297–309, 2017 Figure 2. Impact of mutant TBK1 on NFκB activity in the IFN pathway. Graphical representation of the mean NFκB-induced luciferase activity of identified in-frame amino acid deletions and missense mutations found in patients-only, shared by patients and controls, and in controls-only, normalized to the mean signal from wild type. Luciferase activities were measured in at least three independent experiments and measured five times per experiment. The different domains are indicated in different colors as shown in the figure legend. WT, wild type TBK1 vector; Mock, empty vector containing no TBK1; S172A-KD, p.Ser172Ala TBK1 kinase dead mutation. Mock and S172A-KD were used as negative controls. Error bars depict standard deviation and asterisks above the bars indicate significant difference from the wild-type level after Bonferroni correction (P<0.001). Protein numbering according to reference sequence NP_037386.1. NFκB activation as compared with wild-type TBK1, of which the c.281T>C (p.Leu94Ser) mutation showed a complete loss. These six missense mutations were located in the KD of TBK1. To a lesser extent but still significant, the c.1252A>G (p.Ile418Val) mutant in the SDD decreased NFκB induction by 45%. In the group of missense mutations present in both patients and controls, just one missense mutation c.871A>G (p.Lys291Glu), also located in the KD domain and present in one patient and two control subjects, showed a significant decrease in NFκBinduction (3/25 carriers, 12%). Of the 15 missense mutations that were observed in control subjects only, two mutations located in the KD protein domain showed a significant reduction, with a complete loss for c.47G>A (p.Gly16Asp) and a 25% reduction for c.428G>A (p.Arg143His) (2/16 carriers, 13%). When comparing the prevalence of missense mutations with a compromised NFκB activation capacity (=functional missense mutations) in patients and controls, we observed about twice as many in patients. In the patients, eight carriers of a functional and therefore potentially pathogenic missense mutation were identified (8/2,538, 0.32%) as compared to four in control subjects (4/2,183, 0.18%) (P=0.40). Although functional missense mutations were identified in the patient-only, the patient and control, as well as the control-only group, over three times as many carriers of functional missense mutations were counted in the patient-only group (7/16, 44%) versus the group of carriers of missense mutations that were also observed in the control population (5/41, 12%) (P=0.025). Phenotypic Characteristics of TBK1 Mutation Carriers Demographic, genetic, and clinical features of the pathogenic and possibly pathogenic TBK1 mutation carriers (protein-truncating mutations, in-frame deletions, and functional missense mutations) are summarized in Table 4. Eleven of the 19 index patients with a TBK1 LoF mutation had FTD as presenting clinical phenotype. In this subset of patients, nine developed FTD without clinical signs of MND. In the years following first diagnosis, two patients developed ALS and another patient progressed into a corticobasal syndrome (CBS). Eight patients presented first with ALS, of which one showed concomitant cognitive deterioration suffering from a severe memory disorder and visuoconstructional deficits but no specification of the dementia diagnosis was possible. Of all patients diagnosed with ALS (n=10), four had bulbar onset and one had spinal onset. In five ALS patients, the site of onset was not specified. Of all FTD (or unspecified dementia) patients (n=12), the majority was diagnosed with bvFTD (8/12). Three others presented with a language variant of FTD, progressive nonfluent aphasia (PNFA) or PPA. The remaining patient received a diagnosis of unspecified dementia (together with ALS). Mean age at onset in all 19 TBK1 LoF carriers was 63.9 ±7.8 years (range 48–78). Of the 12 patients that died, mean age at death was 65.5 ±8.9 years (range 50–77) with an average disease duration of 42 ±40 months (range 6–136). Neuropathological examination was performed in three of the deceased patients. The patient with the p.Val97Phefs∗2 mutation displayed pure MND with TDP-43 inclusions. The carrier of the p.Ala417∗mutation showed mild TDP-43 proteinopathy in affected brain regions (type B). Neuropathological investigation in the p.Thr79del carrier confirmed the diagnosis of FTLD-MNDTDP (type B), but additional argyrophilic grain disease stage III was noted (Fig. 3). In the eight functional missense mutation carriers, four presented first with FTD, of whom one developed concomitant ALS, and four presented with ALS only. Again, in the FTD patients, bvFTD was the predominant subtype (3/4). In the ALS patients, two had spinal onset and two had bulbar onset. Average onset age was low at 46.6 ±7.4 years (range 34–57). The three patients that passed away died at relatively young ages of 43, 59, and 61 years (average age at death 54.3 ±9.9 years). HUMAN MUTATION, Vol. 38, No. 3, 297–309, 2017 303 Table 3. TBK1 Missense Mutations in the European Study Population FTD FTD-ALS ALS Controls cDNA Predicted protein Domain dbSNP NFκBactivity n=1,873 n=111 n=554 n=2,183 Missense mutations found in patients only c.188A>G p.Asn63Ser KD - n.s. 1 c.281T>C p.Leu94Ser KD - Reduced 1 c.362G>A p.Gly121Asp KD - Reduced 1 c.427C>T p.Arg143Cys KD - Reduced 1 c.687G>T p.Arg229Ser KD - Reduced 1 c.731G>T p.Gly244Val KD - Reduced 1 c.737T>C p.Ile246Thr KD - Reduced 1 c.794T>C p.Val265Ala KD - n.s. 1 c.812G>T p.Arg271Leu KD - n.s. 1a c.1057A>G p.Ile353Val ULD - n.s. 1 c.1190T>C p.Ile397Thr linker - n.s. 1 c.1217A>G p.Tyr406Cys linker - n.s. 1 c.1252A>G p.Ile418Val SDD rs138839127 Reduced 1 c.1544T>C p.Ile515Thr SDD rs151225287 n.s. 1a c.1612C>T p.His538Tyr SDD - n.s. 1 c.1717C>G p.Arg573Gly SDD - n.s. 1 Missense mutations found in patients and control subjects c.217A>G p.Ile73Val KD - Increased 2 1 c.550A>G p.Met184Val KD - n.s. 1 1 c.871A>G p.Lys291Glu KD rs34774243 Reduced 1a2 c.964C>T p.His322Tyr ULD rs145905497 n.s. 1a1 c.1179A>G p.Ile393Met linker - n.s. 1 1 c.1603G>A p.Ala535Thr SDD rs199905735 n.s. 1a1 c.1709A>G p.Lys570Arg SDD - n.s. 1 2 c.1792A>G p.Met598Val SDD - n.s. 1 2 c.1957G>C p.Glu653Gln SDD rs144370662 n.s. 1 4 Missense mutations found in control subjects only c.40A>G p.Ile14Val KD - n.s. 1 c.47G>A p.Gly16Asp KD - Reduced 1 c.149A>C p.Asp50Ala KD - Increased 1 c.167T>C p.Phe56Ser KD - n.s. 1 c.428G>A p.Arg143His KD - Reduced 1 c.944C>T p.Ser315Leu ULD rs369620088 n.s. 1 c.1037T>C p.Ile346Thr ULD - n.s. 1 c.1040C>T p.Ser347Phe ULD - n.s. 1 c.1150C>T p.Arg384Trp ULD - n.s. 1 c.1364A>G p.Asn455Ser SDD - Increased 1 c.1366G>C p.Glu456Gln SDD - n.s. 1 c.1538G>A p.Gly513Glu SDD - n.s. 1 c.1796C>T p.Thr599Met SDD - n.s. 1 c.1952C>T p.Thr651Ile SDD - n.s. 1 c.2170C>T p.Arg724Cys CTD rs185524052 n.s. 2 TBK1 functional domains according to Larabi et al. (2013): KD, kinase domain (residues 1–307); ULD, ubiquitin-like domain (residues 309–384); linker; linker (residues 385–407); SDD, scaffold dimerization domain (residues 408–657); CTD, C-terminal domain (residues 657–745). Results of the in vitro NFkB luciferase reporter assay measuring the effect of mutant TBK1 on NFκB activity are listed (see also Fig. 2). Reduced indicates that a significant reduction in luciferase activity was measured; increased indicates that a significant increase in luciferase activity was measured. n.s., no significant change in luciferase activity was measured. aRefers to mutations and carriers identified in the Belgian discovery cohort that were published earlier [Gijselinck et al., 2015]. cDNA numbering according to reference sequence NM_013254.3. Nucleotide positions refer to cDNA sequence and nucleotide numbering uses +1 as the A of the ATG translation initiation codon in the reference sequence, with the initiation codon as codon 1. Protein numbering was according to the reference sequence NP_037386.1. Neuropathology of the p.Thr79del Mutation Carrier Macroscopic evaluation showed a moderate and temporally accentuated brain atrophy with an unfixed brain weight of 1,340 g. On histological examination (Fig. 3), neuronal loss, reactive astrogliosis, and microglial activation were observed predominantly involving themedialtemporallobe.AbundantandwidespreadneuronalTDP43 protein inclusions were detected in neurons of the limbic system including amygdala, entorhinal, and transentorhinal region, hippocampus (dentate gyrus and CA1 sector), cingulate cortex, inferior temporal cortex, and in the motor cortex, with only few inclusions in frontal and parietal cortex, in basal ganglia and thalamus, and brainstem nuclei. Type of inclusions varied and comprised compact and ring-like neuronal cytoplasmic inclusions that were observed predominantly, but not exclusively, in superficial cortical layers and also throughout the cortex. Only very isolated dystrophic neurites were detected. Diffuse granular cytoplasmic immunoreactivity (neuronal "preinclusions") was frequently seen in middle-sized neurons of frontal and temporal cortex, limbic system, basal ganglia, brainstem, and spinal cord. Skein-like inclusions were evident in motor neurons of the anterior horn of the spinal cord, but also in motor neurons of the hypoglossal nucleus, pigmented neurons of the substantia nigra, and few striatal neurons. Frequent oligodendroglial inclusions were detected both in white matter and gray matter (arrows). Involvement of upper motor neurons was appreciated, and there was florid corticospinal tract degeneration showing myelin and axonal loss, and abundant CD68-positive macrophages, whereas lower motor neurons of anterior horns of spinal cord were moderately affected. The distribution pattern of pathology was most concordant with FTLD type B according to the current FTLD consensus classification 304 HUMAN MUTATION, Vol. 38, No. 3, 297–309, 2017 Table 4. Clinical and Pathological Phenotype of Patients Carrying a TBK1 LoF Mutation or Possibly Pathogenic Missense Mutation Mutation Origin Gender Clinical diagnosisaSubtypeb Family history Age at onset (years) Ageatlast examination/death (years) Disease duration (months) Additional information Truncating mutations p.Gln∗2cSpanish Female FTD bvFTD 56 60 >53 p.Lys29Argfs∗15 German Male FTD PNFA +PSP 73 †77 48 p.Val97Phefs∗2 Swedish Male ALS +62 †63 MND-TDP p.Arg117∗Italian Male FTD bvFTD +67 †74 86 p.Arg127∗German Female ALS Bulbar 70 Alive p.Trp445∗Spanish Female FTD +CBS PNFA/agramatic variant 78 84 >72 p.Gly272 Thr331delcBelgian Male FTD bvFTD +48 †50 29 p.Ser398Profs∗11cBelgian Male ALS Bulbar +59 Alive >75 p.Ala417∗Swedish Female FTD bvFTD +68 †71 27 FTLD-TDP type B p.Thr462Lysfs∗3GermanMaleALS +D+74 †75 11 LMN>>UMN p.Ser518Leufs∗32cBelgian Female ALS +64 †64 6 In-frame deletions p.Thr79del Spanish Male FTD +ALS bvFTD +bulbar 56 †58 18 FTLD-MND-TDP type B + argyrophylic grain disease (stage III) p.Asp167delcBelgian Male ALS 60 †61 p.Glu643delcBelgian Female FTD +ALS bvFTD +spinal +62 †74 136 p.Glu643delcBelgian Female FTD bvFTD +64 Alive >109 p.Glu643delcBelgian Male ALS Bulbar +51 †53 20 p.Glu643delcBelgian Male ALS 63 †66 p.Glu643delcBelgian Male FTD PPA +70 †73 42 p.Glu643delcBelgian Female FTD bvFTD 69 Alive >99 Functional missense mutations p.Leu94Ser Bulgarian Male ALS Spinal +44 55 >120 Slow disease progression p.Gly121Aspc Spanish Male ALS Spinal 34 39 >60 Slow disease progression p.Arg143Cys German Male FTD bvFTD 45 p.Arg229Ser German Male ALS 47 p.Gly244Val Portuguese Female FTD +ALS Bulbar +41 †43 C9orf72 repeat expansion carrier p.Ile246Thr German Female ALS Bulbar 57 †59 p.Lys291GlucBelgian Male FTD bvFTD +52 †61 p.Ile418Val Portuguese Female FTD bvFTD +53 54 aPresenting diagnosis or symptoms are listed first. bClinical subtype is given where documented. In FTD, the subtypes behavioral variant FTD (bvFTD), primary progressive aphasia (PPA), progressive nonfluent aphasia (PNFA), semantic dementia (SD), and progressive supranuclear palsy (PSP) are specified where documented. In ALS, spinal or bulbar onset is specified where documented. cRefers to mutation carriers identified in the Belgian discovery cohort that were published earlier [Gijselinck et al., 2015; Van Mossevelde et al., 2015]. CBS, corticobasal syndrome; MND, motor neuron disease; LMN, lower motor neuron symptoms; UMN, upper motor neuron symptoms; D, unspecified dementia. +, a positive family history was documented. [Mackenzieet al., 2011].Inaddition, concomitantargyrophilicgrain pathology (AgD) was observed. This was characterized by the presence of hyperphosphorylated tau (AT8) and four-repeat tau-positive grains in amygdala, entorhinal and transentorhinal cortex, CA1 sector of the hippocampus, and cingulum, along with frequent pretangles and neuropil threads, tau-positive oligodendroglial coiled bodies in medial temporal white matter, bush-like astrocytes, and ballooned neurons in amygdala corresponding to stage III according to Saito et al. (2004). Discussion In the pursuit of the missing heritability of the FTD-ALS spectrum, TBK1 haploinsufficiency was recently put forward as a novel disease mechanism. Classical LoF mutations include nonsense and frameshift mutations that lead to mutant transcripts containing a PTC, which are degraded by NMD resulting in a 50% loss of protein. In addition to loss of transcript, several other possibilities can lead to loss–of-protein or protein function. For example, deletions of one or more key amino acids due to small in-frame indels or in-frame exon skipping and missense mutations can affect the catalytic function or the stability of the protein. In the present study, we investigated the full mutation spectrum of TBK1 and its associated phenotypic spectrum in a large study population of 2,538 European FTD and ALS patients. In addition to protein-truncating LoF mutations, the functional effect of in-frame amino acid deletions and missense mutations was further explored in vivo on protein level and in vitro by an NFκB-induced luciferase reporter assay as functional readout for TBK1 activity. In total, we identified 11 index patients carrying a TBK1 protein-truncating mutation (Table 2). Nine mutations were nonsense or frameshift mutations, of which five, (c.86delA (p.Lys29Argfs∗15), p.Val97Phefs∗2, p.Arg127∗, c.1335G>A (p.Trp445∗), p.Thr462Lysfs∗3), are reported here for the first time. Multiple studies have demonstrated that PTC mutations in TBK1 HUMAN MUTATION, Vol. 38, No. 3, 297–309, 2017 305