scieee AI-readable full text Open interactive document viewer

Circulating tumor cells in metastatic colorectal cancer from basic understandig to clinical practice

Barbazán García, Jorge

Abstract

Colorectal cancer (CRC) represents the third most diagnosed cancer type worldwide, accounting for more than 600.000 deaths in 2012, which approximately represents 8,5% of all cancer-related deaths. It arises from the inner intestinal layer, usually from preexisting polyps that, after a series of molecular and genetic alterations, finally generate colorectal tumors. It is very important to consider that in CRC patients, the appearance of cancer metastasis, tumor masses that originate from primary tumors at distant sites, strongly determine patient prognosis. Only 8-10% of patients diagnosed with CRC at advanced stages survive after five years of follow up, which reinforces the importance of metastasis research to improve patient management and survival rates in CRC.

Full text

DEPARTAMENTO DE MEDICINA Circulating tumor cells in metastatic colorectal cancer from basic understandig to clinical practice Memoria que presenta: Jorge Barbazán García para optar ao grao de Doutor en Bioloxía Fdo: Jorge Barbazán García Santiago de Compostela, Maio 2014. DEPARTAMENTO DE MEDICINA Dr Rafael López López, profesor asociado de ciencias da saúde, no departamento de Medicina da Universidade de Santiago de Compostela, e Dr Miguel Abal Posada, investigador estabilizado do Sistema Nacional de Saúde (programa I3SNS). CERTIFICAN Que a presente memoria titulada “Circulating tumor cells in metastatic colorectal cancer: from basic understanding to clinical practice” presentada por Don Jorge Barbazán García para optar ao Grao de Doutor en Bioloxía, foi realizada baixo a nosa dirección no laboratorio de Oncoloxía Médica Traslacional, vinculado ao Departamento de Medicina da Universidade de Santiago de Compostela. Asimesmo, consideran que dito traballo está en condicións de ser defendido como Tese de Doutoramento ante o tribunal correspondente. E para que así conste firmamos a presente en Santiago de Compostela, a 2 de Maio de 2014. Fdo: Dr Rafael López López Fdo: Dr Miguel Abal Posada Para levar a cabo esta tese de doutoramento, Jorge Barbazán García foi financiado cunha bolsa FPU (Ref AP2009-5229), do ministerio de Educación, Cultura e Deporte (Goberno de España). To carry out this doctoral thesis, Jorge Barbazán García was supported by a FPU fellowship (Ref AP2009-5229) from the ministry of Education, Culture and Sports (Spanish Government). O verdadeiro heroísmo está en transformar os desexos en realidades, e as ideas en feitos A.R. Castelao Témosche un bo traballo feito! María García “Maruja” 2. Cancer metastasis. Focus on colorectal cancer 2.1 The metastatic cascade 2.1.1 Local invasion 2.1.1.1 Collective invasion 2.1.1.2 Single cell invasion 2.1.2 Intravasation 2.1.3 Survival in the circulation 2.1.4 Arrest at distant sites and extravasation 2.1.5 Micrometastasis formation and target organ colonization 2.2 Metastasis formation: a matter of number and time 3. Circulating tumor cells 3.1 Methods for circulating tumor cell isolation and quantification 3.2 Clinical applications 3.2.1 Baseline CTC enumeration 3.2.2 Circulating tumor cells as predictive markers 3.2.3 Global molecular profiling of CTCs 4. Integrin signaling and Talin 44 55 60 44 55 58 45 45 46 47 48 49 51 52 58 58 59 Chapter I General Introduction and Objectives General Introduction 21 General Introduction 1. Colorectal Cancer 1.1 Epidemiology Colorectal Cancer (CRC) constitutes the third cancer type in terms of incidence worldwide, with more than 1.3 million new cases diagnosed in 2012 1, which means that 2 new CRC cases are diagnosed every minute in the world. In terms of mortality, around 690.000 CRCrelated deaths were reported in the same year, positioning CRC as the fourth cancer type, after lung, liver and stomach cancers 1 (Figure 1). Globally, CRC accounts for almost 9,7% of the total number of diagnosed cancers worldwide, and for 8,5% of deaths caused by cancer 1. By sex, CRC represents the third most commonly diagnosed cancer in males after lung and prostate cancer, respectively, and it is the fourth cancer-related death cause, after lung, liver and stomach cancers. Regarding females, breast cancer leads the list of the most diagnosed cancer types, with CRC in the second place, accounting for more than 610.000 new estimated cases in 2012. After breast and lung cancers, CRC is the third most frequent cancer-related death cause in women 2 (Figure 1). CRC incidence rates have notably increased in several areas historically at low risk, especially including countries in Eastern Asia and Europe 3,4. These unfavorable trends are thought to reflect a combination of factors including changes in dietary patterns, obesity and an increased prevalence of smoking 3,5,6. While CRC death rates have been decreasing in several Western countries, largely resulting from improved treatment and early detection, rates continue to increase in many developing countries, with more limited resources and health infrastructure, particularly in Central and South America and Eastern Europe 2. Figure 1: Estimated new cancer cases and deaths worldwide for leading cancer sites by sex. Source: GLOBOCAN 2012. 22 Chapter I Spain is considered one of the developed countries where CRC incidence rates have continued to rise during the last years, especially among men. 24,2 and 43,9 of every 100.000 women and men were, respectively, diagnosed of CRC in 2012 in Spain 1. In the same year, mortality rates were 8,4 and 17,1 (of each 100.000 individuals) for women and men, respectively 1. This places CRC as the most diagnosed cancer in Spain (taking both sexes into account), and the second in terms of mortality, only after lung cancer 1 (Figure 2). However, CRC mortality trends in Spain have been decreasing for men since 2001, with a mean of 0,5% per year. For women, a decrease of 1,2% per year is registered since the mid-90s 6. Galicia is ranked the third Spanish region in terms of CRC mortality, only after Asturias and País Vasco, for both sexes, with death rates falling in the same ranges as Spanish ones 6. Recent results from the EUROCARE-5 study, revealed that the European mean agestandardized 5-year survival for CRC patients was 57,0% in the period 2000-2007 (64,3% for the U.S, 2001-2007 7) with negligible differences between sexes. Central and Northern European countries displayed slightly higher survival rates, with Southern countries, including Spain, presenting rates similar to the European mean (57,1% for Spain) 8. European CRC 5-year survival rates were continuously increasing in the last years, with 30,3% in 1991, and 44,7% in 2002 9. It is important to mention that CRC survival rates greatly vary depending on the stage on which the cancer is detected. When CRC is detected at a localized stage, the 5-year relative survival rate is 90,1%. After the cancer regionally spreads to involve adjacent organs or lymph nodes, survival rate drops to 69,2%. When the disease has spread to distant organs, 5-year survival rate is 11,7% (data from 2008, U.S) 7. Figure 2: Estimated new cancer cases and deaths in Spain for leading cancer sites. Source: GLOBOCAN 2012 23 General Introduction 1.2 Risk factors and causes 1.2.1 Sporadic CRC Most cases of CRC arise sporadically, and factors like age, previous colonic polyps or environmental factors, contribute to the development of CRC 10. About 20% of all patients with CRC are supposed to have some component of familial risk, without strictly fulfilling criteria for hereditary CRC 10,11. A detailed list of the main risk factors for sporadic CRC is shown in Table 1, upper section. 1.2.2 Hereditary CRC Between 5-10% of CRC patients develop in the setting of defined hereditary cancer syndromes, with Hereditary Nonpolyposis Colorectal Cancer (HNPCC) and Familial Adenomatous Polyposis (FAP), as the two main forms of hereditary CRC 10,11. An extended list of hereditary CRC syndromes is shown in Table 1, lower section. 1.2.2.1 Familial Adenomatous Polyposis (FAP) FAP is an autosomal dominant disease caused, in 80% of affected individuals, by a germline mutation in the adenomatous polyposis coli (APC) gene 12. Its prevalence is approximately 1:10.000 births. FAP patients can develop more than 100 colorectal adenomas (50% of patients by age 15 years, 95% by age 35 years), and it arises in almost 100% of patients by the age of 40 years if left untreated 11. Disease severity is associated with proximity of mutations to the central region of APC gene, with mutations between codons 1445 and 1578 linked to an increased risk of desmoid tumors. A FAP variant is attenuated FAP, with patients developing from 10 to 100 adenomas. APC mutations in patients with attenuated FAP, are typically located at the 5’ or 3’ ends of the gene 12. 1.2.2.2 Hereditary Nonpolyposis Colorectal Cancer (HNPCC) HNPCC, also known as Lynch syndrome, is the most common hereditary disorder associated with CRC. It displays an autosomal dominant inheritance pattern. The onset of the disease is at 45 years on average (versus 63 years for the general population) 10. Lynch syndrome is associated with germline mutations in mismatch repair genes (most commonly MLH1, MSH2, or MSH6) 12,13. Pathology of CRC on HNPCC affected individuals is often poorly differentiated, with an excess of mucoid and signet cell features, a Crohn’slike reaction, and an excess of infiltrating lymphocytes within the tumor 10. 30 Chapter I Figure 3: Representative hematoxilin & eosin stainings for different types of serrated polyps. A) An hyperplastic polyp with serrated glands limited only to the upper one-half of the crypt. B and C) Sessile serrated adenomas showing abnormal architectural features such as L-or-Tshaped crypts, and serrations that extend all the way to the crypt base. D and E) Traditional serrated adenomas showing a serrated appearance with crypt lumens lines by tall columnar cells with enlarged, crowded and hyperchromatic nuclei. Adapted from Noffsinger A.E. et al 30. 1.3.2. Mouse models for colorectal carcinogenesis The development of experimental models that mimic the molecular pathways behind CRC carcinogenesis has been crucial for its better understanding. In this respect, mouse models closely emulate many aspects of the human disease counterpart, recapitulating some of the genetic lesions underlying sporadic or hereditary forms of CRC. Two main CRC mouse models have been developed to this regard, genetically engineered and chemically induced, which basically differ on the methodology used for the generation of colorectal tumors. 1.3.2.1 Genetically engineered CRC mouse models Genetically Engineered Mouse Models (GEMMs) have been the basis for the study of hereditary CRC and, at the same time, for the elucidation of the role played by some of the genes involved in the development of sporadic CRC. The first model for FAP, termed Min (multiple intestinal neoplasia) mouse, was developed Currently, some ambitious projects are being carried out, with the aim of gaining a deeper understanding of cancer genomics to improve the global management of cancer patients. Of particular interest is The Cancer Genome Atlas (TCGA), driven by the National Human Genome Research Institute (U.S). Interestingly, recent results from this project have shown that a specific subset of 24 genes was significantly mutated in patients with CRC, proposing, among others, ARID1A, SOX9 and FAM132B/WTX as potential driving genes for CRC 42. 31 General Introduction by random mutagenesis, and carried a truncation mutation at codon 850 of the Apc gene 43. Min mice developed up to 100 polyps in the small intestine in addition to colon tumors. Later models specifically targeting the Apc gene by directed mutagenesis were developed. Apc truncation at codon 716 (ApcΔ716) 44 or 1638 (Apc1638N) 45, resulted in the formation of polyps in the small intestine. Apc1638N mice displayed a long lifespan (a year or more), perhaps because of the fact that, on average, each mouse developed only 3-5 adenomas/ carcinomas. However lifespan for ApcΔ716 mice was much reduced because of the formation of a large number of gastrointestinal adenomas. Genetic models bearing mutation in additional genes (Cdx2 46 or Smad4 47), in combination with ApcΔ716, have shown to increase the rate of polyps and tumor formation as well as tumor invasiveness. Mutations in the betacatenin gene, whose stability is regulated by Apc, caused the formation of up to 3000 polyps in the small intestine, reinforcing the role of the Apc gene in the development of FAP 48. Regarding HNPCC, mouse models bearing alterations in the Msh2 and Mlh1 genes have been developed. Msh2 deficient mice developed gastrointestinal adenomas and carcinomas. However, 50% of the animals died before the age of 6 months (when the formation of intestinal tumors can be observed) due to the development of T-cell lymphomas, suggesting the involvement of Msh2 in lymphoblastic lymphomas 49. Mlh1 knockout mice displayed a reduced survival similar to Msh2 -/- animals, also due to the presence of T-cell lymphomas and small intestinal tumors 50. The combination of Mlh1 and Apc1638N mutant mice dramatically increased the number and invasiveness of intestinal tumors, consequently decreasing mice survival 50. Other mouse models have been developed with mutations in additional genes, not directly implied in hereditary CRC. Mice bearing mutations in the Tgfβ1 gene dramatically accelerated the progression of colorectal adenocarcinomas 51. Mutated K-ras transgenic mice represent one of the most important models for sporadic colorectal cancer. Colonspecific expression of activated mutant K-ras (K-rasG12D) resulted in the development of single or multiple lesions recapitulating the stages of tumor progression 52,53. 1.3.2.2 Chemically induced CRC models As the spontaneous incidence of CRC in mice is low (1-4%), many chemicals have been used to induce CRC. Some of this carcinogens include dimethyhydrazine (DMH), azoxymethane (AOM), dextran sulfate sodium (DSS), 2-amino-1-methyl-6-phenylimidazol, N-methyl-N’-nitro-N-nitrosoguanidine (MNNG) or 3,2’-dimethyl-4-aminobiphenyl (DMBA). Dosage and treatment duration, as well as the route of administration, determine the effectiveness of these drugs for the formation of colorectal tumors. Moreover, it has been shown that the genetic background of the mice plays a significant role in the development of tumors when using this approach 54. 32 Chapter I 1.4 Screening, diagnosis and staging 1.4.1 Screening Colorectal cancer constitutes a disease characterized by a long preclinical stage, with the progression from early adenoma to invasive cancer taking years 55. Moreover, and despite advances in treatment, 40-50% of patients presenting with symptomatic CRC eventually die of metastatic disease 56. These characteristics of CRC make it more suitable for population screening than any other malignancy. 1.4.1.1 Conventional CRC screening tests Current CRC screening tests can be broadly differentiated as early detection tools or cancer-prevention tools, depending on their modes of action 57. Cancer prevention tools constitute tests that can find both colorectal polyps and lesions that have progressed to a more advanced stage. Early detection tools constitute a series of methodologies that are only able to detect CRC, but they are not suitable for the detection of possible premalignant lesions. Table 2, summarizes conventional CRC screening tests. Fecal occult blood test (FOBT) and Fecal immunochemical test (FIT) are the two main early detection tools available 58. FOBTs can be used to quantitatively detect microscopic amounts of haem in the stool. FITs detect human globin by means of an antibody-based assay, detecting also microscopic amounts of material in the stool, as FOBTs 57-59. Advantages and disadvantages of early detection tools are summarized in Table 2, lower section. These techniques provide fast and inexpensive results, however, they are being replaced by imaging techniques, as a positive test does not prove a definitive diagnosis. Cancer prevention tools mainly include imaging techniques that allow visualization of the inner part of the intestine for the detection of polyps or more advanced lesions (Figure 4). In some cases, these techniques allow the removal of existing lesions in the same procedure 57. Advantages and disadvantages of the main cancer-prevention tools are summarized in Table 2, upper section. Related to the early detection of CRC, the local government of Galicia has recently implemented a screening program for population considered at risk (women and men between 50 and 69 years), based on the use of FOBT. This type of strategies are of key importance for the reduction of CRC-related mortality rates, especially in regions like this, where factors including dietary habits and the presence of an ageing population, increase the risk for CRC development. 33 General Introduction Table 2. Conventional CRC screening tests Screening test Advantages Disadvantages Cancer-prevention tools Flexible sigmoidoscopy -Fairly quick and safe -Sedation not required -Does not require a specialist -Done every 5 years -Images only 1/3 of the colon -Can miss small polyps -Can’t remove all polyps -Small risk of bleeding, infection of bowel tear -Colonoscopy will be needed if abnormal Colonoscopy -View of the entire colon -Can biopsy and remove polyps -Done every 10 years -Can diagnose other diseases -Can miss small polyps -Full bowel preparation needed -Sedation needed -Small risk of bleeding, infection of bowel tear Double-contrast barium enema (DCBE) -View of the entire colon -Relatively safe -Done every 5 years -No sedation needed -Can miss small polyps -Full bowel preparation needed -Cannot remove polyps during testing -Colonoscopy will be needed if abnormal CT-colonography (virtual colonoscopy) -Fairly quick and safe -View of the entire colon -Done every 5 years -No sedation needed -Can miss small polyps -Full bowel preparation needed -Cannot remove polyps during testing -Colonoscopy will be needed if abnormal Early detection tools Fecal occult blood test (FOBT) -No direct risk to the colon -No bowel preparation -Sampling done at patient’s home -Inexpensive -May produce false-positive results -Should be done every year -Colonoscopy will be needed if abnormal Fecal immunochemical test (FIT) -No direct risk to the colon -No bowel preparation -Sampling done at patient’s home -Fairly inexpensive -May miss many polyps and some cancers -May produce false-positive results -Should be done every year -Colonoscopy will be needed if abnormal Data from Kuipers et al 57 34 Chapter I 1.4.1.2 Other screening modalities 1.4.1.2.1 Imaging techniques CRC screening methodologies are continuously improving, with the aim of lowering patient burden and enhancing neoplasia detection. In the last years, methods that include modifications of conventional endoscopes to improve visualization have been developed 60,61. An interesting recent technique is the use of a colon-capsule endoscopy 62,63. This system consists in an indigestible capsule with a 172-degree video imager at each end. The capsule is moved through the colon by peristalsis and transmits images to an external data recorder carried by the screenee. This type of imaging requires performing certain previous clinical procedures to maximize the quality of the final images, and its current costs represent a limitation for the widespread of the capsule in screening programs 64. Figure 4: Representative colonoscopy images. A) Normal intestinal wall. B) Numerous polyps characteristic of HNPCC. C) A pedunculated adenoma with signs of minimal bleeding at the base of the stalk. D) Advanced colorectal carcinoma. 1.4.1.2.2 Molecular markers Apart from the direct bowel observation by different imaging procedures, several indirect molecular markers have been explored as screen-detection tools for CRC and precursors of cancer. These markers can be measured in serum, tissue or stools, and they mainly reflect the mechanism of exfoliation of neoplastic cells and secretion of mucus containing abnormal glycoproteins in CRC 57. Serum markers include, for example, the analysis of the methylation status of septin-9 (SEPT9) because its ability to discriminate between normal and cancerous tissues 65. The expression analysis of MMP7 (Matrix metalloproteinase-7) and PTGS2 (prostaglandin G/H synthase 2) from RNA has also been assessed 66. Some proteins have been analyzed in the stool (calprotectin or carcinoembrionic antigen, CEA) 67. However, evidences from all the previous mentioned markers are still in an initial step, and larger validation studies should be conducted to delineate its value as screening markers. 35 General Introduction 1.4.2 Signs and symptoms Most colorectal cancers are diagnosed after the onset of symptoms which mainly include 68: - A change in bowel habits, such as diarrhea and constipation, that lasts for more than a few days. - Rectal bleeding, dark stools or blood in the stool. - Abdominal pain - Weakness and fatigue. - Unintended weight loss. 1.4.3 Diagnosis and staging CRC is definitively diagnosed on the basis of the results of colonoscopy or sigmoidoscopy, followed by tumor biopsy examination 10. A newly diagnosed case of CRC undergoes a complete check, in order to determine cancer extent. Physical examination and a complete colonoscopy (to rule out metachronous tumors) are performed, and a computed tomography (CT) of the chest, abdomen, and pelvis are carried out to identify metastatic disease (Figure 5). Ultrasounds and Magnetic Resonance Imaging (MRI) can also be used to determine the extent of disease. Positron Emission Tomography (PET) with the 18-fluoro-2deoxy-D-glucose (FDG-PET) can be used to rule out extrahepatic spread (Figure 5). Based on all the obtained parameters, using the above-mentioned methodologies, staging is described according to the TNM (tumor, node, metastases) system 69 (Table 3) (Figure 6). An accurate tumor staging results critical for the management of disease, as the choice of an appropriate treatment is based on it. Figure 5: Detection of metastatic lesions in CRC by imaging techniques. A) Liver and B) lung lesions detected by computed tomography. C) Metastatic liver nodes detected by FDGPET 36 Chapter I Figure 6: Colorectal cancer stages. As colorectal cancer progresses from stage 0 “carcinoma in situ” to stage IV, cancer cells sequentially grow through the layers of the rectum wall, and spread to lymph nodes and distant organs in the most advanced stages. Table 3. TNM classification of colon cancer T=primary tumor TX: primary tumor cannot be assessed. T0: no evidence of primary tumor. Tis: carcinoma in situ: intraepithelial or invasion of lamina propria T1: tumor invades submucosa T2: tumor invades muscularis propria T3: tumor invades through the muscularis propria into subserosa or into peritonealised pericolic or perirectal tissues T4a: tumor penetrates the surface of the visceral peritoneum T4b: tumor directly invades or is histologically adherent to other organs or structures N=regional lymph nodes NX: regional lymph N0: no regional lymph node metastasis N1a: metastasis in one regional lymph node N1b: metastasis in two to three regional lymph nodes N2a: metastasis in four to six regional lymph nodes N2b: metastasis in seven or more regional lymph nodes M=distant metastasis MX: distant metastasis cannot be assessed M0: no distant metastasis M1a: distant metastasis to one site M1b: distant metastasis to more than one site Staging Stage I (T1/T2, N0, M0) Stage IIA (T3, N0, M0) Stage IIB (T4a, N0, M0) Stage IIC (T4b, N0, M0) Stage IIIA (T1/T2, N1, M0) Stage IIIB (T3/T4, N1, M0) Stage IIIC (Any T, N2a/N2b, M0) Stage IVA (Any T, Any N, M1a) Stage IVB (Any T, Any N, M1b) Adapted from Cunningham et al 10 37 General Introduction 1.4.4 Prognostic factors and biomarkers A prognostic factor is defined as a measurement of a disease-related parameter, through a direct or indirect observation, that is associated with the clinical outcome of the patient in the absence of therapy or with the application of a standard therapy that patients are likely to receive 70. The American Joint Committee on Cancer (AJCC) has established a colorectal working group, which has evaluated the role of biologic, genetic, molecular and other nonanatomic factors with prognostic value in CRC 71. Prognostic factors are classified into five different categories (I, IIA, IIB, III and IV) (Table 4) based on the existence of conclusive evidences about their effectiveness, with category I including the best characterized factors, currently used in routine clinical patient management, and category IV including factors that have been studied but didn’t show prognostic significance. Examples of prognostic factors included in each category, are summarized in Table 4, right panel. To date, a limited number of factors have shown the necessary prognostic evidences to be considered as clinically relevant, and only tumor extent related features are considered of strong prognosis value. The presence of carcinoma in situ, a malignancy that has not yet penetrated the basement membrane of the epithelium to invade the underlying lamina propria, is considered a major good prognosis factor. Moreover, the presence of distant metastasis or cancer spread to regional lymph nodes constitute two important factors that determine patient outcome 72. The evaluation of serum CEA is the most accepted and frequently used tumor prognostic biomarker in CRC, partly due to its relatively inexpensive and easy detection. The main use of CEA in CRC is in surveillance following curative resection for primary cancer 73,74, where CEA levels higher than 5.0ng/ml have an adverse impact on patient prognosis, independent of tumor stage 75. In the last years, alternative biomarkers have been proposed in order to evaluate patient prognosis more accurately. In this regard, the analysis of Circulating Tumor Cells (CTCs), tumor cells that have shed into the circulation from the primary tumor, has become of a great interest. CTCs are proposed as a major vehicle for tumor dissemination and metastasis formation, so it is reasonable to think that their presence in the blood could provide information about disease status, separating patients with different prognosis depending on the existence of CTCs or not (and if yes, their number) in patient’s blood. In fact, several works have confirmed the validity of CTC count as an independent prognostic factor, mainly in metastatic CRC (mCRC) 76-81. Another promising biomarker to evaluate patient outcome is the analysis of circulating tumor DNA (ctDNA), DNA fragments mainly originated from apoptotic or necrotic tumor cells that discharge their DNA into the blood circulation 82. Elevated concentrations of cell-free ctDNA fragments have been found to be associated with unfavorable outcome in some clinical studies 82,83. Moreover, ctDNA sequencing offers the possibility to assess tumor-specific mutations without the need of 38 Chapter I Table 4. Classification of prognostic markers in CRC. Category Definition Prognostic factors included Category I Well supported by literature, generally used in patient management, and of sufficient importance to modify TNM stage groups -Pathological assessment of tumor extent (pT) -Regional lymph node metastases (pN) -Presence/absence of blood/lymphatic vessel invasion -Residual tumors -Elevated serum CEA Category IIA Extensively studied biologically and/or clinically. Sufficient to be noted in a pathology report -Presence of residual tumor after resection -Radial margins -Histologic grade -Tumor border configuration Category IIB Well studied but not sufficiently established -Lymphocytic infiltration of tumor or peritumoral tissue -Histologic types -Tumor tissue molecular markers -18q/DCC loss (LOH) -mutated KRAS -MSI -Thymidylate synthase (TS) high -p27 low -Bcl-2 loss -p53 inactivation Category III Less well studied and not yet sufficiently established Perineural invasion, microvessel density, tumor cell associated proteins or carbohydrates, peritumoral fibrosis, peritumoral inflammatory response, focal neuroendocrine differentiation, nuclear organizing regions, proliferation indices. Category IV Studied and shown to have no consistent prognostic significance Tumor size and histologic tumor type Data from López-Gómez et al 72 tissue biopsy, making easier the evaluation of tumor characteristics 83. Both CTCs and ctDNA analysis have been proposed as new promising biomarkers for patient prognosis in CRC, providing valuable information from a simple and non invasive blood sample, reason why their use has led to the occurrence of the term “liquid biopsy”. Detailed information of the clinical value of CTCs can be found in introduction section 3. 39 General Introduction 1.5 Treatment CRC treatment encompasses different strategies that are applied or not mainly depending of the grade of tumor extent, reason why an adequate staging is crucial for the selection of the most suitable therapy. 1.5.1 Surgery Surgery represents the only curative modality for localized CRC and also provides a potentially curative option for selected patients with limited metastatic disease in liver and/or lung. In many cases, even in those who cannot be cured by surgery, this procedure benefit them through palliation of symptoms such as obstruction and bleeding from the primary tumor 84. When CRC is found at a very early stage, usually in situ carcinomas, local excision of the primary tumor can be applied. Total resection of the tumor should be done in cases of larger tumor extent. 1.5.2 Adjuvant CRC therapy Despite improvements in CRC surgery, many patients still have a high risk of tumor recurrence. To reduce those risks, adjuvant treatment is used in a subset of patients suffering from non-disseminated disease. Adjuvant therapy corresponds to any given treatment that is administered to the patient after the main therapy, which is normally surgery is this kind of patients. For stage III patients, adjuvant therapies are mainly based in the use of 5-Fluorouracil (5-FU), alone or in combination with other agents 85. For example, 5-FU plus Leucovorin (LV) has demonstrated an improvement in patient outcome 86. Adjuvant therapy is also used for stage II CRC patients. In the last years, the combination of targeted therapies with classic chemotherapeutic agents has gained importance. The introduction of monoclonal antibodies that target the Epidermal Growth Factor Receptor (EGFR) (Cetuximab or Panitumumab) or Vascular Endothelial Growth Factor (VEGF) (Bevacizumab), has expanded the agents available for use in adjuvant setting 85. However, these agents have not demonstrated enough clinical utility when applied in the adjuvant setting so far, and their main field of application is in metastatic CRC (see section 1.5.4). 46 Chapter I 2.1.1.2 Single cell invasion One of the main traits that characterized single cell invasion/migration is the complete or partial loss of cell-cell contacts. Individual tumor cells may invade via two distinct programs: the mesenchymal invasion (protease, stress fiber and integrin-dependent), or the amoeboid invasion (integrin-independent, Rho/ROCK-dependent) 124. Mesenchymal invading cells frequently display many hallmarks of the Epithelial to Mesenchymal Transition (EMT) process (see Box 3), and usually display high levels of cell-matrix adhesion and proteolysis. On the contrary, amoeboid invading cells are largely independent of these requirements but rely on cortical actomyosin contractility 116,121,125-127. A range of intermediate phenotypes were described between single and collective cell migration. Single cells can migrate individually, but close enough one from each other, and following similar paths, normally imposed by the presence of a chemical gradient or by the physical characteristics of the ECM, in an invasion modality termed “multicellular streaming” 128. Very weak or no cell-cell contacts were detected in this specific situation (Figure 8). Multicellular streaming has been observed in ortothopic breast cancer and melanoma models, but not in CRC 122,124,129. Once invading cells degrade the component of the basement membrane, and migrate through it, they reach the stromal compartment where they must coexist with several Figure 8: Cancer cell invasion modalities. Cancer cell invasion patterns include amoeboid or mesenchymal single-cell migration; multicellular streaming with or without weak junctional contacts or collective cell migration. Although each pattern can be described as a different process, overlapping cell behavior can result in mixed or unstable phenotypes. Intensity range of proposed properties (from absent to strong) is indicated by minus and plus signs. Adapted from Friedl et al 127. 47 General Introduction different tumor-associated cell types (fibroblasts, endothelial cells, adipocytes and bonemarrow derived cells 130,131). As primary tumor progression proceeds, the stroma becomes increasingly “reactive” acquiring typical characteristics of the stroma observed in wound healing or inflammation, and these features further enhance the aggressive behavior of carcinoma cells 116. For example, stroma fibroblasts (also termed Cancer Associated Fibroblasts, or CAFs) can remodel the ECM through enzymes, rendering it more supportive of tumor cell invasion 132,133 (Figure 9). Altogether, the specific characteristics of the stromal cells contribute to the migration and invasion of cancer cells through the stromal compartment towards nearby lymph and blood vessels. Figure 9: The early steps of metastasis: tumor invasion, dissemination and survival in the circulation. In order to disseminate, carcinoma cells need to acquire the capabilities to break down the basement membrane, invade into the stroma, enter the bloodstream and manage to survive before they can arrest at distant sites and grow into clinically detectable metastases. Examples of tumor-stroma crosstalk are illustrated. EC: endothelial cells. Image from Wan et al 138. 2.1.2 Intravasation The term intravasation refers to the process by which invasive carcinoma cells enter into the lumina of tumor associated lymphatic or blood vessels. Although lymphatic spread of CRC is routinely observed in human tumors and represents an important prognostic marker for disease progression, dissemination via the hematogenous circulation appears to represent the major mechanism by which metastatic cells disperse 115. Growing tumors need to develop neo-vasculature in order to grow beyond the diffusion limit of preexisting blood vessels 134, process that facilitates the escaping of tumor cells from the primary tumors through the circulation 115. Moreover, newly formed blood vessels within the tumor are characterized by its leaky structure, with not well-established cell-cell contacts between endothelial cells, and under continuous reconfiguration, characteristics that are likely to facilitate intravasation 135. The molecular mechanisms controlling intravasation remain to be well defined. In colon cancer, it has been recently shown that Notch signaling in cancer cells can be stimulated by coexisting stromal cells, further enhancing intravasation and thus, promotion of metastasis 136 (Figure 9). 48 Chapter I 2.1.3 Survival in the circulation Once malignant cancer cells have invaded the circulatory compartment, they attain ready access to virtually all organs of the body. These circulating tumor cells (CTCs), represent carcinoma cells that are en route between primary tumors and sites of dissemination and therefore may represent “metastatic intermediates” 116. CTCs must be able to survive several stresses, including physical damage from hemodynamic shear forces, and immune mediate-killing 115. Carcinoma cells seem to overcome these threats through the formation of relative large associations with blood platelets, that protect them both from shear forces and facilitates evasion of immune detection 130 (Figure 9). Moreover, the lack of integrin-dependent adhesion to ECM components, that is normally essential for cell survival, makes CTCs more susceptible of undergoing anoikis (apoptosis triggered by loss of anchorage to substratum) 137,138. To this regard, it has been shown that brain-derived neurotrophic factor (Bdnf) receptor (trkB) conferred resistance to anoikis in rat intestinal epithelial cells 139 (Figure 9). Moreover, in a prostate cancer model, Talin1, a key component of the focal adhesion complex, regulated anoikis resistance further promoting metastasis formation 140 (see introduction section 4 for further Talin1 information). However, the relevance of anoikis in the process of metastasis remains uncertain, as it make take mere minutes for a malignant cell departing from a primary tumor to encounter a capillary bed and adhere to the vascular wall 115. Due to the large diameter of CTCs (20-30μm), they are likely to become trapped in narrow capillaries (≈8 μm) in their first pass through the circulation 116 (Figure 10), and if the time that CTCs spend devoid of adhesion is so short, anoikis may not be a very significant impediment during metastasis progression. 2.1.4 Arrest at distant sites and extravasation Having invaded and endured the circulation, metastatic cells must at some point escape the bloodstream to finally colonize a target organ, in a process termed extravasation 115. Despite the theoretical ability of CTCs to disseminate to a wide variety of secondary loci, clinicians have long noted that individual carcinoma types form metastasis in only a limited subset of target organs 141. Particularly in CRC, liver is largely the preferential site for metastasis formation, with lung as a frequent, but secondary site. In fact, CRC metastatic dissemination seems to follow a stepwise manner in which lung metastasis develops only after the formation of considerable liver metastases. This pattern can be explained by the anatomical layout of the vasculature, which drain most CTCs through mesenteric circulation into the liver 133. This model for CRC dissemination is partially supported by a study showing lower number of viable CTCs in the peripheral blood, compared to the mesenteric blood in patients with CRC 142. Moreover, carcinoma cells arriving in the liver encounter fenestrated sinusoids that are highly permeable even in their normal state and consequently seem to pose only minor obstacles to extravasating tumor cells 143. 49 General Introduction However, tissue-specific arrest of CTCs might not be only a physical process, by which CTCs are retained in capillary beds due to size restrictions. Some cells may elude this rapid trapping because of their unusual plasticity, enabling then to be lodged in the microvessels of more distal organs 116. An alternative hypothesis is that CTCs have predetermined predilections to lodge in certain tissues. In fact, entry of CRC cells into the hepatic vasculature can initiate a proinflamatory cascade that results in Kupffer cells being triggered to secrete chemokines that upregulate vascular adhesion receptors, enabling adhesion of CTCs to the microvasculature of the liver 144. Another hypothesis is that tumor cells, either at primary sites or in the circulation, can release soluble factors of microvesicles to convert incipient metastatic sites into compatible “premetastatic niches” 145,146. For example, melanomaderived exosomes have been show to promote metastasis by education of bone marrow cells 147, and Tenascin C, a component of the extracellular matrix, produced by breast cancer cells in primary tumors, can remodel secondary sites promoting a more permissive niche for CTCs implantation 148. Metastatic cells can either escape the circulation individually, or considerable growth within the intravascular space may occur before target organ colonization 149 (Figure 10). To escape the circulation, CTCs must first interact with endothelial cells lying in the luminal side of blood vessels. Although the process of tumor cell extravasation remains to be well defined, several similitudes to the normal extravasation process of leucocytes at inflammatory sites have been identified 120,150. Initial attachment of CTCs to endothelial cells is mediated by interaction of endothelial selectins (E-selectin) and its ligands in cancer cells [tetrasaccharide sialyl Lewis x (sLex) or sialyl Lewis a (sLea), MUC1 or CD44120 ,151] (Figure 11, step 1). Figure 10: The late steps of metastasis: arrest in the circulation, extravasation and distant metastasis formation. After survival in the circulation, cancer cells leave the circulation in a process called extravasation at potentially secondary sites. Cancer cells can be retained at capillary sites due to size restrictions, or by the specific interaction with adhesion molecules expressed by endothelial cells. After adhesion, cancer cells transmigrate through the endothelial layer (transendothelial migration or TEM), and after this they invade the endothelial basement membrane. Extravasated cells can then enter a state of dormancy or proliferate within this new microenvironment, were a few of them will give raise to metastases. Adapted from Reymond et al 125 50 Chapter I After initial attachment to ECs, CTCs must establish more stable adhesions in which integrins are mainly involved (Figure 11, step 2). In the context of extravasation, several integrins on cancer cells have been implicated in their attachment to the endothelium and transmigration across it 152. Particularly, β1, β4 and αVβ3 integrins contributed to the strong adhesion between cancer and endothelial cells 120. Together with integrins, MUC1 and CD44 have also been implicated in this type of adhesion 153-155. Chemokine production by cancer cells also contributes to extravasation. For example, CCL2A (CC-chemokine ligand 2) produced by colon cancer cells interacts with its receptor (CCR2) on ECs to increase extravasation and metastasis into the lungs 156. After firm adhesion to ECs, cancer cells must migrate through them in a process termed transendothelial migration (TEM) (Figure 11, step 3). Two main forms of TEM have been described, mostly on the basis of work using leukocytes: Paracellular and transcellular TEM. Paracellular TEM is defined by the migration of cancer cells through EC junctions after their disruption by cancer cells. Transcellular TEM is defined as the migration of cancer cells directly through the EC body 120. So far, it is not clear which route is used by cancer cells in vivo, or whether the route depends on the vascular bed or on the cancer type. Figure 11: Cancer cell extravasation. Cancer cells first interact with blood vessel endothelial cells in a transient adhesion process, which involves endothelial selectins and their counterpart receptors on cancer cells (1). The second step (2) consists in the establishment of firmer adhesions and is mediated through chemokines and cell adhesion molecules on the endothelium and integrins on cancer cells. The last step (3) is characterized by the extravasation of cancer cells through endothelial cells junctions. EC: endothelial cells; TC: tumor cells. Adapted from Gout et al 156 51 General Introduction 2.1.5 Micrometastasis formation and target organ colonization In order to form micrometastases, extravasated carcinoma cells must survive in the foreign microenvironment that they encounter in the parenchyma of distant tissues, which greatly differs from the one in the primary tumor. Due to this, most cancer cells will die by apoptosis initiated by an adverse environment 157 (Figure 10). To overcome this adverse scenario, two main strategies have been proposed for cancer cells to successfully establish a micrometastasis: adaptation of cancer cells to the new microenvironment or preparation of the metastatic niche prior to the arrival of cancer cells from the primary tumor, or both 116. One example for cancer cell adaptation involves activation of Src tyrosine kinase signaling, which increases the capacity of breast carcinoma cells to persist in bone without influencing their initial homing to this tissue. The metastatic niche preparation hypothesis, also termed the “premetastatic niche”, implied the release of systemic signals by primary tumors that induce changes in ECM proteins at distant sites 145. As mentioned before, the production of molecules such as lysyl oxidases (LOXs) 158, Tenascin C 148, or the release of vesicular structures (exosomes) 147 have been related to the formation of a premetastatic niche. Successful micrometastasis formation by cancer cells does not imply further proliferation for the formation of large macroscopic metastases. In fact, it seems that the vast majority of tumor cells suffer either slow attrition over periods of weeks and months or persist as microcolonies in a state of apparent long-term dormancy, retaining viability in the absence of any net gain or loss in overall cell number 159 (Figure 12). Factors like the ability of extravasated cancer cells to induce angionenesis, or their self-renewal capacity, have shown to be key steps for the outgrowth of micrometastases. In fact, it has been proposed that only a subpopulation of neoplastic cells, termed “tumor initiating cells, or TICs”, possess enough self-renewal ability to effectively give raise to macrometastases 160. EMT transcription factors such as Snail, Twist or ZEB1 (see Box 3) have been proposed as possible molecules facilitating the acquisition of a TIC phenotype 161. This, together with other factors such as microRNAs, or the coexistence with stromal cells at distant sites, finally enable that cancer cells complete an intricate, multistep, cell-biological process that culminates in the formation of macroscopic, life-threatening growths at distant organ sites 116. 52 Chapter I 2.2 Metastasis formation: a matter of number and time Despite the implications that the appearance of metastasis has in patient survival, the metastatic process, as a whole, is extraordinarily inefficient. Animal modeling suggests that less than 0,02% of tumor cells that are shed into the circulation can survive and form metastasis 159. Cancer spreading constitutes a process limited by multiple factors from its very early steps. Cancer cell survival at the invasive areas of primary tumors is restricted by the presence of an inhospitable surrounding stromal environment, together with the ineffective oxygen and nutrient input, due to the lack of well-established tumor vasculature. Data from animal models indicate that survival in the circulation, arrest at distant sites and extravasation seem to be the more effective processes in terms of cell survival. More than 80% of cells intravenously implanted were found to succeed in extravasating 157. In contrast, once tumor cells exit the microvasculature into the parenchyma of foreign tissues, very low rates of cell survival are observed (<3% of intravenously implanted cells finally form micrometastases, and less than 0,02% form macrometastases 157) (Figure 12). Consistent with this experimental observation is the fact that large numbers of CTCs can be detected within the bloodstream of carcinoma patients, including those who develop few, if any, over metastases 162. Moreover, the appearance of micrometastases into the bone marrow of breast cancer patients, was not closely related with the development of macroscopic metastases, with only 50% of the patients developing tumors after 10 years 163, further supporting the idea of the metastatic spreading as a highly inefficient process. Figure 12: The inefficiency of the metastatic cascade. Data from experimental models has revealed inefficiency of the metastasis formation process, with a rate of attrition that often exceeds 99%. Here is depicted the approximate fraction of intravenously implanted tumor cells that have died after passage through the indicated steps of the invasion-metastasis cascade. Image from Valastyan et al 121. In contrast to the traditional notion that metastasis is a late event in tumor progression, increasing evidence suggests that tumor cells can disseminate from the earliest preneoplastic lesions, sometimes even before the formation of overt primary tumors 164. In small cell lung cancer and pancreatic cancer, metastatic disease often appears at the time of or shortly after the initial diagnosis, whereas many patients with breast, prostate and skin cancers show metastasis after a prolonged period of dormancy 165. In the case of CRC, progression 53 General Introduction from adenomas to invasive carcinomas is a relatively slow process that may take years. However, from invasive carcinomas, tumor cell dissemination and colonization of distant organs (e.g. the liver or lungs) constitutes a fast event 143. It is estimated that most genetic alterations for CRC metastasis are acquired during progression to the invasive carcinoma stage, and few, if any, additional genetic events are required for the formation of distant metastasis 166, which may, al least in part, explain temporal dynamics of CRC progression. Despite the high rates of attrition that accompany certain steps of the invasion-metastasis cascade, overt metastasis do eventually rise in many CRC (and other carcinoma) patients, where they almost invariably represent the source of terminal disease. 54 Chapter I Adapted from Radisky et al 167 55 General Introduction 3. Circulating tumor cells Circulating Tumor Cells (CTCs) are cells that circulate in the blood of cancer patients, originating either from primary tumors or metastases. The presence of CTCs in patients with cancer was first reported in 1869 by the Australian physician Thomas Ashworth 168. Since their discovery, CTCs have been regarded as a very promising field of research due to opportunities that lie in the easy and relatively inexpensive collection of peripheral blood samples and thus, of tumor cells. Serial monitoring of CTCs could provide an estimate of circulating disease burden over time and shed light on some of the fundamental processes that lead to an aggressive phenotype, metastasis and resistance to current therapies. Taking into account that CTCs in the bloodstream are potentially coming from primary tumors, bone marrow and distant metastases 117,169,170, it is expectable that CTCs represent tumor heterogeneity as well as or better than any single biopsy 171. It is also important to note that, at least a subpopulation of CTCs, possibly hold all the necessary properties for the initiation of a metastatic tumor at a distant site, as recently reported in breast cancer 172. Altogether, these CTC characteristics make them a key component of the metastatic cascade where to focus on, due to their potential as prognosis and predictive biomarkers, but also as interesting targets for the development of new therapeutic strategies aiming the eradication of specific CTC populations responsible for metastasis formation and thus, possibly modifying the course of cancer disease. 3.1 Methods for circulating tumor cell isolation and quantification One main limitation for the determination of circulating tumor burden in cancer patients is their very rare frequency of appearance, estimated as one CTC per ≈107 white blood cells (WBCs) per milliliter of blood 173,174. The scarcity of CTCs and the abundance of leucocytes amongst they are present, demand extreme sensitive and specific CTC isolation and quantification methods. During the last years, an important number of technologies for CTC detection were developed, based on several properties that make CTCs differentiable from non-tumor cells also present within the blood. The expression of tumor-specific markers, the larger size of CTCs compared with WBCs, or some functional abilities of CTCs (e.g. invasiveness), have been exploited for their isolation, quantification and further molecular characterization (Table 8). Enrichment of CTCs by immunomagnetic capture has been the most successful and widely used approach to date. The CellSearch® platform (Janssen Diagnostics, Raritan, NJ, U.S), enriches CTCs using ferromagnetic beads coated with an antibody towards EpCAM, an adhesion molecule highly expressed in epithelial cells and absent in leucocytes. In this system, after enrichment, positive expression of cytokeratins 8, 18 and 19, and absence of 62 Chapter I Once Talin is activated, it is recruited to focal adhesion complexes to functionally interact with integrin cytoplasmic tails. Since Talin contains two β integrin binding sites, one within the FERM and the other within the rod domain, Talin homodimers have up to four integrinbinding sites, thus providing a biochemical base to Talin’s ability to act as an integrin crosslinker, promoting clustering of integrins at specific focal adhesion sites 243. Binding of Talin to integrin cytoplasmic tails has been widely studied, finding higher affinity rates to β1 and β3 integrin subunits 219,244. Following the interaction of Talin1 with the β-integrin tail, conformational changes are propagated across the membrane to the extracellular domains of integrins, increasing their affinity for ligands. After binding of individual integrins to their ECM ligands, a Talin-mediated connection is formed between the ECM and the cytoskeleton, giving raise to the formation of nascent adhesions. Forces transmitted through these immature adhesions contribute to the reinforcement of the ECM-cytoskeleton link and to the recruitment of additional cytoskeletal and signaling proteins 245. As adhesions mature, multiprotein complexes assemble at the cytoplasmic face of clustered, ligand-bound integrins, forming mature focal adhesions and finally transmitting signals into the cell, regulating processes such as cell spreading, adhesion or migration 227,246. Proteins recruited to focal adhesion complexes include focal adhesion kinase (FAK), Src-family kinases, integrin-linked kinase (ILK), paxillin or vinculin, among others, and together orchestrate the whole array of cellular functions regulated through the interaction of cell-ECM at focal adhesion sites 246. Objectives 67 Objectives The main objectives of this thesis have been delineated in order to cover some of the major current limitations in the field of CTC research, with the final goal of improving patient clinical management. By focusing on mCRC patients, this thesis comprises four principal objectives: the improvement of CTC detection methods sensitivity, the molecular characterization of CTCs for the deepening in their functional biology, the optimization of new prognostic and predictive CTC-related biomarkers and finally, the discovery of CTCrelated molecules critical for the efficiency of metastatic dissemination. 1. The development of an improved method for CTC isolation and quantification from patients with mCRC. a. The design of an improved qPCR-based CTC detection procedure, in order to maximize detection rates. b. The search for potential candidate genes for CTC detection, based on their expression pattern in epithelial and intestinal tissues. Their expression analysis in CTC-enriched samples from mCRC patients, using healthy donor’s blood as a background indicator. c. The development of a mathematical model for the combination of selected CTC-markers, and its validation as a prognostic factor for the prediction of mCRC patient’s survival. 2. The molecular characterization of CTCs in mCRC patients, in terms of their gene expression profile. a. The optimization of a methodology to explore the genetic characteristics of CTCs from very low cellularity samples, based on the linear amplification of the genetic material obtained using the technique proposed on objective 1, and its hybridization onto gene expression microarrays. b. The determination of the specific gene expression profile of CTC-enriched samples from mCRC patients, using negative control samples from healthy volunteers as background indicators. c. A bioinformatic analysis on the main biological pathways and processes underlying CTC gene-expression profile. d. The validation of microarray data by testing the expression of a set of selected CTC-specific genes by qPCR in an independent cohort, and in primary and metastatic tumor tissues. 68 Chapter I 3. The evaluation of a panel of CTC markers as a prognostic and predictive tool for the analysis of therapy response in mCRC patients. a. The selection of CTC-markers from objectives 1 and 2 for the improved CTC quantification using the general methodology described in objective 1. b. The gene expression assessment of a set of EMT markers in a group of CTC-isolated samples from mCRC patients, and its comparison with samples from healthy volunteers. The selection of CTC-related EMT markers differentially expressed between patients and controls. c. The evaluation of the prognostic value of the selected CTC-marker panel for the prediction of patient survival at baseline (before treatment). d. The classification of mCRC patients in therapy responders o nonresponders based on the variations of CTC-markers along treatment and the analysis of their predictive value. e. The direct comparison of CTC-markers and conventional imaging techniques for the early assessment of therapy response. 4. The characterization of the role of Talin1 in the process of metastatic dissemination mediated by CTCs, and the analysis of Talin1 as a new potential therapeutic target in mCRC. a. The search for candidate CTC-genes from objective 2 and the validation of Talin1 as a molecule expressed in CTCs from mCRC patients. b. The study of the effect of Talin1 depletion in HCT116 and CT26 colorectal cancer cell lines on in vitro assays mimicking the process of CTC extravasation from the bloodstream, by interaction with endothelial cells and subsequent basement membrane invasion. c. A study of the importance of Talin1 for metastasis formation from CTCs, modeled using HCT116 cell line, in an in vivo mouse model for hematogenous cancer dissemination. d. The assessment of Talin1 expression levels in CTCs from mCRC patients as a prognostic and predictive biomarker, as well as its expression pattern in primary colorectal carcinomas and metastatic tissues. Chapter II A logistic model for the detection of circulating tumor cells in human metastatic colorectal cancer Jorge Barbazán, María Vieito, Alicia Abalo, Lorena Alonso-Alconada, Laura MuineloRomay, Marta Alonso-Nocelo, Luís León, Sonia Candamio, Elena Gallardo, Urbano Anido, Andreas Doll , María de los Ángeles Casares, Antonio Gómez-Tato, Miguel Abal & Rafael López-López J Cell Mol Med, Vol 16, No 12, 2012, pp 2342-2349 http://onlinelibrary.wiley.com/doi/10.1111/j.1582-4934.2012.01544.x/abstract;jsessionid=483295FD67D56D715307464294B0A1FA.f02t01 7979 Talin1 enhances colorectal cancer dissemination through circulating tumor cells by promoting cancer cell extravasation and invasion Jorge Barbazán1, Nadia ElKhatib2, Sara Geraldo2, Lorena Alonso-Alconada1, Vasily Gurchenkov2, Alexandros Glentis2, Beatriz Fernández3, Tomás GarcíaCaballero3, Rafael López-López1, Danijela Vignjevic2 and Miguel Abal1,* 1 Translational Laboratory, Medical Oncology Department. Complexo Hospitalario Universitario de Santiago de Compostela SERGAS; Trav Choupana s/n 15706. Santiago de Compostela, Spain. 2 Institut Curie, UMR144, CNRS, Paris 75005, France. 3 Department of Pathology, Complexo Hospitalario Universitario de Santiago de Compostela/SERGAS, Santiago de Compostela, Spain. Key words: Circulating Tumor Cells, Talin1, Extravasation, Metastasis, Endothelial cells, Basement membrane invasion Running title: Talin1 promotes CTC dissemination in colorectal cancer * Corresponding author: Miguel Abal, Translational Medical Oncology Laboratory, Medical Oncology Department, Complexo Hospitalario Universitario de Santiago de Compostela/SERGAS; Trav Choupana s/n 15706, Santiago de Compostela, Spain. Tel: +34 981955073 Fax: +34 981950535 E-mail: [email protected] History: Submitted The appearance of cancer metastasis constitutes the main factor that determines patient outcome, causing a dramatic drop in survival rates. During tumor dissemination, circulating tumor cells (CTCs) must interact with blood-vessels endothelial cells to effectively extravasate from the circulation and possibly give raise to the formation of distant metastasis. We have previously reported a gene expression signature of CTCs in metastatic colorectal cancer (mCRC) that highlighted the importance of cell adhesion and migration abilities for CTC biology. In this work, among these genes described as CTC-specific, we have identified Talin1 as a potential molecule driving CTC extravasation. Talin1 depletion in CRC cell lines suppressed their ability to adhere and endothelial monolayer and further transendothelial migration, partially due to their inability to establish focal contacts with fibronectin fibers at the surface of endothelial cells, a novel cell-cell interaction mechanism described here. Talin1 also influenced later extravasation steps by regulating basement membrane invasion. These in in vitro findings were further confirmed in an in vivo model for cancer hematogenous dissemination. Finally, Talin1 expression in CTCs from mCRC patients was found to correlate with patient prognosis as well as with therapy response. Altogether, these findings suggest: i) a principal role for Talin1 in the process of CTC escape from the circulation and subsequent implantation prior to metastasis establishment and ii) a potential value for Talin1 as a therapeutic target against cancer dissemination and as a prognosis and predictive tool, key points to improve patient’s management at the clinical setting. Introduction Colorectal Cancer (CRC) constitutes the third cancer type worldwide in terms of incidence 2. The appearance of metastasis, a stepwise sequence of events by which primary tumors spread to distant sites, represents the main cause for CRC related deaths 306. To effectively establish secondary tumors, cancer cells must overcome a large number of physical and biological barriers before colonizing distant sites. After breaching of the basement membrane (BM) at the primary site, intravasation into pre-existing and newly formed blood and lymph vessels, and survival in the circulation, tumor cells must extravasate from the bloodstream at the target organ before its 80 Chapter V colonization 138,143. Despite the low efficiency of the metastasis process (only 0,01% of the tumor cells reaching the circulation might develop into distant tumors 157), metastatic disease continue to be the main challenge in oncology. Circulating Tumor Cells (CTCs), tumor cells that escape the primary tumor and reach the bloodstream, are considered to be one of the main responsible for cancer dissemination 143,307. During the last years, several methodologies have been developed for the effective isolation, quantification and characterization of CTCs from patients with different malignancies 308, widely evidencing their prognostic value 83. Moreover, it has been recently shown that CTCs can initiate metastasis in a xenograft model 172, reinforcing their role as metastatic cells and positioning CTCs as interesting targets for the treatment of disseminated disease. Recently, our group reported a global gene expression profile of CTCs coming from metastatic CRC (mCRC) patients, in which we described a set of CTC-specific genes that could serve as detection and prognosis markers, but also as potential therapeutic targets due to their expression in CTCs 213. Among them, we found Talin1, a protein encoded by the TLN1 gene, which belongs to the integrin-signaling pathway. Together with a large number of others, Talin1 is involved in the formation of focal adhesions (FAs) at cellextracellular matrix (ECM) contact sites. Talin1 links the cytoplasmic domains of β1 and β3-Integrins to actin filaments in the cytoplasm 219,309, playing a key role in the process of integrin inside-out activation, but also as a transducer molecule for outside-in signaling upon integrin activation and interaction with the ECM 227,310. Regarding the role of Talin1 in cancer, it has been recently shown that Talin1 expression was related with cancer progression to metastasis in prostate and in oral squamous cell carcinomas 140,311, by promoting increased tumor invasiveness and anoikis resistance. Cancer hematogenous dissemination through CTCs requires the attachment of cancer cells in the bloodstream to the endothelial layer of blood vessels, as a first step in extravasation 312, process in which several adhesion molecules, including integrins, are involved 312,313. Elevated Talin1 expression in CTCs from mCRC patients, lead us to hypothesize a role for this molecule in the process of CTCs escape from the circulation and thus, for metastasis formation. In this work we evaluated how Talin1 is involved in different steps of tumor cell extravasation, including attachment to endothelial monolayers, transendothelial migration (TEM) and BM invasion. We also demonstrate that Talin1 influences metastasis formation in an in vivo model for cancer dissemination. Moreover, Talin1 expression levels in CTCs from mCRC patients were found to be an effective marker for prognosis and therapy response effectiveness. Altogether, our results suggest Talin1 both as an interesting marker for patient outcome and as a potential therapeutic target against cancer dissemination through CTCs. Materials and methods Cell culture Human adenocarcinoma HCT116 and mouse carcinoma CT26 colon cancer cell lines were obtained from American Type Culture Collection (ATCC) and cultured in DMEM medium (Life Technologies) supplemented with 10% Fetal Bovine Serum (FBS) (Life Technologies) and 1% penicillin/streptomycin (Life Technologies). Human Umbilical Vein Endothelial Cells (HUVEC) were obtained from Life Technologies and cultured in endothelial basal medium EBM2 (Lonza). For HUVECs, culture vessels were pretreated with 0,2% gelatin diluted in PBS for 30min at 37ºC. Human Embryonic Kidney 293 (HEK293) cells were purchased from ATCC and cultured in DMEM medium supplemented with 10% FBS and 1% penicillin/streptomycin. Plasmids, shRNA, antibodies and proteins EGFP tagged Paxillin was kindly provided by D Vignjevic (Institut Curie, Paris). Luciferase reporter pLenti CMV V5-LUC Blast (w567-1) and lentiviral packaging and envelope vectors (psPAX2 and pmD2.G, respectively) were purchased from Addgene. Lentiviral transduction particles bearing ShRNA against Talin1 (human: 5’-CCGGCCCAGAGTATTAACGCTCCAACT 81 Talin1 promotes CTC dissemination in colorectal cancer CGAGTTGGAGCGTTAATACTCTGGGTTTT TG-3’ and 5’-CCGGGCCTCAGATAATCTGGTG AAACTCGAGTTTCACCAGATTATCTGAGG CTTTTT-3’, mouse: 5’-CCGGTGGTGAAGACGATGCAATTTGC TCGAGCAAATTGCATCGTCTTCACCATTT TTG-3’ and 5’-CCGGCGCTCCAAGAGTATTA TTAATCTCGAGATTAATAATACTCTTGGAG CGTTTTTG-3’ and Non Target Control (NTC) shRNA (5’-CCGGCAACAAGATGAAGAGCACCAA CTCGAGTTGGTGCTCTTCATCTTGTTGTT TTT-3’) that targets not known mammalian genes, were purchased from Sigma Aldrich (MISSION Transduction Particles). All experiments were performed using two independent ShRNAs for each cell line, obtaining similar results for both. Only one is shown in the results section for simplification. Mouse anti-α-Tubulin (Clone DM 1A) and rabbit anti-Fibronectin were from Sigma-Aldrich. Goat anti-Talin (C20) was from Santa Cruz Biotechnology. Mouse anti-Vinculin was obtained from Dr Vignjevic (Institut Curie, Paris). Labelledphalloidin, DAPI and all secondary antibodies were purchased from Molecular Probes. Human fibronectin was purchased from Life Technologies and used at 20μg/ml in PBS for surface coating (1h at room temperature or overnight at 4ºC). Lentiviral infections For Talin1 knockdown, 2x104 HCT116 or CT26 cells were seeded on a 24-well plate and incubated 24 hours at 37ºC. Next day, culture medium was replaced and Hexadimethrine Bromide (HDMB) (Sigma Aldrich) was added at a final concentration of 8μg/mL. Lentiviral infection was carried out following manufacturer’s instructions using a multiplicity of infection (MOI) of 10 (previously optimized using MISSION TurboGFP Control Transduction Particles (Sigma Aldrich)). Puromycin (Life Technologies) was used as selection antibiotic at a concentration of 1μg/mL (for HCT116) and 6μg/mL (for CT26). For the generation of luciferase expressing cells, viral particles were generated in HEK293 cells by co-transfection of packaging and envelope vectors (psPAX2 and pMD2.G, respectively) together with pLenti CMV V5-LUC Blast (w5671) using Lipofectamine 2000 (Life Technologies), according manufacturer’s instructions. 48 hours after transfection, culture medium containing lentiviral particles was collected, filtered and added to HCT116 and CT26 cells (shControl and shTalin1) for 24 hours. Hexadimethrine Bromide (HDMB) (Sigma Aldrich) was added at a final concentration of 8μg/mL. Cell lines stably expressing luciferase reporter gene were selected and maintained with Blasticidine HCL (Life Technologies) at 10μg/mL. Western blot Cells were washed with PBS, lysed in lysis buffer (1% triton, 50mM Tris pH7.5,1mM EDTA, 150mM NaCl and protease inhibitors cocktail (Sigma Aldrich). Protein was quantified using the Bicinchoninic Acid assay (BCA) (Sigma Aldrich) and boiled in 2x Laemmli buffer. The samples were separated by SDS-PAGE on 10% gels, transferred to nitrocellulose membranes, and blocked in 5% non-fat dried milk for 60 min. The membranes were incubated with primary antibodies overnight at 4ºC followed by incubation with peroxidaseconjugated secondary antibodies for 1h at RT. Immunoreactive bands were detected using an ECL kit (Thermo Scientific). Real time quantitative gene expression To check Talin1 knockdown at mRNA level, cancer cells were washed once with PBS and RNA was extracted with the High Pure RNA isolation kit (Roche) following manufacturer’s instructions. cDNA was synthesized (MuLV reverse transcriptase, Life Technologies), and gene expression was evaluated using hydrolysis probes (Life Technologies). Data was represented as fold change relative to the expression in the non-target controls. GAPDH was used as loading control. Immunofluorescence Cells were fixed in 4% paraformaldehyde in PBS for 20 min, followed by permeabilization with extraction buffer for 30 secs [0.5% Triton X-100 and 4% PEG (MW 40 000) in cytoskeleton PEM buffer (100 mM Pipes, pH 6.9, 1 mM MgCl2, 82 Chapter V and 1 mM EGTA)] containing 2μM phalloidin. After permeabilization, cells were briefly washed twice with PEM buffer and once with PBS. Primary antibodies were diluted in PBS and incubated at 1:100 dilution (except for mouse anti-vinculin, 1:2), for 1h at room temperature in a humid chamber. Secondary antibodies were diluted 1:200 in PBS and incubated together with labelled phalloidin (1:200) and DAPI (1:1000) for 1h at room temperature in the dark. Cells were then washed with PBS and mounted onto glass slides with Prolong Gold (Life Technologies). Quantification of FAs size and number CT26 and HCT116 cells (Control and Talin1 Knockdown) were seeded onto fibronectincoated coverslips. After 12-16h (for CT26) or 48h (for HCT116) cells were fixed and stained for Vinculin, Talin, Phalloidin and DAPI. Cells were imaged with a 100x objective of a wide-field microscope (DM6000 B/M; Leica) equipped with a CCD camera (CoolSNAP HQ;Photometrics). The lengths of FAs were measured using the MetaMorph Imaging software. 10 cells were quantified for each different cell line and condition. Quantification of FAs dynamics CT26 (shControl and shTalin1) cells were transfected with EGFP-tagged Paxillin using a Nucleofector (Lonza) according to the manufacturer’s instructions and seeded onto fibronectin-coated glass dishes. Turnover of FAs was analyzed 24h later using 63x NA 1.4 objective of an inverted microscope (TE2000; Nikon) equipped with a spinning dish head (CSU22; Yokogawa) and a charge coupled device camera (CoolSNAP HQ2; Photometrics). Images were acquired every 2 minutes for during 3-4 hours. FA turnover was defined as elapsed time between the first and the last frames in which FA was observed. At least 150 FAs were quantified for each condition in a minimum of 10 different cells. Lamellipodia lifetime was defined as the elapsed time between the first frame where one single lamellipodia protrusion started to form, until the frame where it completely retracted. A minimum of 10 different cells was analyzed. Mann-Whitney test was used to evaluate significant differences between conditions. Cell proliferation assay For the analysis of cell proliferation dynamics, 104 cancer cells were seeded per well on 96well culture plates and incubated at 37ºC for 24, 48 and 72h. After incubation, the number of viable cells was determined by using AlamarBlue (Life Technologies) following manufacturer’s recommendations. Adhesion assays For evaluation of tumor cell adhesion to HUVECs, 3x104 endothelial cells were seeded in gelatin-coated 96-plate wells and incubated overnight for cell monolayer formation. Cancer cells were stained with Calcein AM (Life Technologies) and plated at a concentration of 2,5x105 cells/well over HUVEC monolayers in triplicates. Basal fluorescence emission was measured immediately after cell seeding in a microplate luminometer (LumiStar Optima, BMG LabTech) to evaluate possible differences in cell number. Cells were then incubated at 37ºC for the specified time. After incubation, wells were washed three times to remove non-adherent cells, and fluorescence intensity was measured. Adhesion was represented as the percentage of adherent cells per condition, normalized to the initial cell number per well. All experiments were run at least three independent times.Adhesion of tumor cells to different ECMs was tested using the ECM Cell Adhesion Array plates (Millipore), following the previous Calcein AM labeling protocol. Flow-adhesion assays For the evaluation of tumor cell adhesiveness under flow conditions, we used a setup composed by a culture chamber (PocMini-2, PeCon GmbH) connected to a syringe pump (NE-1000, New Era Pump Systems Inc) The culture chamber was placed on a thermostated platform to maintain the temperature at 37ºC during the experiment. The whole setup was placed in an inverted microscope (Zeiss Axio Vert A1) to allow cell visualization. Tumor cells were stained with Calcein AM and resuspended at a concentration of 105 cells/mL in complete growth medium. Cells were then pumped through the culture chamber 83 Talin1 promotes CTC dissemination in colorectal cancer at 500μl/min during 1 hour, followed by a 10min wash with complete medium. After this time, the bottom glass from the culture chamber was removed and gently washed with culture medium to eliminate non-attached cells. Tumor cells attached to the glass surface, were trypsinized, centrifuged and resuspended in 100μl of PBS. Attached cells were indirectly quantified by fluorescence emission measurement in a luminometer. To evaluate cell adhesiveness under flow conditions, the bottom glass of the culture chamber was either coated with fibronectin, or seeded with 5x105 HUVECs in EBM-2 medium and incubated at 37ºC overnight for monolayer formation. All experiments were performed in three independent runs. 2D and transwell migration assays For the evaluation of cell migration ability in twodimensional surfaces, CT26 cells (ShControl and shTalin1) were seeded onto fibronectin-coated glass bottom dishes. Cells were incubated 15 minutes at 37ºC for initial cell attachment, and then migration was visualized in clear field under an inverted videomicroscope (Nikon Eclipse Ti) using a 10x objective. Images were acquired every 3 minutes for 8 hours and 10 random fields were imaged for each condition. Migration speed and path length was quantified using the manual tracking plugin implemented on Fiji (ImageJ) in 50-100 cells per condition. Experiments were performed three independent times. For transwell migration assays, 105 CT26/HCT116 cells (ShControl and shTalin1) were seeded on the upper chamber of 24-well hanging cell culture inserts (8,0 µm pore size polycarbonate membrane; Millicell, Millipore) in 100 µl of DMEM medium containing 5% FBS. The lower chamber was filled with DMEM supplemented with 20% FBS to create an FBS chemotactic gradient. Cells were incubated for 24h (CT26) or 72h (HCT116) at 37ºC. Cells that migrated through the membrane were trypsinized, collected and stained with Calcein AM (5 µM) according to manufacturer’s recommendations. After staining, cells were centrifuged, resuspended in 100 µl of PBS and fluorescence intensity was quantified using a luminometer. Three independent assays were run for each experimental condition. Results were represented as the relative number of shTalin1 migrating cells compared to control cells, defined as 100%, for each cell line. Transendothelial (TEM) migration assay The effect of Talin1 knockdown on migration through an endothelial monolayer was evaluated using transendothelial migration assays. 105 HUVECs were seeded on the upper chamber of a gelatin-coated 24-well hanging cell culture insert (Millicell, Millipore) in EBM-2 complete medium, and incubated 4-6h at 37ºC to form a monolayer. Monolayer integrity was assessed in a control insert by addition of high-molecularweight FITC-dextran (Sigma Aldrich) to the upper chamber (1mg/mL). 600 µl of EBM-2 medium were added to the lower chamber. Every 30 min, 50 µl samples were collected from the lower chamber and diluted to 1ml with PBS. 100 µl of diluted sample were transferred to a 96-well black plate and fluorescent content was quantified at 492/520 nm absorption/emission wavelengths. No fluorescence intensity is detected in the lower chamber once the HUVEC monolayer reaches confluency. 5x105 CT26 cells (control and shTalin1) were stained with Calcein AM (Life Technologies) as previously described, and added to the upper chamber of the cell culture insert once the HUVEC monolayer was established, in 10%FBS DMEM medium. 20%FBS DMEM medium was added to the lower chamber to create a chemotactic gradient. Cells were allowed to migrate through endothelial cells for 24h at 37ºC. Transmigrated cells were trypsinized, collected, centrifuged, resuspended in 100 µl of PBS and fluorescence emission was measured in a luminometer. At least three independent assays were run for each experimental condition. Results were represented as the relative shTalin1 CT26 transmigrated cells compared to control CT26 cells, defined as 100%. HUVEC monolayer integrity assay Disruption of HUVE cells monolayer integrity by cancer cells was analyzed using the XCELLigence system (Roche Applied Sciences) as previously described 327 This method enables 84 Chapter V real-time monitoring of cellular events by using impedance measurements across interdigitated microelectrodes integrated on the bottom of tissue culture microtiter plates (E-plates). Impedance changes occur if cells attach to E-plates or change their size, shape and number. Briefly, 2,5x104 HUVECs were seeded on gelatin-coated E-plates and incubated 20-24 hours for monolayer establishment. Impedance readings were performed every 10 minutes and monolayer formation was evidenced by a cell index flattening. After this time, 2x104 HCT116 or CT26 cells (ShControl and ShTalin1) were added on top of the HUVE cells and impedance was monitored again for 1-4 hours. Invasion of cancer cells was measured by their ability to trigger endothelial cells retraction, which results in a cell index drop. Results were normalized to the time of addition of tumor cells, and invasion was quantified as the slope variation along the analysis time for each condition. Experiments were performed in duplicates and repeated three independent times. Tumor cell-HUVEC interaction assay For the evaluation of fibronectin production by HUVECs, 105 endothelial cells were seeded on gelatin-coated 12mm glass coverslips and incubated overnight at 37ºC. Cells were then fixated with 4% PFA for 20min at room temperature, stained for fibronectin, phalloidin and DAPI, and visualized on a Leica SP5 confocal microscope. Images analysis and threedimensional reconstructions were performed with Fiji (ImageJ). For analysis of cancer cellendothelial cell interaction, 4x105 CT26 control and shTalin1 cells were seeded on 12-well plates and transfected to transiently express EGFP-Paxillin using Lipofectamine LTX (Life Technologies) according to manufacturer’s protocol. 105 HUVECs were seeded on a gelatincoated 12mm glass coverslip and incubated overnight to form a monolayer. After 24 hours of transfection, cancer cells were trypsinized and seeded on top of the HUVEC monolayer in 10%FBS DMEM medium. Cocultures were incubated for 2 hours at 37ºC to allow tumor cellHUVEC contact establishment. Cells were then fixated with 4% Paraformaldehyde (PFA) (Sigma Aldrich) for 20min at room temperature, washed with PBS and stained for fibronectin, phalloidin and DAPI. Cell interactions were visualized with a 100x objective of a wide-field microscope (DM6000 B/M; Leica) equipped with a CCD camera (CoolSNAP HQ;Photometrics). Native basement membrane migration/ invasion assay The influence of Talin1 on migration/invasion on a physiologic system was evaluated as previously described by Schumacher et al 314. The peritoneal basement membrane (BM) was isolated from BALBc mice, and mounted on 6,5mm diameter Transwell (BD Biosciences) from which the polycarbonate membrane was cut out, using tissue adhesive (Vetbound, 3M). Mesothelial cells were eliminated by treating the membrane with ammonium hydroxide (1M) (Sigma Aldrich) for 1h at room temperature. After PBS washing, 105 tumor cells were plated on the top of the BM in DMEM medium supplemented with 2% FBS. DMEM supplemented with 10% FBS was used as a chemoattractant in the lower chamber. After 4 days of incubation at 37ºC, the samples were washed with PBS, fixed with 4% paraformaldehyde 40min at room temperature, and stained at both membrane sides with phalloidin and DAPI for two hours. After staining, the whole insert was mounted on a glass bottom dish. Migrating/invading cells were imaged with a 20x objective of a laser-scanning confocal microscope (Leica SP8.) 3 to 5 random areas were imaged per sample and experiments were performed in three independent runs. Quantification of cell invasion was performed by counting the total number of nuclei/actin protrusions existing in the lower side of the BM, and they were expressed as a ratio with respect to the total number of nuclei in each area, indicator of cell number for each experiment. Images, z-sections, 3D reconstructions, and quantifications were performed with Fiji (ImageJ). Experimental metastasis assays HCT116 control or shTalin1 cells (5x105 in 0.1 ml of sterile PBS) stably expressing luciferase reporter were injected into the left ventricle of the heart of female nude mice, aged 7 weeks (nu/nu, Charles River) under 2,5% isoflurane/air anesthesia. 85 Talin1 promotes CTC dissemination in colorectal cancer Only mice with evidence of a satisfactory intracardiac injection, indicated on day 0 by systemic bioluminescence distributed throughout the animal, continued in the experiment. Metastasis formation was monitored every week by bioluminescent imaging with a Xenogen IVIS (IVISR Lumina II) system coupled to Living Imaging software 4.2 (Xenogen Corporation). Luciferin (150 mg/kg in PBS; Firefly Luciferin, Caliper Lifescience Corp, Hopkinton, MA, U.S) was injected intraperitoneally as the substrate for the luciferase. Mice were sacrificed after four weeks and metastasis were macroscopically visualized and confirmed by luminescence emission. All tumor-bearing tissues were collected, fixed in 4% formalin, and embedded in paraffin. Haematoxilin-Eosin staining was performed to determine the presence of metastasis. Mice were housed and maintained under specific pathogen-free conditions and used in accordance with institutional guidelines and approved by the Committee for Animal Care from the Universidade de Santiago de Compostela (USC). CellSearch CTC quantification in mice To further explore distant dissemination, a 50µl of peripheral blood sample was extracted before mice sacrifice and tested for the presence of CTCs with the CellCaptureTM CTC Mouse Kit (Veridex LLC, Janssen Diagnostics). Briefly, mice blood was mixed with 25µl of Anti-EpCAM ferrofluids and incubated for 15 minutes. After immunomagnetic capture and enrichment, CTC were immunofluorescent staining using AntiCytokeratins 8, 18 and 19 and DAPI. Analysis and enumeration of CTC was performed by an experienced user using the CellTracks Analyzer II® (Veridex LLC, Janssen Diagnostics). CTCs immunoisolation and qPCR quantification in mCRC patients Circulating tumor cells were indirectly quantified in blood from 50 mCRC patients as previously described 273. Blood from 20 healthy volunteers was extracted and analyzed as control samples. Briefly, CTCs were immunoisolated from 7,5ml of peripheral blood using magnetic beads coated with an antibody towards EpCAM (CELLection Epithelial Enrich, Life Technologies) following manufacturer’s instructions. Total CTC RNA was extracted with the QIAmp viral RNA mini kit (Qiagen) and cDNA was synthesized using SuperScriptIII (Life Technologies). To further optimize the sensibility of detection, a preamplification step was performed using TaqMan PreAmp Master Mix kit (Life Technologies). Talin1 and Protein Tyrosine Phosphatase Receptor Type C (PTPRC or CD45) expression was quantified by real time quantitative PCR using hydrolysis probes (Life Technologies) in a StepOne Plus thermocycler (Life Technologies). Every sample was run in duplicate for each gene and appropriate negative controls were included in each qPCR reaction plate. Cq values (defined as the cycle number at which the fluorescence reached a fixed threshold value) for each transcript were normalized to 40 (maximum number of cycles), and this value to the 40-Cq value for CD45 [(40-Cq target)-(Cq CD45)], used as a reference gene as it detects hematopoietic cells unspecifically isolated. We previously reported the validity of CD45 as a reference gene 273 as its expression levels are equal in patient and healthy donor samples. Gene expression analysis in primary tumors and metastatic tissue Primary colorectal carcinomas (n=8) and metastasis (liver metastasis, n=7; lung metastases, n=7) were processed by the Pathology Department of the Complexo Hospitalario Universitario of Santiago de Compostela. The superficial non-invasive zone and the deep invasive area of the primary tumors were macroscopically dissected, ensuring similar tumor percentages. RNA was purified (TRIZOL reagent, Invitrogen; RNeasy kit, Qiagen), cDNA was synthesized (MuLV reverse transcriptase, Life Technologies), and gene expression was evaluated using hydrolysis probes (Life Technologies). Data was represented as fold change relative to the expression in the superficial non-invasive area. GAPDH, ACTB and RLPLO housekeeping genes were used as loading controls. 86 Chapter V Data analysis Differences between groups were assessed by applying Mann-Whitney non-parametric t-tests. In the cases were data were normalized to the relative values of ShControl cells, Wilcoxonsigned rank test. For survival analysis, prognostic groups were set based on Talin1 CTC expression levels. Single patients were included into low or high-Talin1-CTC groups if Talin1 levels were, respectively, below or above cutoff, defined as the 75% percentile. Kaplan-Meier (KM) and univariate COX regression survival analysis were used to study associations between Talin1 expression levels and PFS/OS. All statistic tests were performed with SPSSv20.0 and GraphPad prism v5 software and considered significant when p≤0.05. Results Talin1 is expressed in CTCs from mCRC patients and mediates tumor cell adhesion to endothelial cells and transendothelial migration Previously, we showed that, among other genes, Talin1 is expressed in CTCs coming from CRC patients bearing metastasis. Here we validate those results in a bigger cohort (50 mCRC patients and 20 healthy donors), and we confirmed that Talin1 was specifically expressed in CTCs coming from mCRC patient’s blood (Supplementary Figure S1A) (p<0,01). Talin1 expression effectively discriminated mCRC patients from healthy controls, as evidenced by ROC curve analysis (AUC: 0,816, p=0,0017) (Supplementary Figure S1B). Figure 1. Talin1 influences cancer cells extravasation-related abilities. A) Western blot showing Talin1 protein expression in ShControl and ShTalin1 HCT116 and CT26 cells. Α-Tubulin was used as loading control. B) Relative Talin1 gene expression levels of ShControl cells compared to ShTalin1 (HCT116 and CT26) measured by qPCR. GAPDH was used as loading control. C) HCT116 and CT26 ShTalin1 cells adhesion to a HUVEC monolayer, normalized to adhesion of ShControl cells. D) Flow adhesion assay setup. Cells were maintained at 37ºC under agitation and forced to flow through a closed culture chamber system, over a HUVEC monolayer using a syringe pump. E) Representative images of HCT116 and CT26 cells (Control and Talin1 depleted) adhering to HUVECs under flow conditions. Cancer cells were labelled with Calcein AM, and represented on red. HUVE cells were imaged in bright field. Bars 100μm F) Tumor cell-HUVEC adhesion quantification for HCT116 and CT26 cell lines, from three independent assays. Adhesion of ShTalin1 cells is represented normalized to ShControl cells adhesion for both cell lines. G). Representative images of membrane protrusions formation in CT26 cells (ShControl and ShTalin1) after 1 hour of flow adhesion. Bars: 50μm. (H, I) HUVEC monolayer integrity assays. Endothelial cell retraction was measured in the XCELLigence system under the presence of ShControl or ShTalin1 HCT116 H) or CT26 I) cells, based on Cell Index reduction over time. Quantification of endothelial retraction (Cell Index slope during analyzed time) is represented in right panels for each cell line. J) Transendothelial migration of CT26 cells (ShControl and ShTalin1) after 24 hours of coculture with HUVECs. (*): p<0,05, (**): p<0,01, (***): p<0,001 87 Talin1 promotes CTC dissemination in colorectal cancer The first barrier that a CTC must overcome to escape the circulation and possibly establish a metastasis in a distant organ is the luminal endothelial layer of blood vessels. As Talin1 was found to be expressed in CTCs, we sought to evaluate its potential role in the steps involved in the process of CTC extravasation from the circulation. For that, Talin1 expression was stably knocked-down in two different cell lines (HCT116 and CT26) by shRNA lentiviral delivery (Figure 1A, B). Moreover, and as a model of endothelial cells, Human Umbilical Vein Endothelial Cells (HUVECs) were used. After Talin1 depletion, both HCT116 and CT26 cells, showed a significantly decreased ability to attach to a preformed HUVEC monolayer, in a static adhesion assay, when compared with control cells (Figure 1C). In order to mimic the physiological conditions of a CTC being in the bloodstream, we analyzed the adhesion capacities of Talin1 depleted cancer cells in a flow adhesion assay. Tumor cells were flowed over an endothelial monolayer during a determined time period, and the final percentage of cells adhering the HUVEC layer was quantified. Using this setup (Figure 1D) we found that both HCT116 and CT26 Talin1-depleted cells failed to attach to the endothelial cell monolayer under flow conditions, when compared with control cells (Figure 1E, quantification in 1F). Moreover, and specially for the highly invasive CT26 cells, ShControl cells were able to attach and formed membrane protrusions, that could be helping in the following steps of transmigration through the endothelial layer. However, in the case of Talin1 depletion, even though some cells succeed to attach to the HUVEC layer, they formed fewer membrane protrusions (Figure 1G). An important step in the process of tumor cell extravasation from the circulation, after attachment to the vascular endothelium, is the retraction of endothelial cells to enable cancer cell migration between them before reaching the underlying basement membrane. To check whether Talin1 could influence endothelial retraction, we performed an endothelial monolayer integrity assay. A monolayer of HUVECs was formed in the wells of an E-plate (XCELLigence system, Roche), and then 2x104 cancer cells were added and cocultured with endothelial cells. Figures 1H and I represent the normalized impedance signal obtained for each cell line (HCT116 and CT26, respectively) from the moment of cancer cell addition. When no cells were added to the monolayer of HUVECs, cell index (a direct indicator of the total percentage of the plate occupied by cells) was maintained over time, or even slightly increased (black lines). After the addition of cancer cells, cell index rapidly decreased, possibly due to the disruption of endothelial junctions and retraction of the endothelial monolayer (Figures 1H and I, red lines), as quantified by the slope decrement of each line over the analysis time (Figures 1H and I, right panels). Both for HCT116 and CT26 cells, Talin1 depletion lead to a reduction in endothelial monolayer retraction (Figures 1H and I, blue lines, quantification in right panels). These results, suggest that Talin1 could be relevant for the initial steps of CTC transmigration through the endothelial barrier. Finally, we found that ShTalin1 CT26 cells were significantly less efficient in migrating through a HUVEC monolayer, when compared with control cells, in a TEM assay (Figure 1J). Together these results indicate that Talin1 plays a role in the extravasation step of CTCs from the circulation by influencing both the adhesion and transmigration of cancer cells to an endothelial monolayer. Cancer cell adhesion to endothelial cells partially depends on FAs-endothelial fibrillary fibronectin contacts Several cell adhesion molecules (CAMs) mediate the connection between cancer cells and endothelial cells 312. For example, VCAM, ICAM or L1 molecules, expressed by the vascular endothelium, interact with α4β1 integrin, CD44 or αvβ3 receptors present on different cancer cells. Talin1 is involved in formation of cell-matrix adhesions, however, little is known about its role in cell-cell attachment. Here we hypothesize that, al least in part, adhesion of cancer cells to the endothelial layer could be mediated through the interaction of cancer cell FAs with the ECM produced by endothelial cells at their surface. To this regard, we found a large amount of 94 Chapter V tumor cell adhesion to HUVE cells, used as a model of endothelial blood vessel layer, both under static and more physiological flow conditions. Adhesion times used in these experiments were relatively short, indicating a possible role for Talin1 in the early “docking” step, probably through activation of integrins in the plasma membrane. We also found that, mimicking later steps of cancer cell extravasation, Talin1 failed to form membrane protrusions that could allow cancer cells to squeeze in between endothelial cells, with a posterior consequence in endothelial cell retraction, and finally in transendothelial migration. As observed in vitro, reduction in FA turnover time after Talin1 depletion could explain the reduced ability of those cells to establish membrane protrusions over the endothelial layer. Moreover, β1 integrins (commonly activated through Talin1 and expressed in HCT116 and CT26 cells) have been related to the process of endothelial cell retraction by the induction of VE-cadherin phosphorylation, which dissociates β-catenin from the VE-cadherin complex, finally disrupting endothelial adherens junctions in breast cancer 317. Although not proven, we speculate that a similar mechanism could be occurring in our CRC model. As mentioned, attachment of cancer cells to the endothelium prior to extravasation relies on the interaction between endothelial selectins and CAMs with their cancer cells counterreceptors (SLeX glycoproteins and β1 and β3 integrins, among others) 120,150,312,313. Here, we showed an additional attachment mechanism, mediated by the expression of fibronectin fibers on the surface of endothelial cells, which colocalized with cancer cells FAs, accounting approximately for 20% of cancer cell-endothelial adhesiveness, as demonstrated by antibody blocking of endothelial fibronectin. To our knowledge, this is the first work reporting these types of contacts, which could represent a novel mechanism for CTC firm adhesion to the endothelium, prior to TEM. The involvement of Talin1 in this particular mechanism relies on the reduced ability of cancer cells to form FAs after Talin1 depletion, and thus, the establishment of endothelial-cancer cells contacts through FAfibronectin interactions. Interestingly, data in lung cancer suggested that plasma fibronectin could confer a pro-metastatic ability to cancer cells by activating αVβ3 integrins, further promoting tumor cell invasion 318. To this regard, production of fibronectin at endothelial cells surface and/ or deposition of circulating plasma fibronectin could also be mediating metastasis formation by promoting CTC extravasation. Cell adhesion strength and migration speed have been related in a biphasic manner 319,320. Migration velocity increases from low to medium adhesion strengths, while an excessive increment in cell adhesion causes a dramatic reduction in cell movement. Talin1 depletion directly causes an increase in cell speed in 2D fibronectin coated substrates, probably due to a reduction in adhesion strength, likely caused both by a reduction in FA number and turnover. In contrast, Talin1 depletion decreased the ability of cells to migrate in a Transwell assay. This can be explained because the formation of mature and stable FAs (absent in Talin1 knockdown) is a necessary event for the interaction with the cellular acto-myosin cytoskeleton, which can transmit cell-substrate traction throughout the cell 321, further allowing migration through the pores of the Transwell insert. Because a gradient of FBS was established to perform this kind of assays, one could speculate that the reduced expression of Talin1 in cancer cells could also be influencing directional migration of cells towards a chemical gradient. However, no differences in directional migration were found for CT26 cells in Dunns chemotaxis assays (data not shown), discarding a role for Talin1 in chemotaxis. After TEM, CTCs must deal with the presence of the endothelial basement membrane, invading through it to effectively colonize the final metastatic site. To address the role of Talin1 in this later step, we used a native BM invasion assay, which represents the closest model to the in vivo situation, as a native mouse BM is used. Reduced expression levels of Talin1 led to a significantly reduced invasion ability of the highly invasive CT26 CRC cell line, suggesting an important role for Talin1 in this process. Cancer cells used F-actin-based structures called invadosomes to establish close contact with the ECM and invade through it, due to their ability to degrade ECM components 322. 95 Talin1 promotes CTC dissemination in colorectal cancer As Talin1 is involved in invadosome formation, we hypothesize that reduced ability of CT26 to invade BM structures could be, at least in part, due to a reduction in invadosomes number and/ or activity. Matrix degradation assays, as well as Matrix Metalloproteinases (MMP) expression analysis would be of great interest to elucidate the mechanism by which Talin1 could be modulating cell invasiveness. These results, together with the reduced ability of Talin1 depleted cells to adhere, induce retraction and TEM of endothelial cell monolayers, indicate the relevance of Talin1 in the whole process of CTC extravasation from the circulation. Based on our in vitro observations, we analyzed the role of Talin1 in a mouse model of metastatic dissemination. Metastasis formation was dramatically decreased for human HCT116 cancer cells, a better model than mouse CT26 cells to test CRC dissemination, after Talin1 depletion, with a reduced number of finally detected CTCs on injected animals. Clinically, we describe an association between Talin1 and the sequential acquisition of an aggressive phenotype, based on Talin1 expression levels in primary and metastatic lesions, in agreement with some works that have already reported the role of Talin1 in cancer progression 140,311. Moreover, it has been shown to be a target for mir-9, a microRNA with tumor suppressor activity in ovarian carcinoma 323. These results, together with the observation that patients with high Talin1 expression in CTCs displayed much less survival times (PFS and OS) than those with lowTalin1, reinforced the role of Talin1 as a CTC and metastasis marker and as a potential therapeutic target against cancer dissemination. Importantly, we also found that Talin1 expression on CTCs had a predictive value, due to the fact that, variations in Talin1 CTC expression during treatment, predicted therapy response in terms of patient survival. Talin1 loss of function was previously associated to Docetaxel chemosensitivity in triple negative breast cancer 324 and elevated Talin1 expression in metastatic cancer cells has also been linked to anoikis (detachment-induced cell death) resistance 140, and to TRAIL-induced apoptosis 325. Talin1 function could represent a mechanism by which CTCs acquire resistance to chemotherapy, explaining our patient survival data. It is also reasonable to hypothesize that, in our metastasis mouse model, Talin1 depleted cells could undergo anoikis after failure to attach the blood vessels endothelium. Currently, several experimental therapies are being tested in clinical trials, to assess the validity of targeting integrin activation, in which Talin1 is involved. αVβ3 binding inhibition to ECM was effectively blocked by small peptides (Cilengitide, EMD121974, Merck) or by monoclonal antibodies (DI17E6), showing promising results in clinical trials for different tumor types, including mCRC (DI17E6 in combination with Cetuximab, NTC01008475) 326. Based on our results, here we propose Talin1 as a direct target for pharmacological inhibition, especially for the treatment of metastatic disease. In summary, the evidence presented supports a particular role for Talin1 in circulating tumor cell extravasation, through the specific interaction with blood vessels endothelial cells, mediating adhesion, transendothelial migration and further basement membrane invasion, which finally results in metastasis formation. Our clinical data suggest Talin1 as a valuable marker both to predict patient prognosis based on Talin1 levels in CTCs, but also as a tool to monitor treatment effectiveness in mCRC. Further studies will pursue the evaluation of specific Talin1 inhibitors, what will place this molecule in a relevant condition to be considered as a new therapeutic target to tackle metastatic spreading. Acknowledgements We gratefully thank all the patients for their willingness to participate in the study and the staff of the medical oncology department for their collaboration in sample collection and clinical data analysis. The authors also want to thank NIKON Imaging Facility at Institut Curie, Paris. Jorge Barbazán is recipient of a FPU fellowship from the Spanish Ministry of Education, Culture and Sports. Lorena Alonso-Alconada was supported by a fellowship from the Vasque government. 96 Chapter V Supporting Information Supporting Figures Figure S1. Talin1 is expressed in CTCs from mCRC patients. A) Talin1 genes expression levels in CTCs immunoisolated from mCRC patient’s blood and healthy controls. B) ROC curve of mCRC patients Talin1 expression in CTCs versus healthy controls. (**): p<0,01 Figure S2. Talin1 knockdown does nor affect tumor cell proliferation. Proliferation of HCT116 and CT26 (ShControl and ShTalin1) cells after 24, 48 and 72h. Supporting Movies These files can be downloaded here: Movie S1 Movie S2 Movie S3 https://dl.dropboxusercontent. com/u/42562496/Videos%20Tesis/ Movie%20S1.avi https://dl.dropboxusercontent. com/u/42562496/Videos%20Tesis/ Movie%20S2.avi https://dl.dropboxusercontent. com/u/42562496/Videos%20Tesis/ Movie%20S3.avi Chapter VI General Discussion and Conclusions General Discussion 103 General Discussion Colorectal cancer (CRC) represents the third most diagnosed cancer type worldwide, accounting for more than 600.000 deaths in 2012, which approximately represents 8,5% of all cancer-related deaths 1. Taking into account that incidence rates are still continuously increasing in developing countries 3,4, research in CRC screening, diagnosis and treatment is underscored. During the last years, significant advances have been made in the early detection and treatment of localized CRC, which has importantly contributed to the reduced mortality rates and allowing for five-year survival rates over 90% 7. However, the appearance of disseminated disease is still a milestone that invariably determines patient’s prognosis, with reduced 5-year survival rates that reach 10% in the worst cases 7. This makes the occurrence of metastasis the main actual bottleneck in the management of CRC patients. In this regard and despite patients with advanced CRC stages cannot routinely undergo surgery, progress in the discovery of new therapeutic agents have substantially improved survival rates and general patient welfare. However, the development of more specific and active cancer drugs, must go hand by hand with the establishment of new and more effective prognostic and predictive factors, to reliably estimate patient’s life expectancy, allow the selection of adequate therapies, and evaluate their response to anti-tumor agents. Notwithstanding considerable achievements have been made to this regard, prognostic, and especially predictive markers often fail to show results close to the expected. This could be probably due to their analysis in primary tumor tissue samples, and not in metastatic lesions, which are those that truly determine the prognosis of this type of patients 328. Moreover, given that cancer is a continually evolving disease at the molecular level, it is controversial whether a single primary tumor biopsy at a specific time point represents the patient’s disease 329. Sequential analysis of primary tissue during the course of a given therapy, or the evaluation of molecular alterations in metastatic lesions would thus probably be a better indicator of tumor characteristics, leading to an optimized therapy response prediction. However, subjecting patients to serial invasive biopsies (from primary or metastatic tissues) is often impractical and confer a considerable risk to the patient 171. In addition, single site biopsies are unlikely to capture the complexity of the genomic landscape of a patient’s tumor, normally due to the presence of high intratumor heterogeneity 330. Thus, having a more comprehensive picture of the overall tumor content is required for a better patient management. The analysis of Circulating Tumor Cells (CTCs) provide innovative and promising solutions to these problems, as they can be quantified and characterized repetitively in a non-invasive way, through the obtaining of a simple blood sample, thus serving as a surrogate patient’s “liquid biopsy”. CTCs correspond to tumor cells that have been shed into the bloodstream by primary tumors and, at least a subpopulation of these CTCs, has the ability for the generation of overt metastatic lesions 172. Moreover, CTCs found in the circulation can also come from distant metastases or bone marrow 117,169,170, proposing CTCs as metastatic intermediates and making their analysis of a great relevance for the better understanding of dynamic cancer complexity. CTC counts have been shown to predict CRC patient’s prognosis, among other Conclusions 115 Conclusions 1. Anti-EpCAM magnetic immunoisolation of CTCs combined with their quantification by the assessment of VIL1, GAPDH and CD45 gene expression, generated an improved method for the analysis of circulating tumor burden in patients with metastatic colorectal cancer, in terms detection sensitivity and specificity. 2. The logistic model built by combining VIL1, GAPDH and CD45 has shown a prognostic value, separating mCRC patients based on their clinical outcome, and identifying patients at high risk of disease progression. 3. We have developed an effective methodology for the evaluation of the global gene expression profile of samples containing very low amounts of starting genetic material. This technique, based on the combination of EpCAM-based CTC immunoisolation, whole transcriptome amplification and microarray hybridization, allowed the molecular characterization of CTCs from mCRC patients. 4. A specific set of 410 genes was found to characterize the population of CTCs isolated from mCRC patients. At the molecular level, this gene expression signature was related to a potential CTC phenotype mainly characterized by its adhesive and migratory abilities. 5. The specific expression of APP, CD9, CLU, ITGB5, LIMS1, RSU1, TIMP1, TLN1, VCL and BMP6 genes in CTC-enriched samples from mCRC patients, analyzed by qPCR, significantly validated our microarray analysis data. Moreover, the prognosis value of these CTC-markers, as well as their elevated expression levels in metastatic tissues compared to primary tumors, evidenced the usefulness of our methodology for the discovery of new and improved metastasis-related clinical biomarkers. 6. We have developed a panel of CTC-related markers, composed by GAPDH, VIL1, CLU, TIMP1, LOXL3, ZEB2 and CD45, for the evaluation of patient prognosis but more importantly, for the assessment of therapy response prediction in mCRC patients undergoing first-line treatment. 7. We have shown that the sequential analysis of CTC-related transcripts along treatment constitutes an improved method for therapy response evaluation, when compared with standard computerized tomography. The implementation of this methodology at the clinical setting, in combination with routine imaging techniques, would improve current therapy effectiveness evaluation protocols. At this time, PrediCTC, a therapy response evaluation kit based on this methodology, is being designed and clinically validated on a multicenter trial. 116 Chapter VI 8. We have demonstrated that the depletion of Talin1, a CTC-related molecule, in HCT116 and CT26 colorectal cancer cell lines, reduced their ability to attach and migrate through a monolayer of endothelial cells, key features in the process of CTC extravasation from blood. 9. We have identified a potentially new cancer cell-endothelium interaction mechanism, driven by the formation of focal adhesions by CT26 cancer cells at fibronectin-rich sites in the surface of endothelial cells. Talin1 represents a key component for the correct formation of these contact types. 10. We have proved that Talin1 represents a crucial cellular component for the correct establishment and turnover of focal adhesions in HCT116 and CT26 cell lines and that, functionally, Talin1 regulates cell-ECM adhesiveness, migration and basement membrane invasion. 11. We have shown up the role of Talin1 in cancer dissemination mediated by CTCs in an in vivo model, highlighting its biological importance in metastasis formation, reinforced by its increased expression, in human tissue samples, as tumor progression advances. Moreover, we have validated the gene expression analysis of Talin1 in CTC-enriched samples as a prognostic and predictive factor in mCRC patients. 12. In closing, this thesis encompasses a global approach that, focusing on the study of circulating tumor cells in the process of cancer metastasis, aims to improve the current clinical tools available for a better patient management. As a whole, the establishment of new prognosis and predictive biomarkers, as well as potential therapeutic targets such as Talin1, widely evidence the clear translational commitment of this thesis. It represents an effort to transfer basic CTC-derived knowledge into a clinical application, with the ultimate intention of improving patient’s welfare. 117 Circulating tumor cells in metastatic colorectal cancer from basic understandig to clinical practice Conclusions graphic overview 126 colorectal cancer. Annals of Oncology 20, 1223– 1229 (2009). 81. de Albuquerque, A. et al. Prognostic and predictive value of circulating tumor cell analysis in colorectal cancer patients. Journal of Translational Medicine 10, 1–1 (2012). 82. Schwarzenbach, H., Hoon, D. S. B. & Pantel, K. Cell-free nucleic acids as biomarkers in cancer patients. Nat Rev Cancer 11, 426–437 (2011). 83. Pantel, K. & Alix-Panabieres, C. Real-time Liquid Biopsy in Cancer Patients: Fact or Fiction? Cancer Research 21, 6384-8 (2013). 84. Núñez, H., Uña, E., Herreros, J., Abril, C. & Romero, A. in The Challenge of Colorectal Cancer: A Review Book (Cidón, E. U.) 1–27 (Research Signpost, 2011). 85. Carrato, A. Adjuvant treatment of colorectal cancer. Gastrointest Cancer Res 2, S42–6 (2008). 86. Wolmark, N. et al. The benefit of leucovorinmodulated fluorouracil as postoperative adjuvant therapy for primary colon cancer: results from National Surgical Adjuvant Breast and Bowel Project protocol C-03. J. Clin. Oncol. 11, 1879– 1887 (1993). 87. Jacobi, N. & Gieseler, F. Adjuvant and neoadjuvant therapy in colorectal cancer. Eur Surg 42, 283–286 (2010). 88. Hoff, P. M. et al. Comparison of oral capecitabine versus intravenous fluorouracil plus leucovorin as first-line treatment in 605 patients with metastatic colorectal cancer: results of a randomized phase III study. J. Clin. Oncol. 19, 2282–2292 (2001). 89. García-Teijido, P., Sampedro-Gimeno, T. & BlayAlbors, P. in The Challenge of Colorectal Cancer: A Review Book (Cidón, E. U.) 1–17 (Research Signpost, 2011). 90. Cunningham, D. et al. Randomised trial of irinotecan plus supportive care versus supportive care alone after fluorouracil failure for patients with metastatic colorectal cancer. The lancet 352, 1413–1418 (1998). 91. Bécouarn, Y. et al. Phase II trial of oxaliplatin as first-line chemotherapy in metastatic colorectal cancer patients. Digestive Group of French Federation of Cancer Centers. J. Clin. Oncol. 16, 2739–2744 (1998). 92. Arkenau, H.-T. et al. Efficacy of oxaliplatin plus capecitabine or infusional fluorouracil/leucovorin in patients with metastatic colorectal cancer: a pooled analysis of randomized trials. Journal of Clinical Oncology 26, 5910–5917 (2008). 93. Folprecht, G. et al. Irinotecan/fluorouracil combination in first-line therapy of older and younger patients with metastatic colorectal cancer: combined analysis of 2,691 patients in randomized controlled trials. Journal of Clinical Oncology 26, 1443–1451 (2008). 94. Oken, M. M. et al. Toxicity and response criteria of the Eastern Cooperative Oncology Group. Am. J. Clin. Oncol. 5, 649–655 (1982). 95. Heinemann, V., Douillard, J. Y., Ducreux, M. & Peeters, M. Targeted therapy in metastatic colorectal cancer – An example of personalised medicine in action. Cancer Treatment Reviews 39, 592–601 (2013). 96. Hurwitz, H. et al. Bevacizumab plus irinotecan, fluorouracil, and leucovorin for metastatic colorectal cancer. New England Journal of Medicine 350, 2335–2342 (2004). 97. Saltz, L. B. et al. Bevacizumab in combination with oxaliplatin-based chemotherapy as firstline therapy in metastatic colorectal cancer: a randomized phase III study. Journal of Clinical Oncology 26, 2013–2019 (2008). 98. Welch, S., Spithoff, K., Rumble, R. B., Maroun, J.Gastrointestinal Cancer Disease Site Group. Bevacizumab combined with chemotherapy for patients with advanced colorectal cancer: a systematic review. Annals of Oncology 21, 1152–1162 (2010). 99. Longo, R. & Gasparini, G. Challenges for patient selection with VEGF inhibitors. Cancer Chemother. Pharmacol. 60, 151–170 (2007). 100. Messa, C., Russo, F., Caruso, M. G. & Di Leo, A. EGF, TGF-alpha, and EGF-R in human colorectal adenocarcinoma. Acta Oncol 37, 285–289 (1998). 101. Van Cutsem, E. et al. Cetuximab and chemotherapy as initial treatment for metastatic colorectal cancer. New England Journal of Medicine 360, 1408–1417 (2009). 102. Douillard, J.-Y. et al. Panitumumab–FOLFOX4 Treatment and RASMutations in Colorectal Cancer. New England Journal of Medicine 369, 1023–1034 (2013). 103. Lièvre, A. et al. KRAS mutation status is predictive of response to cetuximab therapy in colorectal cancer. Cancer Research 66, 3992– 3995 (2006). 104. Amado, R. G. et al. Wild-type KRAS is required 127 References for panitumumab efficacy in patients with metastatic colorectal cancer. Journal of Clinical Oncology 26, 1626–1634 (2008). 105. Karapetis, C. S. et al. K-ras mutations and benefit from cetuximab in advanced colorectal cancer. New England Journal of Medicine 359, 1757–1765 (2008). 106. Karnoub, A. E. & Weinberg, R. A. Ras oncogenes: split personalities. Nat Rev Mol Cell Biol 9, 517–531 (2008). 107. Winder, T. & Lenz, H.-J. Molecular predictive and prognostic markers in colon cancer. Cancer Treatment Reviews 36, 550–556 (2010). 108. Sastre, J. et al. Circulating Tumor Cell Count Is a Prognostic Factor in Metastatic Colorectal Cancer Patients Receiving FirstLine Chemotherapy Plus Bevacizumab: A Spanish Cooperative Group for the Treatment of Digestive Tumors Study. The Oncologist 17, 947–955 (2012). 109. Matsusaka, S. et al. Circulating tumor cells as a surrogate marker for determining response to chemotherapy in Japanese patients with metastatic colorectal cancer. Cancer Science 102, 1188–1192 (2011). 110. Lu, C. Y. et al. Circulating tumor cells as a surrogate marker for determining clinical outcome to mFOLFOX chemotherapy in patients with stage III colon cancer. Br J Cancer 108, 791–797 (2013). 111. Neki, K. et al. Usefulness of circulating tumor cells after preliminary chemotherapy for prediction of response to further anticancer therapy in patients with initially unresectable metastatic colorectal cancer. Anticancer research 33, 1769–1772 (2013). 112. Kawahara, H. et al. Determination of circulating tumor cells for prediction of recurrent colorectal cancer progression. Hepatogastroenterology 59, 2115–2118 (2012). 113. Lankiewicz, S., Zimmermann, S., Hollmann, C., Hillemann, T. & Greten, T. F. Circulating tumour cells as a predictive factor for response to systemic chemotherapy in patients with advanced colorectal cancer. Molecular Oncology 2, 349–355 (2008). 114. Lim, S. H. et al. Circulating tumour cells and circulating free nucleic acid as prognostic and predictive biomarkers in colorectal cancer. Cancer Letters 346, 24–33 (2014). 115. Gupta, G. P. & Massagué, J. Cancer Metastasis: Building a Framework. Cell 127, 679–695 (2006). 116. Valastyan, S. & Weinberg, R. A. Tumor Metastasis: Molecular Insights and Evolving Paradigms. Cell 147, 275–292 (2011). 117. Pantel, K. & Brakenhoff, R. H. Dissecting the metastatic cascade. Nat Rev Cancer 4, 448–456 (2004). 118. Rowe, R. G. & Weiss, S. J. Breaching the basement membrane: who, when and how? Trends in Cell Biology 18, 560–574 (2008). 119. Bissell, M. J. & Hines, W. C. Why don’t we get more cancer? A proposed role of the microenvironment in restraining cancer progression. Nat Med 17, 320–329 (2011). 120. Reymond, N., d’Água, B. B. & Ridley, A. J. Crossing the endothelial barrier during metastasis. Nat Rev Cancer 13, 858–870 (2013). 121. Yilmaz, M., Christofori, G. & Lehembre, F. Distinct mechanisms of tumor invasion and metastasis. Trends in Molecular Medicine 13, 535–541 (2007). 122. Friedl, P., Locker, J., Sahai, E. & Segall, J. E. Classifying collective cancer cell invasion. Nature Cell Biology 14, 777–783 (2012). 123. Nabeshima, K. et al. Front-cell-specific expression of membrane-type 1 matrix metalloproteinase and gelatinase A during cohort migration of colon carcinoma cells induced by hepatocyte growth factor/scatter factor. Cancer Research 60, 3364–3369 (2000). 124. Friedl, P. & Wolf, K. Tumour-cell invasion and migration: diversity and escape mechanisms. Nat Rev Cancer 3, 362–374 (2003). 125. Ridley, A. J. et al. Cell migration: integrating signals from front to back. Science 302, 1704– 1709 (2003). 126. Sanz-Moreno, V. & Marshall, C. J. The plasticity of cytoskeletal dynamics underlying neoplastic cell migration. Current Opinion in Cell Biology 22, 690–696 (2010). 127. Yilmaz, M. & Christofori, G. Mechanisms of Motility in Metastasizing Cells. Molecular Cancer Research 8, 629–642 (2010). 128. Roussos, E. T., Condeelis, J. S. & Patsialou, A. Chemotaxis in cancer. Nat Rev Cancer 11, 573– 587 (2011). 129. Roussos, E. T. et al. Mena invasive (MenaINV) promotes multicellular streaming motility and transendothelial migration in a mouse model 128 of breast cancer. Journal of Cell Science 124, 2120–2131 (2011). 130. Joyce, J. A. & Pollard, J. W. Microenvironmental regulation of metastasis. Nat Rev Cancer 9, 239–252 (2009). 131. Martin, M., Pujuguet, P. & Martin, F. Role of stromal myofibroblasts infiltrating colon cancer in tumor invasion. Pathol. Res. Pract. 192, 712– 717 (1996). 132. Levental, K. R. et al. Matrix crosslinking forces tumor progression by enhancing integrin signaling. Cell 139, 891–906 (2009). 133. Wan, L., Pantel, K. & Kang, Y. Tumor metastasis: moving new biological insights into the clinic. Nat Med 19, 1450–1464 (2013). 134. Hanahan, D. & Weinberg, R. A. Hallmarks of Cancer: The Next Generation. Cell 144, 646– 674 (2011). 135. Carmeliet, P. & Jain, R. K. Principles and mechanisms of vessel normalization for cancer and other angiogenic diseases. Nat Rev Drug Discov 10, 417–427 (2011). 136. Sonoshita, M. et al. Suppression of Colon Cancer Metastasis by Aes through Inhibition of Notch Signaling. Cancer Cell 19, 125–137 (2011). 137. Guo, W. & Giancotti, F. G. Integrin signalling during tumour progression. Nat Rev Mol Cell Biol 5, 816–826 (2004). 138. Geiger, T. R. & Peeper, D. S. Metastasis mechanisms. BBA - Reviews on Cancer 1796, 293–308 (2009). 139. Douma, S. et al. Suppression of anoikis and induction of metastasis by the neurotrophic receptor TrkB. Nature 430, 1034–1039 (2004). 140. Sakamoto, S., McCann, R. O., Dhir, R. & Kyprianou, N. Talin1 Promotes Tumor Invasion and Metastasis via Focal Adhesion Signaling and Anoikis Resistance. Cancer Research 70, 1885–1895 (2010). 141. Fidler, I. J. The pathogenesis of cancer metastasis: the ‘seed and soil’ hypothesis revisited. Nat. Rev. Cancer 3, 453–458 (2003). 142. Denève, E. et al. Capture of viable circulating tumor cells in the liver of colorectal cancer patients. Clinical Chemistry 59, 1384–1392 (2013). 143. Nguyen, D. X., Bos, P. D. & Massagué, J. Metastasis: from dissemination to organ-specific colonization. Nat Rev Cancer 9, 274–284 (2009). 144. Auguste, P. et al. The host inflammatory response promotes liver metastasis by increasing tumor cell arrest and extravasation. Am. J. Pathol. 170, 1781–1792 (2007). 145. Psaila, B. & Lyden, D. The metastatic niche: adapting the foreign soil. Nat Rev Cancer 9, 285–293 (2009). 146. Peinado, H., Lavotshkin, S. & Lyden, D. The secreted factors responsible for pre-metastatic niche formation: old sayings and new thoughts. Seminars in Cancer Biology 21, 139–146 (2011). 147. Peinado, H. et al. Melanoma exosomes educate bone marrow progenitor cells toward a prometastatic phenotype through MET. Nat Med 18, 883–891 (2012). 148. Oskarsson, T. et al. Breast cancer cells produce tenascin C as a metastatic niche component to colonize the lungs. Nat Med 17, 867–874 (2011). 149. Al-Mehdi, A. B. et al. Intravascular origin of metastasis from the proliferation of endotheliumattached tumor cells: a new model for metastasis. Nat Med 6, 100–102 (2000). 150. Madsen, C. D. & Sahai, E. Cancer DisseminationLessons from Leukocytes. Dev. Cell 19, 13–26 (2010). 151. Gout, S., Tremblay, P.-L. & Huot, J. Selectins and selectin ligands in extravasation of cancer cells and organ selectivity of metastasis. Clin Exp Metastasis 25, 335–344 (2008). 152. Bendas, G. & Borsig, L. Cancer cell adhesion and metastasis: selectins, integrins, and the inhibitory potential of heparins. International Journal of Cell Biology 2012, 676-731 (2012). 153. Yu, L.-G. et al. Galectin-3 interaction with Thomsen-Friedenreich disaccharide on cancerassociated MUC1 causes increased cancer cell endothelial adhesion. J. Biol. Chem. 282, 773– 781 (2007). 154. Rahn, J. J. et al. MUC1 mediates transendothelial migration in vitro by ligating endothelial cell ICAM-1. Clin Exp Metastasis 22, 475–483 (2005). 155. Ratliff, T. L. CD44 potentiates the adherence of metastatic prostate and breast cancer cells to bone marrow endothelial cells. J. Urol. 173, 1045 (2005). 156. Wolf, M. J. et al. Endothelial CCR2 signaling induced by colon carcinoma cells enables extravasation via the JAK2-Stat5 and p38MAPK pathway. Cancer Cell 22, 91–105 (2012). 157. Luzzi, K. J. et al. Multistep nature of metastatic inefficiency: dormancy of solitary cells after 129 References successful extravasation and limited survival of early micrometastases. Am. J. Pathol. 153, 865– 873 (1998). 158. Erler, J. T. et al. Hypoxia-induced lysyl oxidase is a critical mediator of bone marrow cell recruitment to form the premetastatic niche. Cancer Cell 15, 35–44 (2009). 159. Chambers, A. F., Groom, A. C. & MacDonald, I. C. Dissemination and growth of cancer cells in metastatic sites. Nat Rev Cancer 2, 563–572 (2002). 160. Clevers, H. The cancer stem cell: premises, promises and challenges. Nat Med 17, 313–319 (2011). 161. Thiery, J. P., Acloque, H., Huang, R. Y. J. & Nieto, M. A. Epithelial-mesenchymal transitions in development and disease. Cell 139, 871–890 (2009). 162. Nagrath, S. et al. Isolation of rare circulating tumour cells in cancer patients by microchip technology. Nature 450, 1235–1239 (2007). 163. Braun, S. et al. A pooled analysis of bone marrow micrometastasis in breast cancer. New England Journal of Medicine 353, 793–802 (2005). 164. Kang, Y. & Pantel, K. Tumor Cell Dissemination: Emerging Biological Insights from Animal Models and Cancer Patients. Cancer Cell 23, 573–581 (2013). 165. Aguirre-Ghiso, J. A. Models, mechanisms and clinical evidence for cancer dormancy. Nat Rev Cancer 7, 834–846 (2007). 166. Jones, S. et al. Comparative lesion sequencing provides insights into tumor evolution. Proc. Natl. Acad. Sci. U.S.A. 105, 4283–4288 (2008). 167. Radisky, D. C. Epithelial-mesenchymal transition. Journal of Cell Science 118, 4325– 4326 (2005). 168. Ashworth, T. R. A case of cancer in which cells similar to those in the tumours were seen in the blood after death. Aust Med J 146–149 (1869). 169. Kim, M.-Y. et al. Tumor self-seeding by circulating cancer cells. Cell 139, 1315–1326 (2009). 170. Hoon, D. S. B. et al. Molecular mechanisms of metastasis. J. Surg. Oncol. 103, 508–517 (2011). 171. Krebs, M. G. et al. Molecular analysis of circulating tumour cells—biology and biomarkers. Nature Reviews Clinical Oncology 11, 129-144 (2014). 172. Baccelli, I. et al. Identification of a population of blood circulating tumor cells from breast cancer patients that initiates metastasis in a xenograft assay. Nature Biotechnology 31, 539-544 (2013). 173. Allard, W. J., Matera, J., Miller, M. C. & Repollet, M. Tumor cells circulate in the peripheral blood of all major carcinomas but not in healthy subjects or patients with nonmalignant diseases. Clinical Cancer Research. 15, 6897-904 (2004). 174. Friedlander, T. W., Premasekharan, G. & Paris, P. L. Looking back, to the future of circulating tumor cells. Pharmacology and Therapeutics 142, 271-280 (2013). 175. Riethdorf, S. et al. Detection of circulating tumor cells in peripheral blood of patients with metastatic breast cancer: a validation study of the CellSearch system. Clin. Cancer Res. 13, 920–928 (2007). 176. Königsberg, R. et al. Circulating tumor cells in metastatic colorectal cancer: Efficacy and feasibility of different enrichment methods. Cancer Letters 293, 117-123 (2010). 177. Cohen, S. J. et al. Isolation and Characterization of Circulating Tumor Cells in Patients with Metastatic Colorectal Cancer. Clinical Colorectal Cancer 6, 125–132 (2011). 178. Saucedo-Zeni, N. et al. A novel method for the in vivo isolation of circulating tumor cells from peripheral blood of cancer patients using a functionalized and structured medical wire. Int. J. Oncol. 41, 1241–1250 (2012). 179. Fischer, J. C. et al. Diagnostic leukapheresis enables reliable detection of circulating tumor cells of nonmetastatic cancer patients. Proc. Natl. Acad. Sci. U.S.A. 110, 16580-85 (2013). 180. Navin, N. et al. Tumour evolution inferred by single-cell sequencing. Nature 472, 90–94 (2011). 181. Campbell, P. J. et al. The patterns and dynamics of genomic instability in metastatic pancreatic cancer. Nature 467, 1109–1113 (2010). 182. Christiansen, J. J. & Rajasekaran, A. K. Reassessing epithelial to mesenchymal transition as a prerequisite for carcinoma invasion and metastasis. Cancer Research. 66, 8319-26 (2006). 183. Vona, G. et al. Isolation by size of epithelial tumor cells : a new method for the immunomorphological and molecular characterization of circulatingtumor cells. Am. J. Pathol. 156, 57–63 (2000). 184. Desitter, I. et al. A new device for rapid isolation 130 by size and characterization of rare circulating tumor cells. Anticancer research 31, 427–441 (2011). 185. Hou, H. W. H. et al. Isolation and retrieval of circulating tumor cells using centrifugal forces. Sci Rep 3, 1259–1259 (2012). 186. Gascoyne, P. R. C., Noshari, J., Anderson, T. J. & Becker, F. F. Isolation of rare cells from cell mixtures by dielectrophoresis. Electrophoresis 30, 1388–1398 (2009). 187. Talasaz, A. H. et al. Isolating highly enriched populations of circulating epithelial cells and other rare cells from blood using a magnetic sweeper device. Proc. Natl. Acad. Sci. U.S.A. 106, 3970–3975 (2009). 188. Ozkumur, E. et al. Inertial focusing for tumor antigen-dependent and -independent sorting of rare circulating tumor cells. Sci Transl Med 5, 179ra47 (2013). 189. Stott, S. L. et al. Isolation of circulating tumor cells using a microvortex-generating herringbone-chip. Proc. Natl. Acad. Sci. U.S.A. 107, 18392–18397 (2010). 190. Saliba, A.-E. et al. Microfluidic sorting and multimodal typing of cancer cells in selfassembled magnetic arrays. Proc. Natl. Acad. Sci. U.S.A. 107, 14524–14529 (2010). 191. Zieglschmid, V. et al. Combination of immunomagnetic enrichment with multiplex RTPCR analysis for the detection of disseminated tumor cells. Anticancer research 25, 1803–1810 (2005). 192. Müller, V. et al. Prognostic impact of circulating tumor cells assessed with the CellSearch System™ and AdnaTest Breast™ in metastatic breast cancer patients: the DETECT study. Breast Cancer Res 14, R118 (2012). 193. Harb, W. et al. Mutational Analysis of Circulating Tumor Cells Using a Novel Microfluidic Collection Device and qPCR Assay. Transl Oncol 6, 528– 538 (2013). 194. Alix-Panabières, C. EPISPOT assay: detection of viable DTCs/CTCs in solid tumor patients. Recent Results Cancer Res. 195, 69–76 (2012). 195. Lu, J. et al. Isolation of circulating epithelial and tumor progenitor cells with an invasive phenotype from breast cancer patients. Int. J. Cancer 126, 669–683 196. Fan, T., Zhao, Q., Chen, J. J., Chen, W.-T. & Pearl, M. L. Clinical significance of circulating tumor cells detected by an invasion assay in peripheral blood of patients with ovarian cancer. Gynecologic Oncology 112, 185–191 (2009). 197. López-Riquelme, N. et al. Imaging cytometry for counting circulating tumor cells: comparative analysis of the CellSearch vs ImageStream systems. APMIS (2013). doi:10.1111/apm.12061 198. Wendel, M. et al. Fluid biopsy for circulating tumor cell identification in patients with early-and late-stage non-small cell lung cancer: a glimpse into lung cancer biology. Phys Biol 9, 016005 (2012). 199. Cristofanilli, M. Circulating Tumor Cells: A Novel Prognostic Factor for Newly Diagnosed Metastatic Breast Cancer. Journal of Clinical Oncology 23, 1420–1430 (2005). 200. de Bono, J. S. et al. Circulating tumor cells predict survival benefit from treatment in metastatic castration-resistant prostate cancer. Clin. Cancer Res. 14, 6302–6309 (2008). 201. Cristofanilli, M. et al. Circulating tumor cells, disease progression, and survival in metastatic breast cancer. New England Journal of Medicine 351, 781–791 (2004). 202. Scher, H. I. et al. Circulating tumour cells as prognostic markers in progressive, castrationresistant prostate cancer: a reanalysis of IMMC38 trial data. The Lancet Oncology 10, 233–239 (2009). 203. Krebs, M. G. et al. Evaluation and Prognostic Significance of Circulating Tumor Cells in Patients With Non-Small-Cell Lung Cancer. Journal of Clinical Oncology 29, 1556–1563 (2011). 204. Pierga, J.-Y. et al. Circulating tumor cell detection predicts early metastatic relapse after neoadjuvant chemotherapy in large operable and locally advanced breast cancer in a phase II randomized trial. Clin. Cancer Res. 14, 7004– 7010 (2008). 205. Thorsteinsson, M., Söletormos, G. & Jess, P. Low number of detectable circulating tumor cells in non-metastatic colon cancer. Anticancer research 31, 613–617 (2011). 206. Bidard, F. et al. Clinical validity of circulating tumour cells in patients with metastatic breast cancer: a pooled analysis of individual patient data. Lancet Oncology. 15, 406-4014 (2014). 207. Mostert, B. et al. KRASand BRAFmutation status in circulating colorectal tumor cells and their correlation with primary and metastatic tumor tissue. Int. J. Cancer 133, 130–141 (2013). 131 References 208. Maheswaran, S. et al. Detection of mutations in EGFR in circulating lung-cancer cells. New England Journal of Medicine 359, 366–377 (2008). 209. Pailler, E., Adam, J., Barthélémy, A. & Oulhen, M. Detection of circulating tumor cells harboring a unique ALK rearrangement in ALK-positive non–small-cell lung cancer. Journal of Clinical Oncology 18, 2273-81 (2013). 210. Ilie, M. et al. ALK-gene rearrangement: a comparative analysis on circulating tumour cells and tumour tissue from patients with lung adenocarcinoma. Annals of Oncology 23, 2907– 2913 (2012). 211. Smirnov, D. A. et al. Global gene expression profiling of circulating tumor cells. Cancer Research 65, 4993–4997 (2005). 212. Sieuwerts, A. M. et al. mRNA and microRNA expression profiles in circulating tumor cells and primary tumors of metastatic breast cancer patients. Clin. Cancer Res. 17, 3600–3618 (2011). 213. Barbazan, J. et al. Molecular Characterization of Circulating Tumor Cells in Human Metastatic Colorectal Cancer. PLoS ONE 7, e40476 (2012). 214. Ramsköld, D. et al. Full-length mRNA-Seq from single-cell levels of RNA and individual circulating tumor cells. Nature Biotechnology 30, 777–782 (2012). 215. Cann, G. M. et al. mRNA-Seq of single prostate cancer circulating tumor cells reveals recapitulation of gene expression and pathways found in prostate cancer. PLoS ONE (2012). 216. Heitzer, E. et al. Complex Tumor Genomes Inferred from Single Circulating Tumor Cells by Array-CGH and Next-Generation Sequencing. Cancer Research 73, 2965–2975 (2013). 217. DeMali, K. A., Wennerberg, K. & Burridge, K. Integrin signaling to the actin cytoskeleton. Current Opinion in Cell Biology 15, 572–582 (2003). 218. Hehlgans, S., Haase, M. & Cordes, N. Signalling via integrins: implications for cell survival and anticancer strategies. Biochim. Biophys. Acta 1775, 163–180 (2007). 219. Critchley, D. R. & Gingras, A. R. Talin at a glance. Journal of Cell Science 121, 1345–1347 (2008). 220. Burn, P., Kupfer, A. & Singer, S. J. Dynamic membrane-cytoskeletal interactions: specific association of integrin and talin arises in vivo after phorbol ester treatment of peripheral blood lymphocytes. Proc. Natl. Acad. Sci. U.S.A. 85, 497–501 (1988). 221. Knezevic, I., Leisner, T. M. & Lam, S. C. Direct binding of the platelet integrin alphaIIbbeta3 (GPIIb-IIIa) to talin. Evidence that interaction is mediated through the cytoplasmic domains of both alphaIIb and beta3. J. Biol. Chem. 271, 16416–16421 (1996). 222. Legate, K. R. & Fässler, R. Mechanisms that regulate adaptor binding to beta-integrin cytoplasmic tails. Journal of Cell Science 122, 187–198 (2009). 223. Kelly, D. F. & Taylor, K. A. Identification of the beta1-integrin binding site on alpha-actinin by cryoelectron microscopy. J. Struct. Biol. 149, 290–302 (2005). 224. Otey, C. A. & Carpen, O. Alpha-actinin revisited: a fresh look at an old player. Cell Motil. Cytoskeleton 58, 104–111 (2004). 225. Anthis, N. J. & Campbell, I. D. The tail of integrin activation. Trends Biochem. Sci. 36, 191–198 (2011). 226. Kaufmann, S., Käs, J., Goldmann, W. H., Sackmann, E. & Isenberg, G. Talin anchors and nucleates actin filaments at lipid membranes. A direct demonstration. FEBS Lett. 314, 203–205 (1992). 227. Das, M., Ithychanda, S. S., Qin, J. & Plow, E. F. Mechanisms of talin-dependent integrin signaling and crosstalk. BBA - Biomembranes. 1838, 579-588 (2013). 228. Burridge, K. & Connell, L. A new protein of adhesion plaques and ruffling membranes. J Cell Biol 97, 359–367 (1983). 229. Burridge, K. & Connell, L. Talin: a cytoskeletal component concentrated in adhesion plaques and other sites of actin-membrane interaction. Cell Motil. 3, 405–417 (1983). 230. Monkley, S. J. et al. Disruption of the talin gene arrests mouse development at the gastrulation stage. Dev. Dyn. 219, 560–574 (2000). 231. Liu, J. et al. Talin1 Regulates Integrin Turnover To Promote Embryonic Epithelial Morphogenesis. Molecular and Cellular Biology 31, 3366–3377 (2011). 232. Manso, A. M. et al. Talin1 has unique expression versus talin 2 in the heart and modifies the hypertrophic response to pressure overload. Journal of Biological Chemistry 288, 4252–4264 (2013). 132 233. Conti, F. J., Monkley, S. J., Wood, M. R., Critchley, D. R. & Müller, U. Talin 1 and 2 are required for myoblast fusion, sarcomere assembly and the maintenance of myotendinous junctions. Development 136, 3597–3606 (2009). 234. Chishti, A. H. et al. The FERM domain: a unique module involved in the linkage of cytoplasmic proteins to the membrane. Trends Biochem. Sci. 23, 281–282 (1998). 235. Gingras, A. R. et al. Mapping and consensus sequence identification for multiple vinculin binding sites within the talin rod. J. Biol. Chem. 280, 37217–37224 (2005). 236. Lee, H.-S., Lim, C. J., Puzon-McLaughlin, W., Shattil, S. J. & Ginsberg, M. H. RIAM activates integrins by linking talin to ras GTPase membrane-targeting sequences. J. Biol. Chem. 284, 5119–5127 (2009). 237. Tremuth, L. et al. A fluorescence cell biology approach to map the second integrin-binding site of talin to a 130-amino acid sequence within the rod domain. J. Biol. Chem. 279, 22258–22266 (2004). 238. Hemmings, L. et al. Talin contains three actinbinding sites each of which is adjacent to a vinculin-binding site. Journal of Cell Science 109 ( Pt 11), 2715–2726 (1996). 239. Bertagnolli, M. E., Locke, S. J., Hensler, M. E., Bray, P. F. & Beckerle, M. C. Talin distribution and phosphorylation in thrombin-activated platelets. Journal of Cell Science 106 ( Pt 4), 1189–1199 (1993). 240. Han, J. et al. Reconstructing and deconstructing agonist-induced activation of integrin alphaIIbbeta3. Curr. Biol. 16, 1796–1806 (2006). 241. Legate, K. R. et al. Integrin adhesion and force coupling are independently regulated by localized PtdIns(4,5)2 synthesis. EMBO J. 30, 4539–4553 (2011). 242. Franco, S. J. et al. Calpain-mediated proteolysis of talin regulates adhesion dynamics. Nature Cell Biology 6, 977–983 (2004). 243. Moser, M., Legate, K. R., Zent, R. & Fässler, R. The tail of integrins, talin, and kindlins. Science 324, 895–899 (2009). 244. Frame, M. & Norman, J. A tal(in) of cell spreading. Nature Cell Biology 10, 1017–1019 (2008). 245. Ginsberg, M. H., Partridge, A. & Shattil, S. J. Integrin regulation. Current Opinion in Cell Biology 17, 509–516 (2005). 246. Harburger, D. S. & Calderwood, D. A. Integrin signalling at a glance. Journal of Cell Science 122, 1472–1472 (2009). 247. Jemal, A. et al. Cancer Statistics, 2009. CA: A Cancer Journal for Clinicians 59, 225–249 (2009). 248. Negin, B. P. & Cohen, S. J. Circulating Tumor Cells in Colorectal Cancer: Past, Present, and Future Challenges. Curr. Treat. Options in Oncol. 11, 1–13 (2010). 249. Garrigós, N. et al. Circulating tumour cell analysis as an early marker for relapse in stage II and III colorectal cancer patients: a pilot study. Clin Transl Oncol 12, 142–147 (2010). 250. Allen, J. E. & El-Deiry, W. S. Circulating Tumor Cells and Colorectal Cancer. Curr Colorectal Cancer Rep 6, 212–220 (2010). 251. Eisenhauer, E. A. et al. New response evaluation criteria in solid tumours: Revised RECIST guideline (version 1.1). European Journal of Cancer 45, 228–247 (2009). 252. Wong, S. C. C. et al. Clinical Significance of Cytokeratin 20-Positive Circulating Tumor Cells Detected by a Refined Immunomagnetic Enrichment Assay in Colorectal Cancer Patients. Clinical Cancer Research 15, 1005–1012 (2009). 253. Rigau, M. et al. PSGR and PCA3 as biomarkers for the detection of prostate cancer in urine. Prostate 70, 1760–1767 (2010). 254. Sieuwerts, A. M. et al. Molecular characterization of circulating tumor cells in large quantities of contaminating leukocytes by a multiplex realtime PCR. Breast Cancer Res Treat 118, 455– 468 (2008). 255. Pantel, K. & Alix-Panabières, C. Circulating tumour cells in cancer patients: challenges and perspectives. Trends in Molecular Medicine 16, 398–406 (2010). 256. Lin, H., Balic, M., Zheng, S., Datar, R. & Cote, R. J. Disseminated and circulating tumor cells: Role in effective cancer management. Critical Reviews in Oncology / Hematology 77, 1–11 (2011). 257. Munz, M., Baeuerle, P. A. & Gires, O. The emerging role of EpCAM in cancer and stem cell signaling. Cancer Research 69, 5627–5629 (2009). 258. Horst, D., Kriegl, L., Engel, J., Kirchner, T. & Jung, A. CD133 expression is an independent prognostic marker for low survival in colorectal cancer. Br J Cancer 99, 1285–1289 (2008). 133 References 259. Herrmann, I. et al. Highly efficient elimination of colorectal tumor-initiating cells by an EpCAM/ CD3-bispecific antibody engaging human T cells. PLoS ONE 5, e13474 (2010). 260. Dandachi, N. et al. Critical evaluation of real-time reverse transcriptase-polymerase chain reaction for the quantitative detection of cytokeratin 20 mRNA in colorectal cancer patients. The Journal of Molecular Diagnostics 7, 631–637 (2005). 261. Maestro, L. M. et al. Circulating tumor cells in solid tumor in metastatic and localized stages. Anticancer research 29, 4839–4843 (2009). 262. Rahbari, N. N. et al. Meta-analysis Shows That Detection of Circulating Tumor Cells Indicates Poor Prognosis in Patients With Colorectal Cancer. YGAST 138, 1714–1726.e13 (2010). 263. Wang, J.-Y. et al. Multiple molecular markers as predictors of colorectal cancer in patients with normal perioperative serum carcinoembryonic antigen levels. Clin. Cancer Res. 13, 2406–2413 (2007). 264. Gazzaniga, P. et al. Chemosensitivity profile assay of circulating cancer cells: prognostic and predictive value in epithelial tumors. Int. J. Cancer 126, 2437–2447 (2010). 265. Gazzaniga, P. et al. Molecular markers in circulating tumour cells from metastatic colorectal cancer patients. J. Cell. Mol. Med. 14, 2073–2077 (2010). 266. Tol, J. et al. Circulating tumour cells early predict progression-free and overall survival in advanced colorectal cancer patients treated with chemotherapy and targeted agents. Annals of Oncology 21, 1006–1012 (2010). 267. Jemal, A. et al. Global cancer statistics. CA: A Cancer Journal for Clinicians 61, 69–90 (2011). 268. Bretthauer, M. Evidence for colorectal cancer screening. Best Pract Res Clin Gastroenterol 24, 417–425 (2010). 269. Oppenheimer, S. B. Cellular basis of cancer metastasis: A review of fundamentals and new advances. Acta Histochemica 108, 327–334 (2006). 270. Yang, M.-J. et al. Enhancing detection of circulating tumor cells with activating KRAS oncogene in patients with colorectal cancer by weighted chemiluminescent membrane array method. Ann Surg Oncol 17, 624–633 (2010). 271. Cristofanilli, M. The biological information obtainable from circulating tumor cells. Breast 18 Suppl 3, S38–40 (2009). 272. Riethdorf, S. & Pantel, K. Advancing personalized cancer therapy by detection and characterization of circulating carcinoma cells. Ann. N. Y. Acad. Sci. 1210, 66–77 (2010). 273. Barbazan, J. et al. A logistic model for the detection of circulating tumour cells in human metastatic colorectal cancer. J. Cell. Mol. Med. 16, 2342–2349 (2012). 274. Gonzalez-Roca, E. et al. Accurate expression profiling of very small cell populations. PLoS ONE 5, e14418 (2010). 275. Bonnomet, A. et al. Epithelial-to-mesenchymal transitions and circulating tumor cells. J Mammary Gland Biol Neoplasia 15, 261–273 (2010). 276. Yeh, C.-S. et al. Molecular detection of circulating cancer cells in the peripheral blood of patients with colorectal cancer by using membrane array with a multiple mRNA marker panel. Int. J. Oncol. 28, 411–420 (2006). 277. Mierke, C. T. The role of vinculin in the regulation of the mechanical properties of cells. Cell Biochem. Biophys. 53, 115–126 (2009). 278. Ye, L., Mason, M. D. & Jiang, W. G. Bone morphogenetic protein and bone metastasis, implication and therapeutic potential. Front. Biosci. 16, 865–897 (2011). 279. Powner, D., Kopp, P. M., Monkley, S. J., Critchley, D. R. & Berditchevski, F. Tetraspanin CD9 in cell migration. Biochem. Soc. Trans. 39, 563–567 (2011). 280. Dougherty, G. W., Jose, C., Gimona, M. & Cutler, M. L. The Rsu-1-PINCH1-ILK complex is regulated by Ras activation in tumor cells. European Journal of Cell Biology 87, 721–734 (2008). 281. Mazzarelli, P., Pucci, S. & Spagnoli, L. G. CLU and colon cancer. The dual face of CLU: from normal to malignant phenotype. Adv. Cancer Res. 105, 45–61 (2009). 282. Ricca, T. I. et al. Tissue inhibitor of metalloproteinase 1 expression associated with gene demethylation confers anoikis resistance in early phases of melanocyte malignant transformation. Transl Oncol 2, 329–340 (2009). 283. Oka, M. et al. CD9 is associated with leukemia inhibitory factor-mediated maintenance of embryonic stem cells. Molecular Biology of the Cell 13, 1274–1281 (2002). 284. Lin, A. Y. et al. Comparative profiling of primary colorectal carcinomas and liver metastases 134 identifies LEF1 as a prognostic biomarker. PLoS ONE 6, e16636–e16636 (2010). 285. Schelter, F. et al. Tumor cell-derived Timp-1 is necessary for maintaining metastasis-promoting Met-signaling via inhibition of Adam-10. Clin Exp Metastasis 28, 793–802 (2011). 286. Gertler, R. et al. Detection of circulating tumor cells in blood using an optimized density gradient centrifugation. Recent Results Cancer Res. 162, 149–155 (2003). 287. Gervasoni, A. et al. Molecular signature detection of circulating tumor cells using a panel of selected genes. Cancer Letters 263, 267–279 (2008). 288. Lagoudianakis, E. E. et al. Detection of epithelial cells by RT-PCR targeting CEA, CK20, and TEM-8 in colorectal carcinoma patients using OncoQuick density gradient centrifugation system. J. Surg. Res. 155, 183–190 (2009). 289. Hartkopf, A. D., Wagner, P., Wallwiener, D., fehm, T. & Rothmund, R. Changing levels of circulating tumor cells in monitoring chemotherapy response in patients with metastatic breast cancer. Anticancer research 31, 979–984 (2011). 290. Hayes, D. F. Circulating Tumor Cells at Each Follow-up Time Point during Therapy of Metastatic Breast Cancer Patients Predict Progression-Free and Overall Survival. Clinical Cancer Research 12, 4218–4224 (2006). 291. Lievre, A. et al. KRAS Mutations As an Independent Prognostic Factor in Patients With Advanced Colorectal Cancer Treated With Cetuximab. Journal of Clinical Oncology 26, 374–379 (2008). 292. Aldulaymi, B. et al. High plasma TIMP-1 and serum CEA levels during combination chemotherapy for metastatic colorectal cancer are significantly associated with poor outcome. Oncology 79, 144–149 (2010). 293. Lim, J. & Thiery, J. P. Epithelial-mesenchymal transitions: insights from development. Development 139, 3471–3486 (2012). 294. Bednarz-Knoll, N., Alix-Panabières, C. & Pantel, K. Plasticity of disseminating cancer cells in patients with epithelial malignancies. Cancer Metastasis Rev 31, 673–687 (2012). 295. Fabbri, F. et al. Detection and recovery of circulating colon cancer cells using a dielectrophoresis-based device: KRAS mutation status in pure CTCs. Cancer Letters 335, 225– 231 (2013). 296. Gasch, C. et al. Heterogeneity of Epidermal Growth Factor Receptor Status and Mutations of KRAS/PIK3CA in Circulating Tumor Cells of Patients with Colorectal Cancer. Clinical Chemistry 59, 252–260 (2013). 297. Budd, G. T. et al. Circulating Tumor Cells versus Imaging--Predicting Overall Survival in Metastatic Breast Cancer. Clinical Cancer Research 12, 6403–6409 (2006). 298. Witta, S. E. Restoring E-Cadherin Expression Increases Sensitivity to Epidermal Growth Factor Receptor Inhibitors in Lung Cancer Cell Lines. Cancer Research 66, 944–950 (2006). 299. Larue, L. & Bellacosa, A. Epithelial– mesenchymal transition in development and cancer: role of phosphatidylinositol 3′ kinase/ AKT pathways. Oncogene 24, 7443–7454 (2005). 300. Yang, A. D. Chronic Oxaliplatin Resistance Induces Epithelial-to-Mesenchymal Transition in Colorectal Cancer Cell Lines. Clinical Cancer Research 12, 4147–4153 (2006). 301. Xiong, H. et al. Roles of STAT3 and ZEB1 Proteins in E-cadherin Down-regulation and Human Colorectal Cancer EpithelialMesenchymal Transition. Journal of Biological Chemistry 287, 5819–5832 (2012). 302. Peinado, H. et al. A molecular role for lysyl oxidase-like 2 enzyme in snail regulation and tumor progression. EMBO J. 24, 3446–3458 (2005). 303. Kahlert, C. et al. Overexpression of ZEB2 at the Invasion Front of Colorectal Cancer Is an Independent Prognostic Marker and Regulates Tumor Invasion In Vitro. Clinical Cancer Research 17, 7654–7663 (2011). 304. Comijn, J. et al. The two-handed E box binding zinc finger protein SIP1 downregulates E-cadherin and induces invasion. Mol. Cell 7, 1267–1278 (2001). 305. Thiery, J. P. & Sleeman, J. P. Complex networks orchestrate epithelial–mesenchymal transitions. Nat Rev Mol Cell Biol 7, 131–142 (2006). 306. Fowler, K. J., Linehan, D. C. & Menias, C. O. Colorectal Liver Metastases: State of the Art Imaging. Ann Surg Oncol 20, 1185–1193 (2012). 307. Plaks, V., Koopman, C. D. & Werb, Z. Circulating Tumor Cells. Science 341, 1186–1188 (2013). 308. Alix-Panabières, C. & Pantel, K. Circulating tumor cells: liquid biopsy of cancer. Clinical Chemistry 59, 110–118 (2013). 135 References 309. Tadokoro, S. et al. Talin binding to integrin beta tails: a final common step in integrin activation. Science 302, 103–106 (2003). 310. Kato, H. et al. The Primacy of β1 Integrin Activation in the Metastatic Cascade. PLoS ONE 7, e46576 (2012). 311. Lai, M.-T. et al. Talin-1 overexpression defines high risk for aggressive oral squamous cell carcinoma and promotes cancer metastasis. J. Pathol. 224, 367–376 (2011). 312. Miles, F. L., Pruitt, F. L., Golen, K. L. & Cooper, C. R. Stepping out of the flow: capillary extravasation in cancer metastasis. Clin Exp Metastasis 25, 305–324 (2007). 313. Barthel, S. R. et al. Definition of molecular determinants of prostate cancer cell bone extravasation. Cancer Research 73, 942–952 (2013). 314. Schoumacher, M., Glentis, A., Gurchenkov, V. V. & Vignjevic, D. M. Basement membrane invasion assays: native basement membrane and chemoinvasion assay. Methods Mol. Biol. 1046, 133–144 (2013). 315. Christofori, G. New signals from the invasive front. Nature Cell Biology 441, 444–450 (2006). 316. Tantivejkul, K., Kalikin, L. M. & Pienta, K. J. Dynamic process of prostate cancer metastasis to bone. J. Cell. Biochem. 91, 706–717 (2004). 317. Haidari, M. et al. Integrin 2 1 Mediates Tyrosine Phosphorylation of Vascular Endothelial Cadherin Induced by Invasive Breast Cancer Cells. Journal of Biological Chemistry 287, 32981–32992 (2012). 318. Malik, G. et al. Plasma Fibronectin Promotes Lung Metastasis by Contributions to Fibrin Clots and Tumor Cell Invasion. Cancer Research 70, 4327–4334 (2010). 319. Barnhart, E. L., Lee, K.-C., Keren, K., Mogilner, A. & Theriot, J. A. An Adhesion-Dependent Switch between Mechanisms That Determine Motile Cell Shape. PLoS Biol 9, e1001059 (2011). 320. Kim, D. H. & Wirtz, D. Focal adhesion size uniquely predicts cell migration. The FASEB Journal 27, 1351–1361 (2013). 321. Giannone, G., Mège, R.-M. & Thoumine, O. Multi-level molecular clutches in motile cell processes. Trends in Cell Biology 19, 475–486 (2009). 322. Linder, S. Invadosomes at a glance. Journal of Cell Science 122, 3009–3013 (2009). 323. Tang, H. et al. miR-9 functions as a tumor suppressor in ovarian serous carcinoma by targeting TLN1. Int J Mol Med 32, 381–388 (2013). 324. Singel, S. M. et al. A Targeted RNAi Screen of the Breast Cancer Genome Identifies KIF14 and TLN1 as Genes That Modulate Docetaxel Chemosensitivity in Triple-Negative Breast Cancer. Clinical Cancer Research 19, 2061– 2070 (2013). 325. Phipps, L. E., Hino, S. & Muschel, R. J. Targeting Cell Spreading: A Method of Sensitizing Metastatic Tumor Cells to TRAIL-Induced Apoptosis. Molecular Cancer Research 9, 249– 258 (2011). 326. Millard, M., Odde, S. & Neamati, N. Integrin targeted therapeutics. Theranostics 1, 154–188 (2011). 327. Rahim, S. & Üren, A. A Real-time Electrical Impedance Based Technique to Measure Invasion of Endothelial Cell Monolayer by Cancer Cells. JoVE (2011). doi:10.3791/2792 328. Dancey, J. E., Bedard, P. L., Onetto, N. & Hudson, T. J. The genetic basis for cancer treatment decisions. Cell 148, 409–420 (2012). 329. Dienstmann, R., Rodon, J. & Tabernero, J. Biomarker-driven patient selection for early clinical trials. Curr Opin Oncol 25, 305–312 (2013). 330. Gerlinger, M. et al. Intratumor heterogeneity and branched evolution revealed by multiregion sequencing. New England Journal of Medicine 366, 883–892 (2012). 331. Went, P. et al. Frequent high-level expression of the immunotherapeutic target Ep-CAM in colon, stomach, prostate and lung cancers. Br J Cancer 94, 128–135 (2006). 332. Pringault, E., Robine, S. & Louvard, D. Structure of the human villin gene. Proc. Natl. Acad. Sci. U.S.A. 88, 10811–10815 (1991). 333. Moll, R., Robine, S., Dudouet, B. & Louvard, D. Villin: a cytoskeletal protein and a differentiation marker expressed in some human adenocarcinomas. Virchows Arch., B, Cell Pathol. 54, 155–169 (1987). 334. Veridex, LLC. https://www.cellsearchctc.com/ significance-ctcs#. Data on file. 335. Huang, Y. et al. Membrane transporters and channels: role of the transportome in cancer chemosensitivity and chemoresistance. Cancer Research 64, 4294–4301 (2004). 142 GFP Green Fluorescent Protein GTP Guanosine Triphosphate HCC Hepatocellular Carcinoma HDMB Hexadimethrine Bromide HER2 Human Epidermal Growth Factor Receptor 2 HNPCC Hereditary Nonpolyposis Colorectal Cancer HP Hyperplastic Polyps HR Hazard Ratio HUVEC Human Umbilical Vein Endothelial Cell ICC Immunocytochemistry KM Kaplan-Meier LA Leukapheresis LOH Loss of Heterozygosity LV Leucovorin mBC Metastatic Breast Cancer mCRC Metastatic Colorectal Cancer MMP Matrix Metalloproteinase MMR Mismatch Repair MNC Mononuclear Cell MNNG N-methyl-N’-nitro-N-nitrosoguanidine MoAb Monoclonal Antibody MSI Microsatellite Instability MSS Microsatellite Stable NR Non-Responder NSCLC non small-cell lung cancer OS Overall Survival PBS Phosphate Buffered Saline PCR Polymerase Chain Reaction PD Progression Disease PET Positron Emission Tomography PFS Progression Free Survival PIP2 Phosphatidylinositol 4,5 Biphosphate PKC Protein Kinase C PR Partial Response PS Performance Status PSA Prostate Specific Antigen qPCR Quantitative Polymerase Chain Reaction R Responder RNA Ribonucleic acid ROC Receiver Operating Characteristic RT Room Temperature SD Stable Disease SD Standard Deviation ShRNA Short Hairpin RNA SSA Sessile Serrated Adenoma TEM Transendothelial Migration TF Transcription Factor TGCA The Cancer Genome Atlas 143 List of Abbreviations TIC Tumor Initiating Cell TKI Tyrosine Kinase Inhibitor TS Thymidylate synthase TSA Traditional Serrated Adenoma U.S. United States UGT1A1 UDP-Glucuronosyl Transferase 1A1 USC Universidade de Santiago de Compostela VEGF Vascular Endothelial Growth Factor WBC White Blood Cell WTA Whole Transcriptome Amplification Resumo 149 Resumo O Cancro Colorrectal O cancro colorrectal (CCR) representa o terceiro tipo de cancro en canto a incidencia a nivel mundial, e o cuarto no referente a taxas de mortalidade, con aproximadamente 690.000 mortes relacionadas con CCR no ano 2012, sendo lixeiramente máis habitual entre a poboación masculina 1, e cunha tendencia ao incremento especialmente en países en vías de desenvolvemento 3,4. A pesares disto, as taxas de mortalidade en países coma España rexistran unha redución paulatina dende o ano 2001 para ambos sexos 6, á que hai que sumar tamén un incremento progresivo das taxas de supervivencia dos pacientes con CCR 8,9, todo iso debido ás melloras en prevención, diagnóstico e tratamento deste tipo de tumores nos últimos anos. As taxas de supervivencia a 5 anos de pacientes afectados de CCR varían enormemente en función do estadio no que este sexa diagnosticado, cun 90,1% para CCR en estadios localizados, que se reduce a un 69,2% trala extensión tumoral cara a órganos adxacentes ou nódulos linfáticos, ou a un 11,7% xa nos casos máis avanzados nos que existe unha diseminación a órganos máis distantes 7. Aproximadamente un 5-10% dos casos de CCR son considerados de índole hereditaria, sendo o Cancro Colorrectal Hereditario Non Polipósico ou a Polipose Adenomatosa Familiar (HNPCC ou FAP, polas súas respectivas siglas en inglés), as dúas formas principais de CCR 10,11. A maioría dos casos de CCR teñen unha etioloxía esporádica, e factores como a idade, a presenza previa de pólipos no colon, ou certos factores ambientais teñen sido relacionados coa etioloxía deste tipo de cancro 10. A nivel molecular, xa no ano 1990, Fearon e Vogelstein describiron un modelo de carcinoxénese colorrectal no que se propoñía a súa formación a partires da progresión paulatina de adenomas preexistentes 16, a través de mutacións secuenciais que resultan na alteración de polo menos 4-5 xenes (activación de oncoxenes e inactivación de xenes supresores de tumores). Aínda que se seguen a conservar as premisas formuladas neste modelo inicial, nas últimas dúas décadas describíronse outras rutas que contribúen ao proceso de carcinoxénese colorrectal. Estas inclúen a denominada inestabilidade de Microsatélites (ou MSI) 27,29, a ruta de metilación de illas CpG (CIMP) 31,32, a de inestabilidade cromosomal (CIN) 18, ou a máis recentemente descrita “Serrated pathway” (denominación inglesa pola morfoloxía en forma de dentes de serra das lesións nas que se observa) 34-36. En conxunto, todas estas características tumorais proporcionan información a nivel molecular que permite unha clasificación dos tumores dunha forma máis exacta, o que finalmente repercute nun mellor manexo e tratamento deste tipo de cancros. Se temos en conta a dramática redución das taxas de supervivencia nos estadios máis avanzados desta enfermidade, xunto coa lenta evolución da mesma (dende a presenza de adenomas ata o desenvolvemento de CCR) ponse claramente de manifesto a importancia da detección temperá neste tipo de tumores. Diversas metodoloxías que permiten a detección de sangue ou de determinadas proteínas asociadas ao CCR nas feces (FOBT e FIT) 57-59, ou de marcadores de CCR no soro sanguíneo (SEPT9, MMP7, PTGS2 ou CEA) 65-67, foron descritos como ferramentas útiles para a detección precoz de CCR. Neste senso, dende 150 o ano 2013, está implantado na comunidade galega un programa de detección precoz deste tipo de cancro, baseado no uso da técnica FOBT. Non obstante, o uso de técnicas de imaxe, que permiten a visualización e extirpación de lesións nun mesmo procedemento, constitúen o tipo de técnicas mais amplamente utilizado, polas consecuencias positivas que supoñen para o doente 57. Independentemente da técnica utilizada, a diagnose final do CCR faise en base ao resultado dunha colonoscopia, conxuntamente cunha biopsia do propio tumor e coa aplicación doutras técnicas de imaxe coma a tomografía de emisión de positróns (PET) para a detección de diseminación tumoral a distancia. Finalmente, a cada tumor asígnaselle un estadio en función dos resultados das probas anteriores, segundo a clasificación TNM que ten en conta tanto o tumor primario, coma a presenza de afectación nodular ou de metástases a distancia. A cirurxía constitúe o único tratamento curativo para este tipo de tumores, sempre e cando se encontren en estadios localizados 84. Aínda nestes casos, e para eliminar riscos de recorrencias pola presenza de células tumorais remanentes trala extirpación do tumor, é habitual a administración de terapias adxuvantes (complementarias á cirurxía) 85,338,339. Tamén, aínda que é máis frecuente no caso de cancro rectal, se poden aplicar terapias neo-adxuvantes en determinadas situacións, para diminuír o tamaño do tumor antes da intervención cirúrxica 87. No caso da presenza de enfermidade metastática a distancia, a quimioterapia constitúe practicamente a única alternativa, e é aplicada normalmente cun fin paliativo, para mellorar a calidade de vida do paciente. A mesma, está baseada principalmente no uso de 5-fluoracilo normalmente en combinación con outros axentes (irinotecan ou oxaliplatino), e con terapias biolóxicas dirixidas (Bevacizumab ou Cetuximab) 10,11. A existencia de factores prognóstico (asociados coa evolución do doente en ausencia de terapia), ou predictivos (que permiten a identificación de pacientes con máis probabilidade de responder a unha terapia determinada), considérase hoxe en día fundamental para un mellor manexo dos pacientes con CCR. Un exemplo de factor prognóstico son os niveis do Antíxeno Carcinoembriónico (CEA) en soro, cuxos niveis elevados están asociados cunha peor evolución de enfermidade 72. Por outra banda, a presenza de mutacións activadoras do xene KRAS, constitúe un dos factores predictivos máis estudados en CCR, estando asociado coa resistencia a terapias anti-EGFR, ruta na que está implicada o propio KRAS 103. O proceso de metástase e as Células Tumorais Circulantes Aínda que causante de máis do 90% da mortalidade relacionada co cancro 115,116, o proceso de metástase dista moito de ser completamente descifrado debido á súa elevada complexidade. O mecanismo polo cal as células epiteliais nos tumores primarios son capaces de xerar finalmente unha masa metastática a distancia, produce unha serie de eventos en serie, denominados en inglés “metastatic cascade 117”. Nun primeiro lugar, ditas células tumorais han de invadir a nivel local, para acabar atravesando a membrana basal, que separa o 151 Resumo compartimento tumoral do estroma veciño 118,119, para finalmente alcanzar os vasos, tanto sanguíneos como linfáticos, situados nas zonas adxacentes ao tumor primario, e entrar nos mesmos nun proceso denominado intravasación 115. Dito proceso de invasión caracterízase pola adquisición dun fenotipo máis mesenquimal por parte das células tumorais epiteliais, a través dun fenómeno denominado “Transición Epitelio-Mesénquima” ou EMT polas súas siglas en inglés. Grazas a isto, as células tumorais adquiren unha maior capacidade migratoria e invasiva, que lles permite avanzar cara a vasculatura e penetrar finalmente na mesma 134,161,294. Aínda que potencialmente ditas células tumorais teñen acceso tanto á circulación sanguínea como á linfática, no caso do CCR, tense descrito que a ruta principal de diseminación, e polo tanto de formación de metástases, é a hematóxena 115. Unha vez no compartimento circulatorio, estas Células Tumorais Circulantes ou CTCs teñen virtualmente acceso a tódolos órganos do corpo. Con todo, na maioría dos tumores obsérvase un claro patrón de metástase, con órganos diana preferenciais para cada tipo de tumor primario. No caso do CCR, o fígado constitúe o órgano principal en canto a formación de metástases, cos pulmóns en segundo lugar 141. A propia disposición anatómica pode explicar parcialmente este patrón, debido á existencia dunha circulación mesentérica que conecta directamente fígado e intestino 133. Emporiso, outros fenómenos como a liberación de factores solubles 148 ou microvesículas 147 por parte do tumor primario, poden colaborar na preparación do tecido diana antes da propia chegada das células tumorais que darán lugar á formación das metástases, xerando o que se denomina un “nicho premetastático” 145,146. Unha vez na súa localización final, as CTCs han de abandonar a circulación para a posterior colonización no tecido diana, nun proceso denominado “extravasación”, no cal, estas se adhiren primeiramente ás células endoteliais que conforman a cara luminal dos vasos sanguíneos, e migran a través das mesmas (migración transendotelial ou TEM) 150,340. Finalmente, e tras alcanzar o estroma do tecido diana, unha subpoboación destas CTCs, as denominadas Células Iniciadoras de Tumores (ou TICs) 160 dará lugar á formación de micrometástases que serán as que finalmente orixinarán metástases macroscópicas 116. A pesar do impacto que a aparición de metástases ten na supervivencia dos doentes 116, estudos en modelos animais suxiren que o proceso de formación das mesmas é altamente ineficiente, e calcúlase que unicamente un 0,02% do número total de CTCs liberadas á circulación a nivel do tumor primario darán lugar finalmente á formación de masas metastáticas macroscópicas 159. Aínda así, a formación das mesmas segue a representar a principal causa de mortalidade relacionada con cancro. O feito de que as CTCs representen un dos principais intermediarios no proceso de diseminación tumoral, con capacidade para, a lo menos a través dalgunha das súas subpoboacións, dar lugar á formación de metástases 172, fixo que nos últimos anos numerosos grupos de investigación se dedicasen ao seu estudo en profundidade. A propia bioloxía das mesmas, convérteas en candidatos moi atractivos para a análise do proceso de diseminación tumoral dunha forma dinámica e pouco invasiva, cos beneficios que iso pode reportar para a calidade de vida do doente. É importante ter en conta que, a día de hoxe, a maior parte das análises realizadas para determinar o prognóstico dun doente con cancro,