Remodeling of vascular smoth muscle ion channels involved in purinergic signaling in essential hypertension

PROGRAMA DE DOCTORADO EN INVESTIGACIÓN BIOMÉDICA TESIS DOCTORAL: Presentada por INÉS ÁLVAREZ MIGUEL para optar al grado de Doctora por la Universidad de Valladolid Dirigida por: Dr. José Ramón López López Dra. Mª Teresa Pérez García REMODELING OF VASCULAR SMOOTH MUSCLE ION CHANNELS INVOLVED IN PURINERGIC SIGNALING IN ESSENTIAL HYPERTENSION ABBREVIATIONS INDEX [Ca2+]i Intracellular Ca2+ Concentration Ab Antibody AC Adenylate Cyclase ACE Angiotensin Converter Enzyme ADP Adenosine Diphosphate Ang II Angiotensin II ANO/TMEM16 Anoctamin Family of Ca2+-Activated ClChannels ANP Atrial Natriuretic Peptide AT1 Angiotensin Receptor Type 1 ATP Adenosine Triphosphate BAPTA 1,2-Bis(2-Aminophenoxy)ethane-N,N,N',N'-Tetraacetic Acid BESTs Bestrophin Family of Ca2+-Activated ClChannels BKCa Large-Conductance Ca2+-Activated K+ Channels BPH Blood Pressure High Mice Model BPN Blood Pressure Normal Mice Model BSA Bovine Serum Albumin CaCCs Ca2+-Activated ClChannels CaMKII Ca2+/Calmodulin-Dependent Protein Kinase II cAMP Cyclic Adenosine Monophosphate CFTR Cystic Fibrosis Transmembrane Conductance Regulator cGMP Cyclic Guanosine Monophosphate CGRP Calcitonin Gene-Related Peptide CHO Chinese Hamster Ovary Cell Line ClCa ClChannel Accessory Proteins ClCs Voltage-Gated ClChannels ClICs Intracellular ClChannels Cm Membrane Capacitance CO Cardiac Output CVP Central Venous Pressure DAG Diacylglycerol DIDS 4,4′-Diisothiocyanatostilbene-2,2′-Disulfonic Acid DMSO Dimethyl Sulfoxide DNA Deoxyribonucleic Acid DOCA Deocorticosterone EDHF Endothelium-Derived Hyperpolarizing Factor EGTA Ethylene Glycol-bis(2-Aminoethylether)-N,N,N′,N′-Tetraacetic Acid EJPs Excitatory Junction Potentials eNOS Endothelial Nitric Oxide Synthase E-NTPDase Extracellular Ectonucleotidase Trisphosphate Diphosphohydrolase ER/SR Endoplasmic Reticulum/ Sarcoplasmic Reticulum EX Equilibrium Potential of X Ion GA Glutaraldehyde GABA γ-Aminobutyric Acid GC Guanylyl Cyclase GFP/YFP/RFP Green/Yellow/Red Fluorescent Proteins GPCRs G-Protein Coupled Receptors GSD Ground State Depletion Super-resolution GTP Guanosine Triphosphate ICC Immunocytochemistry Iclamp Current-Clamp IClCa Ca2+-Activated ClCurrent IKCa Intermediate-Conductance Ca2+-Activated K+ Channels IP/coIP Immunoprecipitation/Co-immunoprecipitation IP3 Phosphatidylinositol (3,4,5)-Trisphosphate IP3R Phosphatidylinositol (3,4,5)-Trisphosphate Receptor KATP ATP-Dependent K+ Channels KCa Ca2+-Activated K+ Channels KIR Inward Rectifying K+ Channels KO Knockout Animal Model KV Voltage-Dependent K+ Channels LTCCs L-Type Ca2+ Channels MEA β-Mercaptoethylamine mRNA Messenger Ribonucleic Acid NA Noradrenaline Nif Nifedipine NKCCs Na+, K+, ClCotransporters NO Nitric Oxide OAG 1-Oleoyl-2-Acetyl-sn-Glycerol Pa Mean Arterial Pressure PBS Phosphate Buffered Saline PCR Polymerase Chain Reaction Pd Dyastolic Pressure PFA Paraformaldehyde PGI2 Prostacyclin PHE Phenylephrine PIP2 Phosphatidylinositol 4,5-Biphosphate PiP3K Phosphatidylinositol-4,5-Biphosphate 3-Kinase PKA Protein Kinase A PKC Protein Kinase C PKG Protein Kinase G PLA Proximity Ligation Assay PLC Phospholipase C PP2B Protein Phosphatase 2B/Calcineurin Ps Systolic Pressure PX Permeability of X Ion Pyr3/6/10 Pyrazole3/6/10 Compounds PVAT Perivascular Adipose Tissue qPCR Quantitative PCR Ra Access Resistance RAAS Renin-Angiotensin-Aldosterone System RNA Ribonucleic Acid ROCs Receptor-Operated Channels RP18S Ribosomal Protein 18S RyR Ryanodine Receptor Channels SDS-PAGE Soidum Dodecyl Sulfate Polyacrilamide Gel Electrophoresis SEM Standard Error Of The Mean SERCA Sarcoplasmic Reticulum Ca2+-ATPase Pump SHR Spontaneous Hypertensive Rat Model SKCa Small-Conductance Ca2+-Activated K+ Channels SMDS Smooth Muscle Dissociation Solution SNS Sympathetic Nervous System SOCE Store-Operated Ca2+ Entry SOCs Stretch-Operated Channels STOC Spontaneous Transient Outward Currents SURs Sulphonylurea Receptors TEA Tetraethylammonium TPR Total Peripheral Resistances TRPA Transient Receptor Potential Ankyrin Family of Channels TRPC Transient Receptor Potential Classic Family of Channels TRPCV Transient Receptor Potential Vanilloid Family of Channels TRPM Transient Receptor Potential Melastatin Family of Channels TRPML Transient Receptor Potential Mucolipin Family of Channels TRPP Transient Receptor Potential Polycystin Family of Channels TRPs Transient Receptor Potential Channels UDP Uridine Diphosphate UTP Uridine Triphosphate Vclamp Voltage-Clamp Vm Membrane Potential VOCCs Voltage-Operated Ca2+ Channels VPR Volume Pressure Recording VRACs Volume-Regulated Anion Channels VSM Vascular Smooth Muscle VSMCs Vascular Smooth Muscle Cells αβ-MeATP α,β-Methylene ATP INDEX 1. INTRODUCTION .................................................................................................................-11. The Vascular wall ......................................................................................................... - 1 - 2. Biology of Vascular Smooth Muscle Cells (VSMCs) ...................................................... - 3 - 2.1. Structure of VSMCs .............................................................................................. - 3 - 2.2. Vascular smooth muscle function and regulation ................................................ - 4 - 2.3. Smooth muscle control of vascular tone. ............................................................. - 5 - 3. Hypertension ............................................................................................................... - 9 - 3.1. Etiology of hypertension .................................................................................... - 10 - 3.2. Animal models used to study essential hypertension ........................................ - 10 - 4. Ion channels in VSMCs. .............................................................................................. - 12 - 4.1. K+-channels ......................................................................................................... - 12 - 4.1.1. Voltage-dependent K+ channels (KV) ........................................................... - 13 - 4.1.2. Inward rectifying K+ channels (KIR) .............................................................. - 14 - 4.1.3. Ca2+-activated K+ channels (KCa) .................................................................. - 16 - 4.1.4. K+ channels remodeling in BPH mice .......................................................... - 17 - 4.2. Voltage-operated Ca2+ channels (VOCCs) ........................................................... - 18 - 4.2.1. Classification of VOCCs................................................................................ - 18 - 4.2.2. Structure of VOCCs...................................................................................... - 19 - 4.2.3. Function of L-type and T-type Ca2+ channels in VSMCs .............................. - 19 - 4.2.4. Remodeling of L-type Ca2+ Channels in BPH mice ....................................... - 20 - 4.3. Other channels: Receptor-operated (ROCs) and stretch-operated (SOCs) channels and Cl--conducting channels ...................................................................................... - 21 - 5. Receptor-dependent contraction signaling pathways ............................................... - 22 - 5.1. Adenosine P1 receptors ..................................................................................... - 22 - 5.2. Purine and pyrimidine P2 receptors ................................................................... - 22 - 5.2.1. P2X receptors .............................................................................................. - 23 - 5.2.2. P2Y receptors .............................................................................................. - 23 - 5.3. Role of P2X and P2Y receptors in the control of vascular tone .......................... - 25 - 5.4. Role of purinergic signaling in hypertension ...................................................... - 27 - 6. TRP channels .............................................................................................................. - 29 - - 2 - INTRODUCTION (NA) and other neurotransmitters are released to regulate local contractility and blood flow (Herring and Paterson, 2018). Tunica media In peripheral vessels, the tunica media is located under the adventitia, separated from it by the fenestrated outer elastic lamina (mainly composed by elastin). In arterioles, the tunica media consists of a single layer of smooth muscle cells, while in resistance arteries of larger caliber, cells are arranged in multiple layers organized in spiral form (McGrath et al., 2005). In addition, the tunica media is in close contact with endothelia through myoendothelial gap junctions, providing a functional interaction between both layers (Levy and Pappano, 2007). Tunica intima The tunica intima is separated from the media by a fenestrated inner elastic lamina and is composed by a monolayer of endothelial cells. Endothelial cells play crucial roles in many vascular functions, such as vascular permeability, local vascular control, angiogenesis and homeostasis regulation. Therefore, endothelial dysfunction induces several pathological disorders including hypertension, atherosclerosis, stroke and inflammatory syndromes (Herring and Paterson, 2018). Figure I1. Structure of arterial vascular wall showing tunica adventitia, tunica media and tunica intima with their associated principal cells (adapted from Martinez-Lemus, 2012). - 3 - INTRODUCTION 2. Biology of Vascular Smooth Muscle Cells (VSMCs) The vascular wall is an adapting structure that can respond to mechanical, hemodynamic, and neurohumoral challenges. In this way, there is an active control of tissue blood flow that relies largely on the role of the vascular smooth muscle cells (VSMCs). Owing to their contractile properties, VSMCs are responsible for determining the diameter of resistance vessels, controlling blood flow and contributing to the regulation of blood pressure and vascular tone. 2.1 Structure of VSMCs To carry out their function, VSMCs present several specific structures with different physiological roles: the contractile unit, the sarcoplasmic reticulum, cell junctions and caveolae (Figure I2). Contractile unit The cytosol of VSMCs contains thin actin filaments whose endings are interweaved with thick myosin filaments. Unlike the well aligned sarcomeric structure of cardiac or skeletal myocytes, actin filaments in VSMCs are disposed in a lengthwise way and are anchored to both plasma membrane and cytoplasm through dense bands and dense bodies, respectively. These dense bands and bodies, in turn, are linked by intermediate filaments composed of desmin and vimentin proteins. In addition, dense bands are attached to the extracellular matrix by integrins. Altogether, this cytoskeleton structure allows VSMCs to distribute the contraction force through the entire vascular wall (Aaronson, Ward and Wiener, 2004; Gunst and Zhang, 2008). Furthermore, the contractile unit allows VSMCs to maintain a partial contracted state, giving rise to the physiological basal tone that determines vessel resting diameter. Modulation of such tone upon stimulation leads to vasodilator or vasoconstrictor responses. Sarcoplasmic reticulum (SR) In VSMCs, SR occupies ~2-6% of cell volume and contains high concentrations of Ca2+ (~50 mM). Elements of SR are in close proximity to areas of cell membrane, where several types of ion channels and proteins involved in excitation-contraction coupling have been found (Aaronson, Ward and Wiener, 2004). - 4 - INTRODUCTION Cell junctions and caveolae Plasma membrane of VSMCs presents numerous tiny invaginations or caveolae involved in cell signaling. Moreover, gap junctions connecting adjacent VSMCs allow the transmission of depolarizations between cells, so that VSMCs form a functional syncytium. In addition, myoendothelial junctions allow the transmission of regulatory signals from endothelial to VSMCs and vice versa, providing complex integrated signaling mechanisms to the control of contractility and vascular tone (Herring and Paterson, 2018). Figure I2. Structure of a vascular smooth muscle cell. 2.2. Vascular smooth muscle function and regulation The vascular system plays very important roles in the regulation of the nutrients and oxygen distribution through the entire body. Propelled by the cardiac force, blood flows through arteries, arterioles and capillaries to get to the most distant cells and tissues. Total blood flow (L·min-1) in the cardiovascular system, which is known as cardiac output (CO), represents the blood flow pumped out by the heart. CO depends on the gradient of pressure generated by the heart and on the resistance that the whole vascular system offers to flow. This relationship is known as Darcy´s Law (Herring and Paterson, 2018): 𝐶𝑂=(𝑃 𝑎−𝐶𝑉𝑃) 𝑇𝑃𝑅 Where 𝑃 𝑎 is the mean arterial pressure (mmHg), 𝐶𝑉𝑃 is the central venous pressure and 𝑇𝑃𝑅 is the total peripheral resistance. Since 𝐶𝑉𝑃 is nearly zero, this expression can be simplified to the following equation: 𝐶𝑂=𝑃 𝑎 𝑇𝑃𝑅 - 5 - INTRODUCTION Arterial pressure rises steeply and reaches its maximum with the ventricle ejection. This is called systolic pressure (𝑃𝑠). After that, it gradually declines to a minimum that matches the end of the diastole. This is called diastolic pressure (𝑃𝑑). Since diastole is longer than systole, mean arterial pressure (𝑃 𝑎) can be defined as follows: 𝑃 𝑎=𝑃𝑑+(𝑃𝑠−𝑃𝑑)/3 𝑇𝑃𝑅 is defined as the resistance to laminar flow and following Poiseuille´s Law, which describes the hydraulic resistance of a tube: 𝑅=8𝜂∙𝐿/𝜋𝑟4 Where, 𝑅 is the resistance to a laminar flow of a fluid of 𝜂 viscosity through a tube of 𝐿 length and 𝑟 radius. Although Poiseuille´s Law was deduced from the behaviour of Newtonian fluids with laminar flow in rigid tubes, it properly defines the factors that determine 𝑅 in the circulation, so that it can also be applied with some restrictions to blood vessels. Combining this equation with Darcy´s Law and rearranging terms, ∆𝑃𝑎=𝑄∙8𝜂∙𝐿 𝜋𝑟4 From this equation it is evident that small changes in radius result in big effects on mean arterial pressure, constituting an extremely powerful mechanism by which blood vessels regulate both local blood flow and mean arterial pressure (Herring and Paterson, 2018). Smooth muscle cells in the tunica media are the cells responsible for changes in the vascular radius through their contraction-relaxation capabilities. Since the vascular tone defines the vessel radius, VSMCs finely control both 𝑃 𝑎 and blood flow. 2.3. Smooth muscle control of vascular tone. As mentioned before, vascular tone is defined as the state of contractile tension in the vessel walls, which can be maintained even in the absence of sympathetic innervation. The molecular mechanisms underlying this contractile state are very dependent on the fine control on the membrane potential (Vm) of VSMCs. K+ channels and L-type Ca2+ channels (LTCCs, the most dominant isoforms of voltageoperated Ca2+ channels (VOCCs) in VSMCs) are the main channels participating in this control. K+ channels closing leads to membrane depolarizations, causing LTCCs channels-dependent Ca2+ influx, increase of intracellular calcium concentrations ([Ca2+]i) and vasoconstriction, while opening of K+ channels causes hyperpolarization, LTCCs closing, decrease in [Ca2+]i and vasodilation (Jackson, 2000; Tykocki, Boerman and Jackson, 2017). - 6 - INTRODUCTION Figure I3. Regulation of vascular tone by K+ channels and VOCCs channels. In VSMCs (top), K+ channels-triggered Vm changes regulate VOCCs-mediated Ca2+ influx, causing changes in [Ca2+]i that lead to vasoconstriction or vasodilation (bottom) of vessels, thus regulating basal vascular tone (adapted from Jackson, 2000). In addition to voltage dependent K+ and Ca2+ channels, VSMCs have additional channels involved in the autoregulation of vascular tone. Several members of different K+ channels families, Ca2+-conducting channels, Clchannels, non-selective cation channels and receptor-operated channels (ROCs) expressed in VSMCs have been found to be relevant in this regard (Figure I4). The negative membrane potential of VSMCs (~-50-60 mV) is defined by the intracellular and extracellular [K+], [Na+] and [Cl-] and their relative permeability (~10:4:2, respectively). K+ channels play crucial roles in the control of vascular tone by influencing membrane potential and so the activity of Ca2+ channels. Interestingly, the high [Cl-]i in VSMCs (~30-50 mM) determines an ECl (-26 mV) above the membrane potential, so that activation of chloride channels has a depolarizing effect (Kitamura and Yamazaki, 2001). In the case of ROCs, the main pathway present in VSMCs starts with the activation of a phospholipase-C (PLCβ) dependent of Gq/11 coupled receptors. Membrane PIP2 is cleaved by the phospholipase into IP3 and DAG. IP3 activates its specific IP3R receptor on the SR leading to Ca2+ release to the cytosol (pharmacomechanical coupling). DAG activates ROCs both, directly and through the PKC signaling pathway, leading to membrane depolarization, VOCCs opening and a further increase of [Ca2+]i and contraction. Ca2+ released from the SR can also activate Ca2+-activated channels (K+ and Cl-), finely tuning the changes in Vm - 7 - INTRODUCTION (electromechanical coupling) and therefore the activation of VOCCs, the final level of [Ca2+]i and the magnitude of contraction (Herring and Paterson, 2018). The structure, function and role of K+, Ca2+, Cland ROCs families of channels in the vasculature will be discussed in detail in the next sections. Figure I4. Contribution of vascular smooth muscle channels to electromechanical and pharmacological coupling in VSMCs. Since vascular tone is the key determinant of vessel diameter, it is fine-tuned by intrinsic and extrinsic mechanisms that regulate vessels resistance by inducing the appropriate vasoconstriction or vasodilation. The intrinsic mechanisms are those driven by the vascular wall itself and include smooth muscleand endotheliumderived self-adjusting mechanisms, while extrinsic mechanisms are driven by extravascular mechanisms such as perivascular vasomotor nerves and endocrine factors. Intrinsic control of vascular tone Among the intrinsic mechanisms that regulate vascular basal tone, temperature, myogenic response (defined as the vasoconstriction in response of an increase in the arterial pressure), endothelial-derived molecules (NO, PGI2, endotheliumderived hyperpolarizing factor -EDHF-, and endothelin) and vasoactive autacoids constitute the main ones. NO is synthesized from L-arginine by endothelial nitric oxide synthase (eNOS) and diffuses into smooth muscle where it activates guanylyl cyclase (GC) which in turn catalyzes cyclic guanosine monophosphate (cGMP) production from guanosine triphosphate (GTP). cGMP then activates protein kinase - 8 - INTRODUCTION G (PKG) which reduces [Ca2+]i causing vasodilation. PGI2, produced from arachidonic acid, and EDHF act as potent vasodilators on smooth muscle, while endothelin causes vasoconstriction (Herring and Paterson, 2018). Extrinsic control of vascular tone Extrinsic control of vascular tone is mainly due to the activity of vasomotor nerves and circulating hormones. The sympathetic vasoconstrictor nerves contain many varicosities that release NA, adenosine triphosphate (ATP) and neuropeptide Y. NA and ATP acting mainly through α-adrenergic Gq-protein coupled receptors (GPCRs) and purinergic ionotropic receptors, respectively, promote vasoconstrictor responses (Herring and Paterson, 2018, see below). Likewise, a fall in the sympathetic activity causes vasodilation. In addition, in a limited number of tissues, the resistance arteries are innervated by vasodilator fibers together with the ubiquitous sympathetic vasoconstrictor fibers. These vasodilator fibers can be sympathetic, parasympathetic or sensory fibers (Herring and Paterson, 2018). In this regard, it is well established that cutaneous substance P-containing sensory fibers are associated with blood vessels and are, at least in part, responsible for mediating antidromic phenomena such as vasodilation and plasma extravasation. Stimulation of nociceptive C-fibers causes vasodilation due to the release of substance P and calcitonin gene-related peptide (CGRP), leading to the flare responses to a damage. The stimulation of these fibers leads also to mast cells stimulation and histamine release, which potentiates the flare response by increasing microvascular permeability. This spreading flare, together with the local redness and swelling is an important component of the Lewis triple response (the reaction of skin to a mild trauma). Regarding circulating hormones, the main ones involved in the control of vascular tone are: Adrenaline, Vasopressin, Angiotensin II (Ang II) and atrial natriuretic peptide (ANP). Adrenaline induces vasoconstriction through activation of vascular smooth muscle α-adrenergic receptors (or vasodilation in the skeletal muscle through activation of β-adrenergic receptors); vasopressin, also called antidiuretic hormone, is a potent vasoconstrictor; angiotensin II, produced by the reninangiotensin-aldosterone system (RAAS), acts directly as a vasoconstrictor agent on vascular smooth muscle and indirectly by enhancing sympathetic activity. It also has an extensive cross-talk with endothelial factors, which is crucial for the angiotensin converting enzyme (ACE) signaling pathway. Finally, ANP acts as a potent vasodilator (Herring and Paterson, 2018). - 9 - INTRODUCTION Therefore, a complex system of different intercommunicated signaling mechanisms is constantly activated to regulate the contractility of VSMCs. The failure of this integrated system leads to specific cardiovascular disorders (v.g. heart attack, stroke, hypertension) or contributes to aggravate systemic syndromes such as obesity or diabetes. The relationships between these diseases and vasculature are complex and multifaceted, including changes in the vessels that directly contribute to the progression of the disease, changes that result from disease progression, and even changes that represent compensatory mechanisms (Tykocki, Boerman and Jackson, 2017). 3. Hypertension Hypertension is a multifactorial cardiovascular disorder characterized by a chronic, usually progressive, raise in the arterial mean pressure that if it is not properly treated leads to multi-organ lesions in heart, brain and kidneys. Since individual pressure measurements vary individually, repeated values of Ps and Pd exceeding 140/90 mmHg, respectively, are used to diagnose chronic hypertension (Table I1). Classification Ps (mmHg) Pd (mmHg) Normotension <120 and <80 Elevated 120-129 and <80 Grade 1 hypertension 130-139 or 80-89 Grade 2 hypertension ≥140 or ≥90 Table I1. Classification of adult blood pressure (adapted from Whelton et al., 2018). Hypertension can be divided into essential or primary hypertension, involving 90% of cases, and secondary hypertension, involving the remaining 10%. Essential hypertension is a symptomless, multifactorial genetic disorder, in which inheritance of abnormal genes predisposes an individual to high blood pressure, especially if environmental influences are present, such as salt and alcohol intake, sedentary lifestyle and obesity (Aaronson, Ward and Wiener, 2004). In contrast, secondary hypertension has an identifiable pathologic cause, including hyperaldosteronism and renovascular diseases, which impair volume regulation and activation of reninangiotensin-aldosterone system; pheochromocytoma, which raises pressure through α-adrenoceptor activation; and pre-eclamptic toxemia, which develops during pregnancy (Herring and Paterson, 2018). - 10 - INTRODUCTION 3.1. Etiology of hypertension Arterial pressure rises because of an imbalance between cardiac output (CO) and total peripheral resistances (TPR). In the early stages, hypertension could be associated with a CO increase with normal or slightly raised TPR, but over time CO reverts to normal values while TPR becomes permanently increased. The molecular, functional and structural changes that lead to this chronic elevation of TPR are not fully understood. Several hypothesis including neurogenic induced hypertension through augmented sympathetic innervation, and also reninangiotensin-aldosterone induced hypertension have been suggested (Herring and Paterson, 2018). Due to the crucial roles that vascular ion channels play in the control of vascular tone and contractility through their contribution to set resting Vm, the altered expression and function of these VSM channels may contribute to vascular dysfunction and to the pathogenesis of hypertension. However, it is not clear whether these changes occur as part of the disease progression or as compensatory mechanisms to maintain homeostasis. Although there is a huge knowledge about the contribution of VSM channels to the pathophysiology of hypertension, our understanding of their specific roles in vascular dysfunction remains unclear. Some of the difficulties arise from the lack of specific pharmacological blockers against some channels, the huge macromolecular complexes where these channels interact with a wide range of additional proteins, and the broad heterogeneity between vascular tissues and species. Understanding the specific role of a given ion channel to the pathogenesis of hypertension requires the selection of a suitable animal model and the use of multiple approaches. 3.2. Animal models used to study essential hypertension Due to the complexity of essential hypertension disease, different animal models have been developed to study the molecular mechanisms involved in the hypertension etiology and treatment. These models can be grouped into genetic and non-genetic (Table I2). Genetic models are in turn divided in genotype-driven models, created by gene overexpression (transgenic) or deletion (knockout) to focus in a gene involved in hypertension, and phenotype-driven models, which involve selective breeding of hypertensive strains and their maintenance over generations. The latter models include the spontaneously hypertensive rat (SHR) model, the salt-sensitive Dahl rat model and the blood pressure high (BPH) mouse model (Lerman et al., 2005). Non-genetic models have been broadly used to study the effects of induced hypertension on end-organ damage in different species. These models include: 1) - 11 - INTRODUCTION surgically induced hypertension, such as the hypertensive models developed by unilateral constriction of renal artery (1K1C and 2K1C models); 2) pharmacologically induced hypertension, such as deocorticosterone (DOCA)-salt rat model, Angiotensin IIand other vasoactive peptide-infused models; and 3) environmental-induced hypertensive models, such as salt dietand stress-induced hypertensive models (Lerman et al., 2005). Animal model Pa increase (mmHg) Time to establish (weeks) Hypertension type Genetic Models Genotype-driven Transgenic Variable Variable Essential Phenotype-driven SHR 40-60 4-6 Essential Salt-Dahl rats >30 2 BPH mice >30 birth Non-Genetic Models Surgically-induced 2KIC >50 4 Vascular renal disease 1KIC >70 4 Pharmacologicallyinduced DOCA-salt >20-35 3 Hyperaldosteronism Angiotensin II >40-50 4-10 days Essential NOS inhibitors >5-25 4-6 Essential Environmentallyinduced High salt dietinduced >10 4-5 days Essential Stress-induced 10-20 4-6 months Cold-induced 20-40 3 Table I2. Different experimental animal models to study hypertension (Lerman et al., 2005). BPH mice as a model of essential hypertension Among these possible models to study hypertension and due to the interest of our research group in the study of the pathophysiology of essential hypertension, we chose the BPN/BPH. The phenotype-driven hypertensive (BPH/2J) mouse model of essential hypertension and its normotensive control (BPN/3J) was early developed by crossbreeding of eight different mouse strains showing high and normal blood pressure measured by the tail-cuff method. Early studies using the high blood pressure (BPH) mouse strain also showed increased heart rate and early mortality (Schlager, 1981; Schlager and Sides, 1997), and later studies found a reduction in the NA content in hypothalamus, amygdala and cerebellum (Schlager, Freeman and - 18 - INTRODUCTION VSMCs from BPH mice were significantly more depolarized than BPN VSMCs, there were no changes in the contribution of Kv currents to resting Vm, suggestng that the remodeling of Kv2 currents was an adaptative mechanism to prevent larger vasoconstrictor responses. In adition, we found that VSMCs from BPH mesenteric arteries exhibited a significant decrease in the mRNA expression of KIR2.1, KIR4.1, KIR6.x and SUR2, and a decrease in the current amplitudes mediated by both KIR and KATP channels. The decreased expresion of both channels did contribute to the more depolarized resting Vm of BPH cells, but only the response to KATP channel blockers and activators was impaired when arterial tone was tested. Altogether, our data indicate that changes in KATP channels in resistance arteries could be an important determinant of the hypertensive phenotype in the BPH model (Tajada et al., 2012). 4.2. Voltage-operated Ca2+ channels (VOCCs) Voltage-operated Ca2+ channels (VOCCs) are broadly distributed in many tissues and cells. They transduce membrane depolarization into an increase in [Ca2+]i by activating a Ca2+ influx down its large electrochemical gradient. By increasing [Ca2+]i, VOCCs play important roles in the regulation of contractility, vascular tone and gene expression in VSMCs (Jackson, 2000; Ghosh et al., 2017). 4.2.1. Classification of VOCCs VOCCs were first divided in six different families according to their pharmacology and the electrophysiological characteristics of their currents. L-type Ca2+ currents present relative high voltage of activation (from -40 to -30 mV), high single channel conductance, slow voltage-dependent inactivation and are blocked mainly by dihydropyridines. T-type Ca2+ currents present more negative voltage of activation (from -70 to -60 mV), rapid voltage-inactivation, small single channel conductance and are relatively insensitive to organic Ca2+ blockers. The additional N-, P-, Qand R-type Ca2+ currents, less common in VSMCs, present intermediate currents between Land T-type and are sensitive to the blockade with several toxins, except R-type currents. These different types of currents have been grouped, in turn, into three subfamilies according to the genes encoding the α1-subunit responsible of carrying the currents: 1) the CaV1 subfamily comprising four members (CaV1.1-1.4) and carrying the high-voltage-activated, long lasting L-type Ca2+ currents; 2) the CaV2 subfamily, including channels carrying P/Q-(CaV2.1), N-(CaV2.2) and R-type (CaV2.3) currents; and 3) the CaV3 subfamily including members (CaV3.1-3.3) carrying low-voltage-activated, transient T-type Ca2+ currents (Tykocki, Boerman and Jackson, 2017). - 19 - INTRODUCTION 4.2.2. Structure of VOCCs The general structure of VOCCs consists of a complex of α1, α2, β, γ and δ subunits in such a way that the principal α1-subunit (190 kDa) associates with a disulfidelinked α2δ dimer (170 kDa), an intracellular phosphorylated β-subunit (55 kDa) and a transmembrane γ-subunit (33 kDa) (Figure I9) (Catterall, 2011). The α1-subunit is organized in four repeated motifs (I-IV), each of which containing six transmembrane α-helices (S1-S6) with a loop between S5 and S6 forming the pore. The S4 helix of each motif serves as the voltage sensor and their conformational changes lead to channel opening. The intracellular β-subunit has no transmembrane segments and binds to the intracellular loop between I and II motifs of α1-subunit, while γ-subunit is a glycoprotein with four transmembrane domains and Nand C-termini in the cytosol. The extracellular α2-subunit is attached to the membrane through disulfide linkage to δ-subunit, which is anchored to the membrane through glycophosphatidylinositol. Although α1subunit is sufficient to render channel functionality, α2δ and specially β-subunits enhance the channel expression and confer more physiological gating properties (Catterall, 2011). Figure I9. Structure of L-type Ca2+ channels (LTCCs) showing the pore forming α1-subunit, the intracellular regulatory β-subunit, the extracellular disulfide-linked α2δ dimer and the transmembrane γ-subunit (adapted from Catterall, 2011). 4.2.3. Function of L-type and T-type Ca2+ channels in VSMCs As previously mentioned, L-type Ca2+ channels constitute the dominant VOCC channel expressed in VSMCs cells, although evidences of functional T-type Ca2+ channels have been also reported. The principal role of these channels is their contribution to the regulation of vascular tone by Vm: depolarizations open L-type Ca2+ channels leading to Ca2+ influx, increase in [Ca2+]i and vasoconstriction, whereas hyperpolarization closes these channels, decreases [Ca2+]i and causes - 20 - INTRODUCTION vasodilation. In addition, L-type Ca2+ channels play important roles in the control of myogenic tone and vasomotion (Tykocki, Boerman and Jackson, 2017, see for refrences). Moreover, these channels are regulated not only by changes in Vm but also by additional signaling mechanism, including vasoconstrictorand vasodilatordependent signaling pathways. Several evidences showed a directly Gq/11-induced activation of L-type Ca2+ channels independently of changes in Vm and likely through PKC-induced increase of their open-state probability, thus enhancing the agonists-induced vasoconstriction (Del Valle-Rodríguez, López-Barneo and Ureña, 2003; Ureña, del Valle-Rodríguez and López-Barneo, 2007). On the other hand, both activation and blockade of L-type Ca2+ channels have been reported in the presence of vasodilators. While, cGMP-PKG signaling pathways appears to block Ltype Ca2+ channels contributing to vasodilation, vasodilator-induced cAMP-PKAdependent mechanisms lead to both activation and inhibition of L-type Ca2+ channels (Xiong and Sperelakis, 1995). 4.2.4. Remodeling of L-type Ca2+ Channels in BPH mice Strong evidences support an increased expression and function of CaV1.2 channels in hypertension that contributes to the increased myogenic tone and contractility and to the decreased vasodilator activity, all of which contributing to the increased peripheral vascular resistances. The molecular mechanisms by which hypertensive patients show increased functional expression of LTTCs channels remains unclear, but may be related to an increased trafficking of α-subunit to cell membrane through an increased expression of the modulatory α2δ and β subunits and also through the activation of PiP3K-γ mediated by G12/13-coupled receptors (Bannister et al., 2012; Kharade et al., 2013; Tykocki, Boerman and Jackson, 2017). Using the BPH mouse model, we found a decrease in the global smooth muscle Ca2+ influx due to fewer CaV1.2 channels. However, these CaV1.2 channels were hyperactive in BPH cells, leading to a larger local Ca2+ influx at rest that triggered an increased Ca2+ release from intracellular stores (sparks). Moreover, since BKCa channels from BPH myocytes showed reduced Ca2+ sensitivity, their activation by the increased [Ca2+]i was impaired. The decreased CaV1.2 currents but higher CaV1.2 triggered sparks found in BPH VSMCs have been related to differences in the subunit composition of these channels (Tajada et al., 2013). Our results suggest that changes in the molecular composition of both CaV1.2 and BKCa channels could explain vascular dysfunction during hypertension in BPH mice. - 21 - INTRODUCTION 4.3. Other channels: Receptor-operated (ROCs) and stretch-operated (SOCs) channels and Cl--conducting channels In addition to the important roles that both, K+-conducting channels and voltagedependent Ca2+ channels play to the contribution of membrane potential, vascular tone and contractility, many other families of ion channels have been found to be functionally expressed in VSMCs. In this context, non-selective cation channels and Cl--conducting channels have been the principal families of ion channels widely studied both, in health and disease. Non-selective cation channels comprise several families of agonists-activated and stretch-activated channels which are permeable only to cations (K+, Na+ and Ca2+). Both, the agonist or the stretching stimulus can activate the channel either directly or indirectly. In the direct activation, the channel is the receptor itself, such as the P2X ATP receptors. In contrast, the indirect activation involves a second messenger chain triggered by an agonist-activated receptor. In this context, several GPCR receptors and the transient receptor potential (TRP) channels, which behave as ROCs, are widely expressed in VSMCs and have been found to be involved in the physiopathology of the vascular system. Receptor activation increases [Ca2+]i (see above, section 2.3), and the consequent activation of Ca2+ sensitive channels modulate membrane potential, the activity of VOCCs and the final contractile responses. As described above, KCa channels behave as brakes, hyperpolarizing Vm and limiting VOCCs activation. However, Ca2+ sensitive Clchannels have the opposite effect, producing a membrane depolarization or amplifying in some cases the depolarization induced by ROCs activation, potentiating the activation of VOCCs and generating in some cases action potentials (v.g. in the portal vein). This role of Cl--conducting channels in the VSMCs arises from the fact that these cells present a high [Cl-]i and then, a more depolarized ECl (above membrane potential) compared to other cell types. Thus, activation of Cl--conducting channels results in Clefflux and VSMCs depolarization. Since this Thesis focuses on TRP channels, Ca2+ activated Clchannels and Purinergic signaling in BPN/BPH mice, a more detailed description of the structure, function and action mechanisms of these receptors and channels will be discussed in the following sections. - 22 - INTRODUCTION 5. Receptor-dependent contraction signaling pathways It has been broadly described that the transmitters released from perivascular nerves and also several factors released from endothelial cells dually contribute to vascular tone control. Most of these molecules modulate vascular tone through the activation of both metabotropic and ionotropic receptors (see above, section 2.3). Although several differences in the regulatory mechanisms have been found in different vascular beds and in different species, the purinergic signaling has an important dual role in the control of vascular tone and remodeling. Purine and pyrimidine nucleotides lead to complex integrated responses due to the activation of the nineteen different types of purinergic receptors characterized so far, which are divided in two main families: adenosine P1 and P2 receptors (Burnstock, 1978, 1980). 5.1 Adenosine P1 receptors Adenosine P1 family comprises A1, A2A, A2B and A3 receptors and are coupled to Gi/o (A1 and A3) and to Gαs (A2A and A2B) proteins, leading to a reduced and increased cAMP production, respectively. However, evidences showed A1, A2B and A3 receptors couple also to Gq/11 leading to PLCβ signaling cascade activation. A1 and A3 receptors display a ~49% of sequence identity, while A2A and A2B receptors are ~45% identical. Adenosine receptors present a typical GPCR structure, consisting in an extracellular N-terminus, seven α-helical membrane spanning domains and an intracellular C-terminus. Consensus sites for N-glycosilation and cysteine containing sites are localized in the extracellular loops. An additional cysteine residue localized in the C-terminus of A1, A2B and A3, but not A2A, has been found to be posttranscriptionally modified. Additionally, the intracellular third loop plays an important role in the AC activity and in the receptor internalization (Olah and Stiles, 2000). Besides the differences on species and vascular beds, all adenosine P1 receptors have been found in perivascular nerves, smooth muscle and endothelial cells with A2A and A2B receptors being the most commonly expressed. P1 receptors contribute mostly to vasodilation responses via inhibitory, pre-junctional modulation and also enhancing cAMP-mediated NO production (Burnstock and Ralevic, 2013). 5.2 Purine and pyrimidine P2 receptors Since the first description of the purinergic signaling by Drury and Szent-Györgyi in 1929 and the first definition of purinergic receptors by Burnstock in 1976, several studies have focused on a possible receptor subdivision based on pharmacological - 23 - INTRODUCTION approaches. Purinergic receptor were divided into P1 and P2 families by Burnstock in 1978 and some time later the P2 family was subdivided into ionotropic P2X receptors and G-protein-coupled P2Y receptors (Burnstock and Kennedy, 1985). 5.2.1 P2X receptors P2X receptors comprise P2X1-7 isoforms, all of which having intracellular Nand Ctermini linked by two transmembrane domains (TM1, involved in channel gating; and TM2, lining the ion pore) and a extracellular loop (Brake, Wagenbach and Julius, 1994; Valera et al., 1994; Burnstock, 2007). P2X receptors are ligand-gated channels with variable affinity for ATP and variable conductance for Na+, K+ and Ca2+. P2X activation causes widespread cellular responses depending on their cellular subtype expression and on the homo and/or heteromeric structures they form (P2X2/P2X3, P2X4/P2X6, P2X1/P2X5) (North and Surprenant, 2000). Among P2X receptors, P2X1 is the protein most expressed in smooth muscle, followed by P2X2, P2X4 and P2X7, while P2X3, P2X5 and P2X6 receptors are usually absent. In contrast, all the P2X isoforms have been found in endothelial cells with P2X4 receptors being the dominant protein (Ralevic and Dunn, 2015). 5.2.2 P2Y receptors P2Y family comprises eight isoforms grouped according to their sequence similarity and to their G-protein selectivity (Table I3): P2Y1-like receptors (P2Y1, P2Y2, P2Y4, P2Y6 and P2Y11) present a 28-52% sequence identity and couple mainly with Gq, while P2Y12-like receptors (P2Y12, P2Y13 and P2Y14) share 45-50% sequence identity and couple mainly with Gi/o. However, most of the Gq receptors link also to other Gproteins, such as Gi/0 and G12/13 or Gs (P2Y11) and show a complex cross-talk with other membrane receptors and channels (Erb and Weisman, 2012). The structure of P2Y receptors consists of an extracellular N-terminus, seven transmembrane spanning domains involved in the ligand binding, three intracellular loops involved in the G-protein coupling and an intracellular Cterminus containing several protein kinases binding sites. P2Y receptors are broadly expressed in different tissues and cellular subtypes so that their cellular responses vary based on their ligand specificity, G protein coupling and second messenger system. P2Y1, P2Y2, P2Y4 and P2Y6 receptors are commonly expressed in smooth muscle cells and their coupling to Gq/11 protein leads to PLC-mediated [Ca2+]i increase and contraction. In endothelial cells, P2Y1, P2Y2 and P2Y6 are the most abundant receptors, with some vessels expressing P2Y4, and are related to [Ca2+]i increase and subsequently NO, EDHF and PGI2 coreleasing, leading to vasodilation. However, vasoconstrictor effects mediated by - 24 - INTRODUCTION P2Y receptors expressed in the endothelial cells have been also described when the endothelium is damaged, leading to local vasospasm (Burnstock and Ralevic, 2013) Ligand-stimulated activation of P2Y receptors is rapidly desensitized and proteins internalized due to the GPCR kinases (GRK1-7) mediated phosphorylation of intracellular Ser/Thr residues, which are then targeted by β-arrestins (β-Arr1-4) leading to receptor endocytosis and recycling. Although all P2Y receptors are β-Arr desensitized and internalized, several differences have been found based on the receptor subtype: all P2Y receptors interact with β-Arr2, while P2Y2 and P2Y4 receptors interact with both β-Arr1 and β-Arr2 (Hoffmann et al., 2008). The variabilities in the ligand specificity, in the G-protein coupling and the possibility to form homoor heteromers with P2Y receptors and other proteins lead to a wide variety of P2Y receptor mediated cellular processes, many of them quite relevant in cardiovascular, inflammation and neurotransmission disorders. P2YRs Agonist G proteinMain effector P2Y1 ADP GqPLCβ, Rac, Rho activation P2Y2 UTP=ATP GqPLCβ activation GoPLCβ, Rac activation G12Rho activation P2Y4 UTP=ATP GqPLCβ activation GoPLCβ activation P2Y6 UDP GqPLC activation G12/13Rho activation P2Y11 ATP GqPLCβ activation GsAC activation P2Y12 ADP Gi/oAC inhibition; PLCβ, RhoA activation P2Y13 ADP Gi/oAC inhibition; PLCβ, RhoA activation P2Y14 UDP-Glucose Gi/oAC inhibition; PLCβ activation Table I3. P2Y receptors subtypes, their main agonists and Gprotein coupling. - 25 - INTRODUCTION 5.3 Role of P2X and P2Y receptors in the control of vascular tone Because of the differences found in the expression of purinergic receptors in VSMC and endothelial cells, purinergic signaling can elicit both vasoconstrictor and vasodilator responses. Common to most vessels is that ATP co-released with noradrenaline (NA) from the sympathetic perivascular nerves produces vascular constriction. However, ATP released from endothelium leads to NO and endothelium-derived hyperpolarizing factor (EDHF) production and vasodilation. In addition, UTP and UDP co-released from platelets and damaged endothelial cells lead to vasoconstriction. Obviously, the final response depends on the balance among all these pathways. ATP and NA are separately co-stored in the perivascular nerves varicosities and are released to the adventitia layer as co-transmitters in variable proportions. ATP is released earlier than NA and induces the initial phase of contraction, while NA is responsible of the long-lasting vasoconstrictions (Burnstock and Ralevic, 2013). Although there are evidences of the expression of both P2X and P2Y receptors in vascular smooth muscle, the availability of good pharmacological tools and the development of genetic KO mice have allowed to describe P2X1 receptors as the main mediators of the fast vasoconstrictor response to ATP released from sympathetic perivascular nerves (Vial and Evans, 2002; Burnstock and Ralevic, 2013). In addition, clusters of P2X1 receptors have been found in close proximity to sympathetic nerve varicosities (Hansen et al., 1999). The ATP-triggered P2X1 activation leads to channel opening, increase of Na+, K+ and Ca2+ conductance, membrane depolarization and subsequent VOCCs channels-mediated Ca2+ entry and contraction, whereas NA triggered responses are slower due to the G-protein coupling and second messenger involvement. Furthermore, both pressure and vessel size are important determinants of the magnitude of the purinergic response: P2X1-triggered contractions dominated in small and medium size arteries, whereas the noradrenergic component dominated in large vessels (Gitterman and Evans, 2001). Likewise, the ATP component in the constriction response was significantly reduced at low arterial pressures (Rummery et al., 2007). The rapid smooth muscle depolarizations arising from the actions of neurotransmitters are known as fast excitatory junction potentials (EJPs) and are maintained by the continuously release of ATP quanta, while slow depolarizations have a noradrenergic component (Ralevic and Dunn, 2015). On the other hand, NA acting on α1-adrenergic receptors can promote additional ATP release from smooth muscle cells through pannexin-1 channels (Figure I10), contributing to the integrated complex vasoconstriction response (Billaud et al., 2011). Some of the ATP released can directly act through pre-junctional, inhibitory autoreceptors, such as P2Y receptors and A1 adenosine receptors, the latter after being rapidly - 26 - INTRODUCTION metabolized to adenosine by ectonucleotidase triphosphate diphosphohydrolases (E-NTPDases) of the VSMCs membrane (Kauffenstein et al., 2010) and by soluble ATPases released from the sympathetic nerves (Figure I10) (Burnstock and Ralevic, 2013). Purines released from perivascular nerves can also activate endothelial cells via P2Y and P2X4 receptors, leading to NO, EDHF and PGI2 release, vasodilation and inhibition of platelet aggregation. Furthermore, ATP-triggered ATP release in endothelial cells by shear stress and hypoxia can also activate this vasodilation response in a paracrine way (Figure I10) (Burnstock and Ralevic, 2013). Evidences showed that endothelial dysfunction promotes platelets aggregation and leukocytes accumulation, leading to ATP, ADP and UTP release, which induces local vasospasm through smooth muscle P2Y receptors (Burnstock and Ralevic, 2013). Smooth muscle cells also express P2Y receptors, which are activated by pyrimidine nucleosides and nucleotides. Although several isoforms (P2Y1,2,4,6) have been found in smooth muscle, evidences point to an important contribution of P2Y2 and mainly P2Y6 to the UTPand UDP-triggered vasoconstrictions (Figure I10) (Vial and Evans, 2002; Bar et al., 2008; Koltsova, Maximov, et al., 2009). Of note, P2Y6 involvement in the control of vascular tone has been recently related to its dimerization with AT1 receptors, promoting Ang II-induced hypertension dependent on age (Nishimura et al., 2016). As in the case of ATP, UTP causes vasodilation when acting in endothelial cells through P2Y2 and P2Y4, but not P2Y6 receptors, via EDHF mechanism (Burnstock and Ralevic, 2013). - 27 - INTRODUCTION Figure I10. Summary of the purinergic signaling control of vascular tone. 1, ATP co-released with NA from varicosities enhances EJPs and induces P2X1-mediated depolarization, VOCCs activation, [Ca2+]i increase and vasoconstriction. 2, ATP released is rapidly metabolized by E-NTPDases to adenosine, which has pre-junctional, inhibitory activities via P2Y and A1 autoreceptors. 3, ATP is also released from smooth muscle cells via pannexin1. 4, UDP and UTP contribute to vasoconstriction via G-protein coupled P2Y2,4,6 receptors. 5, ATP acting on P2Y and P2X1,4 receptors in endothelia has vasodilator effects via AC activation of cAMP-triggered NO, EDHF and PGI2 production. 6, ADP, ATP and UTP released from endothelial and platelets cells contributes to endothelia-mediated vasodilation. However, purines and pyrimidines released from aggregating platelets cause P2Xand P2Y-triggered vasoconstriction. 8, ADP, ATP and UTP have inhibitory effects on platelets in a paracrine way. 5.4 Role of purinergic signaling in hypertension Using different in vitro and in vivo models of hypertension, evidences have shown the physiological contribution of different components of the purinergic signaling to the control of vascular tone, rendering purinergic signaling components as new possible therapeutic targets. In this context, several different evidences support a contribution of the purinergic signaling to hypertension development:  Essential hypertension has been associated with an increased sympathetic nerve activity and with hyperplasia and hypertrophy of arterial walls. - 34 - INTRODUCTION channels (Yuan et al., 2009). However, another set of studies failed to demonstrate the TRPC involvement in STIM1/Orai1-triggered SOCE pathway, both in heterologous and native systems (Dehaven et al., 2009). Regarding differences obtained in different cell lines and animal models about the role of TRP channels as SOCE channels and their coupling to STIM1/Orai1 complex, more precise functional studies are required. Therefore, considering TRP family as SOCE channels is still in a controversial debate. 6.3. TRPC channels and hypertension Evidences showed that TRPC3 and TRPC6 channels are the main TRPC members whose dysfunction plays an important role in essential hypertension. Several studies in hypertensive animal models reported a functional increased expression of TRPC3 (Liu et al., 2009; Chen et al., 2010; Noorani, Noel and Marrelli, 2011; Wang et al., 2017) and TRPC6 (Yu et al., 2004; Pulina et al., 2010; Zulian et al., 2010) channels which correlate with enhanced agonists-induced Ca2+ influx and contraction. However, whether this increased expression of TRPC channels is cause or consequence of the hypertension remains unclear. Contrary to what it was expected, TRPC6-/- mice (Dietrich et al., 2005) showed increased vascular tone and increased sensitivity of smooth muscle to vasoconstrictor agonists that resulted in a higher increased mean arterial blood pressure. However, these mice exhibit a clear upregulation of TRPC3 channels that can compensate in different ways the TRPC6 knockout phenotype. TRPC channels also play essential roles in the regulation of myogenic tone, as it was shown by the involvement of TRPC6 channels to the pressure-induced depolarization in cerebral arteries (Welsh et al., 2002). Moreover, increased coupling between TRPC3 and TRPC6 channels with additional proteins, such as other TRP channels, IP3R receptors (Adebiyi et al., 2010, 2012), Ca2+-activated Clchannels (Wang et al., 2016) and many others, enhanced Ca2+ influx, contraction and subsequently blood pressure, while the coupling with serine-threonine kinase WNK4 reduced TRPC3triggered Ca2+ entry (Woo et al., 2011). Therefore, changes in the functional expression of some subtypes of TRPC channels could influence the mechanisms by which VSMCs control vascular tone and contractility, thus promoting vascular dysfunction and increased blood pressure, leading to hypertension. The development of selective pharmacological blockers of TRPC channels could present a potential strategy to prevent and treat essential hypertension (Earley and Brayden, 2015). - 35 - INTRODUCTION 7. Chloride channels In contrast to ions like Na+ and K+, in many cell types the electrochemical gradient of Cl− across the plasma membrane is close to its electrochemical equilibrium, which is expected from a passive distribution across the plasma membrane. However, within VSMCs, the ECl is normally at a potential more positive than the resting Vm because of active Cl− accumulation. Hence, opening of Cl− channels in the plasma membrane causes Cl− efflux, membrane depolarization, and increased contractile force. VSM Cl− transporters and Cl− channels significantly contribute to the physiological regulation of vascular tone and arterial blood pressure, so that changes in their expression and activity could contribute to vascular pathophysiology. 7.1 Classification and structure of Clchannels Clchannels are structurally very heterogeneous and no official classification exists. Therefore, following the International Union of Basic and Clinic Pharmacology (IUPHAR) Guides (Alexander et al., 2017), there have been described up to five different families:  Voltage-gated Clchannels (ClC1-7, ClCKa and ClCKb). ClC1, ClC2 and the two ClCk isoforms are expressed in the plasma membrane. The rest are expressed in endomembranes and behave as Cl-/H+ exchangers. ClCs are mainly involved in cell excitability, transepithelial transport, extracellular ion homeostasis, endocytosis and lysosomal function (Jentsch, 2015; Poroca, Pelis and Chappe, 2017).  Cystic fibrosis transmembrane conductance regulator (CFTR). This channel is a membrane ATP-gated Clchannel involved in the transepithelial transport of water and electrolyte whose dysfunction leads to cystic fibrosis (Linsdell, 2014).  Volume-regulated anion (VRAC) channels. This family of Clchannels participates in the decrease of cell volume upon swelling stimuli by conducting Clefflux. They also participate in membrane excitability, transcellular Cltransport, angiogenesis, cell proliferation and so many other cell functions (Nilius and Droogmans, 2003).  Large conductance (maxi) Clchannels. This maxi-anion channel, which is widely expressed in many tissues, is activated by swelling stimuli and it has been involved in the control of membrane potential, secretion and cell - 36 - INTRODUCTION volume regulation. Additionally, due to its ability to release small amounts of ATP and glutamate molecules, it has been associated to signal transduction between cells (Sabirov and Okada, 2009).  Ca2+-activated Clchannels (CaCC). This family comprises the anoctamin (ANO1-10) and bestrophin (BEST1-4) subfamilies. These subfamilies have been well characterized and are involved in numerous cellular functions, including transepithelial transport, control of neuronal and cardiac excitability and regulation of smooth muscle contraction (Matchkov, Boedtkjer and Aalkjaer, 2015). Their structure, vascular function and involvement in hypertension will be discussed in the next sections. These families of Clchannels have been found to be widely expressed in the plasma cell membrane in many tissues, in intracellular membranes and in the cytosol together with an additional family of intracellular Clchannels (ClIC1-4). This family comprises both soluble and integral membrane isoforms and are likely to have enzymatic and intracellular membrane structural functions (Edwards and Kahl, 2010; Littler Dene et al., 2010). 7.2 CaCCs channels 7.2.1 Bestrophins BEST channels have been found to form dimers, tetramers and pentamers. Each single protomer comprises four short transmembrane α-helices (TM1-4) and a long intracellular domain formed by five α-helices together with the C-terminus. Nand C-termini are localized in the cytosol, the latter likely involved in Ca2+ regulation (Figure I15 A). When pentamerizing, an hydrophilic single pore formed by TM2 domain is followed by an hydrophobic neck involved in the channel gating (Yang et al., 2014). BEST channels are permeable to NO3->Br->Cland permeability to SCN-, HCO3-, GABA and even glutamate has also been reported (Dickson, Pedi and Long, 2014). Of special interest is the BEST3 channel due to its expression in VSMCs from different vascular tissues and its role in the membrane potential regulation by coupling intracellular Ca2+ and NO/cGMP pathways through Cloutward currents (Matchkov et al., 2008). 7.2.2 Anoctamins Anoctamin family (ANO or also TMEM16) comprises ten different members, most of them behaving as Ca2+-dependent phospholipid scramblases. However, ANO1/TMEM16A and ANO2/TMEM16B are bona-fide Ca2+-activated Clchannels - 37 - INTRODUCTION (CaCCs) (Whitlock and Hartzell, 2017). These CaCCs are formed by eight transmembrane domains with Nand C-termini in the cytosol. The N-terminus presents several calmodulin binding and dimerization motifs, while the C-terminus presents a highly conserved region of unknown functions called Anoctamin domain. Differences in the transmembrane domains linking loops have been proposed: the TM5-TM6 long extracellular loop which reenters the membrane early described has been questioned and replaced by another model proposing a long intracellular loop which also reenters the membrane between TM6-TM7 (Figure I15 B). In any case, this loop have been proposed as the direct Ca2+ sensor of the channel (Pedemonte and Galietta, 2014). ANO1 (TMEM16A) and ANO2 (TMEM16B) appear as closely related members belonging to the same subfamily, while ANO3,4,9 (TMEM16C,D,J) and ANO5,6 (TMEM16E,F) form two separated subgroups, and ANO7,8,10 (TMEM16G,H,K) are distant paralogs of ANO1 (Pedemonte and Galietta, 2014). Evidences showed that ANO channels are activated not only by cytosolic Ca2+, but also by membrane potential in a positive feedback way. More precisely, membrane depolarization enhanced Ca2+ sensitivity of the channels. Figure I15. Structures of BEST and ANO subfamilies of CaCC channels. A, structure of BEST protomer (left) and the outside membrane view (right) of the pentamer form (from Yang et al., 2014). B, structure of ANO1 channel based on the more recently proposed model (adapted from Pedemonte and Galietta, 2014). - 38 - INTRODUCTION 7.3 CaCCs and NKCC cotransporters in vasculature In addition to the important role of VOCCs on the depolarization-triggered Ca2+ entry and contraction of VSMCs, Clconductance through VSMCs have been widely explored, although little is still known. As mentioned above, [Cl-]i (~50 mM) and Clconductance in VSMCs are larger compared to other cells, such as skeletal and cardiac muscle cells. Intracellular Claccumulation is due in part, but not exclusively, to the activity of the sole isoform of cation-Cl--cotransporter found in VSMCs, the Na+/K+/2Cl--cotransporter NKCC1. The equilibrium potential for Clin VSMCs cells (~-26 mV) is less negative than their resting potential but is high enough to activate VOCCs and high enough to block spontaneously generated actions potentials in excitable cells. Many studies showed the role of Clconductance activated upon agonists stimulation in the smooth muscle contraction response, however, the exact mechanisms still remain unknown (Kitamura and Yamazaki, 2001). Both BEST and ANO families of CaCCs have shown to be expressed in vascular vessels, however, their relative contribution to agonists-triggered contraction are different. It has been shown that BEST downregulation has no effect on NA-induced vasoconstriction, suggesting their sole contribution to membrane potential, while downregulation and pharmacological inhibition of ANO1 abolished vasoconstrictor responses (Matchkov, Boedtkjer and Aalkjaer, 2015). Therefore, ANO family, and mainly ANO1 channel, have been the focus of the more recently studies about CaCCs in the vasculature and its associated disorders. Upon agonist-dependent stimulation, Ca2+ released from the intracellular stores activates Clefflux (IClCa) through ANO1 channels, contributing to membrane depolarization, LTTCs-triggered Ca2+ influx and further [Ca2+]i increase. In addition, ANO1 channels also influenced the stretch-activated Ca2+ influx, which is crucial for the myogenic tone response (Bulley et al., 2012). Moreover, the role of ANO1 channels is largely influenced by phosphorylation mechanisms involving Ca2+- dependent kinases and phosphatases, such as CaMKII and calcineurin, respectively, confirming the importance of the amplitude and kinetics of intracellular Ca2+ transients to ANO1 functions (Pedemonte and Galietta, 2014). However, it is not clear if a direct phosphorylation of ANO channels leads to IClCa or an additional regulatory subunit is involved. In this context, ClChannel Accessory (ClCa) family of proteins, such as ClCa1 and ClCa2, has been found to influence the Ca2+-dependent ANO1 activation. ClCa1, described in mammals as a secreted metalloprotease, have been found to enhance ANO1-dependent IClCa by directly engaging and stabilizing dimeric ANO1 proteins at the membrane surface without increasing its expression (Sala-Rabanal et al., 2015). In contrast, ClCa2 protein, which was found to be anchored to the plasma membrane through C-terminus, directly interacted with - 39 - INTRODUCTION STIM1/Orai1 complex, enhancing SOCE-activated ANO1-dependent IClCa (Sharma et al., 2018). Another protein-protein interaction involving ANO1 channels was found for TRPC6 channels in cerebral arteries (Wang et al., 2016). In this study, TRPC6 and ANO1 channels were found in close spatial proximity at the plasma membrane and agonist-induced TRPC6 activation lead to local Ca2+ signals that activated ANO1triggered IClCa and vasoconstriction. For NKCC1 cotransporter, its main roles in vascular physiology are related to [Cl-]i regulation. By controlling [Cl-]i/[Cl-]o ratio, NKCC1 cotransporter regulates Vm and excitation-contraction coupling. Indeed, NKCC1 blockade attenuated basal tone, myogenic tone and agonists-induced vasoconstriction through Cl--dependent hyperpolarization and suppression of VOCCs activity (Orlov et al., 2015). These NKCC1-dependent vascular functions were also confirmed using NKCC1-/- KO mice, suggesting the important role of this cotransporter in the vasculature (Koltsova, Kotelevtsev, et al., 2009; Koltsova, Maximov, et al., 2009). In endothelial cells, IClCa contributes to cell volume and membrane potential. However, little is known about the endothelial [Cl-]i. Thus, the hyperor depolarizing effects of endothelial-triggered IClCa in the intact vascular wall remains unclear (Matchkov, Boedtkjer and Aalkjaer, 2015). 7.4 Role of ANO1 channels and NKCC1 cotransporter in hypertension Regarding the role of IClCa for vascular tone and contractility, several studies have identified some CaCCs, namely ANO1 channels, as potential targets to the treatment of hypertension, although the available data are contradictory. ANO1 upregulation has been characterized and correlated to increases in blood pressure in two different rat models of pulmonary hypertension (Leblanc et al., 2015), as well as in spontaneous hypertension (B. Wang et al., 2015). On the other hand, hypertension-associated downregulation of ANO1 channels due to an increase in the activity of CaMKII was also reported (Wang et al., 2012). Finally, in a mouse model with smooth muscle-specific ANO1 KO, arterial blood pressure was decreased and the development of Ang II-induced chronic hypertension was less severe (Heinze et al., 2014). The role of NKCC cotransporters in the pathogenesis of hypertension have been differentiated according to primary and secondary hypertension. NKCC1 cotransporter plays an important role in the physiopathology of primary hypertension since is the only isoform expressed in VSMCs, and several mechanisms underlying its role have been proposed. In SHR rats model, both NKCC1 mRNA and protein levels were increased, which involved the NKCC1dependent [Cl-]i regulation, affecting VSMCs contraction and SNS activity. Indeed, - 40 - INTRODUCTION bumetanide-induced NKCC1 blockade on α-adrenergic-dependent vasoconstriction were higher compared to normotensive controls (Lee et al., 2010). Moreover, the higher mRNA and proteins levels also observed in paraventricular nucleus of SHR rats correlated with the higher [Cl-]i found in these neurons, resulting in a decreased activity of GABAergic neurons in SHR, compared to controls (Ye et al., 2012). Studies focused on epigenetic regulation of NKCC1 in SHR model concluded that hypomethylation of NKCC1 promoter resulted in its augmented expression and subsequently augmented [Cl-]i, membrane depolarization and contraction, leading to blood pressure increase (Lee et al., 2010). Moreover, increased activity of NKCC1 cotransporter was also observed in erythrocytes from SHR rats and hypertensive patients, contributing to the long-term increase of blood-pressure. On the other hand, studies performed in NKCC1-/- KO mice revealed a significant decreased in the blood pressure of these animals (Meyer et al., 2002). - 41 - INTRODUCTION 8. Hypothesis of study. Our group has been exploring the contribution of different VSM ion channels to the molecular mechanisms involved in the physiopathology of essential hypertension. Using a genetic, phenotype-driven mouse model of essential hypertension (BPH and their BPN control mice), the functional expression of different families of channels, including K+ channels and VOCCs, and their contribution to the hypertensive phenotype have been widely explored. However, the contribution of many other families of receptors and ion channels, such as ROCs and SOCs channels are still unknown. This Thesis aims to explore the role of some ROCs and some GPCR, specifically TRPC channels and P2Y receptors in the genesis of the hypertensive phenotype in BPN/BPH model of essential hypertension. Since sympathetic nerve activity is increased in this model (see section 3.2), we hypothesize that changes in the activation of the purinergic signaling pathway could be directly contributing to changes in the resting membrane potential and Ca2+ influx in VSMCs, leading to [Ca2+]i increase and promoting the subsequent increased vascular tone and contractility, characteristic of hypertension. The differences between of BPN and BPH in the purinergic response may be the result of changes in the purinergic receptors and/or may be generated by differences in the expression or/and functional activity of TRPC and Ca2+ activated Clchannels, working downstream in the signaling pathway and fine-tuning the changes in Vm that activate VOCCs opening and vascular contraction. Figure I16. Scheme of the hypothesis of the purinergic signaling contribution to essential hypertension. - 50 - MATHERIAL AND METHODS deflated, the VPR cuff sensor measures the tail swelling. Systolic blood pressure (Ps) corresponds to the first appearance of tail swelling, while diastolic blood pressure (Pd) is calculated from the rate of tail swelling, and both are identified as the first and second inflections, respectively, of the recording line in the real-time blood pressure graph (Krege et al., 1995; Wang, Thatcher and Cassis, 2017). Mice were acclimated to 32-35°C during 15 min prior to data acquisition. Sessions of recorded measurements were carried out daily during 4-6 consecutive days at the same time. Each session consisted of a total of 40 cycles of inflating steps to a maximum occlusion pressure of 250 mmHg followed by deflating steps of 15 s. The first 5 cycles were used for acclimation and were not included for the analysis. Values of 15 μL were fixed as the minimum tail volume for data acquisition. Mice were first trained at least 2 days prior to data acquisition, as we found that this was enough to ensure extreme reliable and reproducible measurements from session to session. Figure M1. CODA® High Throughput Noninvasive Blood Pressure system 3. Animals surgery BPN and BPH mice ranging from 16 to 58 weeks old (average 36.2 ± 2.4 weeks for BPN and 34.6 ± 1.7 weeks for BPH) and weighing 29.33 ± 0.23 g for BPN and 24.37 ± 0.24 g for BPH (n=69-80, P<0.001) were anesthetized by isoflurane inhalation (5% O2 at 2.5 Lmin-1) and sacrificed by cervical dislocation. Mesenteric arteries were obtained as described previously (Moreno-Domínguez et al., 2009). Briefly, a laparotomy was performed to obtain the small intestine, which was placed in a Sylgard®-coated plate filled with ice cold (4°C) oxygenated (95% O2-5% CO2) smooth muscle dissociation solution (SMDS)- 10μM Ca2+ (Table M1). - 51 - MATHERIAL AND METHODS Composition SMDS (mM) SMDS 10 μm Ca2+ (mM) NaCl 120 120 KCl 4.2 4.2 NaCHO3 25 25 KH2PO4 0.6 0.6 MgCl2·6H2O 1.2 1.2 Glucose 11 11 CaCl2 - 0.010 pH 7.4 Table M1. Smooth muscle dissociation solution. Subsequently, arteries were cleaned of connective and adipose tissues under a dissecting microscope. The characteristic V-shaped intersection of arteries was taken into account to distinguish them from the veins (Figure M2). 2nd and 3rd order mesenteric arteries were collected and processed in different ways: 1) Frozen at -80°C for further RNA extraction, 2) used directly for myography studies and 3) used to obtain freshly isolated VSMCs. Figure M2. V-and U-shaped intersection of artery and vein. 4. RNA isolation and real-time PCR To explore the mRNA expression pattern of receptors and channels, real-time PCR was performed in mesenteric arteries from BPN and BPH mice. The protocols used consist of several consecutive steps: - 52 - MATHERIAL AND METHODS a) RNA samples homogeneization and isolation Total RNA isolation was carried out using the TRIzol® Reagent (Ambion, Life Technologies Corporation) and the Precellys® (Bertin Instruments, France) homogenization methods followed by the PureLink® DNase treatment (Ambion, Life Technologies Corporation), following the manufacturer´s instructions (Figure M3). Briefly, 2nd and 3rd mesenteric arteries from 4-5 mice were denuded of endothelial layer by scraping with a pipette tip and cut in fragments less than 3 mm length. Then, samples were homogenized in TRIzol® Reagent using the CK14 and CK28 Precellys® kit, which consists of tubes containing two sizes of ceramic beads designed for hard tissue homogenization, and a Precellys® tissue homogenizer. By adding chloroform, RNA was then separated in an aqueous layer and precipitated using isopropanol. After washing twice, PureLink® DNase treatment (Ambion, Life Technologies Corporation) was carried out following the manufacturer´s instructions. Finally, RNA was stored at -80°C or used within the day to check the RNA purity and integrity. Figure M3. Total RNA isolation scheme. b) RNA quantification To obtain high efficiency and purity in RNA during the isolation step, many factors, such as the type of tissue, sample handling during surgery, extraction and storage, have to be considered. To check the correctness of these procedures, the quality of the purified RNA was confirmed both by agarose gel electrophoresis and by measuring the absorbance using a spectrophotometer (NanoDrop ND-1000, Thermo Scientific). The equation of Beer-Lambert correlates absorbance to concentration as following: - 53 - MATHERIAL AND METHODS 𝐴=𝐸∙𝑏∙𝑐 Where, 𝐴 is the measured absorbance (or optical density, OD, in absorbance units A), 𝐸 is the molar extinction coefficient (in M-1 ·cm-1), 𝑏 is the sample thickness (in cm) and 𝑐 is the analyte concentration (mol·L-1). When measuring nucleic acids concentration, this equation is rearranged to: 𝑐=𝐴∙𝑒 𝑏 Where 𝑐 is the nucleic acid concentration (in ng·μL-1), 𝐴 is the absorbance (in absorbance units, A), 𝑒 is the molar extinction coefficient (in ng·cm·μL-1) and 𝑏 is the sample lenght (in cm). Values of optical density ratio A260/280>2 are generally accepted as “pure RNA”, while ratio values less than 2 are indicative of contamination. Finally, quantified RNA was treated with RNAse-Free DNAse I (Ambion) to remove possible genomic DNA contamination from the samples. c) Reverse transcription The reverse transcription reaction was used to obtain cDNA (RT+) from purified RNA samples using the reverse transcriptase enzyme MuLvRT, allowing more stable samples to be obtained. With MuLvRt enzyme, a complementary cDNA strand of a single-stranded RNA template is created using the reaction mix described in table M2 (in PCR buffer): Composition RT+ Reaction mix RTReaction mix Purified RNA 500-700 ng 200-350 ng Random hexamers 2.5 μM 2.5 μM MgCl2 5 mM 5 mM dNTPs 4 mM 4 mM RNAse inhibitor 1 u μL-1 MuLvRT 2.5 u μL-1 Table M2. Reaction mix for experiment (RT+) and genomic control (RT-) conditions. The final volume of the reaction was 80 µl for the RT+ and 20µl for RTThe reaction mixture was subjected to the following temperature-controlled reverse transcription cycle (Figure M4): 10 min at 25°C, 60 min at 42°C, and finally 5 min at 99°C. The amplified cDNA (RT+) was immediately stored at -20°C. - 54 - MATHERIAL AND METHODS Figure M4. cDNA synthesis protocol working scheme d) Amplification by real-time PCR Gene relative expression was explored by real-time PCR using the TaqMan Assay (Applied Biosystems, Life Technologies), which is based on the 5´ nuclease activity of the Taq polymerase on a fluorogenic-labeled probe (Figure M5). This TaqMan probe is constructed with a fluorescent dye and a quencher, both bound to the 5´ and 3´ ends, respectively. While the probe is intact, the quencher reduces the fluorescence emitted by the dye by fluorescence resonance energy transfer. When the probe anneals to the target DNA and the 5´ nuclease activity of Taq polymerase cleaves the reporter dye, the emitted fluorescence increases. This fluorescence intensity is proportional to the amount of target DNA accumulated during PCR reaction. Figure M5. TaqMan probe action mechanism. The previously obtained cDNAs were processed at the Genomic Service of the Parque Científico de Madrid (Spain) using TaqMan Low Density Arrays (TLDA, Applied Biosystems, Life Technologies Corporation). The selected receptor and ion channels genes to explore are described in Table M3. The array also included an endogenous control gene (18S rRNA) to correct for the amount of cDNA, and a - 55 - MATHERIAL AND METHODS smooth muscle marker (calponin) and an endothelial cell marker (eNOS), to check the purity of smooth muscle tissue. Gen name Protein Applied Biosystems identification number P2rx1 P2RX1 Mm00435460_m1 P2rx4 P2RX4 Mm00501787_m1 P2ry1 P2RY1 Mm02619947_s1 P2ry2 P2RY2 Mm00435472_m1 P2ry2s1 P2RY2 Mm02619978_s1 P2ry4 P2RY4 Mm00445136_s1 P2ry6 P2RY6 Mm01275473_m1 P2ry6s1 P2RY6 Mm02620937_s1 Trpc1 TRPC1 Mm00441975_m1 Trpc2 TRPC2 Mm00441984_m1 Trpc3 TRPC3 Mm00444690_m1 Trpc4 TRPC4 Mm00444284_m1 Trpc6 TRPC6 Mm01176083_m1 Trpc7 TRPC7 Mm00442606_m1 Clca1 CLCA1 Mm01320697_m1 Clca2 CLCA2 Mm00724513_m1 Clcn3 CLCN3 Mm01348786_m1 Slc12a2 NKCC1 Mm01265951_m1 Tmem16a TMEM16A/ANO1 Mm00724407_m1 Cnn1 (Calponin 1, smooth muscle) CNN1 Mm00487032_m1 Gapdh (Glyceraldehide-3P-dehydrogenase) GAPDH Mm99999915_g1 Nos3 (Nitric oxide synthase 3, endothelial) NOS3 Mm00435217_m1 Gus (β-glucuronidase) Gus ** Table M3. Genes whose relative expression was explored using TLDA assay. ** Probes designed in our laboratory. - 56 - MATHERIAL AND METHODS A small fraction of cDNAs were used to explore gene expression using TaqMan probes designed in our laboratory in a Rotor-Gene RG3000 (Corbett Life Science, Quiagen) and the results were then compared to those obtained using TLDA arrays. The designed primer sets and TaqMan probes were: mGAPDH Primer 5´-3´ Primer 3´-5´ 5’‐TGTGTCCGTCGTGGATCTG‐3’ 5’‐ GATGCCTGCTTCACCACCTT‐3 TaqMan probe 5’‐FAM‐TGGAGAAACCTGCCAAGTATGATGACATCA‐BHQ2‐3 mGus Primer 5´-3´ Primer 3´-5´ 5’‐CAATGGTACCGGCAGCC‐3’ 5’‐AAGCTAGAAGGGACAGGCATGT‐3’ TaqMan probe 5’‐FAM‐TACGGGAGTCGGGCCCAGTCTTG‐BHQ2‐3 RPL18 Primer 5´-3´ Primer 3´-5´ 5’‐CAATGGTACCGGCAGCC‐3’ 5’‐AAGCTAGAAGGGACAGGCATGT‐3’ TaqMan probe 5’‐FAM‐TACGGGAGTCGGGCCCAGTCTTG‐BHQ2‐3 Amplifications were performed in a total volume of 20 μL, using 10 μL of Absolute qPCR mix (ABgene, Thermo Fisher Scientific Inc.), 1 μL of each forward and reverse primers, 1 μL of probe and 1 μL of cDNA. The reaction conditions used were as indicated in Figure M6. Figure M6. Amplification protocol. e) Relative quantification and quality control For the analysis of the TaqMan assay, a cycle threshold (Ct) for each curve is determined. At the beginning of the qPCR reaction, a basal unspecific fluorescence is detected. Setting a threshold over this background signal within the exponential phase of the amplification curve provides Ct, or the cycle number at which the emitted fluorescence surpasses (cuts) the threshold (Figure M7). Ct is defined as - 57 - MATHERIAL AND METHODS the number of cycles required to produce a significant fluorescence increase compared to the baseline signal, and it is inversely proportional to the initial amount of cDNA. Figure M7. Example of qPCR amplification plots for the endogenous control RPL18 with serial dilution of a sample, providing a different starting number of cDNA copies. Fluorescence is plotted in a log scale and the threshold value can be manually adjusted. Data analysis was performed using the relative quantification method (Livak and Schmittgen, 2001), known as fold-increase method or 2-Ct, based on the comparison of the Ct values of different genes normalized to those of the endogenous controls (Housekeeping genes), such as rRNA 18S and Gapdh. ∆𝐶𝑡= 𝐶𝑡,𝑐ℎ𝑎𝑛𝑛𝑒𝑙 − 𝐶𝑡,𝑐𝑜𝑛𝑡𝑟𝑜𝑙 In order to perform this normalization, the efficiency of the amplification of both, the experimental gene and the endogenous control must be close to 1 and differ less than 10%. An efficiency of 1 means that the amount of DNA template doubles in each cycle. To determine the efficiency of the reaction, we performed a PCR with serial dilutions of one sample and obtained the Ct value for each dilution. Representing Ct against the number of copies of each dilution, we can fit a line to these data and calculate its slope (Figures M7 and M8). From this slope, we obtain efficiency as described in figure M8. The expression TLDA assays used were validated by the manufacturer. According to their specifications, the efficiency of the amplification reactions for all genes was 1, and differed by less than 10%. Figure M8. An example of a standard curve showing the threshold cycle (Ct) on the y-axis and the starting quantity of cDNA target on the x-axis. Slope value is used to calculate the efficiency of the reaction as indicated in the equation. Gene studied was Gapdh. - 58 - MATHERIAL AND METHODS After obtaining for each gene its relative expression (∆𝐶𝑡 value) in preparations, (BPN and BPH tissues) we compared them to get ∆∆𝐶𝑡 with the following equation: ∆∆𝐶𝑡= ∆𝐶𝑡,𝑠𝑎𝑚𝑝𝑙𝑒 − ∆𝐶𝑡,𝑐𝑎𝑙𝑖𝑏𝑟𝑎𝑡𝑜𝑟 Where the sample represents the experimental tissue (BPH) and the calibrator is the control tissue (BPN). With this quantification method, we define a calibrator (in our case BPN tissue) and we determine the changes in our “problem” preparation (the BPH samples) as fold increase or fold decrease with respect to the expression values of the calibrator. To represent these values, we used the logarithm of 2-Ct. Hence, a value of 0 means that there is no change in expression; whilst positive values indicate a higher expression in BPH and negative values indicate a higher expression in BPN tissue. For statistical comparisons, the ∆𝐶𝑡 obtained in each sample (∆𝐶𝑡,𝑐ℎ𝑎𝑛𝑛𝑒𝑙 − ∆𝐶𝑡,𝑐𝑜𝑛𝑡𝑟𝑜𝑙) were subtracted from the mean ∆𝐶𝑡 of the calibrator to provide S.E.M. Each data point was obtained from duplicate determinations from at least three different assays. In the cases where gene expression was not detected in one of the conditions, a 𝐶𝑡 value of 40 was used in order to do the comparisons. 5. Pressure Myography 5.1. Pressure Myography fundaments Pressure Myography is a technique that allows studying the pathophysiological properties and functions of vascular vessels in vitro. By cannulating a small segment of a vessel, pressure myography simulates the physiological conditions of temperature, pH and intraluminal pressure of in vivo vessels. Designing different protocols, this system allows investigation of myogenic tone, of effects of endothelial secretions or the pharmacological effects on vasoconstrictor and vasodilator responses to different drugs and stimuli. Although the pressure myography mounting procedure could stress the vascular tissue, the vessels still retain many of their in vivo characteristics, which allow extrapolating the results to the in vivo behavior of the entire vascular bed. In this study, the pressure myography technique has been applied to investigate the role of different molecular components of the VSMCs membrane to the vascular tone. Using pharmacological approaches, vascular responses of mouse mesenteric arteries were investigated under near physiological conditions. Both - 59 - MATHERIAL AND METHODS constriction and dilation could be readily measured as changes in the vessel´s diameter via digital video-edge detection. 5.2. Pressure Myography System The pressure myograph system (Danish Myo Technology, Aarhus, Denmark) used to study the functional responses of mesenteric arteries consists of several parts: myography pressure unit, pressure regulator interface, vacuum system, DMT microscope and DMT Software (Figure M9). Figure M9. Scheme of the complete Pressure Myograph System (Model 111P). 5.2.1. Myography pressure unit The pressure myography unit contains a bath chamber with two removable glass pipettes with a tip of 0.5 mm. Each pipette is connected to a pressure transducer (P1 and P2 in figure M10) that generates an electrical signal as a function of the pressure imposed by the liquid inside each pipette, based on a Wheatstone bridge circuit. The intraluminal liquid pressure is generated by the external pressure regulator interface connected to the perfusion inlet and outlet of the pressure unit. In addition, the force transducer coupled to the outlet pipette senses changes in the longitudinal force. Finally, the myo chamber cover includes ports for - 66 - MATHERIAL AND METHODS In this study, coIP assays were performed using agarose GFP-Trap_A beads (Chromotek, Planegg-Martinsried, Germany) that recognized the YFP of the hTRPC3-YFP fusion protein (see CHO cell line section). For the immunoblotting assays, the primary antibodies used were rabbit anti-TRPC3 (4.5 μg·ml-1) or rabbit anti-TRPC6 (4.5 μg·ml-1), and the secondary antibody used was horseradish peroxidase-conjugated anti-rabbit (dilution 1:20000). 7.2.1. CoIP procedure CoIP assays were performed in CHO cells transfected with hTRPC3-YFP and TRPC6 plasmids, alone or in combination, using agarose GFP-Trap_A beads following the manufacturer’s instructions (Chromotek, Planegg-Martinsried, Germany). CHO transfected cells were collected in Modified RIPA Buffer (MRB, Table M7) supplemented with Proteases Inhibitor Cocktail (Roche, Basel, Switzerland) and incubated on ice for 15 min. Then cells were centrifuged at 12000 g, at 4°C for 10 min to obtain the CHO cell lysate. This cell lysate was incubated with gentle shaking at 4°C for 2-3 h with the GFP-Trap_A beads previously equilibrated in MRB. Cell lysate was washed with MRB (3x) and then with high NaCl-MRB buffer (3x) and stored in MRB buffer at -20°C. Composition MRB (mM) MRB-750 mM NaCl (mM) NaCl 150 750 Tris pH 8 50 50 NP-40 1% 1% Sodium deoxycholate 0.2% 0.2% pH 7.5 7.5 Table M7. CoIP solutions. For the immunoblot analysis, the cell lysate was diluted in XT Reducing Agent and XT Sample Buffer (Bio-Rad, Hercules, CA, USA) and incubated at 95°C for 5 min. Then, a SDS-PAGE electrophoresis was carried out on 10% polyacrylamide gels to separate the different co-purified proteins. After that, proteins were transferred onto a nitrocellulose membrane and blocked with 5% non-fat dry milk in TTBS buffer (0.1% Tween 20 in Tris-buffered saline) for 1 h. Membranes were then incubated with primary antibodies at 4°C overnight and then with secondary antibodies for 1 h, both incubations in blocking solution. Finally, protein signals were detected using a VersaDoc 4000 Image System (Bio-Rad) with chemiluminiscence reagents (SuperSignal West Femto Maximum Sensitivity Substrate; Pierce, Rockford, IL, USA) and quantification was carried out by - 67 - MATHERIAL AND METHODS densitometric analysis of each antibody band normalized to its corresponding βactin signal using Quantity One software (Bio-Rad). Cell lysate GFP-Trap beads incubation Centrifugation steps Immunoblot analysis Figure M11. CoIP working scheme. 7.3. Proximity Ligation Assay (PLA) The Proximity Ligation Assay (PLA) is a technique for detection of protein or macromolecules associations. This technique identifies association of the target molecules in the order of zeptomoles (40·10-21 mol) (Fredriksson et al., 2002). In a more detailed way (Figure M12), samples are fixed, blocked and incubated with two primary antibodies against the targets raised in different species. When adding the secondary antibodies which have complementary PLA probes attached, if they are in close proximity (at least 40 nm), a hybridization using Ligase can be performed. Then, a rolling-circle amplification (RCA) reaction is performed using fluorescence labelled nucleotides and Polymerase. Finally, the signal from each pair of PLA probes can be easily detected as individual spots by fluorescence microscopy. Primary antibody incubation Secondary antibody incubation Ligation Amplification Figure M12. Working scheme of PLA assay technique. - 68 - MATHERIAL AND METHODS PLA is a highly specific technique (Fredriksson et al., 2002) that can be used for detection and quantification of protein interactions. In this study, PLA technique has been used to identify the composition of multimeric channels (defining homo and heteromeric channel associations) as well as interactions between ion channels, receptors and cotransporters in native VSMCs. The primary antibodies and the working concentrations used were: rabbit anti-TRPC3 (4.5 μg·ml-1, Alomone), goat anti-TRPC3 (dilution 1:200, Novus Biologicals), rabbit anti-TRPC6 (4.5 μg·ml-1, Alomone), goat anti-TRPC6 (dilution 1:200, Novus Biologicals), rabbit anti-P2Y6 (4 μg·ml-1, Alomone), goat anti-ANO1 (dilution 1:200, Santa Cruz). 7.3.1. PLA procedure Protein associations were explored with PLA technology using Duolink® In Situ Kit (Sigma-Aldrich) following the manufacturer´s instructions. Briefly, freshly isolated VSMCs were settled in 12 mm diameter coverslips, at room temperature for 1 hour. Then VSMCs were fixed with 4% paraformaldehyde for 20 min and then treated with 100 mM Glycine during 15 min. After washing three times with PBS 1X, cells were permeabilized using PBTx (0.1% Triton X-100 in PBS) during 20 min and then blocked with Duolink® In Situ Blocking Solution, at 37°C during 20 min. Afterwards, samples were incubated with two primary antibodies (dilution 1:200 in 0.01% Odissey® Blocking Buffer in PBS) raised in different species, at 4°C overnight. For negative controls, samples were incubated only with one primary antibody. After washing three times with Wash Buffer A, cells were incubated with the Duolink® In Situ PLA Probes (PLUS and MINUS), at 37°C during 1 hour. Then, cells were washed three times with Wash Buffer A, 1U/μl Ligase was added (dilution 1:40) and samples were incubated at 37°C during 30 min. After washing with PBS (3x), amplification was performed using 10U/μl Polymerase (1:80 dilution in Duolink® In Situ Detection Reagents Orange) at 37°C during 100 min. After that, samples were washed twice in wash Buffer B for 10 min and once in 0.01% wash Buffer B for 1 min. Finally, samples were completely dried, mounted using Duolink® In Situ Mounting Medium and kept at 4°C protected from light until visualization using confocal microscopy. The immunofluorescence image acquisition was performed using a SP5 Confocal Microscope (Leica Microsystems, Wetzlar, Germany) at the appropriate wavelength. For comparisons between different conditions, image acquisition was performed using the same settings for all the conditions studied. ImageJ (Fiji 1.51g) software was used for image analysis. - 69 - MATHERIAL AND METHODS 7.4. Ground State Depletion (GSD) Super-resolution microscopy 7.4.1. GSD Super-resolution fundaments Ground State Depletion (GSD) microscopy is a super-resolution technique that allows localizing single molecules with high precision and create a high resolution image below the diffraction limit. The principle of single-molecule detection-based super-resolution is based on the different states of energy in which activated fluorophores can be (Figure M13). In conventional fluorescence microscopy, delocalized electrons of fluorophores can be transferred from a ground state (S0) to an excited state (S1) and, as they oscillate back into the S0, they emit fluorescence. In GSD Super-resolution technique, this oscillation cycle is modified by switching the fluorophores to off-states, reducing the amount of simultaneously emitting excitable fluorophores that become spatially and temporally distinct from neighboring fluorophores. Then, the fluorophores in off-states can return back to S0 and fluoresce again, while other molecules switch to off-states (Fölling et al., 2008; Dixon et al., 2017). Figure M13. GSD Super-resolution microscopy based principle. The burst of fluorophores can be fitted to a Gaussian curve whose centroid corresponds to the exact position of each fluorophore and, by collecting all the single fluorophore information of several thousands of separated images, a GSD Super-resolution image with sub-diffraction-limit resolution is reconstructed (Figure M14). The quality of the GSD Super-resolution images obtained depends on the numerical aperture (NA) of the lens, the wavelength of light used for excitation and, crucially, the fluorophore properties: number of photons per switched event, the on-off duty cycle, photostability and number of switching cycles. Using fluorophores with high photon yield per switching event and low on-off duty cycle - 70 - MATHERIAL AND METHODS provides both high localization precision and density. Furthermore, the imaging buffer conditions and properties can modified the switching properties of fluorophores and the quality of the reconstructed image (Dempsey et al., 2011; Dixon et al., 2017). Figure M14. Scheme of ON-OFF switching cycles and GSD Super-resolution image reconstruction. GSD Super-resolution technique was used to explore the exact localization of single molecules, such as purinergic receptors and TRPC channels, on the membrane of VSMCs. In addition, the association and clustering properties of these membrane proteins was also studied. Using immunocytochemistry fundaments with different antibody combinations, it was possible to obtained GSD reconstructed images showing the protein distribution of these receptors and channels with high resolution. 7.4.2. GSD Super-resolution System The GSD Super-resolution system used in this study consists of several parts: inverted microscope, TIRF/GSD module, high power lasers, external light source and acquisition software (Figure M15). - 71 - MATHERIAL AND METHODS Figure M15. GSD Super-resolution system. a) Inverted microscope A DMI6000B inverted microscope (Leica Mycrosystems, IL, USA) was used for Super-resolution measurements. Images were acquire using 160x HCX PL APO (NA=1.47) oil-immersion lens and an Andor iXon3 897 EMCCD Camera coupled to the inverted microscope. The inverted microscope with all of the attached components were placed on an anti vibration table. b) TIRF/GSD module A DMi8 S TIRF module (Leica Mycrosystems, IL, USA) coupled to the inverted microscope was used to switch from TIRF to GSD conditions. This TIRF/GSD module enables to control the TIRF penetration depth and the illumination angle of the samples, allowing the acquisition of super-resolution images with high power illumination options. c) Sample SuMo stage A sample Suppressed Motion (SuMo) 11888439 stage (Leica Mycrosystems, IL, USA) coupled to the inverted microscope was used to minimize possible drifts, ensuring stability during acquisition. - 72 - MATHERIAL AND METHODS d) High power lasers The GSD Super-resolution system is equipped with high-power lasers with the following wavelengths: 488 nm, 532 nm and 642 nm. The measured intensities at the focal plane of each one are 1.4 kW·cm-2, 2.1 kW·cm-2 and 2.1 kW·cm-2, respectively. In addition, the system comprises a 405 nm laser to control the single molecule switching behaviour (backpumping). e) External light source An external EL6000 light source (Leica Mycrosystems, IL, USA) connected to the inverted microscope via a liquid light guide was used to enhance fluorescence imaging. By using an alignment-free, mercury metal halide bulb, it keeps heat away from the sample and the microscope. f) Acquisition software For the image acquisition, LAS X (Leica Mycrosystems, IL, USA) software was used. This software allows controlling the focus in all the XYZ directions, switching between TIRF and GSD imaging modes, and stablishing the setting conditions for acquiring images. In addition, it allows analyzing the high resolution reconstructed images. 7.4.3. GSD Super-resolution procedure GSD Super-resolution requires labelling the proteins of interest with fluorophores, which can be done with the conventional immunocytochemistry technique. Using commercial primary and secondary antibodies, specific mounting media and GSD Super-resolution software, the on-off duty cycles of fluorophores can be easily controlled to obtain a single molecule reconstructed GSD image. a) GSD Super-resolution immunostaining protocol Freshly isolated VSMCs were settled on 25x25 mm square coverslips at room temperature during 1 h and then cells were fixed with PFA-GA (3% paraformaldehyde-0.1% glutaraldehyde in PBS) at room temperature for 10 min. After washing three times with PBS, cells were reduced with 0.1% NaBH4 in ddH2O at room temperature during 5 min. Then, cells were blocked with SBTx blocking solution (20% Sea Block-0.25% Triton-X 100 in PBS) for 1 h at room temperature. After removing SBTx solution, samples were incubated with 10 μg·mL-1 of the primary antibodies: rabbit anti-P2Y6, goat anti-TRPC3, rabbit anti-TRPC3 and rabbit anti-TRPC6, in SBTx solution, at 4°C overnight. After washing three times, cells were - 73 - MATHERIAL AND METHODS incubated with 2 μg·mL-1 of the secondary antibodies Alexa 647 donkey anti-goat and Alexa 568 goat-anti rabbit, at room temperature for 1 h protected from light. Then, samples were washed three times with PBS and postfixed using 0.25% GA in PBS at room temperature during 10 min. Finally, samples were washed three times with PBS and kept at 4°C in 3 mM azide and protected from light until image acquisition. b) GSD Super-resolution sample mounting In GSD Super-resolution, fluorophores are required to be fluorescent only a fraction of time to be individually localized. For this purpose, the imaging buffer contains two components: β-Mercaptoethylamine (MEA, Cysteamine, Sigma Aldrich), to induce photoswitching of the fluorophore, and an oxygen-scavenging system (Glucose-oxidase+Catalase), to reduce the effects of photobleaching. The previously described (Dempsey et al., 2011) imaging buffer used in this study was prepared as following (Table M8): Composition MEA (mM) Diluting buffer B (mM) GLOX (mM) Imaging buffer 10 mM (mM) MEA 100 GLOX Glucose oxidase Catalase 0.56 mg mL-1 0.34 μg mL-1 Glucose 10% w/v NaCl 10 Tris 1M pH 8 50 10 MEA 10 Glucose oxidase 56 mg mL-1 Buffer B Vf Catalase 3.4 mg mL-1 pH 8 (HCl) Table M8. Imaging buffer components for GSD Super-resolution microscopy. Left, separately stored aliquots of the components of the imaging buffer. Right, imaging buffer, freshly prepared. 100 mM-MEA aliquots of 1mL were stored frozen at -20°C, and centrifuged-(14000 rpm, 3 min) GLOX (Glucose-oxidase+Catalase) aliquots were kept at 4°C, both used within 1-2 weeks. The imaging buffer has to be freshly prepared and used within 12 h due to the acidification caused by the enzymatic reactions, preventing changes in the photophysics properties of the fluorophores. To mount the samples, slides of 76x26x1.5 mm with a depression of 15-18 mm diameter and 0.6-0.8 mm depth (neoLab®, Germany) were used. Firstly, imaging buffer was placed on the depression and then coverslips with cells were carefully mounted, avoiding formation of air bubbles. Finally, coverslip was fixed using the yellow and blue components of silicone-glue Twinsil® (Picodent, Wipperfürth, - 74 - MATHERIAL AND METHODS Germany), previously mixed in a 1:1 volume quantity. After 5-10 min, the glue was hardened and samples were mounted on the inverted microscope. c) GSD Super-resolution acquisition protocol For the GSD Super-resolution acquiring, images were acquired firstly with 642 laser and then with 532 laser, using a penetration depth of 130 nm and a TIRF angle of 66.32°. For VSMCs cells, the threshold value to eliminate background, nonspecific signals, was stablished in 85 events·pixel-1 and the minimum number of events per image were fixed at 8. A minimum of 30000 images per laser were acquired to obtain the GSD reconstructed image. 7.4.4. GSD Super-resolution analysis Three different analyses were performed from the GSD reconstructed images: shortest intermolecular distance analysis and cluster size and density analysis. a) Shortest intermolecular distance analysis An object-based analysis to measure the shortest distance between purinergic receptors and TRPC channels was performed using the JACoP plug-in of the ImageJ software (National Institute of Health, NIH). This previously described analysis is based on image segmentation by connexity analysis (Henis et al., 2003; Bolte and Cordelieres, 2006; Mercado et al., 2014). Briefly, all the adjacent pixels of a reference pixel with intensity above a set threshold limit are considered to be part of the same structure as the reference pixel. After segmentation, these individual particles are represented by centroids, defined as the geometrical centre of each particle including its global shape. With JACoP plugin, the shortest distances between centroids are analyzed for each laser-activated GSD reconstructed image. Analyzing the data using frequency histograms fitted to a Gaussian curve of two or three components, these measurements allowed stablishing colocalization between particles. b) Cluster size and density analysis Cluster size (in μm2) and density (in particles·μm2) analysis were performed using the ImageJ software for each individual laser-activated GSD reconstructed image. - 75 - MATHERIAL AND METHODS 8. CHO cell line culture and maintenance Chinese Hamster Ovary (CHO) cell line was used as an in vitro model to explore the role of different transfected ion channels present in native cells. This epithelial-like cell line was initiated in 1957 (Gamper, Stockand and Shapiro, 2005) and several subclones have been developed since then. Their easy culture and maintenance, high transfection efficiency and very low expression of endogenous ion channels make CHO cells specially valuable for electrophysiological studies. CHO cells were maintained in Dulbecco´s modified Eagle´s medium supplemented with 10% fetal bovine serum, penicillin-streptomycin (100 U·ml-1 each) and 2 mM Lglutamine at 37°C in a 5% CO2 humidified atmosphere. CHO cells were grown as a monolayer in poly-lysine-coated coverslips prior to transiently transfection using TransIT-X2® System (Mirrus, Madison, WI, USA) following the manufacturer´s instructions. Cells were trasnfected with: 1 μg of DNA of hTRPC3-YFP (yellow fluorescent fusion protein) kindly provided by Dr Klauss Groschner, (University of Graz, Austria), 1 μg of a bicistronic plasmid expressing ratTRPC6 and green fluorescent protein (GFP) as separate proteins (a gift from DR Jason Yuan, University of Arizona, USA), or 0.5 μg of each. Cells were used within 24-72 h postransfection for immunocytochemistry, coIP and electrophysiological studies. 9. Electrophysiology: patch-clamp technique 9.1. Patch-clamp fundamentals Patch-clamp is a technique used to study ionic currents in individual isolated living cells. An electrical potential difference (𝑉𝑚) across the cell membrane is generated by the selective ion permeability of the membrane, and it is maintained by the Na+- K+ pump. The ion channels and transporters of the lipid membrane behave as conductors (𝐺𝑚), meaning that they represent the pathways for ionic current (𝐼) to flow. These three parameters (Vm, I and Gm) are related by the Ohm´s law: ∆𝑉𝑚=𝐼𝑅𝑚=𝐼 𝐺𝑚 In resting conditions, the ∆𝑉𝑚 between the inner and outer sides of lipid membrane depends on the concentrations of ions to which the membrane is permeable and on their permeabilities (𝑝𝑖𝑜𝑛). In most mammalian cells, K+, Na+ and Clmake the largest contribution to the resting membrane potential (𝑉𝑚), described as the steady-state condition with no net flow of electrical current across the membrane. Therefore, 𝑉𝑚 follows the Goldman-Hodgkin-Katz (GHK) equation: - 82 - MATHERIAL AND METHODS 9.6. Patch-clamp solutions The bath and pipette solutions used to study the contribution of purinergic receptors, TRPC channels and chloride channels currents in VSMCs and CHO cells are described in the following sections. a) Solutions for TRPC current recordings External solution. The TRPC external solution was designed to explore unspecific cationic currents in VSMCs and includes nicardipine to block VOCCs channels, CsCl2 to block Kv currents and DIDS and Niflumic acid to block Ca2+-activated Clcurrents. For CHO cells, standard solution 1X was used (Table M9). Internal solution. The TRPC internal solution was designed to let 100 nM of free Ca2+ and includes CsCl2 to block Kv currents. This solution was prepared adding all components but Mg-ATP and setting a pH of 7.0. Next, keeping the solution at 4°C on ice, ATP was added and pH was brought to 7.2 using KOH. Aliquots of 1 mL were stored at -80°C. Internal solution was filtered before use and always kept on ice. When intracellularly antibodies were needed, the antibody (4.5 μg·mL-1) was added to the filtered internal solution (Table M10). Composition TRPC external solution (mM) STD 1X solution (mM) NaCl 141 141 CaCl2 1.8 1.8 MgCl2·6H2O 1.2 1.2 KCl 4.7 CsCl2 5 Glucose 10 10 Hepes 10 10 Nicardipine 5 μM DIDS 100 μM Niflumic acid 100 μM pH 7.4 (NaOH) Table M90. Bath solutions for TRPC recordings. - 83 - MATHERIAL AND METHODS Composition TRP internal Solution (mM) Perforated-patch internal solution (mM) CsCl2 10 Cs-Aspartate 110 NaCl 10 CaCl2 3.2 8 Mg-ATP 2 KCl 10 K-Glutamate 95 Hepes 10 10 BAPTA 10 Amphotericin B 300 μg mL-1 pH 7.2 (CsOH) 7.2 (KOH) Table M10. Intracellular solutions for TRPC recordings. b) Solutions for Ca2+-activated Clcurrent (IClCa) recordings External solution. The IClCa external solution was designed to explore the Ca2+- activated Clcurrents in VSMCs. This solution includes CsCl2 and tetraethylammonium chloride (TEA) to block K+ currents and nicardipine to block VOCCs channels (Table M11). Internal solution. The IClCa internal solution was designed to let 500 nM of free Ca2+ and includes CsCl2, Cs-Aspartate and TEA to block K+ currents. ATP was added to ice-cold solutions and then pH was adjusted. Aliquots of 1 mL were stored frozen at -80°C and filtered before filling the pipette electrode (Table M11). c) Solutions for perforated-patch recordings For Iclamp measurements, we used the standard solution 1X in the bath (Table M9) and the perforated-patch internal solution (Table M10) in the pipette. This internal solution could be stored at 4°C as it does not contain ATP. When filling the pipette electrode, the pipette tip was first dipped in filtered perforated-patch internal solution (without amphotericin B) and then backfilled with the same solution containing amphotericin B. Amphotericin-B solutions were prepared freshly every 2 hours by adding 4 µl of a stock 50 µg/µl of Amphotericin B in DMSO to 500 µl of filtered internal solution. The solution was then sonicated to allow amphotericin to come into solution and kept at room temperature protected from light. - 84 - MATHERIAL AND METHODS Composition IClCa external Solution (mM) IClCa internal Solution (mM) NaCl 131 CaCl2 1.8 7.22 MgCl2·6H2O 1.2 CsCl2 5 10 Cs-Aspartate 110 TEA Cl 10 10 Mg-ATP 2 Glucose 10 Hepes 10 10 EGTA 10 Nicardipine 5 μM pH 7.4 (NaOH) 7.2 (CsOH) Table M11. Electrophysiological solutions for Ca2+-activated Clchannels. 9.7. Data processing and analysis Electrophysiological data acquisition and part of the analysis were performed with the Clampfit subroutine of the pCLAMP software (Axon Instruments) and with Origin 7.5 software (OriginLab Corp., Northampton, MA, USA). 10. Statistical analysis Statistical analysis was performed using R software (R Foundation for Statistical Computing, Austria). Data are expressed as mean values ± standard error of the mean (SEM) from several different experiments. For pressure measurements, pressure myography, electrophysiology and PLA data, statistical comparisons were performed using the Student´s two-tailed t-test for paired or unpaired data or ANOVA with Bonferroni tests, depending on experimental design. For quantitative PCR data, Student´s t-test was performed in the case of normal distribution (i.e. a Saphyro-Wilks test with p>0.05), whilst a pairwise Mann-Whitney-Wilcoxon test (i.e. a non-parametric test) was applied to determine whether the differences between groups of pooled data were statistically significant. All through the Results section, values of p<0.05 are represented with one asterisk, while values of p<0.01 and p<0.001 were represented with two and three asterisks, respectively. - 87 - RESULTS 1. Essential Hypertension mouse model. The contribution of purinergic receptors, TRPC and Ca2+-activated chloride (CaCCs) channels to the increased vascular tone in hypertension was explored using the BPN/BPH mice model of essential hypertension. Figure R1. Systolic, diastolic and mean arterial blood pressures and pulse pressure in BPN and BPH mice. Each bar represents the mean ± SEM, n=24 and n=16 of BPN and BPH mice, respectively. *** P<0.001 compared to BPN. BPN and BPH arterial blood pressures were measured by Volume Pressure Recording method using a tail-cuff system. Systolic, diastolic, mean pressures and pulse pressure were obtained from BPN and BPH mice between 10 and 40 weeks of age and were consistently higher (~30 mmHg) in BPH compared to BPN mice (Figure R1). Within the ranges of age studied, no time-dependent changes in blood pressure were observed in either group. 1.2. Characterization of vascular reactivity to sympathomimetic agonists in BPH phenotype. BPH VSM cells have a more depolarized resting membrane potential when compared with BPN cells. The values obtained in this work, measured in BPN and BPH freshly isolated VSMCs under current-clamp (I=0) perforated-patch configuration were -48.8 ± 1.1 and -40.7 ± 0.7 mV respectively (n=76 cells from 35 BPN, and n=97 cells from 38 BPH) , in good agreement with previous data obtained in our laboratory (Moreno-Domínguez et al., 2009; Tajada et al., 2012). Mesenteric arteries from BPH mice showed also a higher myogenic tone compared to BPN vessels (Tajada et al., 2012). The role of different ionic channels underlying these differences between BPN and BPH arteries has been thoroughly characterized in our laboratoty (all references from the lab). However, vascular - 88 - RESULTS tone is physiologically regulated by many modulators that activate Gq-coupled receptors, and the possible differences between BPN and BPH mice have not been studied yet. The sympathetic nervous system (SNS) is a main regulator of vessel tone by releasing Noradrenaline (NA) that stimulates VSMCs contraction activating the α1-adrenergic receptors present in these cells. Nevertheless, activation of these receptors does not entirely mimic the physiological activation of sympathetic neuronal contraction due to the release of other neurotransmitters such as ATP (Hirst and Edwards, 1989; Mulvany and Aalkjaer, 1990; Wier and Morgan, 2004). In order to explore the differences between BPN and BPH responses to NA, the effect of Phenylephrine (PHE), a specific α1-adrenergic receptor agonist, on vessels tone was investigated by pressure myography using segments of 2nd and 3rd order mesenteric arteries pressurized to 70 mmHg (Figure R2). Figure R2. Vasoconstriction response elicited by PHE. Dose-response curves of PHE were obtained in BPN (blue) and BPH (red) mesenteric arteries. Data represents mean ± SEM, n=5-12 BPN mice and n=3 of BPH mice. **p<0.01 when applying ANOVA and Bonferroni tests. Concentration-response curves of the PHE-elicited vasoconstrictor effects were obtained in BPN and BPH mice (Figure R2) and fitted to a Hill function curve as follows: 𝐸=𝐸𝑚𝑎𝑥 ∙[𝑃𝐻𝐸]𝑛 𝐸50𝑛+[𝑃𝐻𝐸]𝑛 Where, 𝐸𝑚𝑎𝑥 represents the maximum vasodilator effect, 𝐸50 represents the [PHE] that gives the 50% of the maximum effect and 𝑛 represents the Hill coefficient. BPH - 89 - RESULTS arteries are more reactive to PHE, evidenced by a higher Emax (40.3% vs. 31.2%) and a lower E50 (2.51 μM vs. 6.64 μM). In both cases, the Hill coefficient (0.99 and 0.90) and the correlation R2 coefficient (0.99 and 0.99), the last related to the fitting method, were close to 1. These results demonstrate that BPH arteries exhibit a greater reactivity to an α1adrenergic agonist, pointing to differences in the signaling pathway between BPN and BPH mice not explored yet. For that reason, we decided to explore ion channels participating in the α1-adrenergic signaling pathway-induced contraction which could contribute to the more depolarized Vm and the greater reactivity in BPH cells, such as the transient receptor potential classic (TRPC1-7) family of channels. 2. Role of TRPC channels in essential hypertension. 2.1. mRNA expression profile of TRPC channels In order to study the contribution of the non-specific cationic TRPC channels to the BPH phenotype, their mRNA expression profile was explored by qPCR. Resistance vessels, such as mesenteric arteries, and femoral and aorta tissues from BPN and BPH mice were used. The genes explored included members of the TRPC family (TRPC1-7) and several control genes, such as calponin as a control of VSMC, endothelial nitric oxide synthase (eNOS) as a control of endothelial contamination, and ribosomal protein 18S (RP18S) as an endogenous control for the qPCR technique. We explored both the relative abundance (expressed as 2−∆𝐶𝑡) and the differences in expression observed in BPH mice compared to BPN (expressed as log2−∆∆𝐶𝑡). All members of the family, with the exception of TRPC5 and TRPC7, were expressed in the three vascular beds, although channel expression was larger in resistance (mesenteric) than conduit (femoral and aorta) arteries (See figure R3 and note the different scale for the femoral an aorta data). While TRPC1 expression was dominant in conduit arteries, expression of TRPC1, 3, 4 and 6 was very similar in mesenteric arteries. When differences in expression between BPN and BPH were studied (Figure R3, right panel), the only channel overexpressed in BPH cells was TRPC3. Differences in expression are represented as log2−∆∆𝐶𝑡, so that 0 values indicate no change in mRNA expression, positive values mean higher expression in BPH and negative values mean the opposite. - 90 - RESULTS Figure R3. Changes in the mRNA expression profile of TRPC family of channels in BPN and BPH arteries. Left panels show the relative abundance of TRPC family channels in VSMC of mesenteric, femoral and aorta arteries expressed as 2-ΔCt, where ΔCt=Ctchannel – Ct18S. Right panels show differences in the TRPC channels expression in BPH arteries using BPN as calibrator calculated as 2-ΔΔCt, where ΔCt=ΔCtBPH – ΔCtBPN. Positive values mean increased expression whilst negative values mean decreased expression. Each bar is mean±SEM, n=10. **P<0.01. Since TRPC channels expression is higher in resistance vessels (which functionally contribute more to set blood pressure), and TRPC3 is overexpressed in those vessels in BPH mice when compared with BPN, we decided to explore the possible contribution of TRPC3 channels to the hypertensive phenotype in mesenteric arteries. We used a pharmacological approach, testing several pyrazole compounds (Pyr3, Pyr6 and Pyr10) that have been described as putative blockers of the TRPC channels (Kiyonaka et al., 2009; Schleifer et al., 2012), to explore the contribution of TRPC3 channels to vascular tone using pressure myography and electrophysiology. While Pyr3 and Pyr10 have been proposed as selective blockers of DAG-activated TRPC3 channels, Pyr6 seems to exhibit greater potency inhibiting Orai-mediated Ca2+ entry (Schleifer et al., 2012). - 91 - RESULTS 2.2. TRPC3 contribution to vascular tone. Endothelium-denuded arteries were pressurized to 70 mmHg and precontracted with PHE (5-10 μM) in order to activate TRPC channels and assess the vasodilatory response elicited by the pyrazole compounds. Pyr applications at different concentrations were performed in the continuous presence of PHE, and at the end of the experiment nifedipine (10 μM) was applied to determine the maximum passive vessel diameter (Figure R4 A). Figure R4. Effects of Pyr compounds on the vascular tone in BPN and BPH mesenteric arteries. A, representative examples of the vasodilator effect of Pyr3 in BPN (left) and BPH (right) mesenteric arteries. Arteries were pressurized to 70 mmHg and precontracted with PHE (5 μM) before Pyr applications at the indicated concentrations (μM). At the end of the experiment, Nif (10 μM) was added to obtain the maximum passive diameter. B, concentration-response vasodilator effect of Pyr10, Pyr3 and Pyr6 in BPN (blue) and BPH (red) PHE-precontracted mesenteric arteries. Data were normalized to the maximal diameter values obtained with Nif and expressed as percentage of relaxation (see Methods). Each point is mean ± SEM, n=5-9 arteries in each group. *p<0.05, **p<0.01 Concentration-response curves were obtained for each Pyr compound in BPN and BPH arteries, and data were fitted to a Hill function (Figure R4 B). Pyr3 and Pyr10 elicited a concentration-dependent vasodilator response which was more effective in BPN mesenteric arteries. In fact, the Hill fitted curves for Pyr3 and Pyr10 in BPN arteries were best fitted with two different components (Table R1), being the highaffinity one responsible for ~30% of the total response. This high-affinity component was not present in BPH. We hypothesized that this component - 98 - RESULTS combination) produced a significantly higher number of puncta per cell in BPH than in BPN cells. In contrast, the labelling with two different TRPC6 antibodies (C6-C6 combination) was significantly smaller. Average values of the punctae density normalized to the cell size for all the described combinations are depicted in figure R10 B. Since C3/C3 and C6/C6 labelling are mutually exclusive, and the combination of both would label all possible associations of TRPC3 and TRPC6 channels, the percentage of heteromultimers with more than a TRPC3 (C3>1) or TRPC6 (C6>1) in BPN and BPH cell can be estimated from the C3/C3 and C6/C6 data (Figure R10 C). Figure R10. Differences in TRPC assembly in BPN and BPH mesenteric VSMCs. A, representative confocal images of the punctae distribution in BPN (upper) and BPH (lower) native VSMC cells. B, bar plot showing the average of density punctae of each condition represented in (A). Data are mean ± SEM, n=36-64 cells in each condition from four different experiments. *p<0.05, **p>0.01 compared to BPN. C, interpretation of the summary data, considering 100% as the sum of C3-C3 or C6-C6 and assuming C3-C6 is included in both. Although these experiments do not provide accurate information about the total expression of TRPC3 or TRPC6 channels in the cells, they allow us to conclude that heteromultimers are more abundant in BPH cells, and that the TRPC3/TRPC6 ratio in those multimers is higher than in BPN cells. 2.5. Characterization of the functional contribution of TRPC3 and TRPC6 multimeric associations in native VSMC cells from BPN and BPH mice. All data presented so far suggest a higher TRPC3 contribution, either as homo or heteromultimers, to the BPH phenotype. To test this hypothesis from a functional point of view, we characterized the TRP mediated currents in freshly isolated native VSMCs with the whole-cell configuration of the patch-clamp technique using Pyr - 99 - RESULTS compounds (to block TRPC6 channels) or intracellular anti-TRPC3 antibodies (to block TRPC3 channels). Cationic currents were elicited with a ramp voltage protocol (see Methods) either on non-stimulated VSMCs (basal currents) or after the application of different agonists activating GPCRs (Receptor Operated Currents, ROCs). 2.5.1. Characterization of basal TRPC currents. Ionic currents were recorded in the presence of TRP bath solution (see Methods). Basal current amplitudes at -150 mV were significantly larger in BPH than in BPN cells, even when current amplitudes were corrected for cell size (-8.1 ± 0.5 pA/pF in BPH vs. -6.4 ± 0.7 pA/pF in BPN, figure R11 B), since BPH cells were significantly larger than BPN (16.9 ± 0.6 pF, n=61 cells from 25 BPH; vs. 13.9 ± 0.5 pF, n=36 cells from 16 BPN). On the contrary, the effect of Pyr3 and Pyr10 on current amplitude was smaller in BPH cells. Figure R11 A shows representative records obtained in cells from both mice, and Figure R11 C represents the Pyr3 ad Pyr10 sensitive currents expressed as percentage of total current, measured at -150 mV. Figure R11. Pyr sensitivity of TRPC-mediated basal currents in native VSMCs. A, representative current-voltage traces of a BPN and a BPH native cells in TRP solution (C), in presence of Pyr10 (10 μM) and after washout of the blocker (R). B, bar plot showing averaged current amplitudes at -150 mV for BPN and BPH cells. Data are mean ± SEM, n=40-60 cells from 16-25 mice in each condition. *p<0.05. C, bar plot showing the average fraction of Pyr3and Pyr10sensitive current at -150 mV. Data are mean ± SEM, n=10-23 cells from 7-13 mice in each condition.**p<0.01; ***p<0.001. - 100 - RESULTS For these recordings, the composition of intra and extracellular solutions was designed to minimize or block any other currents (see Methods). Also, particular care was taken to study inly cells with high resistance seals and very good access, so that the contribution of other unspecific, leak conductances is negligible. With these assumptions, the larger TRP currents recorded in BPH cells could certainly contribute to the more depolarized Vm characteristic of that phenotype, and the Pyr effects suggested a smaller contribution of TRPC6 channels to the cationic currents in BPH cells, in clear agreement with the results obtained in the PLA experiments and with the smaller expression of TRPC6 mRNA in VSMCs from mesenteric arteries. Those experiments also suggested a higher contribution of TRPC3 channels in BPH cells. To confirm this last point, the effect of intracellularly applied anti-TRPC3 antibody on whole-cell currents was analyzed in native BPN and BPH cells. A ramp protocol from -150 mV to +80 mV was applied in cells where the antibody anti-TRPC3 (or an antibody control, anti-RFP) was included in the pipette solution. Ramps were applied every 10 s, and the time course of the current amplitudes at -150 mV and +80 mV was studied, being t=0 the beginning of the whole-cell recording (figure R12 A). In the presence of anti-TRPC3 antibody in the pipette, basal current amplitude of BPH cells decreased by 25% and by 39% after 5 and 10 min of recording, respectively. No changes were observed when applying anti-RFP or no antibody. The effects of the anti-TRPC3 antibody were very small in BPN cells, being only significant in BPH cells (figure R12 B). - 101 - RESULTS Figure R12. Effect of anti-TRPC3 antibody on TRPC3-mediated currents in BPN and BPH cells. A, representative traces of the current amplitudes at the indicated voltages in a BPH cell recorded with anti-RFP (left) or with anti-TRPC3 (right) antibodies in the pipette solution. Current-voltage ramp traces 1, 2 and 3 corresponding to 0, 5 and 5 min of recording are depicted. B, average current amplitudes represented as the fraction of the initial current with both, anti-TRPC3 or control antibodies, are shown for BPN and BPH cells. Each bar is mean ± SEM, n=7-14 cells in each group. For the control group, untreated cells and anti-RFP treated cells were pooled together. *p<0.05. These results strongly suggest that TRPC3 contribution to the cationic currents in native VSMCs is higher in BPH when compared to BPN mice. 2.5.2. Characterization of Receptor activated TRPC currents. We have demonstrated so far differences in the contribution of TRPC3/6 channels to basal currents in BPN and BPH VSMCs. Next, we explored these differences when these currents were activated with different agonists, such as ATP (30 μM), UTP (50 μM), Phenylephrine (10 μM) or the DAG-analogue OAG (100 μM). These agonists were applied to activate ROCs, and the effect of Pyr3/10 (10 μM) was investigated to explore the contribution of TRPC6 channels to the currents (Figure R13). - 102 - RESULTS Figure R13. Effect of Pyr blockers on agonist-activated currents in native VSMCs. A, summary data of 30 μM-ATP-, 50 μM-UTP-, 100 μM-OAGand 10 μM-PHE-activated currents alone or in the presence of 10 μM-Pyr3/10 recorded with a ramps protocol from -150 mV to +80 mV. Each bar is the mean ± SEM, n=17-36 cells for agonist-induced currents and n=6-14 cells for Pyr3/10 blockade. **p<0.01 compared with UTP-activated currents in BPN cells. B, representative current amplitude traces recorded in the presence of 30 μM ATP alone or with 10 μM Pyr3 at the indicated voltages in a BPN (left) and a BPH (right) cell. Inset plots showing current-voltage traces in control (1) conditions, in the presence of ATP (2) or ATP+Pyr3 (3). C, bar plot showing the fraction of ATP-activated current that can be blocked by Pyr3 or Pyr10 in BPN and BPH cells. *p<0.05 compared to BPN. ROCs amplitude showed no significant differences between BPN and BPH cells for all the studied agonists, except for UTP, which elicited significantly smaller currents in BPH cells. However, a remarkable difference was obtained when comparing the blocking effect of Pyr compounds. Although Pyr3/10 almost fully abolished ROCs in BPN cells, a significant fraction of the activated currents was insensitive to these drugs in BPH cells. Figure R13 B shows representative traces obtained in BPN and BPH cells when ATP was used to elicit ROCs. Taken together, expression and functional studies performed so far strongly suggest a significant change in the contribution of TRPC3 and TRPC6 channels to the VSMCs electric phenotype in BPH mice. TRPC3/6 mediated currents are larger in BPH cells, and so is the ratio of TRPC3/TRPC6. This “shift” towards a more dominant role of TRPC3 channels could contribute in part to the increased vascular - 103 - RESULTS tone present in the BPH phenotype. However, these differences between BPN and BPH cells do not explain all the differences observed when ROCs were studied, especially when UTP was used as agonist. Since electromechanical coupling is very relevant for controlling vascular tone (Herring and Paterson, 2018) and TRPC3/C6 are just one element in the activation cascade from the receptor to contraction, we decided to explore in detail the purinergic signaling cascade both in BPN and BPH mesenteric arteries in order to better contextualize the observed changes in TRPC3/6 channel. 3. Differences in the purinergic signaling cascade between BPN and BPH VSMCs. 3.1. Functional contribution of P2XR and P2YR receptors to vascular tone. Purinergic signaling is particularly relevant in the physiology of vascular smooth muscle cells, since it is involved in the sympathetic control of the vessel tone. NA and ATP co-released by sympathetic nerves mediates vasoconstriction in a biphasic way. First, there is a transient response mediated mainly by the P2X purinergic receptors which is followed by a sustained response mediated by the α1adrenoreceptors (von Kügelgen and Starke, 1968; Sneddon and Burnstock, 1985). However, the contribution of the purinergic and adrenergic components to the overall vasoconstrictor response to nerve stimulation is not homogeneous in the different vascular beds. In large arteries, the response is essentially adrenergic, while in smaller arteries the response is mediated predominantly through P2X receptors (Gitterman and Evans, 2001). In addition to these responses mediated by the neurogenic release of ATP, it is well known that other nucleotides, like UTP, mediate vasoconstrictor responses through the activation of P2Y receptors, and these receptors have been described to play a relevant role in the myogenic response of small vessels (Kauffenstein et al., 2016). To investigate the possible differences in the purinergic signaling pathways between BPN and BPH VSMCs, vascular responses to different agonists and blockers of those pathways were first explored by pressure myography. Mesenteric arteries (2nd or 3rd order) were pressurized to 70 mmHg and concentrationresponse curves of ATP and UTP were obtained to discriminate between P2Xand P2Y-mediated responses, respectively. - 104 - RESULTS Figure R14. Differences in the vasoconstrictor response to ATP and UTP in BPN and BPH mesenteric arteries. A, B, representative examples showing the ATPand UTP-mediated effects on the vascular tone of BPN (A) and BPH (B) mesenteric arteries. The inset plots show the ATPand UTP-mediated effects on 10 μM αβ-MeATPactivated arteries. Figure R14 shows typical experiments carried out in BPN (left) and BPH (right) arteries. In both cases, UTP and ATP were applied sequentially in several steps with increasing concentrations, from 1 to 50 µM. Whilst ATP responses were transient, and very similar in BPN and BPH cells (10 μM ATP: 18.3 ± 2.1 % vs. 16.7 ± 2.7 % of vasoconstriction, p=0.68, n=7-16 arteries from 8 BPN and 5 BPH mice, respectively), vasoconstrictor effects of UTP were sustained and significantly larger in BPH mesenteric arteries (Figures R15 and R16 A). At the end of each sequence, the higher concentration of the agonist was tested in the presence of αβ-MeATP (10 μM), an agonist of P2X1 that elicits a fast and transient response due to receptor desensitization. These responses are shown in the lower part of the figure at a magnified time scale. Concentration-response curves obtained for ATP and UTP in several arteries were averaged, and data were plotted and fitted to a Hill function curve as follows: 𝐸=𝐸𝑚𝑎𝑥 ∙[𝑁𝑇𝑃]𝑛 𝐸50𝑛+[𝑁𝑇𝑃]𝑛 - 105 - RESULTS Where, 𝐸𝑚𝑎𝑥 represents the maximum effect, [NTP] represents the concentration of the tested nucleotide triphosphate, 𝐸50 represents the concentration of the agonist that gives the 50% of the maximum effect and 𝑛 represents the Hill coefficient. The best fitting parameters are shown in the following table (Table R2): Figure R15. Dose-response vasoconstrictor effect of ATP (left) and UTP (right) in BPN (blue) and BPH (red) mesenteric arteries. Data were normalized to maximal diameter values obtained with Nif (10 μM) and are expressed as percentage of vasoconstriction (see Methods). Each point is mean ± SEM, n=5-16 arteries in each group. p<0.001 in UTP curves when applying ANOVA and Bonferroni test. BPN BPH Emax (%) 𝐸50 (µM) n R2 Emax (%) 𝐸50 (µM) n R2 ATP 33.2±7.5 6.8±3.8 1.2±0.4 0.99 27.2±11.8 6.4±8.5 0.9±0.4 0.98 UTP - ~115* - 0.84 40.2±8.6 2.9±1.8 1±0.4 0.99 Table R2. Main kinetics parameters obtained after fitting ATP and UTP dose-response curves to a Hill function. *Since proper fitting to the Hill function was not possible in BPN cells, the apparent 𝐸50 was stimated carrying out a fitting procedure assuming Emax and n values identical to those obtained in BPH. - 106 - RESULTS In the presence of αβ-MeATP, a maximal dose of ATP did not elicit any response, suggesting that ATP vasoconstriction is essentially mediated by P2X1 purinergic receptors. Moreover, whilst the effects of ATP are very similar in BPN and BPH arteries, BPN cells are almost insensitive to UTP stimulation (as the concentrationresponse curve in these arteries is shifted to the right almost two orders of magnitude). This larger response to UTP in BPH mice was clearly not anticipated from the results obtained when the effect of UTP on TRPC currents was studied (Figure R13). Since the constrictor responses to UTP are in all likelihood mediated by the P2Y1-7 family of purinergic receptors, the striking difference in the response between BPN and BPH arteries suggests a more relevant contribution of P2Y purinergic receptors to the vascular tone in BPH mice. To determine the members of the P2Y family of purinergic receptors involved, we tested the effects of the agonists and blockers described in Table R3: Average results are shown in figure R16. The vasoconstrictor effects of UTP (mainly through P2Y2/P2Y4) and UDP (mainly through P2Y6) were much larger in BPH than in BPN arteries. However, due to the fast break down of UTP to UDP, the UTPmediated effects obtained could represent, at least in part, UDP-mediated effects. Therefore, the more stable synthetic UTP-analog UTPγS and the specific P2Y6 synthetic agonist PSB0474 were tested at 10 μM. Both elicited larger vasoconstrictions in BPH. In addition, the effect of the specific P2Y6 blocker MRS 2578 (10 μM) was tested on the responses induced by UDP or PSB0474, and in both P2X1 P2Y1 P2Y2 P2Y4 P2Y6 ATP =UTP =UTP UTP =ATP =ATP UDP >UTP αβ-MeATP MRS 2578 PSB0474 UTPγS Table R3. Specific physiological (top) and synthetic (bottom) agonists (green) and blockers (red) previously described in the literature used to explore purinergic receptors involved in UTP-mediated signaling cascade in BPN and BPH arteries (from Lewis and Evans, 2000; Malmsjö et al., 2000; Sugihara et al., 2011). - 107 - RESULTS cases a partial blockade was obtained. Taken together, these data suggest that UTP-elicited vasoconstrictor effects are mainly mediated by P2Y6 receptors, with a smaller contribution of P2Y2 and/or P2Y4 receptors. Figure R16. Involvement of P2Y6 purinergic receptors in UTP-mediated responses in BPH. A, bar plot showing differences in the vasoconstriction responses mediated by the indicated P2Y agonists (10 μM) in BPH and BPN mesenteric arteries. Each bar is mean ± SEM, n=2-16 arteries in each group. **p<0.01; ***p<0.001, compared to BPN. B, bar plot showing blocking effect of MRS 2578 (10 μM) on BPH arteries precontracted with UDP and PSB (10 μM). Each bar is mean ± SEM, n=2 arteries. To further investigate the different contribution of the purinergic receptors to the hypertensive phenotype, their mRNA expression pattern was explored by qPCR (Figure R17). qPCR data showed mRNA expression of P2X1 and P2X4 and P2Y1, P2Y2, P2Y4 and P2Y6 purinergic receptors. Even though P2X mRNA levels were much larger than P2Y (note the different scale for each family), mRNA expression was identical in BPN and BPH arteries when comparing the mRNA expression pattern. However, significantly higher expressions of P2Y2 and P2Y6 and lower expression of P2Y1 receptors were observed in BPH VSMCs. These data agreed with the hypothesis of a higher expression of P2Y receptors contributing to the larger UTPmediated effects in the BPH phenotype. - 114 - RESULTS and BPH cells. The hyperpolarization induced by Pyr3 was significantly larger in BPH cells, in agreement with a larger expression of TRP channels in those cells. The effect of Niflumic Acid was not different, but the effect of the specific inhibitor of ANO1, also called T16Ainh, was significantly larger in BPH, in good agreement with the expression data. A B Figure R23. Differences on the effects of UTP and the blockers of TRPC3/6 and CaCCs channels on resting membrane potential in BPN and BPH cells. A, bar plot showing the UTP (50 μM)-induced depolarizations and Pyr3 (10 μM)-, Niflumic (100 μM)- and ANO1 inhibitor (10 μM)-induced hyperpolarizations in BPH compared to BPN cells. Each bar is the mean ± SEM, n=5-54 cells in each group. *P<0.05; ***P<0.001. B, Representative traces of the effect of UTP and Niflumic on Vm in a BPN and a BPH cell from A. Depolarizations induced by KCl (60 mM) as a control of cell stability are also depicted. If we compare the effect of TRP or CaCC blockade on membrane potential, there are no apparent differences, suggesting that both channel families are contributing to set the membrane potential. In fact, the larger effects of Pyr3 in BPH cells suggest that TRP could contribute to the characteristic depolarized basal state of BPH VSMCs. However, when the effect of TRP or CaCC blockers are tested on UTPinduced depolarization in BPH cells, the different contribution of those channels to the response is striking (Figure R24). All inhibitors affected the depolarization induced by UTP, suggesting that all channels contribute to that response, but the magnitude of the effect was very different. Pyr3 showed a very small effect, whilst Niflumic Acid and/or the specific blocker of ANO1 completely abolished (or even reverted) the effect of UTP. These results pointed clearly to CaCCs as important - 115 - RESULTS players in the response to UTP and suggested that the differences in the expression of these channels are at the core of the differences in the purinergic pathway between BPN and BPH mice. Figure R24. Differences in the contribution of TRPC3/6 and CACCs channels to the UTP-induced depolarization in BPN and BPH cells. A, representative traces of the blocking effects elicited by Pyr3 (10 μM), Niflumic Acid (100 μM) and ANO1 inhibitor (10 μM) on UTP-induced depolarizations. As a control of the cell stability KCl (60 mM)-induced depolarizations are also depicted. B, bar plots showing the summarized blocking effects expressed as absolute values (top) and percentage (bottom) on UTP-induced depolarizations in BPN and BPH cells. Each bar is the mean ± SEM, n=5-10 cells in each group. - 119 - DISCUSSION In the present study, using the BPN/BPH model of essential hypertension, we have explored the contribution of TRPC channels to the hypertensive phenotype. Furthermore, since TRPC channels are prototypic examples of Receptor Operated Channels (ROCs), we have investigated the differences between normal and hypertensive mice in the vascular responses to the α-adrenergic and the purinergic signaling pathways, the two GPCR pathways mainly associated with the sympathetic stimulation of resistance arteries. Using different approaches, we have explored differences in the expression profile of members of the purinergic P2X and P2Y families of receptors and we have functionally characterized their relative contribution to the hypertensive phenotype. Focusing on the UTP-mediated activation of purinergic signaling pathway, we have also explored downstream members, such as TRPC and CaCCs channels that, by their direct or second messenger-mediated coupling to purinergic signaling, could be enhancing the integrated response of vasculature. Thus, although we have separately explored the different contribution of these families of receptors and ion channels to the BPH vs BPN phenotype, the obtained results must be interpreted in the context of the integrated responses of arterial vessels to understand the complexity of the hypertensive phenotypic change. 1. TRPC Channels in the BPN/BPH model TRPCs channels have been widely described as ROCs that contribute to modulate the membrane potential and the contractility of vasculature (Earley and Brayden, 2015). In this Thesis we have explored the mRNA expression profile of TRPC channels in several vascular beds of BPN and BPH mice. All channels, but TRPC5 and TRPC7, are expressed in VSMCs from both mice strains. Overall, mRNA expression is more than 20 times larger in resistance (mesenteric) than in conduit (femoral and aorta) arteries, and whilst TRPC1 is the more highly expressed channel in conduit arteries, TRPC1/3/4/6 mRNAs are more abundant in the mesenteric bed. When the expression levels are compared between BPN and BPH mesenteric VSMCs, it is evident that TRPC3 are the only channels that are overexpressed in the hypertensive cells (Figure R3). On the contrary, TRPC1 and TRPC6 are downregulated (although only data for TRPC1 is statistically significant). TRPC1 channels are mainly involved as SOCs (Nesin and Tsiokas, 2014; Ambudkar, de Souza and Ong, 2017), so we decided to focus on TRPC3 and TRPC6 channels as the main candidates to carry out ROCs in mesenteric VSMCs. Since these channels have been described to form functional multimeric channels in several tissues (Hofmann et al., 2002; Earley and Brayden, 2015), we also hypothesized that in - 120 - DISCUSSION addition to their different expression levels, changes in the composition of homoor heterotetramers of these two channels could contribute to the genesis of the hypertensive phenotype. In any case, these differences should determine different, and experimentally discernible, biophysical, pharmacological and functional properties of TRPC channels in BPN and BPH VSMCs. Pyr-compounds are the only available blockers described in the literature as putative blockers of TRPC3 channels (Kiyonaka et al., 2009; Schleifer et al., 2012). We tested the effect of three of these compounds (Pyr10, Pyr3 and Pyr6) on the vascular tone induced in mesenteric arteries by the stimulation with the α1 agonist Phenylephrine (Figure R4). Pyr10 and Pyr3 exhibited a powerful vasodilatory effect both in BPN and BPH arteries. Nevertheless, the effect is clearly different at concentrations below 10 µM, where vasodilation is larger in BPN than in BPH arteries. However, since the specificity for TRPC channel blockers has not been thoroughly tested in the literature, we have tried out several methodological approaches to investigate the functional contribution of TRPC channels in a heterologous expression system (CHO cells) overexpressing TRPC3, TRPC6 or both. In this way we have determined that pyrazole compounds (Pyr3 and Pyr10) are effective blockers of TRPC mediated currents when CHO cells are transfected with TRPC6 channels, either alone or with TRPC3 (Figure R5). As TRPC3 and TRPC6 associate forming heteromultimers (Figure R7), the simplest interpretation of the effect of pyrazole compounds is to assume that the presence of TRPC6 subunits in the channel tetramer is a requirement for the inhibitory effect of these compounds. If this interpretation is correct, pyrazole compounds are effective blockers of TRPC6 channels, and could be used in native cells to estimate the contribution of these channels to the effects mediated by TRPC channels. This interpretation is also consistent with the smaller vasodilatory effect of these compounds in BPH arteries, where, according to mRNA data, we have increased TRPC3 and decreased TRPC6 expression. These results clearly contradict the previously reported selective blocking effect on TRPC3 channels of Pyr10 and Pyr3. Although these reported effects on native TRPC3 channels (Kiyonaka et al., 2009; Schleifer et al., 2012) are compatible with the presence of TRPC3/6 heterotetramers in those preparations, we do not have a clear explanation for the discrepancy. Nevertheless, several differences in the experimental methodology can be highlighted. We have characterized the effects of Pyr on TRPC3, TRPC6 or TRPC3/6 overexpressed in CHO cells by exploring both basal and stretch-activated whole-cell currents with the patch-clamp technique, while previous reports have used TRPC3-transfected HEK293 (and/or HEK293T) cells and have estimated channel activity indirectly from changes in [Ca2+]i upon - 121 - DISCUSSION stimulation of endogenous muscarinic receptors with carbachol (Schleifer et al., 2012). Noteworthy, it has been described that HEK cells endogenously express TRPC3 and TRPC6 channels (Bugaj et al., 2005). In addition, we have analyzed the acute effects of Pyr compounds when applied in the external solutions both in basal conditions and in the presence of the stimulus, while previous reports explored the Pyr-elicited effects, mainly Pyr3, upon chronic pre-treatment before stimulation. Thus, it is quite possible that differences associated to the endogenous expression of TRPC3 and TRPC6 channels in different cell lines and/or differences associated to the response of the blockers related to the specific activation pathway could explain the observed discrepancies. Since Pyr compounds turned out to be experimental tools to check the functional contribution of TRPC6 channels, we explored the possibility of using antibodies against TRPC3 channels to study the functional contribution of those channels. Although the only available antibodies recognize intracellular epitopes of the channel and their use must be limited to patch-clamp experiments where the intracellular medium is accessible, this experimental approach has proven to be instrumental to block TRPC3 mediated currents when these channels were overexpressed in CHO cells (Figure R8). Non-selective cationic currents recorded in VSMCs isolated from BPN or BPH mesenteric arteries are significantly different in magnitude and in their sensitivity to Pyr compounds and anti-TRPC3 antibodies. The larger currents recorded in BPH cells in the absence of receptor activation (basal activity, Figure R11B), the smaller sensitivity to Pyr compounds (Figurer R11C) and the larger effect of anti-TRPC3 antibodies (Figure R12B) strongly correlate with the larger expression of TRPC3 in BPH VSMCs. Certainly, these differences can contribute to explain the more depolarized resting Vm of VSMCs cells from BPH, the increased vascular reactivity observed in BPH mesenteric arteries (Moreno-Domínguez et al., 2009) and the larger effect of Pyr compounds observed in mesenteric arteries form BPN mice. The results obtained with this electrophysiological approach in native cells are supported by data obtained with the Proximity Ligation Assay (PLA) technique. PLA data demonstrate a larger proportion of TRPC3-containing channels (and the consequent smaller proportion of TRPC6 subunits) in BPH cells (Figure R10). These findings are consistent with a larger number of TRPC3 homotetramers and/or heteromultimeric TRCP3/6 complexes in VSMCs from BPH mice. Early evidences previously reported that TRPC heteromultimerization, such as the case of TRPC6/7, showed distinct functional properties than the homomultimeric association (Hofmann et al., 2002; Maruyama et al., 2006). Thus, a better understanding of the mechanisms by which TRPC subunits combine to form functional ion channels complexes is essential to evaluate their contribution to endogenous cation - 122 - DISCUSSION currents. In many cases, the use of KO animal models helps to understand the role of a particular channel, but this is not the case of TRPC3 or TRPC6 channels. Several studies using single, double TRPC3/6 and up to quadruple KO of TRPCs channels concluded that TRPC functions are a result of the combined activity of multiple TRPC proteins and that the interfering with one single TRPC channel does not imply an alteration in the functional responses, thus indicating possible redundancies in the function of TRPC channels (Sexton et al., 2016). However, in good agreement with the results obtained in this Thesis, a study using TRPC6 KO mice showed changes in the vascular phenotype consisting of increased vascular reactivity and blood pressure, which was a result of a compensatory upregulation of TRPC3 channels. From these data, we could conclude that TRPC3 and TRPC6 channels are not freely interchangeable and that they have distinct and non-redundant roles in the vasculature (Dietrich et al., 2005). 2. GPCR signaling Pathways in the BPN/BPH model: The sympathetic drive Noradrenaline (NA) and ATP are co-released by sympathetic neurons in the vicinity of VSMCs contributing to the physiological setting of vascular tone. NA induces contraction by activating α1 receptors whilst ATP activates a complex set of purinergic receptors (ionotropic and metabotropic). Pressure myography data show differences in agonists-induced vascular responses between BPN and BPH mice when the α1 agonist PHE is used (Figure R2), but not when the agonist is ATP (Figure R15, left panel). These results are compatible with the reported sympathetic hyper sensitivity of BPH mice (Davern et al., 2009, 2010) and point to the α1 receptor signaling pathway as the more probable culprit of the differences. We have tested the functional impact of TRPC currents on these responses investigating ROCs elicited by PHE, ATP and OAG in BPN and BPH VSMCs (Figure R13). ROCs are not significantly different in magnitude although the sensitivity to Pyr compounds strongly suggests that the TRPC channels mediating the response are mainly TRPC3 in BPH and TRPC6 in BPN, as expected from the expression data. Nevertheless, the different role of TRPC3 and TRPC6 channels contributing to Vm depolarization when PHE (or NA) are the agonists has not been characterized in detail and needs to be further explored. ATP-induced ROCs are much bigger than ROCs elicited by PHE or OAG (Figure R13). This difference can be easily explained if we consider that ATP is activating also P2X ionotropic receptors. In fact, when the effect of ATP is characterized using - 123 - DISCUSSION myography, almost 100% of the contractile response can be attributed to the P2X receptors, since ATP does not elicit a contractile response when P2X receptors have been desensitized with αβ-MeATP (Figure R14). These results are in good agreement with the large expression of P2X receptors, compared with P2Y (see below), but are difficult to reconcile with the large effect of Pyr compounds on ATP induced currents, both in BPN and BPH cells (Figure R13C). Although the simplest explanation for these results is to assume some unspecific effect of Pyr compounds on P2X currents, we have not fully characterized the biophysical properties of ATP currents to thoroughly test this possibility. 3. GPCR signaling Pathways in the BPN/BPH model: The UTP divergence The more striking result that we obtained comparing ROCs currents in BPN and BPH VSMCs was the effect of UTP (Figure R13A), since non-specific cationic currents elicited by this agonist are twice as big in BPN mice. Surprisingly, larger currents do not correlate with bigger responses in terms of vessel contraction, and in fact, BPN mesenteric arteries are almost insensitive to UTP stimulation, with apparent EC50 over 100 µM (Figure R14 and R15), whilst BPH arteries respond to much lower UTP concentrations (EC50~3µM). Nevertheless, in agreement with the results obtained with other agonists, the effect of Pyr10 suggests that these UTP activated currents are mainly mediated by TRPC6 channels in BPN and by TRPC3 channels in BPH mice. Physiologically, UTP is released from platelets and endothelial damaged cells, and these remarkable differences in the response of mesenteric arteries can be relevant defining the vascular phenotype of the hypertensive animals. Several studies in the literature demonstrate some discrepancies in the contribution of TRPC3 channels to the UTP-activated responses. UTP-induced depolarizations and contraction were found to be mediated by TRPC3 channels in cerebral arteries of adult rats (Reading et al., 2005), as well as in rat cardiomyocytes where TRPC3/7 channels were found to be involved in ATP/UTPmediated responses (Alvarez et al., 2008). In contrast, dual signaling pathways through P2X1-like receptors, and in a less degree through P2Y receptors, but not via TRPC3 channels, appear to be the main molecular mechanisms by which extracellular UTP constricted rat aorta, mesenteric and cerebral arteries (Sugihara et al., 2011). In this latter study, UTP-elicited inward currents could not be blocked by Pyr3 nor intracellularly applied anti-TRPC3 antibodies, although it could be due to the weak TRPC3 expression they found in rat vasculature. - 130 - DISCUSSION Figure D2. Effects of CaCCs (10 μM) blockers on PHE (10 μM)- induced vasoconstriction in a BPN mesenteric artery. We did not perform a full characterization of the sensitivity of the contractile response in BPN and BPH arteries to these inhibitors, but we hypothesize that the higher responsiveness to PHE typical of BPH (Figure R2) could be also due to a higher role of CaCCs in the α1-adrenergic signaling pathway in BPH mice. In fact, we hypothesize that some of the differences in the kinetic and the intensity of the responses to the activation of different Gq-coupled receptors are related to a different contribution of ROCs mediated by TRPC channels and depolarizing currents mediated by CaCCs, especially ANO1. This hypothesis needs to be confirmed with further experiments, quantitatively characterizing the role of TRPC3/6 and ANO1 in the response elicited by different relevant agonists. Although qPCR results showed a higher mRNA expression of ANO1 channels in BPH cells, and current-clamp experiments demonstrated a higher contribution of those channels to set the resting Vm in basal conditions and upon stimulation with UTP (Figures R22 and R23), we did not carry out in this Thesis a full characterization of the sensitivity to ANO1 inhibitors of UTP-elicited inward currents. These studies need to be done, but they must be properly designed in order to take into account the complex kinetic behavior of these channels. It is known that changes in [Cl-]o modulate the gating kinetics and the permeation properties of the channel both in resting (Contreras-Vite et al., 2016) and in UTP-activated conditions (Muraki, Imaizumi and Watanabe, 1998). A decrease in [Cl-]o lead to a decrease in the Clconductance of the channels and [Cl-]o has a dual effect on the kinetics of activation, being monoexponential at low concentrations and biexponential at large concentrations (Large and Wang, 1996; Muraki, Imaizumi and Watanabe, 1998; Contreras-Vite et al., 2016). - 131 - DISCUSSION In addition to this role of [Cl-]o modulating the channel conductance and the kinetic properties of ANO1, [Cl-]i in VSMCs is also of paramount importance, since the Clequilibrium potential is very close to Vm and changes in [Cl-]i would determine the net effect of the opening of chloride channels on resting Vm. Intracellular Clis not at equilibrium in VSMCs as its concentration depends on the activity of several transporters such as NKCC1 (see the Introduction section). Changes in the activity of this cotransporter can influence [Cl-]i, Cldriving force and then the subsequent effect on Vm of ANO1 activity. Previous studies on hypertensive animal models have reported a higher mRNA and protein expression of NKCC1 cotransporter associated to an increased functional activity and a larger contribution to myogenic tone and agonists-induced vasoconstriction (Meyer et al., 2002; Lee et al., 2010; Ye et al., 2012; Orlov et al., 2015). In addition, the blockade or even the lack of this cotransporter led to decreases in the agonists-induced vasoconstriction and in the mean blood pressure, as shown in studies using bumetanide and in studies in NKCC1-/- KO models (Meyer et al., 2002; Koltsova, Kotelevtsev, et al., 2009; Lee et al., 2010; Ye et al., 2012). We did not find any difference in the mRNA expression of NKCC1 between BPH and BPN mice (Figure R22), although preliminary functional studies revealed a relevant role of NKCC1 modulating PHE-induced constrictions of BPN mesenteric arteries (Figure D3). We are in the process of characterizing the effect of blocking NKCC1 in BPN and BPH mice, aiming to understand the relationship between [Cl-]i, CaCC activity and the hypertensive phenotype in response to different agonists. Figure D3. Vasodilator effect of the NKCC1 blocker bumetanide on PHE-induced vasoconstriction in a BPH mesenteric artery. - 132 - DISCUSSION Taken together, our results suggest a clear involvement of TRPC3/C6 and CaCCs (mainly ANO1) in setting the more depolarized resting Vm of BPH VSMC cells. In addition, the role of both channels in the contractile responses induced by GPCR agonists seems to be agonist dependent and quite different in BPN and BPH mice. UTP activation of the P2Y6-dependent purinergic signaling pathway increases membrane DAG (opening TRPC3/C6 channels) and [Ca2+]i (opening ANO1). The activation of both conductances depolarizes the membrane potential, activates VOCCs, further increases [Ca2+]i and induces the final contractile response. However, this response is only relevant in BPH arteries, since UTP is almost unable to elicit a response in BPN animals. Although ANO1 channels are good candidates to explain part of the differences between BPN and BPH responses to UTP, it is quite remarkable how subtle changes in the expression of all the players involved in the response to the same agonist produce such a big difference in the final output. A full understanding of the subtle differences that lead to the hypertensive phenotype of BPH mice requires a detailed characterization of the quantitative contribution of all the ionic channels involved in the control of membrane potential during the activation of different GPCRs by different agonists, especially if we consider that other G proteins, in addition to Gq are also relevant. This characterization is certainly part of a future project that will deepen our understanding of the differences between BPN and BPH mice, giving new quantitative insights that will have the huge advantage of allow a full integrative analysis of the results, since all subtle differences can be contextualized in the same model of hypertension. - 135 - CONCLUSIONS 1. BPH mice show a moderate essential hypertensive phenotype, which associates with an increased vascular tone and sympathetic activity. BPH mesenteric arteries exhibit larger responses to the α1-adrenergic agonist PHE than BPN arteries, whilst there are no differences in the effect of ATP. 2. Differences in the expression of TRPC3 and TRPC6 channels, which are the molecular correlate of the ROCs currents, can explain the differences in the α1adrenergic responses. The mRNA expression profile of TRPC channels demonstrate a larger expression of TRPC3 and a lower expression of TRPC6 channels in VSMCs from mesenteric BPH arteries. 3. Pyr compounds (10 and 3) and anti-TRPC antibodies are good tools to investigate the functional role of TRPC channels in native systems. Control experiments carried out in a heterologous expression system (CHO cells) have validated the use of Pyr compounds as blockers of TRC6 channels, and antiTRPC3 antibodies as blockers of TRPC3 channels. 4. The effect of Pyr compounds on PHE induced vasoconstriction is larger in BPN arteries, in good agreement with the higher expression of TRPC6 in those cells. 5. Basal TRPC currents in BPH VSMCs are larger, more sensitive to intracellular anti-TRPC3 antibody and less sensitive to Pyr3/10 blockers than in BPN cells. Altogether, these results suggest a higher contribution of TRPC3 channels to basal currents in BPH VSMCs. 6. PLA and immunocytochemical experiments demonstrate a different profile of TRPC3/C6 association in BPH VSMCs. BPH cells have a higher expression of TRPC3 channels in the membrane, either as homo or as heterotetramers with TRPC6, whilst TRPC6 homomultimers predominate in BPN VSMCs. 7. PHE, ATP and OAG-activated currents are similar in BPN and BPH VSMCs, while UTP activated ROCs are smaller in BPH VSMCs. The closer proximity between TRPC3/6 channels and P2Y6 UTP receptors in BPN VSMCs suggested by PLA and Super-resolution imaging techniques could explain these differences. However, ROCs elicited with all the stimuli are less sensitive to Pyr compounds in BPH cells, which agree with the higher expression of TRPC3 channels in these cells. 8. Pressure myography studies show that ATP induced vasoconstriction is mainly mediated through P2X1 receptors activation and is unchanged in BPH arteries. In contrast, UTP effect is much larger in BPH vessels. The increased expression and functional contribution of P2Y6 receptors in BPH mesenteric VSMCs can account for this effect of UTP. 9. In current-clamp experiments, UTP induced depolarization of VSMCs cells is significantly larger in BPH cells. This effect is insensitive to Pyr10 but can be inhibited by CaCCs blockers such as Niflumic acid and ANO1-inhibitor. There is also a larger contribution of CaCCs to UTP activated currents in BPH cells, and a - 136 - CONCLUSIONS larger mRNA expression of ANO1 and its regulatory subunit ClCa1. These results strongly suggest that UTP-induced depolarization is mediated by the activation of ANO1 channels. 10. GPCR signaling pathways in BPN/PBH mice are mediated by the integrated coupling between GPCRs and TRPC3/6 and ANO1 channels, although the relative importance of those channels seems to be receptor dependent. Although both TRPC and ANO1 channels contribute to set the resting Vm of VSMCs, ANO1 channels are the essential mediators of the UTP-induced depolarizations. In this context, differences in the functional expression and/or the coupling between GPCRs and TRPC and CaCCs channels could contribute to the increased reactivity of BPH arteries, pointing out to all these proteins as new potential therapeutic targets for the treatment of essential hypertension - 139 - REFERENCES Aaronson, P. I., Ward, J. P. T. and Wiener, C. M. (2004) The Cardiovascular System at a Glance. 2nd edn. Oxford: Blackwell Publishing. Adebiyi, A. et al. (2010) ‘Isoformselective physical coupling of TRPC3 channels to IP3 receptors in smooth muscle cells regulates arterial contractility’, Circulation Research, 106(10), pp. 1603–1612. Adebiyi, A. et al. (2012) ‘An elevation in physical coupling of type 1 inositol 1,4,5trisphosphate (IP3) receptors to transient receptor potential 3 (TRPC3) channels constricts mesenteric arteries in genetic hypertension’, Hypertension, 60(5), pp. 1213–1219. Albert, A. P. et al. (2006) ‘TRPC3 properties of a native constitutively active Ca2+-permeable cation channel in rabbit ear artery myocytes’, Journal of Physiology, 571(2), pp. 361–369. Alexander, S. et al. (2017) Concise Guide to Pharmacology 20178/2018: Other ion channels., Br J Pharmacol. Alvarez, J. et al. (2008) ‘ATP/UTP activate cation-permeable channels with TRPC3/7 properties in rat cardiomyocytes’, American journal of physiology. Heart and circulatory physiology, pp. 21–28. Ambudkar, I. S., de Souza, L. B. and Ong, H. L. (2017) ‘TRPC1, Orai1, and STIM1 in SOCE: Friends in tight spaces’, Cell Calcium. Elsevier Ltd, 63, pp. 33–39. Babenko, A. P., Aguilar-Bryan, L. and Bryan, J. (1998) ‘A view of SUR/K IR 6.X, K ATP channels’, Annual Review of Physiology, 60, pp. 667–687. Bannister, J. P. et al. (2012) ‘Transcriptional upregulation of α2δ-1 elevates arterial smooth muscle cell voltage-dependent Ca2+ channel surface expression and cerebrovascular constriction in genetic hypertension’, Hypertension, 60(4), pp. 1006–1015. Bar, I. et al. (2008) ‘Knockout Mice Reveal a Role for P2Y 6 Receptor in Macrophages , Endothelial Cells , and Vascular Smooth Muscle Cells’, Molecular Pharmacology, 74(3), pp. 777–84. Berg, T. (2003) ‘The vascular response to the K+channel inhibitor 4-aminopyridine in hypertensive rats’, European Journal of Pharmacology, 466(3), pp. 301–310. Billaud, M. et al. (2011) ‘Pannexin1 regulates α1-adrenergic receptormediated vasoconstriction’, Circulation Research, 109(1), pp. 80–85. Boedtkjer, D. M. B. et al. (2008) ‘Vasomotion has chloride-dependency in rat mesenteric small arteries’, Pflugers Archiv European Journal of Physiology, 457(2), pp. 389–404. Bolte, S. and Cordelieres, F. P. (2006) ‘A guided tour into subcellular colocalisation analysis in light microscopy’, Journal of Microscopy, 224(3), pp. 13–232. Bradley, E. et al. (2014) ‘Pharmacological characterization of TMEM16A currents’, Channels, 8(4), pp. 308–320. Bradley, K. K. et al. (1999) ‘Kir2.1 encodes the inward rectifier potassium channel in rat arterial smooth muscle cells’, J Physiol, 515 ( Pt 3(1999), pp. 639–651.