Characterization of the High-Pathogenicity Island encoding the siderophore piscibactin in Vibrio anguillarum: effects on bacterial virulence and implications for the control of vibriosis in fish
Abstract
Vibrio anguillarum is a marine pathogen that can infect warm- and coldwater fish with economical importance in aquaculture. One of the main virulence factosr of this organism is the synthesis and utilization of siderophores, molecules able to bind iron with high affinity from the environment and/or host tissues. Two siderophore-mediated systems have been described: a system that encodes vanchrobactin (encoded in the chromosome and present in all pathogenic strains) and another that encodes anguibactin (encoded in the plasmid pJM1 and present in serotype O1 strains). The vanchrobactin biosynthesis and transport genes are present in all strains but the expression is inactivated in strains that harbour the plasmid pJM1. Recently, genome analysis of V. anguillarum strain RV22 (vanchrobactin producer) revealed the presence of a gene cluster homologous to the Photobacterium damselae subsp. piscicida irp cluster that encodes the siderophore piscibactin. This observation rises the hypothesizes that RV22 could produce a piscibactin-like siderophore in addition to vanchrobactin. Therefore, the present work will focus on the mechanism involved in piscibactin biosynthesis, transport and regulation and its contribution to fish virulence. The regulation of the biosynthesis and secretion of both siderophores will be also studied. Furthermore, we will assess the contribution of vanchrobactin and piscibactin to the virulence of V. anguillarum. Vanchrobactin has been extensively studied, and the genes involved in its biosynthesis and transport have been established, but there are many regulatory aspects still unknown. However not much is known about piscibactin because it is the main siderophore of Pdp, a bacterium that is highly difficult to manipulate genetically. Therefore, we will study the molecular mechanisms involved in its biosynthesis, transport and regulation in V. anguillarum and the contribution of piscibactin to the virulence, persistence and dissemination of this pathogen in the host. Finally, we will evaluate the potential use of vanchrobactin and piscibactin outer membrane receptors as vaccines for use in aquaculture systems.
Full text
'2&725$/7+(6,6 %*#4#%6'4+<#6+101(6*'*+)*2#6*1)'0+%+6;+5.#0&'0%1&+0)6*' 5+&'412*14'2+5%+$#%6+0+0 8+$4+1#0)7+..#47/ '(('%6510$#%6'4+#. 8+47.'0%'#0&+/2.+%#6+105(146*'%10641.1(8+$4+15+5+0(+5* 0DUWD&DUROLQD$IRQVR/DJHV +06'40#6+10#.2*&5%*11.1(6*'70+8'45+6;1(5#06+#)1&'%1/2156'.# 2*&241)4#//'+0#&8#0%'5+0/+%41$+#.#0&2#4#5+6+%$+1.1); 6$17,$*2'(&203267(/$
DECLARACIÓN DEL AUTOR/A DE LA TESIS D./Dña. Marta Carolina Afonso Lages Título da tese: Characterization of the High-Pathogenicity Island encoding the siderophore piscibactin in Vibrio anguillarum: effects on bacterial virulence and implications for the control of vibriosis in fish Presento mi tesis, siguiendo el procedimiento adecuado al Reglamento y declaro que: 1) La tesis abarca los resultados de la elaboración de mi trabajo. 2) De ser el caso, en la tesis se hace referencia a las colaboraciones que tuvo este trabajo. 3) Confirmo que la tesis no incurre en ningún tipo de plagio de otros autores ni de trabajos presentados por mí para la obtención de otros títulos. 4) La tesis es la versión definitiva presentada para su defensa y coincide la versión impresa con la presentada en formato electrónico. Y me comprometo a presentar el Compromiso Documental de Supervisión en el caso que el original no estédepositado en la Escuela. En Santiago de Compostela, 27 de diciembre de 2021.
#7614+<#%+ĵ0 &'. &+4'%614 67614&'.#6'5+5 %JCTCEVGTK\CVKQP QH VJG *KIJ2CVJQIGPKEKV[ +UNCPF GPEQFKPI VJG UKFGTQRJQTG RKUEKDCEVKPKP 8KDTKQCPIWKNNCTWO GHHGEVUQPDCEVGTKCNXKTWNGPEGCPFKORNKECVKQPUHQT VJGEQPVTQNQHXKDTKQUKUKPHKUJ ''ą /CPWGN.WKU.GOQU4COQU 7XWRU\'LUHFWRU ''ą /KIWGN$CNCFQ&CEQUVC 'LUHFWRU ,1)250$1 4XH OD SUHVHQWH WHVLV VH FRUUHVSRQGH FRQ HO WUDEDMR UHDOL]DGR SRU ''ą /CTVC%CTQNKPC #HQPUQ .CIGU EDMR QXHVWUD GLUHFFLyQWXWRUL]DFLyQ \ D XWRUL]DPRV VX SUHVHQWDFLyQ FRQVLGHUDQGR TXH UH~QH O RV U HTXLVLWRV H[LJLGRV HQ HO 5 HJODPHQWR GH (VWXGLRV GH 'RFWRUDGRGHOD86& \ TXH FRPRGLUHFWRUHVGHHVWD QRLQFXUUHQHQODV FDXVDV GH DEVWHQFLyQ HVWDEOHFLGDV HQOD /H\ 'HDFXHUGRFRQORLQGLFDGRHQHO5HJODPHQWRGH(VWXGLRVGH'RFWRUDGRGHFODUDQWDPELpQ TXH OD SUHVHQWH WHVLV GRFWRUDO HV LGyQHD SDUD VHU GHIHQGLGD HQ EDVH D OD PRGDOLGDG 0RQRJUiILFDFRQUHSURGXFFLyQGHSXEOLFDFLRQHVHQORVTXHODSDUWLFLSDFLyQGHODGRFWRUDQGD IXHGHFLVLYDSDUDVXHODERUDFLyQ\ODVSXEOLFDFLRQHVVHDMXVWDQDO3ODQGH,QYHVWLJDFLyQ (Q6DQWLDJRGH&RPSRVWHODGHGLFLHPEUHGH
This work was supported by grants AGL2015-63740-C2-1-R, RTI2018093634-B-C21 from the State Agency for Research (AEI) of Spain, both cofunded by the FEDER Programme (“A way to make Europe”) from the European Union, and by grant PID2019-103891RJ-100 from MCIN/AEI (Spain) (MCIN/AEI/10.13039/501100011033/FEDER). The work was also supported by grants GRC-2014/007 and GRC2018/018 from Xunta de Galicia. The stay in University of Porto (Portugal) was supported by the FEMS fellowship, FEMS-GO-2019-600.
ABSTRACT Vibrio anguillarum is one of the most important pathogens for aquacultured fish, causing vibriosis, a haemorrhagic septicaemia that affects fish species living at different temperatures. Besides, V. anguillarum is an inhabitant of marine and estuarine environments, so it must be able to adapt its physiology to the changing levels of salinity, nutrients, and temperature. Although water temperature raising is usually associated with a higher incidence of vibriosis, 15 °C is considered enough for the occurrence of vibriosis outbreaks. In this work, we analyzed the physiological adaptations of V. anguillarum to low-iron availability and temperature changes that enable it to cause vibriosis in a wide diversity of fish species. Some of these adaptations include the expression of virulence factors that will led to the disease. We used the serotype O2a pathogenic strain RV22 as a model of study. The faster growth shown by V. anguillarum RV22 at 25 ºC compared to growth at 15 ºC, contrasts with its higher virulence at 15 ºC. Temperature and iron levels usually act as signals during host colonization. Therefore, first we analyzed by RNAseq the effect of iron levels and temperature changes on the transcriptome of V. anguillarum RV22. The comparative analysis revealed that under iron deficiency deep changes in the metabolism appear and virulence factors are induced. Metabolic routes requiring iron such as TCA cycle and cytochromes were down-regulated, while genes related to the glycolytic and pentose phosphate pathways were up-regulated. Some components of amino acids and carbohydrate metabolism were down-regulated at 15 ºC, which suggests a slower nutrient import rate at 15 ºC. Interestingly, V. anguillarum expresses different virulence factors at 15 ºC or 25 ºC. At warm temperature, V. anguillarum induces chemotaxis, motility, exopolysaccharide biosynthesis, haemolysin Vah1, T6SS, and the outer membrane components OmpA and OmpV. Conversely, the haemolysin RTX, T6SS2, OmpC, and genes related to
exopolysaccharide transport and assembly, were induced preferentially at 15 ºC. Regarding iron uptake systems, ferrous iron uptake feoB, the vanchrobactin siderophore system and haem utilization were preferentially expressed at 25 ºC whereas the piscibactin siderophore system was strongly up-regulated at 15 ºC. The differential expression of virulence factors in relation to temperature indicates that their relevance may vary between hosts, enabling V. anguillarum to infect fish species living at cold and warm waters. Siderophores are key virulence factors in most pathogens. In V. anguillarum, two siderophore systems have been described: the pJM1 plasmid-encoded anguibactin, which is restricted to serotype O1 strains, and the chromosomally encoded vanchrobactin, which is widespread among pathogenic and environmental isolates. In addition, the genome of V. anguillarum RV22 contains a genomic island that is homologous to the pathogenicity island irp-HPI harbored in plasmid pPHDP70 of Photobacterium damselae subsp. piscicida (Pdp). This island encodes the siderophore piscibactin and it is likely spread among bacteria through HGT. An in silico analysis revealed that irp-HPI is present in several highly virulent V. anguillarum strains that have an active vanchrobactin system. In fact, the 4’-phosphopantetheinyl transferase activity needed for piscibactin synthesis is only encoded by vabD, which is part of the vanchrobactin gene cluster. The chemical analysis clearly demonstrated that V. anguillarum synthesizes piscibactin in addition to vanchrobactin. In vitro growth ability and virulence assays performed with single and combined mutants, suggest that vanchrobactin could be more related to environmental survival, while piscibactin is a key virulence factor for V. anguillarum pathogenesis. The irp-HPI island putatively encodes synthesis and transport of piscibactin and their regulation. The construction of mutants by allelic exchange allowed the elucidation of the role of Irp1, Irp4, Irp8 and FrpABC in piscibactin biosynthesis and utilization. Irp1 is the main NRPS/PKS essential for piscibactin synthesis. The type II thioesterase Irp4 is required for the biosynthesis final steps. Piscibactin is secreted out of the cell through the MFS protein Irp8 located at the plasma membrane. The ferri-piscibactin complex reaches the periplasm through FrpA, a TonB-dependent outer membrane transporter, and it is
transported through the inner membrane by the ABC-type transporter FrpBC. To identify the key structural elements of piscibactin necessary for its transport through FrpA, piscibactin analogues were synthesized and their ability to act as iron source was investigated. The growth promotion assays identified the configuration of C-13 as crucial for iron chelation and recognition by FrpA. The widespread distribution of FrpA suggests that piscibactin analogues carrying antimicrobials could be used in novel therapies against a wide range of pathogens. The transcriptional analysis of irp-HPI showed that piscibactin promoters PpbtA, PfrpA and PfrpBC respond to iron levels and temperature. The measure of transcriptional activity revealed that piscibactin regulatory (PpbtA) and transport genes (PfrpA and PfrpBC) are preferentially expressed under iron deficiency at 15 ºC. irp-HPI putatively encodes two AraC-like transcriptional regulators, PbtA and PbtB. In addition, the global regulators H-NS and ToxR-S are also present in V. anguillarum. To analyze the regulation of irp-HPI expression, in-frame deletion mutants of pbtA, pbtB and the global regulators h-ns and toxR-S were constructed and their relevance for growth under iron deficiency and irp-HPI gene expression was analyzed at 15 and 25 ºC. The results showed that whereas pbtA is required for the expression of piscibactin biosynthetic and transport genes, pbtB is not. The inactivation of H-NS resulted in a decreased growth under iron deficiency and a low activity of PfrpA at 15 and 25 ºC. Inactivation of ToxR-S increased the transcriptional activity of PfrpA and PpbtA at 25 ºC. Notably, the inactivation of PbtA and H-NS resulted in a marked decrease of virulence for fish, which corroborates the importance of piscibactin for the virulence of V. anguillarum. The results suggest that PbtA is the main modulator of irp-HPI gene expression, and that H-NS is indirectly required for the maximum production of piscibactin. ToxR-S could be involved in the repression of piscibactin genes at 25 ºC. Several versions of the promoters PpbtA and PfrpA were identified in different bacteria harbouring irp-HPI. PfrpA showed the highest variability, which indicates that different expression patterns might be present. For instance, the shorter version of PfrpA present in Pdp does not act as transcription start and, in contrast to V. anguillarum, irp-HPI
from Pdp did not show a temperature dependent expression. However, when PfrpA and PpbtA promoters of irp-HPI from Pdp were cloned into V. anguillarum, they also showed a temperature-dependent expression pattern. This indicates that the temperature-dependent expression of irp-HPI depends on activator(s) present in V. anguillarum and absent in Pdp. Since siderophore systems are expressed during the infection process, we finally evaluated the use of the siderophore outer membrane transporters FrpA and FvtA as subunit vaccines against vibriosis. Fish were immunized with the recombinant proteins rFrpA or rFvtA, a RV22 or Pdp bacterin and the antibody levels were measured by ELISA. Both FrpA and FvtA are immunogenic proteins, but they confer limited protection against V. anguillarum infection. However, it is noteworthy that V. anguillarum FrpA conferred cross protection against Pdp. This result indicates that the widespread distribution of FrpA could be used to formulate subunit vaccines against irp-HPI-harbouring pathogens. In summary, in this thesis we demonstrated that V. anguillarum expresses a specific cocktail of virulence factors depending on the environmental temperature, which enables it to infect fish living at cold and warm waters. In addition, V. anguillarum produces the siderophore piscibactin as a key virulence factor, whose expression is regulated by iron levels and favoured at low temperatures.
RESUMO A acuicultura é un sector en constante expansión e nas últimas décadas medrou de maneira exponencial, superando á pesca como principal fonte de produtos acuáticos. Con todo, a alta densidade de individuos nos sistemas de cultivo promoven a aparición e transmisión de patóxenos. Este ambiente favorece fenómenos de evolución das poboacións bacterianas onde a adquisición de factores de virulencia a través da transferencia horizontal de xenes conduce á aparición de novos patóxenos nas plantas de cultivo. Vibrio anguillarum é un dos patóxenos de peixes máis importantes na acuicultura, sendo o axente causal da vibriose, unha septicemia hemorráxica que afecta a especies de peixes que viven nun amplo rango de temperaturas. Así mesmo, V. anguillarum é unha bacteria que habita tanto ambientes mariños como en esteiros, polo que debe de ser capaz de adaptar a súa fisioloxía aos constantes cambios nos niveis de salinidade, nutrientes e temperatura. Aínda que o aumento da temperatura da auga adoita estar asociado coa proliferación de especies de Vibrio e, en consecuencia, cunha maior incidencia de vibriose, V. anguillarum é capaz de causar gromos a temperaturas baixas (5 - 18 ºC), sendo unha temperatura de 15 °C suficiente como para permitir a aparición de gromos. A vibriose é unha enfermidade de evolución rápida na que a morte do hóspede pode ocorrer sen mostrar ningún síntoma externo de enfermidade. Neste tipo de infeccións é de suma importancia o estudo das interaccións hóspedepatóxeno e dos mecanismos implicados na virulencia. En bacterias patóxenas a temperatura e os niveis de ferro adoitan actuar como sinais para iniciar a colonización do hóspede. Neste traballo, analizamos as adaptacións fisiolóxicas de V. anguillarum en condicións de baixa dispoñibilidade de ferro e a diferentes temperaturas, factores que permiten á bacteria provocar gromos de vibriose nun amplo rango de especies de peixes. Algunhas das devanditas adaptacións inclúen a expresión de factores de virulencia que contribúen de forma significativa ao desenvolvemento da enfermidade. Nesta tese utilizouse como modelo a cepa patóxena RV22
que pertence ao serotipo O2a de V. anguillarum. Nesta bacteria observouse unha maior taxa de crecemento a 25 ºC en comparación a 15 ºC, o cal contrasta coa súa maior virulencia a esta última temperatura. Para estudar estes dous factores de virulencia, primeiro analizouse por medio da técnica de RNAseq o efecto dos niveis de ferro e dos cambios de temperatura no transcriptoma de V. anguillarum RV22. Para iso cultivouse a bacteria en medio mínimo CM9 suplementado co quelante de ferro 2,2'- dipiridilo a 15 ºC e 25 ºC. Esta redución da dispoñibilidade de ferro intenta simular as condicións que atopan os patóxenos bacterianos cando infectan a un hóspede. Como control utilizouse a condición de exceso de ferro para identificar especificamente aqueles xenes regulados polos niveis de ferro. A análise comparativa revelou que en déficit de ferro danse cambios profundos no metabolismo celular da bacteria e indúcese a transcrición de factores de virulencia. Así mesmo, verificouse unha redución na expresión dos xenes relacionados cas rutas metabólicas con altos requirimentos de ferro para o seu funcionamento, como o ciclo do ácido tricarboxílico (TCA) e os citocromos, mentres que os xenes relacionados coas vías glucolítica e das pentosas fosfato aumentaron a súa expresión. O crecemento baixo condicións de limitación de ferro induce tamén cambios nos requirimentos de aminoácidos. Demostrouse que existe unha diminución na expresión de xenes relacionados coa degradación de valina, leucina e isoleucina e co metabolismo da histidina. Pola contra, houbo un aumento na expresión de xenes implicados na síntese dos aminoácidos aromáticos fenilalanina, tirosina e triptófano. En particular, existe unha activación da ruta de síntese da arxinina, un aminoácido necesario para a síntese do sideróforo vancrobactina. Ademais, algúns dos compoñentes do metabolismo de aminoácidos e carbohidratos reduciron a súa expresión a 15 ºC, o que suxire unha taxa de captación de nutrientes máis lenta a esta temperatura. Esta diminución dos nutrientes correlacionase de maneira directa coa taxa de crecemento máis lenta observada a temperatura baixa. Ademais, a 15 ºC observouse unha diminución na expresión de xenes relacionados coa síntese das subunidades maiores e menores que conforman os ribosomas e coa bioxénese de tARN.
A deficiencia de ferro induciu a expresión de factores de virulencia, pero curiosamente, V. anguillarum expresa distintos factores de virulencia a 15 ºC e a 25 ºC. A temperatura alta indúcese a biosíntese do lipopolisacárido, hemolisina Vah1, T6SS-1 e compoñentes da membrana externa OmpA e OmpV. Pola contra, a hemolisina RTX, T6SS-2, OmpC e xenes relacionados co transporte e ensamblaxe de exopolisacáridos, inducíronse preferentemente a 15 ºC. En xeral, os xenes relacionados coa virulencia inducíronse en condicións de limitación de ferro, con todo, atopáronse dúas excepcións a este feito. Os xenes relacionados coa quimiotaxe e a motilidade sufriron unha redución da súa expresión baixo limitación de ferro. En canto aos sistemas de captación de ferro, o sistema de internalización do ión ferroso feoB, o sistema do sideróforo vancrobactina e a utilización de hemo expresáronse preferentemente a 25 ºC, mentres que a síntese do sideróforo piscibactina incrementouse de maneira significativa a 15 ºC. Con respecto ao sistema do sideróforo piscibactina, os xenes para o posible regulador transcricional araC1 e o posible transportador de membrana externa frpA encóntranse entre os xenes máis inducidos a 15 ºC. A virulencia é un trazo multifactorial e a expresión diferencial dos factores de virulencia en relación coa temperatura indica que a relevancia destes factores pode variar entre hóspedes, o que permite a V. anguillarum infectar especies de peixes que viven tanto en augas frías como cálidas. A restrición de ferro é un mecanismo de defensa do hóspede, polo tanto, para establecer unha infección exitosa, os patóxenos deben posuír mecanismos para adquirir ferro das fontes do hóspede. Os sideróforos como método de captación de ferro son factores clave para a virulencia na maioría dos patóxenos. En V. anguillarum, describíronse dous sistemas de sideróforos: a anguibactina codificada polo plásmido pJM1, que está restrinxida ás cepas do serotipo O1, e a vancrobactina que está codificada cromosómicamente. A vancrobactina considérase o sideróforo ancestral da especie xa que está moi estendida entre illados patóxenos e ambientais. Este sistema de sideróforo inactivase nas cepas que albergan o plásmido pJM1. Ademais, no xenoma de V. anguillarum RV22 atópase unha illa xenómica homóloga á illa de patoxenicidade irp-HPI localizada no plásmido conxugativo pPHDP70 de
Photobacterium damselae subsp. piscicida. Esta illa codifica o sideróforo piscibactina e é probable que se propague entre as bacterias a través de fenómenos de transferencia horizontal de xenes. Unha análise in silico revelou que a illa irp-HPI está presente en varias cepas de V. anguillarum altamente virulentas que portan o sistema da vancrobactina activo. De feito, a actividade da 4'-fosfopanteteinil transferasa, requirida para a síntese da piscibactina, só está codificada polo xene vabD o cal está localizado no sistema de xenes da vancrobactina. Polo tanto, a interacción entre os sistemas de sideróforos da vancrobactina e da piscibactina é esencial para a síntese deste último sideróforo. A análise química dos sobrenadantes dos cultivos da bacteria demostrou inequivocamente que V. anguillarum é capaz de sintetizar piscibactina ademais de vancrobactina. Os ensaios de capacidade de crecemento in vitro e de virulencia realizados con mutantes simples e combinados suxiren que a vancrobactina podería estar máis relacionada coa supervivencia ambiental, mentres que a piscibactina sería un factor de virulencia clave para a patoxénesis de V. anguillarum, xa que a súa inactivación non afectou en gran medida a capacidade de V. anguillarum para crecer en condicións limitantes de ferro. A illa irp-HPI codificaría funcións relacionadas coa síntese, transporte e regulación da piscibactina. A construción de mutantes por intercambio alélico dos xenes desta illa permitiu dilucidar o papel das proteínas Irp1, Irp4, Irp8 e FrpABC na biosíntese e utilización de este sideróforo. Irp1 (NRPS/PKS) é a principal encima da ruta, sendo esencial para a síntese do sideróforo. A inactivación do xene irp1 nunha cepa produtora de piscibactina afectou de maneira significativa á capacidade de crecemento en condicións de limitación de ferro resultando nunha diminución na produción de sideróforos. A tioesterasa tipo II Irp4 é necesaria para os pasos finais da biosíntese, xa que libera o sideróforo do complexo multienzimático. A inactivación de irp4 resultou tamén nunha diminución do crecemento en déficit de ferro, e, ademais, non se detectou piscibactina en sobrenadantes dos cultivos desta cepa mutante. A secreción de metabolitos por parte da célula debe ocorrer de maneira secuencial. A piscibactina transportase ao periplasma a través da proteína Irp8, pertencente á superfamilia maior
de facilitadores situada na membrana plasmática, xa que o mutante para este transportador non puido promover o crecemento dunha cepa incapaz de producir sideróforos. Con todo, non se definiron todos os compoñentes que interveñen no proceso de secreción. O complexo de ferri-piscibactina internalízase a través de transportadores de membrana externa específicos. A enerxía para o devandito transporte é subministrada pola forza protón-motriz da membrana interna. Logo, o complexo ferri-piscibactina é transportado ao periplasma a través de FrpA, un transportador de membrana externa dependente de TonB, para finalmente ser transportado a través da membrana interna polo transportador de tipo ABC dimérico FrpBC. As deleccións simples para ambos transportadores deron como resultado unha diminución drástica da capacidade de crecemento en condicións de déficit de ferro, ademais de que ningunha das cepas mutantes puido utilizar a piscibactina como fonte de ferro en ensaios de alimentación cruzada. Co obxectivo de identificar os elementos estruturais clave do sideróforo piscibactina necesarios para o recoñecemento por parte do transportador FrpA, sintetizáronse químicamente análogos deste sideróforo e determinouse a súa capacidade para actuar como fonte de ferro. Os ensaios de actividade dos análogos identificaron a configuración do C-13 do sideróforo como crucial para quelar o ferro e para ser recoñecido por parte do transportador FrpA. Curiosamente, tamén se demostrou que estos análogos da piscibactina poden ser internalizados eficientemente a través de diferentes versións de FrpA (V. anguillarum e P. damselae subsp. piscicida). A ampla distribución de FrpA suxire que a utilización de análogos de piscibactina como vectores para axentes antimicrobianos podería abrir a porta ao desenvolvemento de novas terapias contra unha ampla gama de patóxenos. A activación de factores de virulencia debe estar estritamente regulada a nivel transcricional para que estes se activen cando sexa necesario. A análise transcricional de irp-HPI mostrou que o grupo de xenes da piscibactina transcríbense nun único mARN policistrónico que inclúe os xenes pbtA, pbtB, frpA, irp1-5, irp8 e irp9. Así mesmo, os xenes da piscibactina relacionados coa súa síntese, transporte e regulación cotranscríbense dende o promotor situado augas arriba de pbtA. Con todo, a análise dos niveis transcricionais revelou que existen
rexións interxénicas que actúan como promotores. Ademais, os promotores PpbtA, PfrpA e PfrpBC responden aos niveis de ferro e a temperatura. O estudo da actividade transcricional revelou que os xenes reguladores (PpbtA) e de transporte (PfrpA e PfrpBC) da piscibactina exprésanse preferentemente en déficit de ferro a 15 ºC, é dicir posúen un dobre requisito para poder expresarse de forma significativa. A adquisición da illa irp-HPI por parte de V. anguillarum mellora a súa flexibilidade de nicho e permite que o patóxeno infecte unha ampla gama de hóspedes. O ADN adquirido a través da transferencia horizontal adoita codificar factores que regulan a súa propia expresión. Pola contra, elementos codificados no xenoma bacteriano receptor poderían estar implicados na regulación dos xenes adquiridos. Por tanto, son necesarios mecanismos de regulación estritos para modular a expresión do ADN adquirido. irp-HPI probablemente codifica dous reguladores transcripcionales similares a AraC nomeados como PbtA e PbtB. Os activadores transcricionales do tipo AraC están involucrados nunha variedade de funcións reguladoras relacionadas con procesos celulares: modulación do metabolismo do carbono, resposta ao estrés e virulencia. PbtA e PbtB teñen a característica organización de dous dominios, un dominio C-terminal conservado e un dominio N-terminal variable. Ademais, V. anguillarum porta os reguladores xerais H-NS e ToxR-S. H-NS participa na represión de xenes adquiridos mediante transferencia horizontal, mentres que ToxR-S media na activación transcricional de factores de virulencia relevantes en Vibrios patóxenos en resposta a sinais ambientais. Para analizar a regulación da expresión de irp-HPI, construíronse mutantes por delección in-frame de pbtA, pbtB e dos reguladores globais h-ns e toxR-S e analizouse a súa relevancia para o crecemento baixo deficiencia de ferro e para a expresión dos xenes da illa irp-HPI a 15 e 25 ºC. Os resultados mostraron que pbtA é necesario para o crecemento en condicións de limitación de ferro e para a expresión dos xenes biosintéticos e de transporte da piscibactina. Polo contrario, a inactivación de pbtB non produciu ningún cambio fenotípico nin de expresión xénica. Ademais, PbtA non induce a expresión do seu propio promotor (PpbtA). A inactivación de H-NS produciu unha diminución do crecemento en déficit de ferro e unha redución da actividade transcricional de PfrpA
O OD600 – Optical Density at 600 nm OMP – Outer Membrane Proteins ORF – Open Reading Frame P PBS – Phosphate-buffered Saline Pcb – Piscibactin PCP – Peptidyl Carrier Protein PCR – Polymerase Chain Reaction Pdp – Photobacterium damselae subsp. piscicida PKS – Polyketide Synthase PVDF – Polyvinylidene Fluoride R Rif – Rifampicin Rifr – Rifampicin resistance RNAseq – Whole mRNA Sequencing RND – Resistance-nodulation-cell division RT-PCR – Reverse Transcription Polymerase Chain Reaction RTX – Repeat in Toxin S SDS-PAGE – Sodium Dodecyl Sulphate-Polyacrylamide Gel Electrophoresis T T1SS – Type I Secretion System T6SS – Type VI Secretion System TAE – Tris, acetic acid and EDTA buffer TBDT – TonB Dependent Transporter TBE – Tris, boric acid and EDTA buffer TBO – Temperature Below Optimal TBS – Tris-buffered Saline TBST – Tris-buffered Saline with Tween TCA – Tricarboxylic acid cycle TE – Thioesterase TE I – Type I Thioesterase
TE II – Type II Thioesterase TSA-1 – Tryptic Soy Agar supplemented until 1% of NaCl TSB-1 – Tryptic Soy Broth supplemented until 1% of NaCl TTBS – Tween Tris-buffered Saline V Vah – V. anguillarum haemolysin Vang – V. anguillarum W wgs – whole-genome shotgun
INDEX I. INTRODUCTION ...................................................................................... 1 1. AQUACULTURE: PAST, PRESENT AND FUTURE PERSPECTIVES ................ 3 1.1. Infectious diseases and vaccines in aquaculture ........................... 5 2. VIBRIO ANGUILLARUM AS A FISH PATHOGEN ........................................... 8 2.1. General characteristics of V. anguillarum ..................................... 9 2.2. Host colonization and vibriosis ................................................... 10 2.3. Virulence factors described in Vibrio anguillarum ..................... 12 2.3.1. Chemotactic motility and adhesion ..................................... 12 2.3.2. Metalloproteases and haemolysins ..................................... 13 2.3.3. Outer membrane components – LPS and OMPs ................ 14 2.3.4. Type VI Secretion System - T6SS ...................................... 15 2.3.5. Iron uptake mechanisms ..................................................... 16 3. IRON UPTAKE MEDIATED BY SIDEROPHORES IN V. ANGUILLARUM ........ 19 3.1. The vanchrobactin siderophore system ....................................... 21 3.2. Evidence for a third siderophore in V. anguillarum .................... 25 4. KEY SIGNALS IN VIRULENCE FACTORS REGULATION ........................... 28 II. OBJECTIVES .......................................................................................... 33 III. MATERIAL AND METHODS ............................................................. 37 1. BACTERIAL STRAINS, PLASMIDS AND GROWTH CONDITIONS ............. 39 2. DNA MANIPULATION AND CLONING .................................................. 42 2.1. Genomic and plasmidic DNA extraction .................................... 42 2.2. Polymerase chain reactions (PCR) .............................................. 42 2.3. Cloning of DNA fragments ......................................................... 42 2.4. Construction of mutant strains by allelic exchange .................... 43 2.5. Complementation of mutant strains ............................................ 47 3. RNA ANALYSIS .................................................................................... 51 3.1. RNA purification and RT-PCR ................................................... 51 3.2. RNA sequencing ......................................................................... 51 3.2.1. Growth conditions and total RNA extraction ..................... 51 3.2.2. cDNA library construction and sequencing ........................ 52 3.2.3. Bioinformatic analysis and gene expression quantification 52 4. LACZ TRANSCRIPTIONAL FUSIONS AND β-GALACTOSIDASE ASSAYS ... 53 5. PHENOTYPIC CHARACTERIZATION ....................................................... 55 5.1. Growth promotion assays and siderophore production ............... 55 5.2. Cross-feeding assays ................................................................... 55 5.3. Motility ....................................................................................... 56 5.4. Biofilm formation ....................................................................... 56
5.5. Haemolytic activity ..................................................................... 56 6. WESTERN BLOT ANALYSIS .................................................................... 57 6.1. Antibody anti-FrpA design .......................................................... 58 7. BIOLOGICAL ACTIVITY OF PISCIBACTIN ANALOGUES ........................... 58 8. ELECTROPHORETIC MOBILITY SHIFT ASSAY ......................................... 59 8.1. Cloning ........................................................................................ 59 8.2. Expression tests ........................................................................... 61 8.3. Protein purification ...................................................................... 61 8.4. Electrophorectic Mobility Shift Assay (EMSA) ......................... 63 9. EXPERIMENTAL INFECTIONS ................................................................. 65 10. VACCINATION ASSAYS ........................................................................ 65 10.1. Immunization ............................................................................ 65 10.2. Determination of antibody levels by ELISA ............................. 67 11. BIOINFORMATIC ANALYSIS ................................................................. 69 11.1. irp-HPI structure and distribution ............................................. 69 11.2. Promoter sequence analysis and phylogenetic reconstitution ... 69 11.3. FrpA phylogenetic analysis ....................................................... 70 IV. RESULTS AND DISCUSSION ............................................................ 71 1. ADAPTATIONS OF V. ANGUILLARUM THAT ENABLE IT TO CAUSE VIBRIOSIS IN WARM-AND COLD-WATER FISH SPECIES ............................................... 73 1.1. EFFECT OF TEMPERATURE IN THE GROWTH KINETICS AND VIRULENCE OF V. ANGUILLARUM......................................................... 73 1.2. TRANSCRIPTOMIC ADAPTATIONS OF V. ANGUILLARUM TO GROWTH UNDER LOW IRON AVAILABILITY AT COLD OR WARM TEMPERATURE 7 5 1.3. METABOLIC ADAPTATIONS TO GROWTH UNDER IRON STARVATION ....................................................................................................... 78 1.4. EXPRESSION OF VIRULENCE FACTORS AT WARMAND COLDWATER TEMPERATURE UNDER IRON STARVATION ............................. 82 1.4.1. Lipopolysaccharide and exopolysaccharide related genes .. 83 1.4.2. Type VI Secretion System and outer membrane proteins ... 86 1.4.3. Haemolysins ........................................................................ 89 1.4.4. Chemotaxis and Motility ..................................................... 92 1.4.5. Iron uptake systems ............................................................. 95 1.5. SUMMARY OF CHAPTER 1 ............................................................ 98 2. CHARACTERIZATION OF THE PISCIBACTIN GENOMIC ISLAND (irp-HPI) AND IDENTIFICATION OF ELEMENTS REQUIRED FOR PISCIBACTIN PRODUCTION AND UTILIZATION ................................................................ 99 2.1. V. ANGUILLARUM irp-HPI GENOMIC ISLAND (irp-HPIVANG) ........... 99 2.2. PRODUCTION OF PISCIBACTIN BY V. ANGUILLARUM RV22 ........ 102
2. 3. CHARACTERIZATION OF FUNCTIONS REQUIRED FOR PISCIBACTIN PRODUCTION .................................................................................... 105 2.3.1. Deletion of irp1 impairs piscibactin synthesis .................. 106 2.3.2. Irp4 is required for piscibactin synthesis .......................... 108 2.3.3. Irp8 is involved in piscibactin export ................................ 112 2.4. PISCIBACTIN CONTRIBUTES SIGNIFICANTLY TO V. ANGUILLARUM VIRULENCE ....................................................................................... 116 2.5. CHARACTERIZATION OF FERRI-PISCIBACTIN UPTAKE ............... 117 2.5.1. FrpA and FrpBC are involved in ferri-piscibactin uptake 118 2.5.2. Distribution of frpA in different bacteria and phylogenetic analysis ....................................................................................... 121 2.5.3. Structural requirements in piscibactin analogues to be transported through FrpA ............................................................ 122 2.6. SUMMARY OF CHAPTER 2 .......................................................... 128 3. IDENTIFICATION OF REGULATORS INVOLVED IN IRP-HPI GENE EXPRESSION ............................................................................................ 131 3.1. IRP-HPI IS PREFERENTIALLY EXPRESSED AT COLD TEMPERATURES .................................................................................................... 131 3.2. REGULATORS INVOLVED IN IRP-HPI GENE EXPRESSION MODULATION ................................................................................... 133 3.2.1. araC1 (pbtA) deletion impairs growth under iron limited conditions .................................................................................... 134 3.2.2. The global regulators ToxR-S and H-NS play indirect roles in the regulation of the irp-HPIVang gene expression ................... 136 3.2.3. PbtA and H-NS are needed for full virulence of V. anguillarum ................................................................................. 136 3.2.4. PbtA is the main expression modulator of genes encoding piscibactin synthesis and transport ............................................. 138 3.2.5. Purification of PbtA and its Nand C-terminal domains .. 143 3.2.6. PbtA interacts directly with the piscibactin promoters PfrpA and PfrpBC .................................................................................. 145 3.2.7. irp-HPI is widespread in Vibrionaceae and contains several versions of frpA and pbtA promoters .......................................... 148 3.2.8. irp-HPI expression pattern results from the interaction of the type of promoter and other elements in the genome ................... 152 3.3. SUMMARY OF CHAPTER 3 .......................................................... 154 4. UTILITY OF THE SIDEROPHORES OUTER MEMBRANE TRANSPORTERS TO DEVELOP NEW VACCINES AGAINST VIBRIOSIS ........................................ 157 4.1. USE OF SIDEROPHORE TRANSPORTERS FVTA AND FRPA TO DEVELOP VACCINES AGAINST VIBRIOSIS .......................................... 157
4.1.1. Fish immunization assay ................................................... 157 4.1.2. FrpA and FvtA are immunogenic proteins ........................ 159 4.1.3. Evaluation of protection in experimental infections ......... 163 4.2. SUMMARY OF CHAPTER 4 ................................................................ 169 V. CONCLUSIONS .................................................................................. 171 VI. REFERENCES ..................................................................................... 175 VII. APPENDIX........ .................................................................................. 205
I. INTRODUCTION
3 I. INTRODUCTION 1. A QUACULTURE : PAST , PRESENT AND FUTURE PERSPECTIVES Fish is an extraordinarily nutritious and healthy food product that responds to the constant consumer demand for fresh, sustainable, and less processed food. There is a wide variety of aquatic products available for human consumption, therefore their nutritional composition also differs significantly depending not only in the species but also in the way the product is processed before consumption. Fish are a source of protein, fatty acids, and nutrients essential for the human health. Although the caloric content of fish and fish products is relatively low, they are a vital source of long chain omega-3 fatty acids, amino acids, vitamins A, B and D and micronutrients such as iron, calcium zinc and selenium. Nowadays, humanity is consuming recordbreaking levels (Figure I.1) of aquatic products and this demand can only be met by the additional efforts of the aquaculture sector to the extractive fisheries (FAO, 2020). Figure I.1. Fish consumption in the globe (FAO, 2020). Authorization to reproduce in appendix 1.
MARTA A. LAGES 4 In 2017, fish consumption represented 17% of the total animal protein intake of the world population and this fact represents a challenge to produce high-quality aquatic goods. To deal with this increasing demand, innovative solutions must be taken as the extractive fisheries cannot sustainably cover the total requirement of aquatic products. In fact, the capture fishing industry has declined as well as the wild stocks (FAO, 2020). Therefore, aquaculture has become a reliable source of fish, crustaceans, and molluscs (Sommerset et al., 2005). Aquaculture has demonstrated a decisive role in global food security and the sector has been growing consistently over the past decades, at a 7.5% per year since 1970 (FAO, 2020). For the sixth consecutive year aquaculture has surpassed fisheries production, specifically in 2018 aquaculture produced 17.1 million tonnes more than fisheries (114.5 million tonnes) (Figure I.2) (FAO, 2020). Figure I.2. Contribution in millions of tones of capture fishing and aquaculture to the global fish consumption (FAO, 2020). Authorization to reproduce in appendix 1. In 2018, finfish dominated the farmed aquatic animals (54.3 million tonnes) followed by molluscs (17.7 million tonnes), crustaceans (9.4 million tonnes), marine invertebrates (435.400 tonnes), aquatic turtles (370.000 tonnes) and frogs (131.300 tonnes) (FAO, 2020). Spain was the leading country of the European Union in the production of aquacultured products in 2018 (25.5%) however this prominent place was not reflected in terms of value (11%) (APROMAR, 2020). In 2018,
I. Introduction 11 can already be dead (Frans, et al., 2011). In rapidly evolving diseases such as vibriosis, host-pathogen studies are of particularly importance. Two modes of infection have been reported for V. anguillarum: internalization through the skin and/or ingestion of contaminated water or food (Grisez et al., 1996; Svendsen and Bogwald, 1997). Figure I.4. Turbot with signs of vibriosis characterized by the appearance of haemorrhagic spots. In the early stages of infection attachment and colonization of the host surface is key. Although the skin is a difficult barrier to cross due to the presence of the mucus layer, a discontinuity on the skin through injuries or damaged mucus can constitute a colonization site for V. anguillarum from where it can initiate the invasion of the host. The mucus layer is one of the main components of the fish innate immune system, but it is the first barrier that bacteria must cross for the establishment of a successful infection. It contains substances such as lysozyme, proteases and antimicrobial peptides that avoid the adhesion of bacteria (Ellis, 2001). However, V. anguillarum was shown to be resistant to rainbow trout skin mucus and even can use it as a source of nutrients (O’Toole et al., 1996; O’Toole et al., 1999). The attachment to the epithelial cells must occur very quickly before the antimicrobial nature of the mucus and its continuous renewal detaches the pathogenic bacteria. In the first 24 hours of infection, V. anguillarum colonizes both the skin and the intestines (Croxatto et al., 2007; Weber et al., 2010). However, the numbers differ significantly, existing a higher number of bacteria on the skin, indicating that this is an important colonization site and additionally, it suggests that the intestines are more difficult to access and/or that they constitute a more inhospitable
MARTA A. LAGES 12 environment for the growth of this bacterium (Weber et al., 2010). After the attachment to the epithelia, V. anguillarum moves gradually from the surface until reaching the blood stream and organs (Weber et al., 2010; Schmidt et al., 2017). 2.3. Virulence factors described in Vibrio anguillarum Virulence is a measure of pathogenicity and virulence factors are properties of each pathogen that may cause disease in a susceptible host in a concrete environment. These factors allow the adherence, colonization, growth, and persistence within a susceptible host. They may also cause tissue damages and evasion of the host immune system. Although the virulence mechanisms of V. anguillarum are not completely known, several virulence factors have been identified such as motility, chemotaxis, lipopolysaccharide, extracellular products with proteolytic and haemolytic activity, and iron uptake mechanisms. 2.3.1. Chemotactic motility and adhesion The chemotactic response and motility are tightly coupled. Chemotactic motility is a requirement for V. anguillarum virulence. Fish skin and gut are covered by a protective mucus layer that pathogens must invade to disseminate a successful infection. Chemotactic motility towards chemoattractants present in the mucus is used in the initial steps of infection (O’Toole et al., 1996). In fact, a mutation in the cheR gene that encodes a cytoplasmic methyl transferase, leads to a decrease in virulence for rainbow trout. However, the chemotactic response is important for the movement towards the host but not in the persistence within the host (O’Toole et al., 1996). Additionally, the flagellum plays an essential role in pathogenesis. V. anguillarum possess five flagellin proteins encoded by flaABCDE. FlaA, FlaD and FlaE contribute directly to virulence since non-motile mutants showed a decrease in virulence in experimental infections by bath, a method that mimics the natural infection route (McGee et al., 1996; Milton et al., 1996). During the first steps of infection, the flagellum may serve as a motility component involved in the penetration of epithelial mucosa. Nonetheless, it can also be involved in the adhesion process by carrying adhesins (Frans et al., 2011).
I. Introduction 13 2.3.2. Metalloproteases and haemolysins After adhesion to the skin or gut mucus, V. anguillarum must penetrate the epithelial cells. The secretion of the extracellular zinc metalloprotease EmpA, with mucinase activity, degrades the mucus. This tissue damage enables the pathogen to colonize and penetrate the host tissues and consequently cause the infection that at the final stages can reach internal organs such as the liver and spleen (Denkin and Nelson, 1999; Denkin and Nelson, 2004; Croxatto et al., 2007). This metalloprotease is expressed as an inactive proenzyme and only when V. anguillarum is in contact with the intestinal mucus an enzyme with metalloproteolytic function cleaves the propeptide allowing the EmpA to function (Varina et al., 2008). The haemolytic activity of V. anguillarum greatly contributes to the characteristic haemorrhagic septicaemia of vibriosis and the haemolysis directly kills host cells. The lysis of erythrocytes releases the intracellular haem. In V. anguillarum several extracellular haemolysins have been described, Vah 1-5 and a repeat in toxin, RTX (Hirono et al., 1996; Rodkhum et al., 2005; Li et al., 2008). The sequence analysis of Vah 1-5 reveals that they are different types of haemolysins. Additionally, single haemolysin deletion revealed a haemolytic phenotype but in a lesser degree than that observed for the parental strain, indicating that more than one haemolysin contributes to the haemolytic activity of V. anguillarum (Rodkhum et al., 2005). The rtx gene cluster, rtxACHBDE, is comprised of rtxA that encodes the toxin, rtxC encoding the activator, rtxH encoding a conserved hypothetical protein and rtxBDE encoding the transporters. RTX toxins are a diverse group of proteins which include toxins with cytolytic activity, metalloproteases, lipases and adenylate cyclases (Li et al., 2008). Vah1 and RtxA are both exotoxins that work synergistically, however their cytotoxicity leads to different effects in ASK cells. Vah1 causes cell vacuolation and RtxA causes cell rounding. RTX proteins are secreted via the T1SS and in V. anguillarum the rtx operon shows a high degree of amino acid similarity with homologous systems of V. vulnificus and V. cholerae El Tor N16961 (Li et al., 2008).
MARTA A. LAGES 14 2.3.3. Outer membrane components – LPS and OMPs The complement system in fish plays a crucial role in host defence against pathogens as it generates a specific immune response. Although it is usually in an inactive state, it can be activated by the interaction of its components with antibody-antigen complexes or by a direct contact with the pathogen (Holland and Lambris, 2002). Some Gram-negative bacteria can evade the host immune system by resisting the bactericidal effect of the fish serum. In V. anguillarum the long polysaccharide side chains (O antigen) of their lipopolysaccharide (LPS) are essential for this resistance and there is a correlation between the length of the LPS O-antigen and the ability to evade the complement system. The Oantigen protects the bacteria by restraining the complement components to access the cytoplasmic membrane. Serotype O1 and O2 strains of V. anguillarum have been described as resistant to rainbow trout serum and these same strains were reported as pathogenic for Atlantic salmon. Thus, serum resistance mediated by the O-antigen contributes to the survival of bacteria within the host and to the infection process (Boesen et al., 1999). The outer membrane of Gram-negative bacteria is a complex structure composed of phospholipids, LPS, lipoproteins and porins (Henderson et al., 2016). Outer membrane porins are transmembrane pore-forming proteins (OMP) that allow the passive transport of hydrophilic compounds. Besides this transport function, porins are involved in the maintenance of the cell integrity and antibiotic resistance (Choi and Lee, 2019). OmpA and OmpC have been described as essential for the maintenance of membrane integrity whereas the role of OmpF is mainly the transport of antibiotics (Choi and Lee, 2019). Moreover, OmpA is a relevant virulence factor because it is involved in bacterial adhesion, invasion, intracellular survival, serum resistance and evasion of the host immune system (Confer and Ayalew, 2013). OmpA and OmpA-like proteins are found in high numbers in pathogens outer membranes and this surface exposure activates both the innate and the adaptative immune system, making them good candidates for the development of new antimicrobials (Confer and Alyalew, 2013). Additionally, V. anguillarum OMPs confer resistance to bile and induce biofilm formation (Wang et al., 2003). Resistance to bile allows the
I. Introduction 15 pathogen to survive within the host and biofilm formation is an advantage for colonization and survival. Some OMPs such as Omp26La, OmpW and OmpU, are not directly involved in virulence, in fact they are salt-responsive and allow the adaptation of V. anguillarum to different salt concentrations (Kao et al., 2009). 2.3.4. Type VI Secretion System - T6SS Secreted proteins contribute not only to virulence but also to environmental adaptation. The secretion systems are classified according to their structural components, the secreted proteins, and the mechanism of transport. The Type VI Secretion System (T6SS) was firstly described in Vibrio cholerae (Pukatzki et al., 2006) and its contribution to virulence has been characterized. It is a contactdependent system that allows the translocation of effector proteins directly into eukaryotic or prokaryotic cells. The translocation event occurs through the contraction of the structure that propels the end spike of the system into other cells. The T6SS of Gram-negative bacteria share core elements (Joshi et al., 2017). The assembly of the T6SS begins with the formation of the membrane complex which is composed by three proteins (VasDFK in V. cholerae) that are the structural support of the whole system. Then, the proteins that form the baseplate complex (HsiF, VasABE and VgrG1-3 in V. cholerae) are recruited and anchored to the inner membrane. The tip of the apparatus is formed by VgrG1-3 that are capped by proteins containing repeating prolinealanine-alanine-arginine motifs (PAAR). The inner tube of the tail complex is formed by the haemolysin-coregulated protein (Hcp) that is surrounded by the VipA/VipB outer tube. After the secretion process, ClpV ATPase disassembles and recycles the system (Joshi et al., 2017). In V. anguillarum the T6SS provides the bacteria an ecological advantage. Under environmental conditions that mimic the fluctuations of the marine environment, the expression and secretion of Hcp was detected in non-O1 serotype strains (Tang et al., 2016). Furthermore, the T6SS is involved in signal sensing mechanisms as it activates the expression of stress response regulators (Weber et al., 2009).
MARTA A. LAGES 16 2.3.5. Iron uptake mechanisms Iron is an essential element for many metabolic functions in microorganisms. Its abundance in most environments does not correlate directly with its bioavailability. In natural conditions it is present in two redox states, as Fe2+ and Fe3+, and these forms and their solubility are strongly influenced by pH and the presence of anions with which it can form complexes. In the presence of oxygen at neutral or slightly higher pH, iron is present as ferric hydroxides, and the alkaline seawater pH (pH 7.5 to 8.4) leads to a concentration in the nanomolar range of dissolved iron (Price and Morel, 1998). This concentration is far less than that needed by pathogens to survive, making iron a limiting factor for bacterial growth (Wandersman and Delepelaire, 2004). Iron is essential for the synthesis of enzymes that are vital for cellular processes, from cytochromes involved in cell respiration to the synthesis of nucleic acids and TCA enzymes (Andrews et al., 2003; Crosa et al., 2004). When available, iron is also presented as a challenge, since it can react with oxygen generating reactive oxygen species highly harmful for the cell (Cornelis et al., 2011). Therefore, the acquisition of iron as well as its homeostasis are strictly regulated. When facing an environment of iron limitation, most bacteria have developed specific mechanisms to scavenge it from environmental sources or from the host (Miethke, 2013). These systems include the direct contact with host iron-containing molecules such as transferrin or haem proteins or the synthesis and secretion of siderophores, secondary metabolites with high affinity for Fe3+.
I. Introduction 17 Figure I.5. Iron transport systems identified in V. anguillarum. Iron acquisition mediated by the siderophores anguibactin, vanchrobactin and xenosiderophores (enterobactin) are displayed. Other iron transport systems like haem uptake, use of ferrichrome, and utilization of ferrous and ferric iron are also represented. From Li and Ma, Front. Cell. Infect. Microbiol., 2017. Authorization to reproduce in appendix 2. In V. anguillarum different mechanisms of iron acquisition have been described (Li and Ma, 2017) (Figure I.5): a) Production of the siderophores anguibactin and vanchrobactin. Production and utilization of siderophores is one of the most important virulence factors. Biosynthesis, transport, and regulatory mechanisms have been characterized for both siderophore systems, anguibactin and vanchrobactin. However, only anguibactin role in virulence has been demonstrated. Anguibactin and vanchrobactin systems will be described below. b) Utilization of haem and haem-containing proteins. Haem transporters are widespread in pathogenic Vibrios (Kustusch et al., 2011). Haem is found abundantly in fish tissues and potentially it is
MARTA A. LAGES 18 a source of iron for the pathogen. However, free haem is not available as it is mostly present in haemoglobin or haemopexin and haptoglobin. Therefore, the utilization of haem as an iron source is facilitated by the activity of haemolysins that lyse host cells and consequently release the intracellular haem to the extracellular environment (Lemos and Balado, 2020). After its release, haem is captured by the outer membrane transporter HuvA. HuvA is essential for haem uptake as the deletion of this transporter disables the ability to grow with haem as the sole iron source, nonetheless it does not abolish haem-binding activity which suggest the presence of additional proteins with this function but not able to transport haem (Mazoy et al., 2003). Haem uptake is an energy-dependent process, energized by TonB systems. Two TonB systems, TonB1 and TonB2 are involved in haem uptake, and the deletion of these systems leads to a defect in haem uptake and a decrease in virulence (Stork et al., 2004). Some V. anguillarum strains that lack HuvA, have an additional gene, HuvS that assumes the same function (Mouriño et al., 2004). The haem utilization gene cluster is composed of nine genes that encode proteins involved in haem uptake and utilization, HuvA, HuvZ, HuvX, TonB1, ExbB1, ExbD1, HuvB, HuvC and HuvD (Figure I.5). Single gene deletions demonstrated that huvAZBCD genes are essential for haem utilization as iron source (Mouriño et al., 2004). After internalization via HuvA, the periplasmic protein HuvB delivers haem to the inner membrane complex HuvCD that transports it to the cytoplasm (Mouriño et al., 2004). HuvZ is a putative haem storage protein (Wyckoff et al., 2004) and HuvX would be an intracellular haem delivery protein (Sekine et al., 2016) (Figure I.5). Nevertheless, the contribution of haem uptake systems to the virulence of V. anguillarum remains unclear. c) Moreover, additional iron transport systems are present in V. anguillarum genome, although their involvement in virulence is unclear. Four operons encode probable transport systems for unchelated ferrous (feoABC), ferric iron (fbpABC1 and fbpABC2) and ferrichrome (fhuABCD) (Li and Ma, 2017):
I. Introduction 19 - FeoABC system is likely the most ancient iron transport mechanism described to date due to its wide distribution among bacteria (Lau et al., 2016). Despite the scarce characterization of the system, it is thought that FeoB forms the ferrous iron channel through the cytoplasmic membrane and FeoA and FeoC complement the functioning of the system (Payne et al., 2016; Lau et al., 2016). Nonetheless, remains unclear how ferrous iron access the periplasm through the outer membrane. - Ferric iron transport has also been described in Vibrios. This transport is mediated by the ABC transporter FbpABC located in the cytoplasmic membrane. It has been proposed that ferric iron binds FbpA in the periplasm, then it is delivered to FbpBC in the cytoplasmic membrane and the hydrolysis of ATP favours the transport of iron to the cytoplasm (Payne et al., 2016). - Ferrichrome utilization has been reported in V. anguillarum, however the proteins involved in this process have not been characterized (Li and Ma, 2017). 3. IRON UPTAKE MEDIATED BY SIDEROPHORES IN V. ANGUILLARUM Siderophores are small molecules with high affinity for Fe3+ that can scavenge iron form different sources like fish tissues or the environment. Structurally, siderophores are a diverse group of compounds and they are categorized based on the functional group – carboxylate, catecholate and hydroxamate – which confer different iron binding affinities (Hilder and Kong, 2010). There are also siderophores that contain more than one functional group as it is the case of yersiniabactin (Drechsel et al., 1995). Harbouring different siderophore systems gives fitness advantages to bacteria, allowing them to survive in a wide range of environments (Bachman et al., 2012; Holden and Bachman, 2015). In V. anguillarum two iron uptake systems mediated by siderophores have been described to date: anguibactin and
MARTA A. LAGES 20 vanchrobactin (Lemos et al., 1988; Stork et al., 2002; Balado et al., 2006) (Figure I.6). While vanchrobactin is widespread in pathogenic and environmental V. anguillarum strains of serotypes O1 to O10, anguibactin is a plasmid-encoded system associated to highly virulent O1 strains (Actis et al., 1986). The biosynthetic pathway of anguibactin and vanchrobactin has been deeply described and is accomplished by a series of non-ribosomal peptide synthases (NRPS) (Stork et al., 2002; Crosa and Walsh, 2002; Balado et al., 2006). Both siderophores share a common biosynthesis step which leads to the synthesis of the DHBA moiety (Lemos et al., 2010). The genes involved in 2,3dihydroxybenzoic acid (DHBA) synthesis were firstly identified in the chromosome of pJM1 harbouring isolates, but functional homologues are also present in the plasmid. Nonetheless, anguibactin and DHBA synthesis requires AngA whose only functional copy is located in the chromosome (Alice et al., 2005). Figure I.6. Structure of the siderophores vanchrobactin (A) and anguibactin (B). Catecholate functional group is highlighted in blue and hydroxamate is highlighted in orange. Most V. anguillarum highly pathogenic strains that belong to serotype O1 harbour a 65 kb plasmid. This plasmid, pJM1, confers the recipient bacteria the ability to synthesize and use the siderophore anguibactin (Figure I.7). A correlation can be established between the serotype and the presence of the pJM1 plasmid as it has been reported that the O1 side chain is essential for the stability of ferri-anguibactin outer membrane receptor FatA (Welch and Crosa, 2005). Structurally, anguibactin is a mixed siderophore as it contains catecholate and hydroxamate functional groups (Figure I.6.B) and most of the genes
I. Introduction 27 subsp. piscicida (Souto et al., 2012) and it is considered one of the most relevant virulence factors of this fish pathogen (Osorio et al., 2015). In P. damselae subsp. piscicida, the functions related to synthesis and transport of piscibactin are encoded in a pathogenicity island located in a 69 kb conjugative plasmid, named pPHDP70 (Osorio et al., 2015). This pathogenicity island resembles the HPI of Yersinia spp. and E. coli pathogenic strains encoding the siderophore yersiniabactin (Pelludat et al., 1998; Osorio et al., 2006; Souto et al., 2012). The conjugative plasmid pPHDP70 was transmissible from P. damselae subsp. piscicida DI21 to E. coli, Aeromonas salmonicida, V. anguillarum and V. alginolyticus. When transferred to a V. alginolyticus strain impaired for vibrioferrin synthesis, it conferred this bacterium the ability to synthesize and use piscibactin as iron source (Osorio et al., 2015). The pathogenicity island encoding the piscibactin system shows a high homology to the high pathogenicity island present in Yersinia spp. that encodes the siderophore yersiniabactin (Dreschel et al., 1995). In silico analysis of the protein sequence suggested that piscibactin is synthesized by a hybrid NRPS/PKS mechanism like the one described for yersiniabactin. However, the distinct domain organization indicates that piscibactin presents a different structure (Miller and Walsh, 2001; Miller et al., 2002). Therefore, a biosynthetic pathway was proposed for piscibactin based on genetic data and on the pathway previously described for yersiniabactin (Souto et al., 2012). Interestingly, the structure detected at the end of the purification process did not correspond to the terminal piscibactin molecule predicted based on the NRPS domain organization. In fact, the metabolite identified, is the result of the early release of the siderophore at module 5 (Souto et al., 2012). Nonetheless, most detailed aspects of piscibactin synthesis and transport remain unknown since the construction of defective mutants in P. damselae subsp. piscicida is very difficult to accomplish due to the refractory nature of this bacterium to genetic manipulation. The presence of irp genes and the phenotype of the vabF mutant greatly suggest that V. anguillarum RV22, besides producing vanchrobactin, might synthesize, under specific growth conditions, piscibactin or a piscibactin-like siderophore. Thus, the identification of piscibactin as a
MARTA A. LAGES 28 siderophore produced by V. anguillarum will be the main goal of this thesis. 4. KEY SIGNALS IN VIRULENCE FACTORS REGULATION As an inhabitant of the marine and estuarine ecosystem, V. anguillarum must be able to adapt its physiology to the constantly changing aquatic environment. Fluctuations in salinity, nutrients availability and temperature are a constant trait of marine bacteria. Iron is essential for the bacterial metabolism, however when in excess it can be lethal. When intracellularly, iron that is free can be a catalyst for Haber-Weiss reactions and participate in Fenton reactions, generating toxic hydroxyl radicals (Kehrer, 2000; Touati, 2000). These hydroxyl radicals can then damage DNA, unsaturated lipids, and proteins (Imlay and Linn, 1988) thus when in excess, bacteria repress the iron uptake systems. A tight coordination and regulation must be achieved for the iron concentration to meet but not exceed the requirement for the metabolism. In V. anguillarum several regulation mechanisms have been described to date, however the master regulator of iron related genes is the negative regulator Fur. Fur (Ferric uptake regulator) is the major regulator of iron metabolism and transport, and most virulence-related genes (Ratledge and Dover, 2000). It was firstly identified in E. coli as a sensor of intracellular iron concentration and it functions as an iron-binding transcriptional regulator (Litwin and Calderwood, 1994). In the presence of free/excess Fe2+, Fur binds it, forming an iron-Fur complex that attaches to specific sites in the promoter region of iron regulated genes. These sites are termed Fur-boxes and a 21bp palindromic sequence has been identified (Balado et al., 2008; Davies et al., 2011). Although the Fur boxes are usually located in the -10 and -35 regions of promoters (Payne et al., 2016), the location of the Fur box with respect to the transcription initiation site has been found to be variable (Davies et al., 2011). When the Fe2+-Fur complexes bind to these sites, the transcription is blocked leading to the down-regulation of those promoters containing Fur box motifs (Troxell and Hassan, 2013). Under iron limiting environments, Fur detaches from Fe2+, being unable to bind to the Fur boxes, allowing the expression of genes for iron uptake.
I. Introduction 29 In V. anguillarum, Fur regulates the expression of both siderophore systems, being involved in the blockage or derepression of genes encoding anguibactin and vanchrobactin synthesis and transport (Tolmasky et al., 1994; Chen and Crosa, 1996; Chai et al., 1998; Balado et al., 2008). Regarding the iron uptake system mediated by the siderophore vanchrobactin, a LysR-type transcriptional regulator (VabR) has been identified. Analysis of VabR revealed that its N-terminal domain bears a helix-turn-helix DNA binding motif. vabR encodes a regulatory factor that induces the expression of vabG, a biosynthetic gene involved in DHBA synthesis (Balado et al., 2008). Vanchrobactin also plays an inducing role, when added exogenously it induces the expression of the biosynthetic genes. This effect is concentration dependent as increasing amounts of vanchrobactin lead to a linear increase in transcriptional activity of fvtA promoter (Balado et al., 2008). In addition to iron availability, other factors including quorum sensing, carbon sources, availability of oxygen, pH and temperature have been identified as signals that can modulate the expression of virulent factors including iron uptake systems (Carpenter and Payne, 2014; Payne et al., 2016). The effect of temperature changes has been extensively studied in pathogens that infect mammals. The transcription of virulence factors is induced upon contact with the host which leads to a temperature shift from the environmental temperature to a higher temperature, 37 ºC (Guijarro et al., 2015). Usually, the host temperature is the optimal temperature for pathogens growth. Most of the mechanisms involved in temperature shift sensing are related to conformational changes in DNA, RNA, or in proteins (Konkel and Tilly, 2000). H-NS is a conserved repressor of virulence related genes with DNA and RNA binding activity (Stoebel et al., 2008). At temperatures below 37 ºC, H-NS binds to AT-rich DNA regions forming DNA-protein-DNA bridges blocking the movement of the RNA polymerase. When entering the host, the temperature rises to 37 ºC which is the cue for the derepression. H-NS is released from the DNA, allowing the activation by transcriptional regulators and consequent expression of virulence genes (Guijarro et al., 2015). The gene silence effect of H-NS is of particular importance in
MARTA A. LAGES 30 Enterobacteriaceae as it regulates the expression of virF in Shigella flexneri (Falconi et al., 1998) or ssrB in Samonella enterica (Fass and Groisman, 2009). Notably, H-NS and ToxR share part of their regulatory network in V. cholerae and ToxR antagonizes H-NS binding at shared promoter sites (Kazi et al., 2016). ToxR is a global regulator of genome encoded genes as well as horizontal acquired DNA. It is the initiator of a regulatory cascade involved in the expression of major virulence factors, the cholerae toxin and the coregulated pili (Childers and Klose, 2007; Kazi et al., 2016). For its optimal transcriptional activation, ToxR interacts with the transmembrane protein ToxS, which stabilizes its structure for correct functioning (DiRita and Mekalanos, 1991; Pfau and Taylor, 1998). ToxR expression is modulated by environmental cues such as pH, oxygen, temperature, and presence of concrete metabolites (Kazi et al., 2016). It can directly induce the expression of virulence related genes or mediate their control through the AraC-like transcriptional regulator, ToxT (Higgins and DiRita, 1994). Fish diseases outbreaks usually occur at a temperature below that of the optimal (TBO) growth of the pathogen. The regulation of virulence factors at TBO is different from those pathogens of warmblood animals (Guijarro et al., 2015). Several virulence genes have been identified as being induced at TBO, but the regulatory mechanisms are uncharacterized. In Yersinia ruckeri, the etiological agent of the enteric red mouth disease, several virulence factors are preferentially expressed at 18 ºC than at the optimal bacterial growth temperature of 28 ºC. In this pathogen, the operon that encodes the type IV secretion system, the haemolysin YhlA, the protease Yrp1 and the siderophore ruckerbactin have higher expression levels at 18 ºC. Vibrio salmonicida causes disease in a temperature range of 10-20 ºC and virulence factors such as biofilm formation or siderophore production are favoured at low temperatures (Guijarro et al., 2015). As an eurythermal bacterium, V. anguillarum can grow in a wide range of temperatures, from 10 to 42 ºC being 25 ºC considered its optimal growth temperature (Guérrin-Faublée et al., 1995). The water temperature is a factor that can directly enhance the occurrence of vibriosis (Le Roux et al., 2015). Moreover, V. anguillarum is able to
I. Introduction 31 produce disease outbreaks in a wide temperature range since it can infect coldand warm-water farmed fish (Bellos et al., 2015; Toranzo et al., 2017; Ma et al., 2017). Notably, the vibriosis outbreaks caused by V. anguillarum can occur at temperatures as low as 5 ºC, being 15 ºC the optimal temperature to cause vibriosis (Olafsen et al., 1981; Austin and Austin, 2007; Bellos et al., 2015). More recently, Lone Gram group showed that some V. anguillarum strains can produce 100% mortalities in infection challenges in cod (Gadus morhua), halibut (Hippoglossus hippoglossus) and turbot (Scophthalmus maximus) (Rønneseth et al., 2017). Since these challenges were performed at 7, 9 and 16 ºC respectively, the results suggest that some highly virulent V. anguillarum strains can cause high mortality ratios at temperatures that are below the optimal growth temperature and, thus, the adaptation to low temperatures should be considered in the regulation of virulence-related genes. These adaptations and the effect of temperature on expression of genes involved in siderophore synthesis and transport will be also studied in this thesis.
II. OBJECTIVES
35 II. OBJECTIVES Two siderophore systems have been characterized in V. anguillarum: anguibactin, encoded by the pJM1 plasmid, and vanchrobactin, encoded by chromosomal genes. However, the presence in certain strains of V. anguillarum of genes with homology to irp genes encoding the siderophore piscibactin, as well as previous phenotypic evidence, suggest that piscibactin could be also produced by V. anguillarum. In addition, since V. anguillarum can infect diverse fish species living at very different temperatures, we hypothesized that a temperature-dependent regulation of virulence factors could play a relevant role in V. anguillarum versatility to cause disease. Therefore, the main goals of the present thesis are: 1. Analyse the adaptations of V. anguillarum to low-iron availability and temperature changes that enable it to cause vibriosis in a wide diversity of fish species. 2. Characterize the genetic structure and regulation of the HighPathogenicity Island encoding the siderophore piscibactin in V. anguillarum. 3. Determine the role of piscibactin in V. anguillarum virulence for fish. 4. Evaluate the use of FrpA and FvtA, the piscibactin and vanchrobactin outer membrane transporters, respectively, to design new strategies to prevent and control vibriosis in fish.
III. Material and Methods 43 using the NucleoSpin Gel and PCR Clean-up Kit (Macherey-Nagel). Both, purified PCR product (fragment) and plasmid DNA were digested with the same restriction enzymes (FastDigest from Thermo Scientific) to generate compatible ends. Additionally, the plasmid was dephosphorylated using FastAPTM Thermosensitive Alkaline Phosphatase (Thermo Fisher Scientific). The phosphatase eliminates phosphate groups at the 5’end which avoids the recircularization of the plasmids. After digestion the insert was cleaned using the phenol:chloroform method (Sambrook and Russell, 2006) and the plasmid was loaded in a 1% agarose gel to confirm the correct digestion and then purified. Then, insert and plasmid were mixed in a molar relation 5:1 with 1 U of T4 DNA Ligase (Thermo Fisher Scientific) in a final volume of 20 µL. Ligations were incubated for at least 1 h at room temperature or overnight at 15 ºC. Ligations were dialysed through 0.025 µm MCE membrane filters (Millipore). After approximately 20 min the dialysed ligation was mixed with competent cells. Competent cells were obtained by growing E. coli DH5α or S171-λpir strains to mid exponential phase and pelleted through centrifugation at 4 ºC, for 10 min at 8,000 rpm. Electrocompetent cells were centrifuged and washed two times with cold water and the final pellet was resuspended in 100 µL of ultrapure water. For transformation, the previous mix was transferred to a 0.2 cm electroporation cuvette (Bio-Rad) and electroporated in a Gene Pulser electroporator (Bio-Rad). Electroporation was carried out with the following settings: 2.5 kv, 200 Ω and 25 µF. The transformation was recovered with 1 mL LB and the cells were incubated at 37 ºC with shaking at 120 rpm. After 1 h the transformed cells were pelleted by centrifugation, resuspended in 100 µL of LB and plated onto LB plates supplemented with the suitable antibiotic. 2.4. Construction of mutant strains by allelic exchange All the defective mutants used in this study were obtained by allelic exchange (Figure III.1). This technique is based on the substitution of the wild-type gene by a non-functional version that contains a deletion in the central region of the gene. Regions upstream and downstream of the gene of interest (including ca. 20 amino acids of each extreme of
MARTA A. LAGES 44 the gene) were amplified by PCR. Restriction sites were added to each primer used for amplification, named as 1, 2, 3 and 4 (Table III.3) so that the correct orientation of the fragments is obtained. Both fragments corresponding to the upstream and downstream region of the gene were cloned into the low-copy number plasmid pWKS30 (Figure III.3) (Wang and Kushner, 1991). Then the construction was liberated from this plasmid through digestion with the enzymes NotI and ApaI and ligated into the suicide vector pNidKan (confers kanamycin resistance), digested with the same enzymes, and transformed into E. coli S17-1λpir competent cells (Mouriño et al., 2004). pNidKan contains the pir dependent origin of replication and the sacB gene that confers sucrose sensitivity (Figure III.3). The construction was then mobilized to V. anguillarum strains RV22, RV22ΔvabF or RV22 ΔvabD through conjugation on TSA-1 for 48 h at 25 ºC. A first event of recombination occurred, and the cells were plated in 10-fold serial dilutions on TSA-1 plates supplemented with kanamycin and ampicillin. The plasmid pNidKan is unable to replicate naturally in V. anguillarum as this bacterium lacks the pir gene, so it will only be maintained if it is integrated into the chromosome by homologous recombination with the wild-type gene. The first recombinant colonies, resistant to kanamycin and ampicillin, were grown in TSB-1 without selective pressure and after 5-10 consecutive passages, serial dilutions were plated onto LB plates supplemented with 15% sucrose. The plasmid confers sucrose sensitivity therefore only the cells that lost the plasmid will grow. This second event of recombination will generate a 50% of bacterial cells that will remain with the wild-type gene and 50% that will have a deleted copy in the chromosome. The cells that grew in sucrose plates were subjected to PCR to evaluate if they contained the mutated version of the gene. Therefore, the primers 1 and 4 were used to amplify the desired region (Table III.3). A PCR product of approximately 2 kb is an indicative of the deleted site as the revertant bacteria will amplify a larger region correspondent to the wild-type gene. The region subjected to the deletion was Sanger sequenced using primers 1 and 4 to verify that deletions were nonpolar.
III. Material and Methods 45 Figure III.1. Schematic representation of mutagenesis by allelic exchange. Upstream and downstream regions of the target gene were amplified by PCR and cloned into the suicide vector pNidKan. The resultant plasmid was introduced into V. anguillarum through conjugation and the transconjugants were selected based on the strain and plasmid resistance. The integration of the mutated version of the gene into the chromosome of V. anguillarum was accomplished through consecutive passages in non-selective media. This second event of recombination leads to the liberation of the wild-type gene in the plasmid and the generation of mutant strains.
MARTA A. LAGES 46 Table III.3. Primers used for the construction of mutant strains by allelic exchange. Restriction sites are underlined in the primers sequence. Oligonucleotide (5' -> 3') Size (bp) irp1 mutant construction irp1_ang_1_XbaI* GCTCTAGATGATGCATTAGCCCATCAGG 1489 irp1_ang_2_BamHI GCGGATCCAAAGCAAGGGTCGAGAGTGT irp1_ang_3_BamHI CGGGATCCAAAGAGCTCAGCCAGATCAC 1360 irp1_ang_4_EcoRI* GCGAATTCTGCAACAGATAATCACCGTG araC1 mutant construction AraC1_1_EcoRI* GCGGAATTCTACAGCAAAGAGTGGAACGG 927 AraC1_2_BamHI GCGGGATCCCGGTAAGCGTATGGATGTGG AraC1_3_BamHI GCGGGATCCCGTCCGATTATCGACATCGC 945 AraC1_4_XbaI* GCGTCTAGATGTTGTTGAGTGCTGCCATC araC2 mutant construction AraC2_1_EcoRI* GCGGAATTCTGAGTGAGAGTTTGCGTGAC 903 AraC2_2_BamHI CGCGGATCCGATCACACAGCAACGTAACG AraC2_3_BamHI GGCGGATCCCTCAGCGCAGAAATCTACAC 954 AraC2_4_XbaI* CGCTCTAGATTGAGGTTACTGTAGCTCGC frpA mutant construction 1_FrpAang_XbaI* CGCTCTAGAGGCAGCACTCAACAACAAGG 750 2_FrpAang_BamHI GCGGGATCCGAGTGCGAAAGCGGTTGAAG 3_FrpAang_BamHI CCGGGATCCAACCTATTCGTTCGCAATGC 750 4_FrpAang_4_XhoI* GCGCTCGAGGCTTTCAGAGATGGATGGTG irp4 mutant construction 1_Irp4ang_XbaI* CGCTCTAGAGTCTCATTGCAAATGCGCCA 716 2_Irp4ang_PstI CGCCTGCAGGGCACCATTCTGATAAAGTG 3_Irp4ang_PstI GCGCTGCAGCTGATAGCCATATCAGGCGA 861 4_Irp4ang_XhoI* CCGCTCGAGAGCTTGAGCATGAAAGAGCG irp8 mutant construction 1_Irp8_F_XbaI* GGCTCTAGATCGCTTAGCTGACAACATGG 824 2_Irp8_R_BamHI CGCGGATCCAGTGATGCCCTGTTGTCGAA
III. Material and Methods 47 3_Irp8_F_BamHI CCGGGATCCCTGCTGACATTCTCCGTTAC 819 4_Irp8_R_XhoI* GCCCTCGAGCATGGCTTGTTCAGCGTCAT frpBC mutant construction 1_FrpBC_R_NotI* CCGGCGGCCGCTCTCAGCACGTGGAAAGCGA 1320 2_FrpBC_PstI_F GGCCTGCAGGCTGCGCAGTTTATCCATTC 3_FrpBC_PstI_ R CCGCTGCAGGCGCCTATCTTACTGCTTGA 995 4_FrpBC_KpnI_F* GCCGGTACCGACCAATATCTCACCGTGAC h-ns mutant construction 1_HNS_F_XbaI* CGCTCTAGAGCGCCTAATACAATACCGA 888 2_HNS_R_BamHI GCGGGATCCAGCGCGTAGGCTACGAATAT 3_HNS_F_BamHI CCGGGATCCCAAGAGCAACTTGATGCAGG 800 4_HNS_R_XhoI* GGCCTCGAGCCAATGCCAGAGGCAACAAT toxR-S mutant construction 1_ToxR_F_XbaI* CCGTCTAGAAGCGCGAGTTCTTACAGTGA 746 2_ToxR_R_PstI GCGCTGCAGCGTGAATCGGTTAGCAAGGA 3_ToxS_F_PstI GGCCTGCAGGTCGACGTATTGATGTCGTC 626 4_ToxS_R_XhoI* GCCCTCGAGGCGCAAGGTCAAGATGATGT * Primers used to verify the construction of mutants. 2.5. Complementation of mutant strains The re-introduction of the wild-type gene would confirm that the phenotype of the mutant strains was the result of the deletion of a specific gene and not caused by mutations elsewhere in the bacterial genome as the mutant strains recover the parental phenotype. The plasmid pSEVA651 (Martínez-García et al., 2020) was used to complement the allelic exchange mutants (Figure III.2). The entire gene and its promoter region were amplified by PCR and cloned into the vector. The amplification of the promoter region will ensure the expression of the gene as this plasmid does not bear a promoter. Restriction sites were added to the primers. Then, PCR product and plasmid were digested with the same enzymes to originate complementary ends (Table III.4). The plasmid and the gene to complement were transformed into E. coli S17-1-λpir and plated onto LB plates supplemented with gentamycin. The colonies that carry the
MARTA A. LAGES 48 plasmid with the gene to complement were mobilized by conjugation to the correspondent mutant strain. After 48 h at 25 ºC the complemented cells were selected based on gentamycin and ampicillin resistance. The presence of the plasmid in V. anguillarum mutants was confirmed by PCR. Figure III.2. pSEVA651 plasmid map. The plasmid harbours a resistant gene that allows the selection of strains that harbour the plasmid. This plasmid was used for the complementation of mutant strains. Reversion to the wild type of irp4, h-ns and toxR-S mutants was accomplished by allelic exchange. To this purpose the complete wild type genes and flanking regions were PCR amplified using primers listed in Table III.4 and cloned in pCar109. Reintroduction of wild type genes and selection of the double recombination events was made as previously detailed (Figure III.1). After sucrose selection, bacteria were subjected to PCR with the same primer set to evaluate if they contained the wild-type or the mutated version of the gene. Therefore, the
III. Material and Methods 49 complemented strains would bear a copy of the wild-type gene in the chromosome. Table III.4. Primers used for the complementation of the mutant strains obtained through allelic exchange. Restriction sites are underlined in primers sequence. Oligonucleotide (5' -> 3') Size (bp) araC1 AraC1_comp_F_XbaI CGGTCTAGACTGATCTCTGGAGATAGAGC 1537 AraC1_comp_R_BamHI CCGGGATCCATGACTTCACCAGCACGACT frpA 1_FrpAang_comp_F_XbaI CGCTCTAGACTCAGCGCAGAAATCTACAC 2570 2_FrpAang_comp_R_BamHI GGCGGATCCAGAGACGCCTTCTGAACGCA irp4 Irp4_comp_F_NotI CCGGCGGCCGCGTCCAATACCGAGTCAACAG 2511 Irp4_comp_R_ApaI GCGGGGCCCAGCGGCATGTTCGGCAATTT h-ns HNS_comp_F_NotI CCGGCGGCCGCCGACAGAGGAGATGATGCAA 1329 HNS_comp_R_ApaI GCGGGGCCCTCCAACCGTGCCAGTTATGA toxR-S Tox R -S_comp_F_NotI CGCGCGGCCGCCGTATTCGCTTGGGTATCAA 2101 Tox R -S_comp_R_ApaI GCGGGGCCCAGGGTAGAGACGCACAGATT
MARTA A. LAGES 50 Figure III.3. pWKS30 and pCar109 (pNidKan) plasmids map. The low-copy plasmid pWKS30 harbours an ampicillin resistance gene. The pNidKan confers kanamycin resistance and the plasmid also harbours the sucrose sensitivity gene sacB and the pir-dependent origin of replication, oriR6K. Both plasmids were used for cloning. For the complementation of mutant strains, the wild-type gene was directly cloned into pNidKan.
III. Material and Methods 51 3. RNA ANALYSIS 3.1. RNA purification and RT-PCR The organization of irp-HPI was studied by reverse transcription PCR. V. anguillarum RV22 strain was grown in CM9 minimal medium supplemented with 5 µM EDDHA or 10 µM Fe2(SO)4 until OD600 = 1.0. Cells were pelleted by centrifugation at 10,000 g for 10 min and total RNA was isolated with RNAwiz (Ambion) following the manufacturer’s instructions. Reverse transcription reactions were performed with reverse transcriptase M-MLV RT (Invitrogen) using 1 µg RNA pre-treated with RQ1 RNase-Free DNase (Promega). Primers used are listed in Table III.5. cDNA was obtained by amplification using a primer located at the 3’-end of irp5 (Table III.5). This cDNA was then the template for a subsequent PCR reaction to ensure that the genes were co-transcribed using specific primers for araC1 (PCR1). A negative control was performed using total RNA treated with DNase to confirm a possible contamination of the sample with genomic DNA. A PCR reaction using 100 ng of genomic DNA as template was used as a positive control. Table III.5. Primers used to study the irp-HPI gene organization by RT-PCR. RT-PC R experiments Size (bp) RT TTTGGAGATGAGTGCGACAC PCR1 araC1_F GATATGCGCTTTGACTGCCA 196 araC1_ R CTGTGAGACGGCATACAAGC 3.2. RNA sequencing 3.2.1. Growth conditions and total RNA extraction V. anguillarum strain RV22 was grown in CM9 minimal medium (Lemos et al., 1988) under different iron availabilities, iron limited conditions (50 µM 2,2’-dipyridyl) and iron excess (10 µM FeCl3) at 25 ºC or 15 ºC. Bacterial cultures were grown until mid-exponential phase (OD600 ≈ 0.8) and the cells were harvested by centrifugation at 10,000 g for 10 min. Total RNA was isolated with RNAwiz (Ambion)
MARTA A. LAGES 52 following the manufacturer’s instructions. RNA was isolated from three independent experiments for each condition. RNA integrity was observed in a 1% agarose gel and the concentration was checked using the RNA 6000 Nano kit on the Bioanalyzer 2100 (Agilent Technologies, Palo Alto, CA). RNA was stored at -80 ºC until further use. 3.2.2. cDNA library construction and sequencing Construction of cDNA libraries and Illumina Sequencing was outsourced to FISABIO Sequencing and Bioinformatics Service (Valencia, Spain). Before the construction of independent cDNA libraries for whole-transcriptome sequencing, residual DNA and rRNA contamination was eliminated. An independent cDNA library represented each of the biological replicates and consisted of ca. of 20 M of 2 x 150 bp reads. Massive sequencing was performed in an Illumina Miseq using an NextSeq High Output 1 x 150 bp kit. RNAseq reads were deposited at NCBI Sequence Read Archive (accession number SRP213600). 3.2.3. Bioinformatic analysis and gene expression quantification RNAseq data were analysed using the Tuxedo suite software programs (Ghosh and Chan, 2016). Tophat granted the alignment of the reads with V. anguillarum RV22 strain chromosome I and II (GenBank accession number GCA_000257185.1). Furthermore, Cufflinks assembled the mapped reads into possible transcripts to create a transcriptome assembly. Differential expressed genes and transcripts were identified using Cuffdiff. The data obtained from Cuffdiff was analysed using the R package CummeRbund generating quality plots and figures. Finally, Blast2GO performed the functional annotation, enzyme code mapping and pathway analysis. Differentially expressed genes functional classification was obtained by COG database and KEGG and PSORTb v 3.0 was used for subcellular prediction (Yu et al., 2010).
III. Material and Methods 59 used in the experiment at the final concentration of 20, 10, 2 and 0.2 µM. V. anguillarum RV22 ΔvabD, RV22 ΔvabDΔfrpA and P. damselae subsp. piscicida DI21 were grown overnight in TSB-1. The OD600 of each bacterial culture was adjusted to 0.5 and a final dilution of 1:20 (V. anguillarum strains) and 1:40 (DI21) were inoculated in CM9 media containing 75 µM 2,2’-dipyridyl (concentration that inhibits growth). Subsequently, piscibactin and its analogues were added at the suitable concentration. CM9 medium supplemented with 10 µM FeCl3, or with 75 µM 2,2’-dipyridyl and non-inoculated medium were used as controls. The plate was incubated briefly at 25 ºC with shaking at 120 rpm and then transferred to the iMarK Microplate reader (Bio-Rad) to record growth (OD600) for 18 h. Each condition was done in duplicate in each plate and three independent experiments were performed. The results shown are the mean of the values obtained. Statistical significance was determined by student’s t-test with a threshold p value <0.05. 8. ELECTROPHORETIC MOBILITY SHIFT ASSAY 8.1. Cloning V. anguillarum RV22 pbtA (araC1) and its N-terminal and Cterminal were cloned into the expression vector pET20b(+) (Figure III.6). Primers were designed to obtain each of the proteins with a Histag at the Cor N-terminal. Primers used are listed in Table III.7. Table III.7. Primers used to clone pbtA (araC1) and its Nand C-terminal domain into the expression vector pET20b(+). Restriction sites are underlined. Oligonucleotide (5' -> 3') Size (bp) AraC1 with C-terminal His-tag AraC1_NdeI_F GCCATATGGTATCTAAAATGAATCG 990 AraC1_XhoI_R CCGCTCGAGGGGACGTTGACGATGTTTCC AraC1 with N-terminal His-tag AraC1_F_NdeI_ His-tagNTD CGCCATATGCACCACCACCACCACCACAAT CGTGTTGATTTAAAACC 975 AraC1_XhoI_R_stop CCGCTCGAGTTAGGGACGTTGACGATGTTTCC AraC1 C-terminal with His-tag at the C-terminal
MARTA A. LAGES 60 CTD_F_NdeI CGCCATATGTCATCCCTTTCCAGTCGAAC 342 AraC1_XhoI_R CCGCTCGAGGGGACGTTGACGATGTTTCC AraC1 C-terminal with His-tag at the N-terminal CTD_F_NdeI_ His-tag_NTD CGCCATATGCACCACCACCACCACCACTCATCC CTTTCCAGTCGAAC 342 AraC1_XhoI_R_stop CCGCTCGAGTTAGGGACGTTGACGATGTTTCC AraC1 N-terminal with His-tag at the C-terminal AraC1_NdeI_F GCCATATGGTATCTAAAATGAATCG 645 NTD_R_XhoI GCGCTCGAGCTCACTGTCTTTTTTGTTGC Figure III.6. pET20b(+) plasmid map and sequence. The target genes were cloned using NdeI and XhoI restriction enzymes to liberate the pelB leader and clone the genes with a C-terminal His-tag. To obtain the His-tag at the Nterminal, primers were designed with a 6xHis-tag sequence in the forward primer.
III. Material and Methods 61 8.2. Expression tests Expression tests were performed to evaluate the conditions and the strains that express the proteins in higher concentrations. The vector carrying each construction to be tested was transformed into a set of seven chemocompetent E. coli strains. Chemocompetent cells were obtained by allowing the cells to grow until an OD600 of 0.4-0.6. The culture was cooled down on ice for 15-20 min and then subjected to two centrifugations at 4,000 rpm at 4 ºC for 10 min with incubations on ice in between. The pellet was gently resuspended with cold 50 mM CaCl2. Transformation was carried out performing a thermic shock at 42 ºC for 45 s. The recombinant bacteria were grown overnight at 37 ºC in 10 mL LB supplemented with the correspondent antibiotic. From the overnight cultures, new cultures were obtained by adding inoculum to achieve a starting OD600 = 0.07 in 45 mL of LB. The cultures were incubated at 37 ºC, shaking at 200 rpm until achieving an OD600 = 0.5. The culture was then subdivided into three cultures of 15 mL each. In one of the cultures the expression of the protein was immediately induced adding 0.5 µM IPTG and incubated for 4 h at 37 ºC with shaking at 200 rpm. The remaining two cultures were acclimated at 17 ºC and 25 ºC for 20 min. Then the expression of the protein was induced by adding 0.5 µM IPTG and incubated overnight at 17 ºC and 25 ºC. The cultures were centrifuged at 4000 rpm for 10 min at 4 ºC. The cells were resuspended in 1.7 mL of resuspension buffer (50 mM Tris, 500 mM NaCl, pH 8.0) and stored at -20 ºC for at least 24 h. Bacteria were then lysed by sonication and samples corresponding to the total fraction and soluble fraction (obtained after centrifugation at 11,000 g for 20 min at 4ºC) were collected. The samples were loaded in a 14% polyacrylamide gel and ran at 200 V in a Bio-Rad PowerPac Basic. The gel was stained with Coomassie Blue (g/L, 40% methanol, 10% acetic acid), destained in a solution of 40% methanol 10% acetic acid and visualized using Fujifilm LAS-3000. 8.3. Protein purification Based on the expression tests, an E. coli strain and a temperature were selected to achieve the maximum protein yield. The same protocol
MARTA A. LAGES 62 described for the expression tests was followed but with larger culture volumes (see Table III.8). Table III.8. Strain, temperature, and culture volume used for protein purification. Purification conditions Protein E. coli strain Temperature Volume N-terminal Domain BL21 17 ºC 1 L C-terminal Domain BL21 plyS 37 ºC 1 L PbtA (AraC1) Codon + BL21 BL21 Solu 37 ºC 17 ºC 17 ºC 17 ºC 2 L 2 L 6 L 6 L After induction, the culture was incubated at the selected temperature (Table III.8). The cells were pelleted by centrifugation at 4,000 rpm for 30 min at 4 ºC in a Beckman Avanti J-26 XP using the rotor JLA-8.1000. The supernatant was discarded, and the pellet resuspended in 40 mL of resuspension buffer (50 mM Tris, 500 mM NaCl, pH 8.0) and stored at -20 ºC. The cells were lysed with a sonicator and then centrifuged at 17,000 rpm for 30 min at 4 ºC in a Beckman Avanti J-26 XP using the rotor JA-25.50. Then a purification column C-50 (ABT) was prepared. Five mL of the high-density nickel resin (ABT) was added to the column, and it was subsequently washed with distilled water and resuspension buffer. Afterwards, the supernatant was added to the column and the flow through was collected. The column was washed and elutions with increasing imidazole concentration were sequentially added and collected (Table III.9). Table III.9. List of buffers used for the purification process. Buffer Composition Resuspension buffer 50 mM Tris pH 8 500 mM NaCl Wash buffe r 50 mM Tris pH 8 500 mM NaCl 20 mM Imidazole Elution 100 50 mM Tris pH 8 500 mM NaCl 100 mM Imidazole Elution 200 50 mM Tris pH 8 500 mM NaCl 200 mM Imidazole Elution 400 50 mM Tris pH 8 500 mM NaCl 400 mM Imidazole
III. Material and Methods 63 Samples corresponding to the total fraction (samples after sonication), soluble fraction (sonicated sample after centrifugation), flow through, elution 100, 200, 400 and resin were loaded in a 14% polyacrylamide gel. The elution that presented the highest amount of protein (larger band) was further concentrated. Concentration was performed by centrifugation at 4,000 rpm for 10 min at 4 ºC using Vivaspin® centrifugal concentrators with a membrane cut-off lower than the protein of interested molecular weight. After concentration to a volume of approximately 1-3 mL the protein was transferred to a dialysis membrane (Spectra/Por® Dialysis Membrane, Spectrumlabs) previously washed with distilled water and resuspension buffer. The protein was incubated at 4 ºC overnight in the dialysis membrane, floating in the resuspension buffer. Then the protein was centrifuged at 8,000 g for 15 min at 4 ºC to eliminate any precipitation and its concentration was determined in a NanoDrop ND-1000 Spectrophotometer. The protein was kept at -80 ºC until further use. 8.4. Electrophorectic Mobility Shift Assay (EMSA) Electrophoretic mobility shift assay allows the study of DNAprotein interactions. The DNA of interest was amplified by PCR (Table III.10) and end-labelled with biotin using the Biotin 3’ End DNA labelling Kit (Thermo ScientificTM) following the manufacturer’s recommendations. Table III.10. Primers used to amplify ParaC1, PfrpA and PfrpBC. Oligonucleotide (5’->3’) Size (bp) PpbtA (ParaC1) AraC1_EMSA_F TTCTTCCCCTAAAAAATGAC 330 AraC1_EMSA_R TTTAGATACCATTCAAAAAT PfrpA FrpA_1_EMSA_F CAGGGTGCTCTCACGCCTAA 333 FrpA_EMSA_R CGAATCTGTTTTCCTGTGGT PfrpA FrpA_4_EMSA_F AAAAATAGACGACCCGATCT 136 FrpA_5_EMSA_ R CTGTGGTATCCATATTGAAC PfrpBC FrpBC_EMSA_F AATAAAGCTCCATAAATGGA 760
MARTA A. LAGES 64 FrpBC_1_EMSA_ R ATACATCTTCGTAGACAGGG PfrpBC FrpBC_EMSA_F AATAAAGCTCCATAAATGGA 100 FrpBC_12_EMSA_ R GGTGGGCTAGTTACGACTAA The EMSA was performed using the LightShift® Chemiluminescent EMSA Kit (Thermo ScientificTM). Binding reactions were performed as in Table III.11. Binding reactions were incubated for 30 min at 21 ºC and loaded in a 5% 0.5x TBE gel. The gel was running at 100V for 1 h at 4 ºC. The proteins were then transferred to a positively charged nylon membrane in a wet system (0.5x TBE) at 380 mA for 30 min at 4 ºC. The resultant membrane was immediately UV-crosslinked and further treated following the manufacturer’s instructions. Table III.11. Components of the binding reactions. Each reaction contained the 3’end biotin labelled DNA and 0.2 or 1 pmol of the protein. To R3 was added an excess of specific unlabelled DNA. Binding Reactions Component Final amount R1 R2(0.2) R2(1) R3(0.2) R3(1) Ultrapure wate r 8 µL 6.96 µL 5.4 µL --- --- 10x binding buffer (10 mM Tris, 50 mM KCl, 1 mM DTT, pH 7.5) 1x 2 µL 50% glycerol 5% 2 µL 1 M KCl 150 mM 3 µL 100 mM MgCl2 5 mM 1 µL 20 mM EDTA 1 mM 1 µL BSA 0.3 mg/mL 2 µL Unlabelled DNA 2.5 pmol - - - --- --- Protein CTD/NTD 0.2 pmol - 1.04/ 1.42 µL - 1.04/ 1.42 µL - Protein CTD/NTD 1 pmol - - 2.6/ 1.42 µL - 2.6/ 1.42 µL Biotin labeled DNA 25 fmol 1 µL Total volume 20 µL
III. Material and Methods 65 9. EXPERIMENTAL INFECTIONS Fish virulence assays were performed using sole fingerlings (Solea senegalensis) of 10-15 g that are naturally infected with V. anguillarum. Fish were divided in groups of 30 individuals and acclimated at the temperature tested and maintained in 50 L seawater tanks with aeration. Fish were inoculated intraperitoneally with 0.1 mL of a bacterial suspension obtained by resuspending in saline solution (0.85% NaCl) several colonies from a fresh TSA-1 culture. The suspension was adjusted to an OD600 = 0.5 and the inoculum used was a 10-fold serial dilution of this suspension. The precise number of injected bacterial cells was determined by colony plate counting in TSA-1. Control groups were inoculated with 0.1 mL of saline solution and maintained at the correspondent temperature during the time frame of the experiment (7-12 days). Mortalities were recorded daily and statistically significant differences in percentage of survival were determined using the Kaplan-Meier method with Mantel-Cox log-rank test using SPSS (version 20; IBM SPSS Inc., Chicago, IL). P-values were considered significant when p<0.05; <0.01 and 0.001. The Relative Percentage of Survival was determined following: RPS= [1 – (% mortality of the vaccinated groups / % mortality in the control group)] x 100. The assay was executed at the Experimental Aquarium of the University of Santiago de Compostela. The protocols for animal experimentation used followed the current Spanish and European legislation and have been approved by the Bioethics Committee of the University of Santiago de Compostela (Procedure Code 15004/14/003). 10. VACCINATION ASSAYS 10.1. Immunization Vaccination assays were performed to evaluate the protection generated by classical bacterins and the recombinant proteins rFrpA and rFvtA against V. anguillarum infection occurred at 18 and 24 ºC. The cross-protection of FrpAVang against a P. damselae subsp. piscicida infection was also evaluated (Table III.12).
MARTA A. LAGES 66 The assay was performed using Senegalese sole (Solea senegalensis) fish fingerlings of approximately 10 g. The assay was executed at the Experimental Aquarium of the University of Santiago de Compostela. The fish were acclimated for seven days in 100 L tanks of seawater, with recirculation and continuous aeration at 18 ºC. After acclimation, fish were separated in 6 groups that were subjected to the following treatments: rFrpA or rFvtA subunit vaccine; V. anguillarum RV22 or P. damselae subsp. piscicida DI21 bacterins; Freund’s adjuvant control; and PBS (non-immunized control). Table III.12. Representation of the treatments, number of fish and temperature of the experimental challenge. Immunization Treatment Number of fish Temperature of experimental infection (ºC) Bacterin RV22 100 18 22 Bacterin DI21 50 22 rFrpA 100 18 22 rFvtA 100 18 24 Freund’s Adjuvant 100 18 22 24 PBS 100 18 22 24 The recombinant proteins rFrpA and rFvtA were diluted in PBS leading to a final concentration of 0.6 mg/mL and fish belonging to those groups injected intraperitoneally with 100 µL of an emulsion of recombinant protein and Freund’s adjuvant (Sigma-Aldrich) in a 1:1 proportion (complete Freund’s adjuvant was used for the first immunization and the incomplete one in the second immunization). Each fish was immunized with 30 µg of protein. Both recombinant proteins were purified from E. coli cultures expressing the proteins from the corresponding genes cloned in plasmid pET20b(+). They were elaborated by Prof. Carlos Jiménez group of Organic Chemistry of the University of A Coruña.
III. Material and Methods 67 The bacterins were obtained by growing aerobically V. anguillarum RV22 and P. damselae subsp. piscicida DI21, in TSB-1 at 25 ºC with shaking. When the cultures reached an OD600 ca. 0.9, the cells were inactivated by the addition of 37% formaldehyde (PanReac) at 10 mL/L of culture. The suspension was incubated for 4 h with shaking (120 rpm) at 25 ºC. To assure the inactivation of the cells, 100 µL of the suspension was plated in duplicate in TSA-1 and incubated at 25 ºC and 37 ºC. The bacterins were stored at 4 ºC until the immunization. Fish were injected intraperitoneally with 100 µL of the correspondent bacterin. Two control groups were established, PBS and Freund’s adjuvant. Fish belonging to the PBS control group were injected intraperitoneally with 100 µL of sterile PBS. Fish belonging to the Freund’s adjuvant group were also injected intraperitoneally with an emulsified solution of adjuvant in PBS (1:1). Two immunizations were performed. The first one at day 0 and a second immunization or a booster vaccination at day 30. Complete Freund’s adjuvant was used in the first immunization and incomplete Freund’s adjuvant in the booster dose. Sixty days after the first immunization, experimental infection challenges with V. anguillarum or P. damselae subsp. piscicida were performed at 18, 22 or 24 ºC (see Table III.12). Fish were injected intraperitoneally with 100 µL of a suspension of V. anguillarum RV22 or P. damselae subsp. piscicida DI21 with ca 5x105 CFU/mL. Mortality was followed daily. 10.2. Determination of antibody levels by ELISA The levels of antibodies were determined at three time points, before the first immunization (day 0), before the second immunization (day 30) and before the experimental infection (day 60). Blood was extracted from 5 fish of each group by puncturing the caudal vein. Blood was incubated at 4 ºC to coagulate and after approximately two hours, the serum was collected and mixed with glycerol 1:1 (v/v) to freeze it at -20 ºC until use. The level of antibodies generated by the administration of each treatment described above was evaluated by an indirect ELISA immunoassay (Enzyme-Linked ImmunoSorbent Assay) (Figure III.7).
MARTA A. LAGES 68 The monoclonal IgM anti-Gourami antibody (Osphronemus goramy) (AQUATIC Diagnostics Ltd) was used to detect the level of IgG in fish serum. The anti-IgG Gourami antibodies have demonstrated to be effective in the determination of antibodies levels produced in sole fish (Valderrama et al., 2019). ELISA was performed following the manufacturer’s recommendations (AQUATIC Diagnostics Ltd). As primary antigen, that immobilized in the wells of the ELISA plate, was used the purified protein, rFrpA or rFvtA (10 ng in each well) or the bacterins (100 µL/well). Consequently, the fish antibodies able to recognize rFrpA, rFvtA and whole cells were immobilized in the well. The primary antigens were incubated overnight at 4 ºC and then the wells were washed with TTBS (0.5% Tween 20, Tris 50 mM, NaCl 0.15 M, pH 7.5). The antigens were blocked with 5% skim milk in TBS (Tris 50 mM, NaCl 0.15 M, pH 7.5) and incubated for 1 hat 25 ºC. After washing with TTBS, 50 μL of each serum (from a 1:100 dilution) were added to each well and the plate was incubated for 30 min at 25 ºC. After another wash, 50 µL/well of a 1:1000 dilution of the monoclonal IgG mouse anti-Gourami IgM antibody (AQUATIC Diagnostics Ltd) was added. Subsequently, 50 µL/well of a 1:1000 dilution of the antimouse IgG (Bio-Rad) was used to detection. This IgG produced in goat is conjugated to the enzyme peroxidase that allows the quantification through a colorimetric reaction using the Kit TMB-peroxidase (BioRad). After the incubation with the substrate for 30 min at 25 ºC in the dark, the reaction was blocked with 1 N H2SO4. The appearance of a yellow colour is indicative of the presence of antibodies and its intensity is directly dependent on the level of antibodies present. The resultant antibody level was quantified by measuring the A450 in an iMarK Microplate Reader (Bio-Rad). Antibody levels were determined in triplicate and the results shown are the average of the levels detected.
IV. Results and Discussion 75 (TBO) (Guijarro et al., 2015). However, these regulatory mechanisms are yet poorly characterized. 1.2. TRANSCRIPTOMIC ADAPTATIONS OF V. ANGUILLARUM TO GROWTH UNDER LOW IRON AVAILABILITY AT COLD OR WARM TEMPERATURE An RNAseq experiment was conducted to analyse the expression pattern of V. anguillarum RV22 during growth at lowand high-water temperature. The expression level of each gene was analysed in conditions that would mimic the environment faced by the pathogen when infecting cold- (15 ºC) or warm- (25 ºC) water adapted fish species. To this purpose, V. anguillarum RV22 was grown in CM9 minimal medium supplemented with 50 µM 2,2’-dipyridyl reducing iron availability, a condition that mimics the main signal that bacteria find during host colonization (Skaar, 2010). In addition, the expression pattern when V. anguillarum was grown in iron availability (10 µM FeCl3) was used as control to define the genes that are regulated by iron limitation (Figure IV.2). Figure IV.2. Experimental design to evaluate the transcriptomic changes of V. anguillarum RV22 strain to iron availability and temperature shift. The comparative transcriptome analysis under low-iron and highiron availability at 25 ºC revealed 948 differentially expressed genes (DEGs) (Figure IV.3). 511 genes were down-regulated and 437 were up-regulated under low iron availability. For a better interpretation of the results, the differentially expressed genes were grouped into 19 functional KEEG categories (Figure IV.4).
MARTA A. LAGES 76 Figure IV.3. Differentially expressed genes (DEGs) identified under iron deficiency and low temperature (15 ºC). The results showed profound changes in global cellular metabolism adaptations and, most notably, the induction of virulence-related genes. Most of the down-regulated DEGs encode functions related to signal transduction (T), energy metabolism (C), cell motility (N) and translation and ribosome structure (J). By contrast, functions related to replication, recombination, and repair (L), cell wall/membrane biogenesis (M), and inorganic ion transport (P) are induced under low iron. In addition, the number of DEGs downand up-regulated related to amino acids (E) and carbohydrate metabolism (G) functions, as well as some transcriptional factors (K), were equilibrated, which would suggest that the adaptation to grow under iron deprivation implies changes in amino acid and carbohydrate requirements. Most DEGs identified at low-temperature (15 ºC) under low iron availability were up-regulated (299 DEGs) (Figure IV.3). The most represented functional groups were related to amino acids metabolism and transport (E), DNA replication, recombination, and repair (L), cell wall/membrane (M), and inorganic ion transport (P) (Figure IV.4). Interestingly, the slow growth rate observed at 15 ºC did not correlate to a drastic change in the expression pattern of genes related to the energetic metabolism, as it was similar at 25 ºC and 15 ºC (Figure IV.4). In fast growing cells there is a direct correlation between the growth rate and ribosome content, as the machinery responsible for protein synthesis such as ribosomes, tRNA and translation factors have a determinant role in maintaining exponential growth (Bremer and Dennis, 2008). When temperature drops to 15 ºC, there was a significant
IV. Results and Discussion 77 down-regulation of genes related to synthesis of large and small subunits of ribosomes and tRNA biogenesis (J). Growth under iron starvation at 15 ºC is a limiting condition that requires low levels of ribosomal proteins and polypeptide synthesis for bacterial growth (Bremer and Dennis, 2008). Additionally, components of amino acids and carbohydrates transport systems (ABC transporters and phosphotransferase systems) were also down-regulated. The slower growth phenotype of RV22 at 15 ºC might be the result of a decrease in nutrient import. Figure IV.4. DEGs classified under KEGG categories. Number of DEGs upand down-regulated under iron limitation at 25 ºC and at 15 ºC.
MARTA A. LAGES 78 1.3. METABOLIC ADAPTATIONS TO GROWTH UNDER IRON STARVATION The reduction of iron levels within the host environment constitutes a defence mechanism against bacterial pathogens. These conditions are a signal that a pathogen detects when it initiates the host colonization, consequently bacterial cells adapt their metabolism to iron starvation conditions (Skaar, 2010). According to our results, V. anguillarum responds to iron starvation redirecting the central metabolism to increase iron availability. The bacterium down-regulates genes encoding enzymes that participate in pathways with high-iron requirement like TCA cycle, in which some Fe-S containing enzymes participate, favouring glycolysis and pentose phosphate pathway as energy and metabolite sources (Table IV.1). Seven DEGs encoding enzymes of the glycolytic pathway were up-regulated. Conversely, the expression of genes encoding TCA cycle functions decreased (Table IV.1). These observations suggest a systemic up-regulation of glycolysis and a down-regulation of TCA cycle upon iron starvation, which would lead to a comparable increase in pyruvate for subsequent use in fermentative pathways as opposed to the TCA cycle. Even though the inhibition of TCA cycle makes the metabolism less energetically effective, glycolysis generates pyruvate, nicotinamide adenine dinucleotide (NADH), and other metabolic intermediates used by major biosynthetic pathways (Carlos et al., 2018). Besides, the pentose phosphate pathway can also generate NADPH, ribose 5phosphate and erythrose 4-phospate that can be used in other biosynthetic pathways such as fatty acid biosynthesis, nucleotide and nucleic acid biosynthesis and aromatic amino acids biosynthesis (Carlos et al., 2018). Notably, HexR a regulator that represses the activity of the central carbon metabolism (Leyn et al., 2011) was downregulated (Table IV.1).
IV. Results and Discussion 79 Table IV.1. Relevant differentially expressed genes related to metabolism. Darker colour denotes higher expression. Fold change values with p < 0.05 are shown. ns, no significant differences.
MARTA A. LAGES 80 Many genes related to respiratory chain like cytochromes were down-regulated at low iron availability. Iron-sulfur (Fe-S) containing proteins were extensively down-regulated at low iron availability. Fe– S proteins are crucial for cell metabolism since they are involved in numerous biological processes, ranging from energy metabolism, e.g., TCA cycle and respiratory chain, to DNA repair. Interestingly, among low-iron induced DEGs (a 4.3-fold increase) was iscR, which encodes a transcriptional regulator that senses the cellular Fe–S status and adjust transcription of genes encoding several Fe–S assembly factors, Fe–S enzymes, Mn2 +-containing enzymes like superoxide dismutase and ribonucleotide reductase, and additional genes with functions, such as biofilm formation, colicin K synthesis, and RNA metabolism (Lim and Choi, 2014; Santos et al., 2015). Furthermore, IscR homologs play a role in virulence (Mettert and Kiley, 2015). Notably, the essential respiratory protein A, erpA, a Fe–S biogenesis-related gene essential for respiratory metabolism was 2.4-fold induced (Loiseau et al., 2007). In addition, energy production through respiratory chain should be balanced, thus alternative members of the respiratory chain were upregulated at low iron availability: the Rbf complex, the YdjA-like NAD(P)H nitroreductase, the electron transporter RsxE, and oxidoreductase (Table IV.1). Bacteria also adjust the amino acid metabolism to the environmental requirements (Table IV.2). Under iron starvation, valine, leucine and isoleucine degradation routes were down-regulated as the expression of five DEGs encoding enzymes for these functions diminished. Conversely, arginine, phenylalanine, tyrosine and tryptophan biosynthesis, as well as cysteine, methionine, glycine, serine and threonine metabolism were up-regulated.
IV. Results and Discussion 81 Table IV.2. Relevant amino acids metabolism, synthesis and degradation related genes differentially expressed. Darker colour denotes higher expression. Fold change values with p < 0.05 are shown. ns, no significant differences. Arginine is an amino acid required to synthesize the siderophore vanchrobactin (Soengas et al., 2006). The biosynthesis of the aromatic amino acids phenylalanine, tyrosine and tryptophan was 4to 6-fold upregulated. Regarding the synthesis of phenylalanine and tyrosine from chorismate, three enzymes intervene in the process. The conversion of tyrosine to the immediate precursor, 4-hydroxyphenylpyruvate and the conversion of phenylalanine to the precursor phenylpyruvate is also upregulated. Moreover, the conversion of phenylalanine to tyrosine was repressed, as the activity of the enzyme phenylalanine-4-hydroxylase PhhA, was down-regulated. Five DEGs encoding enzymes involved in the synthesis of tryptophan were up-regulated. Notably there was an upregulation of the tryptophan transcriptional repressor that regulates the expression of the trp operon in response to its intracellular levels. The biosynthetic process that leads to the synthesis of these aromatic amino acids generates an intermediate, chorismate, essential for the synthesis of siderophores (Balado et al., 2008). The genes hutGHIU involved in histidine metabolism were also down-regulated. Four DEGs encoding enzymes that are involved in the degradation of L-histidine to Lglutamate were down-regulated. This reaction results in L-glutamate
MARTA A. LAGES 82 that can be involved in a fermentation process leading to the formation of acetate, pyruvate and ammonia or histidine that can also be converted in TCA cycle intermediates (Kastenmuller et al., 2009). Interestingly, there was an up-regulation of a gene encoding a histidine decarboxylase, involved in the decarboxylation of histidine to form histamine. Histamine has been reported as a metabolite that can induce immune responses, specifically it is associated with HFPhistamine fish poisoning and consequently can act as a virulence factor (Barancin et al., 1998; Barcik et al., 2017). Table IV.3. Relevant fatty acid metabolism related genes differentially expressed. Darker colour denotes higher expression. Fold change values with p < 0.05 are shown. ns, no significant differences. Fatty acids represent not only a carbon source for the energetic metabolism but also a source for bacterial membrane remodeling. The membrane phospholipid content affects its permeability and consequently bacterial survival in changing environments and persistence within the host. Beyond the alteration of membrane homeostasis, fatty acids may change Vibrio species virulence phenotype. It has been reported that in V. cholerae the incorporation of specific fatty acids enhance motility, biofilm formation, cholera toxin secretion and antibiotic resistance (Chatterjee et al., 2007; Moravec et al., 2017). Under iron starvation, there is a down-regulation of 5 DEGs related to fatty acid metabolism (Table IV.3). 1.4. EXPRESSION OF VIRULENCE FACTORS AT WARMAND COLDWATER TEMPERATURE UNDER IRON STARVATION Bacterial pathogens must express virulence factors that enable them to colonise and grow within the host. Bacteria face a drastic shift in iron availability upon host encounter (Skaar, 2010). Low-iron adaptations were described in most bacterial pathogens including E.
IV. Results and Discussion 83 coli, V. cholerae and Staphylococcus aureus (Andrews et al., 2003; Mey et al., 2005; Friedman et al., 2006) and it is well established that low-iron up-regulates the expression of most virulence factors. To date several virulence factors have been described in V. anguillarum. They include LPS, motility and chemotaxis, iron uptake mechanisms and extracellular products with haemolytic and proteolytic activity (Li and Ma, 2017; Toranzo et al., 2017). The adaptation to iron starvation produced the up-regulation of genes related to LPS, different systems for iron acquisition, the haemolysins RTX, Vah1 and Vah3, outer membrane proteins associated with the efflux of metabolites (OmpA, OmpC and OmpV), and Type VI Secretion Systems. The temperature-dependent expression of virulence factors is detailed below. 1.4.1. Lipopolysaccharide and exopolysaccharide related genes V. anguillarum lipopolysaccharide has endotoxic activity and allows the pathogen to adhere and persist within the host by evading the immune system (Boesen et al., 1999). It is constituted by three regions, lipid-A, core polysaccharide, and the O-antigen that confers the endotoxic activity, antigenic properties and induce immunological responses (Boesen et al., 1999; Lindell et al., 2012). Interestingly, LPS composition, specifically the O-antigen polysaccharide side chains, influences the bactericidal effect of the complement system (Boesen et al., 1999). It has been reported that V. anguillarum isolates resistant to serum were pathogenic for Atlantic salmon (Austin et al., 1995). This indicates a direct correlation between serum resistance and survival of V. anguillarum in the fish host (Boesen et al., 1999). The genes involved in capsular polysaccharide production are encoded by a biosynthesis operon (VAR_RS0112290VAR_RS0112465) and by the transport and assemble genes wza-wzc (wziab, VAR_RS0107285-VAR_RS0107295) and wbfB-wbfD (VAR_RS0107305-VAR_RS0107315) (Croxatto et al., 2007; Naka et al., 2011). V. anguillarum EPS is essential for the attachment of the pathogen to the host skin, preventing its removal by natural sloughing of fish mucus (Croxatto et al., 2007). Moreover, the attachment to fish skin by formation of a biofilm would boost the colonization and
MARTA A. LAGES 84 proliferation of V. anguillarum (Weber et al., 2010). In E. coli, wza gene encodes an outer membrane lipoprotein that forms a channel essential for the export of polysaccharides (Drummelsmith and Whitfield, 2000). The other genes in this operon, wzb and wzc catalyse the polymerization of the exported polysaccharides (Drummelsmith and Whitfield, 1999; Wugeditsch et al., 2001). EPS provides an environment full of nutrients and exoenzymes and promotes the cooperation between cells, forming biofilms (Croxatto et al., 2007). RNAseq results showed that there was an up-regulation (2.6-fold increase) of genes related to LPS/EPS biosynthesis, assemble and export under iron starvation (Table IV.4). This result suggests that the expression of LPS and EPS related genes increase under iron starvation, allowing the bacteria to evade host’s defences and survive within the host. In addition, genes encoding functions related to exopolysaccharide transport and assemble showed maximal expression (a 2.7-fold increase) at low temperature (Table IV.4) but statistically significant differences were not found. Table IV.4. Expression level and fold change of LPS and EPS related genes. Darker colour denotes higher expression. Fold change values with p < 0.05 are shown. ns, no significant differences.
IV. Results and Discussion 91 MARTX and Vah1 are the main responsible for the haemolytic and cytotoxic activities of V. anguillarum in fish (Hirono et al., 1996; Li et al., 2008). MARTX depends on the expression of six genes (rtxABCHBDE), which encode a potent toxin RtxA, a toxin activator RtxC, and the specialized T1SS RtxDBE, responsible for RtxA secretion (Li et al., 2008). Both haemolysins have a cytotoxic effect on Atlantic salmon kidney cells and only a vah1 rtxA double mutant was no longer cytotoxic. Though, when the implication of MARTX and Vah1 in virulence was studied using Atlantic salmon as fish model, only strains containing a rtxA deletion had reduced virulence. Consequently, it was proposed as a major virulence factor for V. anguillarum (Li et al., 2008). Remarkably, the water temperature used in the experimental infection was not mentioned (Li et al., 2008), however, salmon infections should occur at a low temperature of ca 15 ºC, the temperature that favours MARTX maximal expression. Therefore, the implication of MARTX in virulence in the reported works could be overestimated as both haemolysins expression is temperature dependent. Figure IV.6. Haemolytic activity of V. anguillarum at 15 and 25 ºC. A loopful of cells grown in iron deficiency was placed onto sheep blood agar plates and the haemolytic activity was observed by the appearance of a translucid halo. To evaluate the effect of temperature in V. anguillarum haemolytic activity, a loopful of biomass of RV22 strain, cultured in CM9 plates supplemented with 50 µM of the chelating agent 2,2’-dipyridyl, was placed onto sheep blood agar plates (Figure IV.6) After incubation at 25 or 15 ºC, the appearance of a translucid halo around the biomass is indicative of haemolytic activity. A higher translucency of the haemolytic halo was detected when cells were grown at 15 ºC, but a
MARTA A. LAGES 92 larger halo was observed at 25 ºC. These results indicate that different haemolysins are produced at 15 and 25 ºC. (Figure IV.6). 1.4.4. Chemotaxis and Motility Chemotaxis and motility have been recognized as virulence related factors (Larsen et al., 2004; Guanhua et al., 2018). Conversely to what was observed for other virulence factors, genes related to chemotaxis and flagellum synthesis were significantly down-regulated, between 3.6and 2.1-fold, when V. anguillarum was grown under low iron availability. In addition, a significant down-regulation of these genes was observed when the temperature was dropped to 15 ºC. Although genes encoding structural components of the flagellar system were down-regulated, they exhibited a high basal expression and some proteins of the flagellar motor were even induced, however, no statistically significant differences were observed (Table IV.8). V. anguillarum exhibits rapid motility by means of a polar flagellum and the chemotactic motility is essential for virulence when the host encounters the pathogen in the aqueous environment (O’Toole et al., 1999). Interestingly V. anguillarum responds chemotactically to a wide range of chemoattractants allowing the infection of different fish epithelia (O’Toole et al., 1999). V. anguillarum is chemotactic in a wide temperature range nonetheless the optimal temperature for chemotaxis is 25 ºC congruent with its optimal growth temperature (Larsen et al., 2004). In fact, V. anguillarum responds chemotactically to fish skin and intestinal mucus, however the flagellum is only essential for the initial steps of infection. The flagellum may act as a motility organelle or has an adhesin for binding mucosal tissue and V. anguillarum swimming speed is also temperature dependent as it is reduced at low temperatures (Ormonde et al., 2000; Larsen et al., 2004). Once the pathogen has invaded the host, the flagellum is not needed for the progression of vibriosis (Milton et al., 1996; O’Toole et al., 1996).
IV. Results and Discussion 93 Table IV.8. Expression levels and fold change of chemotaxis and motility related genes. Darker colour denotes higher expression. Fold change values with p < 0.05 were shown. ns, no significant differences.
MARTA A. LAGES 94
IV. Results and Discussion 95 An in vitro experiment was performed to confirm the motility of V. anguillarum under iron availability and iron limitation. V. anguillarum colonies were stabbed in the centre of a tube containing soft agar supplemented with iron or the iron chelator 2,2’-dipyridyl. The tubes were incubated at 25 or 15 ºC. Figure IV.7. V. anguillarum motility observed under iron excess at 25 ºC and iron restriction at 25 and 15 ºC. V. anguillarum colonies were stabbed into soft agar and the appearance of cloudiness indicated motility. The appearance of cloudiness around the central puncture indicates motility. When compared to a non-motile bacterium, V. anguillarum motility was higher under iron availability. Under iron starvation and when the temperature dropped to 15 ºC, the flagellar motility tended to decrease (Figure IV.7). 1.4.5. Iron uptake systems Bacteria can acquire iron, an element essential for metabolic pathways and intracellular survival, by synthesizing specialized systems. Iron can be obtained directly from the host haem group or haem containing proteins or by the production of high-affinity extracellular ferric-chelators, siderophores (Wandersman and Delepelaire, 2004). V. anguillarum genome harbours genes that encode functions related to the acquisition and utilization of the haem group (huvABCDZX) (Mouriño et al., 2004), the acquisition of ferrous iron (feoABC) (Lemos and Osorio, 2010) and two siderophore systems, the
MARTA A. LAGES 96 chromosomally encoded vanchrobactin (vabABCDEFGHSR mbtH) and piscibactin (araC1C2 and irp). Iron acquisition systems are strongly up-regulated under iron starvation (Table IV.9). feoB, that mediates ferrous iron acquisition (Lemos and Osorio, 2010), was 5.9-fold induced. huvBCDZX genes encoding haem uptake and utilization system (Mouriño et al., 2004) showed a 26.4-fold increase in their transcription level. Notably, both siderophore systems presented an up-regulation. Vanchrobactin vabABCDEFGHSR mbtH genes showed a global 60-fold change increase, while piscibactin araC1C2 and irp genes showed an 8.2-fold increase. At 25 ºC the vanchrobactin siderophore system is strikingly more expressed than piscibactin showing more than a 20-fold change difference in expression (FRPKM of 917.3 for vanchrobactin and 41.9 for piscibactin). Ferri-siderophores and the haem group are internalized through specific outer membrane transporters. This process is mediated by the inner membrane potential achieved through the energy transducing TonB-ExbB-ExbD system (TonB1 and TonB2 systems) whose expression increased upon iron starvation, 45.4and 17.4-fold increase (Table IV.9). The vanchrobactin outer membrane receptor gene fvtA was preferentially expressed at 25 ºC, showing a 173.7-fold change increased expression. Notably, piscibactin biosynthetic and uptake genes were greatly up-regulated at low temperature. At 15 ºC under iron deprived conditions, araC1C2 and irp genes achieved the maximal FRPKM of 219.6. Under this condition, the genes araC1, encoding the putative AraC-like transcriptional regulator, and frpA, the gene encoding the putative outer membrane transporter for the ferri-piscibactin complex, are among the most up-regulated genes as their transcription showed a 6.8and 3.9-fold increase. Interestingly, at 15 ºC, huvA, the haem group outer membrane receptor gene, showed its maximal expression level, FRPKM 1287.1. Genes frpB and frpC encode the putative inner membrane ABC transporters and their expression level increased at 15 ºC, showing a 3.7and 4.6-fold increase. When in the cytosol, the ferrisiderophores complexes are dissociated for further use. This function might be accomplished by reductases and interestingly the locus WP_017045538.1 was induced under iron restriction (18.1-fold
IV. Results and Discussion 97 change), and it would encode an uncharacterized putative ferricsiderophore utilization protein. All results put together greatly suggest that the genes that encode piscibactin are among the most induced genes at cold-temperatures. The work carried out to characterize the mechanisms involved in the temperature-dependent regulation of irpHPI genomic element, which encodes the piscibactin siderophore system, are detailed below in Chapter IV.3. Table IV.9. Expression level and fold change of iron uptake systems related genes. Darker colour denotes higher expression. Fold change values with p <0.05 were shown. ns, no significant differences.
MARTA A. LAGES 98 1.5. SUMMARY OF CHAPTER 1 Transcriptomic data gives a new insight into the physiological adaptations of V. anguillarum that enable this bacterium to infect fish that live at different temperatures. The results revealed a deep adaptation of V. anguillarum to grow under iron restrictive conditions. Genes related to the energetic metabolism were down-regulated whereas virulence related genes were induced under this condition. Chemotaxis, motility and T6SS1 are preferentially expressed at 25 ºC. Conversely, the haemolysin RTX, T6SS2 and genes related to exopolysaccharide assembly and transport were induced by a temperature shift to 15 ºC. Concretely, iron limitation induced the expression of siderophores however their relevance varies with temperature. The piscibactin siderophore system is one of the most upregulated virulence factor at 15 ºC, while vanchrobactin, seems to be the preferential system to supply iron at 25 ºC. Notably, in V. anguillarum temperature and iron availability are key signals for the expression of virulence factors. Their expression varies between temperatures, which indicates a different relevance for the infection of coldand warm-water adapted fish species.
99 2. CHARACTERIZATION OF THE PISCIBACTIN GENOMIC ISLAND (irp-HPI) AND IDENTIFICATION OF ELEMENTS REQUIRED FOR PISCIBACTIN PRODUCTION AND UTILIZATION 2.1. V. ANGUILLARUM irp-HPI GENOMIC ISLAND (irp-HPIVANG) V. anguillarum RV22 genome harbours an irp gene cluster, with a size of about 40 kb, located in chromosome II between locus AEH34691 and AEH34692. This cluster shows a similar gene structure and a homology at the amino acid level between 52 and 66% when compared to its ortholog counterpart located in the plasmid pPHDP70 of P. damselae subsp. piscicida. As reported for pPHDP70, RV22 irp gene cluster contains all the genes necessary for piscibactin synthesis and utilization, however an entD homolog is absent (Figure IV.8). entD encodes a 4’-phosphopantetheinyl transferase required to activate the peptide synthesis domains of NRPS. Although an entD is not present in the piscibactin gene cluster, the vanchrobactin gene cluster in strain RV22 harbours a gene encoding the same function, vabD that could complement in trans the other siderophore system (Figure I.8). The irp gene cluster shows some of the marked characteristics of genomic islands acquired via horizontal gene transfer. Apart from its A+T high content (G+C content of ca. 46.7%), adjacent to the irp gene cluster there are three orfs that encode a putative transposon belonging to the Tn7 superfamily (Figure IV.8). These transposons are associated with the insertion of horizontally acquired genes that are not inserted near tRNAs. The nucleotide sequence of these orfs show an 86% identity to V. parahaemolyticus pathogenicity island (Vp-PAI), suggesting that irp genes are part of a genomic island, which was named as irp-HPIVang.
MARTA A. LAGES 100 Figure IV.8. Comparison between the piscibactin gene cluster of V. anguillarum RV22 strain and P. damselae subsp. piscicida. To evaluate the distribution of the irp genomic island among different V. anguillarum strains, an in silico search using 43 genomes available in GenBank was performed (Table IV.10). Results showed that the irp gene cluster is present in several strains including some highly pathogenic isolates harbouring an active vanchrobactin siderophore system (Table IV.10). The prevalence of the irp gene cluster in highly virulent strains suggests a relevant role in virulence. Interestingly, some of these pathogenic strains (Hl610, 90-11-286, 178/90, DSM 21597 and 91-7-154), have been associated with high virulence for larvae of cod, turbot, and halibut in experimental infections where the animals were maintained at 7 ºC, 9 ºC and 16 ºC respectively (Rønneseth, et al., 2017). These data suggest that piscibactin genes are widespread among different V. anguillarum strains that can infect coldand warm-water adapted fish species. Remarkably, the presence of the piscibactin gene cluster appears to be incompatible with the presence of the anguibactin encoding plasmid pJM1, so none of the analysed strains showed the simultaneous presence of the piscibactin and anguibactin systems.
IV. Results and Discussion 107 Figure IV.11. Growth ability of V. anguillarum RV22 and its derivative mutants. Growth was measured under iron excess (10 µM FeCl3) or iron starvation by the addition of 5 µM EDDA or 100 µM 2,2’-dipyridyl. Siderophore production was determined using the CAS liquid assay. Bars labelled with the same letters (a, b, c, d) did not show statistically significant differences (student’s t-test). Under iron excess, no statistically significant differences were observed for the tested strains, as all of them reached an OD600 ca. 1.6. However, under iron restrictive conditions different growth phenotypes emerged. When 5 µM of EDDA was added, the parental strain RV22 and the mutant RV22 Δirp1 (impaired for piscibactin synthesis) showed no significant differences in growth (OD600 ca. 1.1). Regarding RV22 ΔvabF, that only produces piscibactin, there was a significant decrease in growth achieved, showing a phenotype like RV22 ΔvabFΔirp1 (OD600 ca. 0.2). These results suggest that the inactivation of the vanchrobactin siderophore system strongly impacts the growth ability of V. anguillarum under strong iron deficiency (EDDA). Surprisingly, when 2,2’-dipyridyl was used as chelating agent, RV22 ΔvabF reached a growth close to 35% of the growth observed for the wild-type strain, OD600 = 0.7. RV22 Δirp1 showed a growth capacity indistinguishable from that of RV22. RV22 ΔvabFΔirp1 and RV22 ΔvabD had a similar growth potential and it was identical for both chelating agents. To determine siderophore production, cell-free supernatants of cultures
MARTA A. LAGES 108 grown with 50 µM 2,2’-dipyridyl were evaluated for siderophore activity with the CAS liquid assay. RV22 and RV22 Δirp1 showed the highest siderophore production ca. -0.35. Although RV22 ΔvabF showed an intermediate growth, siderophore production was residual. Interestingly, siderophore production in RV22 ΔvabF was indistinguishable from that observed for RV22 ΔvabFΔirp1 and RV22 ΔvabD (A630 ca. -0.1). When RV22 ΔvabFΔirp1 mutant was complemented with plasmid pPHDP70 from P. damselae subsp. piscicida that harbours the irp genes, the parental phenotype was restored (Figure IV.11). Evaluation of siderophore production by the CAS assay revealed that the growth potential directly correlates to the synthesis of vanchrobactin as the mutant impaired for vanchrobactin synthesis (RV22 ΔvabF) showed extremely low levels of siderophore production. In fact, the siderophore production phenotype of RV22 ΔvabF was similar to the mutants RV22 ΔvabD and RV22 ΔvabFΔirp1, both impaired for the synthesis of vanchrobactin and piscibactin. These results suggest that irp1 encodes biosynthetic functions as its deletion in a ΔvabF background impaired siderophore synthesis and the growth under iron limited conditions. Furthermore, vanchrobactin may be the primary siderophore of V. anguillarum and a more efficient source of iron since piscibactin efficiency as siderophore seems to be dependent on the iron source. 2.3.2. Irp4 is required for piscibactin synthesis Many natural products such as siderophores are produced by multimodular non-ribosomal peptide synthetases (NRPS) and polyketide synthases (PKS) from the assembling of different amino acids and polyketide moieties, respectively. Each module of a NRPS/PKS incorporates a single precursor into the nascent product that will remain covalently attached to the peptidyl carrier protein (PCP) domain (Schwarzer et al., 2003). Thus, the final product must be released from the final PCP by a C-terminal type I thioesterase domain (TE I) present in the last NRPS/PKS of the route (Drake et al., 2016).
IV. Results and Discussion 109 Figure IV.12. Genetic organization of piscibactin gene cluster in V. anguillarum (araC1 and araC2 were renamed to pbtA and pbtB, respectively) (A) and biosynthetic model for piscibactin assembly showing module organization and predicted substrate of Irp5, Irp2 and Irp1. Conserved domain annotation: A – adenylation, T – aryl or peptidyl carrier protein, C – condensation, MT – methyltransferase, KS – ketoacyl synthase, AT – acyltransferase, KR – ketoacyl reductase, TE – thioesterase. The piscibactin system possesses a C-terminal TE domain as part of the NRPS/PKS enzyme Irp1 in addition to a separate gene (irp4) that encodes a putative external TE (Figure IV.12). irp4 is located between the biosynthetic genes irp3 and irp9 (Figure IV.12.A) with which it is co-transcribed (see below). The translated product of irp4 showed sequence similarity (42% of identity, 56% similarity) to type II thioesterases such as YbtT from NRPS/PKS biosynthetic pathway of yersiniabactin (Ohlemacher et al., 2018). In addition, Irp4 contains the characteristic conserved thioesterase signature motif GHSMG from the amino acid position 99 to 103 (Geoffroy et al., 2000). This finding suggests that irp4 encodes a functional type II TE. To analyse the role of Irp4 in piscibactin production, a defective mutant for this gene was constructed in RV22 ∆vabF background where the production of vanchrobactin was abolished and so this mutant strain only synthesizes piscibactin. Then, the resultant RV22 ∆vabF∆irp4 mutant was challenged to grow and produce siderophores under different iron
MARTA A. LAGES 110 availability conditions (Figure IV.13). Figure IV.13. Growth ability of V. anguillarum RV22 strain, RV22 ΔvabFΔirp4 and complemented strain. Parental and mutant strain were grown in CM9 medium under iron excess or iron deprived conditions. Cultures grown in CM9 supplemented with 25 µM 2,2’-dipyridyl were used to test siderophore production using the liquid CAS assay. Asterisk denotes statistically significant differences, *p<0.05 (student’s t-test). As shown in Figure IV.13, parental strain RV22 ∆vabF and RV22 ∆vabF∆irp4 mutant were able to grow under iron excess conditions, showing indistinguishable growth capacity. By contrast, RV22 ∆vabF∆irp4 mutant was impaired to grow under iron-restricted conditions, achieved by the addition of 2,2´-dipyridyl at 75 µM to CM9 minimal medium. This mutant reached an OD600 ca. 0.15 when challenged to grow under stringent iron deprived conditions. Further evaluation of siderophore content in the culture supernatants of both strains showed that the deletion of irp4 caused a strong decrease in siderophore production compared to the parental strain RV22 ∆vabF (Figure IV.13). The siderophore production measured using the liquid CAS assay revealed that the mutant strain achieved an A630 ca. -0.18. Moreover, piscibactin was not detected in the cell-free supernatants of RV22 ∆vabF∆irp4 by LC-MS analysis. When this mutant ∆irp4 was complemented with a functional version of the irp4 gene, it recovered the parental phenotype both in terms of growth ability and siderophore production (Figure IV.13).
IV. Results and Discussion 111 Figure IV.14. Cross-feeding assay to evaluate the production of piscibactin by the tested strains RV22 ΔvabFΔirp4, RV22 ΔvabF, RV22 ΔvabD and RV22. A growth halo around the biomass of the tested strains indicates the use of the siderophore by the indicator strain. In addition, a cross-feeding assay was performed to analyse the synthesis of piscibactin by the mutant RV22 ∆vabF∆irp4, using RV22 ∆vabF as indicator strain. A growth halo indicates the utilization of the piscibactin produced by the tested strain (Figure IV.14). The tested strains RV22 ∆vabF, that produces piscibactin, and RV22, that produces both piscibactin and vanchrobactin, induced the growth of the indicator strain. Nonetheless, RV22 ∆vabF∆irp4 and RV22 ∆vabD showed identical phenotypes and were not able to cross-feed the RV22 ∆vabF strain (Figure IV.14). These results provide further evidence that the thioesterase encoded by irp4 is required for piscibactin synthesis. Usually, external type II thioesterases (TE II) are related to editing functions as they can remove non-extendable structures to promote the continuous flow of several rounds of biosynthesis by liberating the CP domains of NRPS/PKS from precursors (Drake et al., 2016). Piscibactin is a yersiniabactin-like siderophore and yersiniabactin system also possesses a C-terminal TE domain as part of the NRPS/PKS synthetase HMWP1 and an external TE named YbtT (Pelludat et al., 1998). Both TE domains are functional and ensure appropriate levels of yersiniabactin production (Bobrov et al., 2002). While the internal Cterminal TE releases the complete siderophore from the multienzymatic complex, YbtT avoids the formation of aberrant molecules that would block siderophore synthesis (Bobrov et al., 2002). Thus, although YbtT is not required for bacterial growth, it is needed for yersiniabactin maximal production as it prevents the incorporation of erroneous
MARTA A. LAGES 112 precursors that could inhibit the biosynthesis pathway (Ohlemacher et al., 2018). Piscibactin biosynthetic pathway is constituted by the NRPS/PKSs Irp5, Irp2 and Irp1 which form a synthesis complex organized in 6 modules (Figure IV.12.B). Irp1 contains an internal Cterminal thioesterase domain that would release the complete siderophore at the final step of biosynthesis (Irp1 module 6). However, the predicted final product of the route was not detected neither in P. damselae subsp. piscicida (Souto et al., 2012) nor in V. anguillarum supernatants (data not shown), and the piscibactin chemical structure is in accordance with the early release of the nascent siderophore at domain 5 (Figure IV.12.B). Since irp4 defective mutant lacks siderophore production, the results greatly suggest that Irp4 is required for piscibactin production since it mediates the early liberation of the siderophore from Irp1. Piscibactin is part of an intriguing and complex system as its labile and unstable nature once synthesized, leads to its rapidly degradation to intermediate forms which greatly difficult its detection (Souto et al., 2012). The inability to detect the predicted final siderophore structure questions the role of the C-terminal thioesterase. It cannot be ruled out that module 6 would be non-functional or that its product may be a cryptic metabolite that is synthesized only under specific conditions. Nonetheless, the loss of Irp4 activity abolishes siderophore production denoting a direct role of Irp4 in piscibactin synthesis and in its release from the NRPS/PKS multienzymatic system. 2.3.3. Irp8 is involved in piscibactin export When bacteria sense a low iron environment, siderophore synthesis is induced. Upon synthesis, siderophores must be exported to the extracellular environment to scavenge iron to fulfil the cell requirements (Ratledge and Dover, 2000). The mechanisms behind the secretion of siderophores remain poorly characterized in most bacteria. Two major siderophore export systems have been described: ATPdependent efflux pumps (Seeger and van Veen, 2009) and the major facilitator superfamily (MFS) (Fluman and Bibi, 2009). In the irp-HPI, irp8 encodes a putative exporter MFS-like. Irp8 is a polytopic protein, spanning the membrane several times, with 12 domains that represent
IV. Results and Discussion 113 transmembrane segments typically found in this type of efflux pumps (Furrer et al., 2002). A three-dimensional structure model based in its closest homologue was constructed using SWISS-MODEL (Figure IV.15) Figure IV.15. Three-dimensional structure of the exporter Irp8 created using SWISS-MODEL and based on the MFS closest homolog. To analyse the role of Irp8 in piscibactin exporting route, an inframe deletion mutant was constructed, and the resultant mutant was challenged to grow under different iron availability conditions: iron excess, CM9 minimal medium supplemented with 10 µM FeCl 3 and iron limited conditions, CM9 medium supplemented with 75 µM 2,2’- dipyridyl. Siderophore production in the parental strain and in its derivative Δirp8 mutant was evaluated in cell-free supernatants of cultures grown under weak iron deprived conditions (CM9 + 25 µM 2,2’- dipyridyl) (Figure IV.16). When grown in iron excess (addition of 10 µM FeCl 3 ), the mutant RV22 ΔvabFΔirp8 showed a growth capacity indistinguishable from that of the parental strain RV22 ΔvabF. Both strains achieved an OD 600 ca. 0.9. However, when challenged to grow under stringent iron limitation by the addition of 2,2’-dipyridyl at 75 µM, both strains showed opposite growth phenotypes. While the parental strain had a 55% decrease in its growth ability when compared to iron excess conditions (OD 600 ca. 0.4), the Δirp8 mutant achieved
MARTA A. LAGES 114 growth levels significantly lower (OD600 around 0.2) when grown under strong iron limited conditions (Figure IV.16). The decrease in growth of RV22 ΔvabFΔirp8 also correlates with a lower siderophore production. Nonetheless, the deletion of the putative exporter irp8 did not totally abolished siderophore production. The mutant strain achieved an A630 ca. -0.15. This siderophore production might indicate that residual amounts of piscibactin or intermediates that retain siderophore activity are still secreted to the extracellular medium which also correlates to the intermediate growth phenotype observed. Figure IV.16. Growth ability of V. anguillarum RV22 ΔvabF and RV22 ΔvabFΔirp8 in iron excess (10 µM FeCl3) or iron deficiency (75 µM 2,2’- dipyridyl). Siderophore production was quantified in cell-free supernatants of cultures grown in CM9 supplemented with 25 µM 2,2’-dipyridyl. Asterisk denotes statistically significant differences, *p<0.05 (student’s t-test). To evaluate the ability of the Δirp8 mutant strain to produce piscibactin, a cross-feeding assay was performed (Figure IV.17). The RV22 ΔvabD strain can grow under iron limited conditions using the siderophore produced by RV22 ΔvabF and RV22. However, the RV22 ΔvabFΔirp8 mutant was unable to cross-feed RV22 ΔvabD strain. This result clearly suggests that RV22 ΔvabFΔirp8 mutant is deficient in siderophore export and Irp8 is involved in the secretion process of piscibactin.
IV. Results and Discussion 115 Figure IV.17. Cross-feeding assay to evaluate the ability of the tested strains (RV22 ΔvabFΔirp8, RV22 ΔvabF, RV22 ΔvabD and RV22) to produce siderophores that the indicator strain could use to grow under iron limited conditions. Previous studies on siderophores export routes suggest that most exporter deletion mutants show intermediate siderophore production and growth phenotype when compared to the parental strain (Furrer et al., 2002; Balado et al., 2006). These phenotypes may be due to the presence of alternative secretion routes or the passive secretion of subproducts of siderophore synthesis that still show some activity when measured by the CAS assay (Furrer et al., 2002; Balado et al., 2006). The enterobactin siderophore export system in E. coli is one of the best characterized routes (Furrer et al., 2002; Horiyama and Nishino, 2014). Enterobactin is exported to the periplasm through EntS, a major facilitator transporter (Furrer et al., 2002). An EntS homolog, VabS, was also identified in V. anguillarum. VabS is involved in the secretion of the siderophore vanchrobactin (Balado et al., 2006). Nonetheless, the secretion of secondary metabolites requires at least three components: an active efflux pump (eg. EntS, VabS and Irp8), a membrane fusion protein that connects the pump to the outer membrane, and a channel located at the outer membrane that allows the passage of the siderophore (Furrer et al., 2002). Enterobactin is captured in the periplasm by the RND transporters AcrB, AcrD and MdtABC and then exported to the extracellular environment through the outer membrane
MARTA A. LAGES 116 channel TolC (Bleuel et al., 2005; Horiyama and Nishino, 2014). The involvement of a RND efflux system has been described for vibriobactin secretion in V. cholerae (Kunkle et al., 2017). According to this, it can be hypothesized that the MFS mediated efflux pump Irp8 of V. anguillarum secretes piscibactin to the periplasm and yet undetermined components export the siderophore to the extracellular environment. 2.4. PISCIBACTIN CONTRIBUTES SIGNIFICANTLY TO V. ANGUILLARUM VIRULENCE To study the contribution of piscibactin and vanchrobactin to V. anguillarum virulence, an experimental infection was performed using turbot fingerlings. The virulence assay was performed at 18-20 ºC, temperature at which turbot are naturally maintained at fish farms. The fish were inoculated intraperitoneally with a dose of 2-4x104 CFU of the correspondent strain: RV22 wild-type strain or its derivative mutants (RV22 ΔvabF, RV22 Δirp1, RV22 ΔvabFΔirp1, RV22 ΔvabD, and the complemented strain (RV22ΔvabFΔirp1 + pPHDP70). The fish were monitored for 7 days, and death events were daily registered (Figure IV.18). Five days post infection, the wild-type strain RV22 and the mutant impaired for vanchrobactin synthesis (RV22 ΔvabF), produced mortalities in the same range, 80% and 88%, respectively. The fish challenged with the mutant that only synthesizes vanchrobactin, RV22 Δirp1, produced 56% mortality 6 days post infection. Conversely, the mutants unable to synthesize neither vanchrobactin nor piscibactin, RV22 ΔvabFΔirp1 and RV22 ΔvabD, reached a mortality of 12% and 8%, respectively, 7 days post infection. Notably, when piscibactin production was restored by gene complementation in trans, RV22 ΔvabFΔirp1 + pPHDP70, the complemented strain reached 78% mortality, 6 days after infection (Figure IV.18). These results denote the strong effect of siderophores production, and in particular piscibactin production, in V. anguillarum virulence. At the tested conditions, when the fish were maintained at 18-20 ºC during the experimental infection, piscibactin contributed more significantly than vanchrobactin to virulence.