Does Seipin Play a Role in Oxidative Stress Protection and Peroxisome Biogenesis? New Insights from Human Brain Autopsies

Does Seipin Play a Role in Oxidative Stress Protection and Peroxisome Biogenesis? New Insights from Human Brain Autopsies Sofı´aSa ´nchez-Iglesias, a Alberto Ferna ´ndez-Liste, b Cristina Guillı´n-Amarelle, a Alberto Ra ´bano, c Leticia Rodriguez-Can ˜ete, a Blanca Gonza ´lez-Me ´ndez, a Antı´a Ferna ´ndez-Pombo, a Ana Senra d and David Arau ´jo-Vilar a * a Thyroid and Metabolic Diseases Unit (U.E.T.eM.), Department of Psychiatry, Radiology, Public Health, Nursing and Medicine (Medicine Area), Center for Research in Molecular Medicine and Chronic Diseases (CIMUS)-IDIS, University of Santiago de Compostela, 15782 Santiago de Compostela, Spain b Instituto de Medicina Legal de Galicia (IMELGA), 15707 Santiago de Compostela, A Corun ˜a, Spain c Neuropathology Department and Tissue Bank, Fundacio ´n CIEN, 28031 Madrid, Spain d Department of Physiology, Center for Research in Molecular Medicine and Chronic Diseases (CIMUS)-IDIS, University of Santiago de Compostela, 15782 Santiago de Compostela, Spain Abstract— Seipin is a widely expressed protein but with highest levels found in the brain and testes. Seipin function is not yet completely understood, therefore the aim of this study was to evaluate the expression of BSCL2 transcripts in the central nervous system (CNS) of humans and investigate the effect of their overexpression on a neuron model and their relationship with oxidative stress protection, as well as shed light on the pathogenic mechanisms of Celia’s Encephalopathy. We analyzed the expression of BSCL2 transcripts using real-time RT– PCR in samples across the brain regions of subjects who underwent necropsy and from a case with Celia’s Encephalopathy. The transcript encoding the long seipin isoform (BSCL2-203, 462 aa) is expressed primarily in the brain and its expression is inversely correlated with age in the temporal lobe, amygdala, and hypothalamus. Strong positive correlations were found between BSCL2 expression and some genes encoding protective enzymes against oxidative stress including SOD1 and SOD2, as well as peroxisome proliferator-activated receptor gamma (PPARG) in the amygdala. These results were experimentally corroborated by overexpressing BSCL2 transcripts in SH-SY5Y cells with lentiviral transduction and assessing their effects on neuron differentiated cells. Confocal microscopy studies showed that both seipin and PEX16 are closely expressed in the hypothalami of healthy human brains, and PEX16 was absent in the same region of the PELD case. We hypothesize that seipin has specific CNS functions and may play a role in peroxisome biogenesis. Ó2018 The Authors. Published by Elsevier Ltd on behalf of IBRO. This is an open access article under the CC BY license (http://creativecommons.org/licenses/by/4.0/). Key words: BSCL2, seipin, human brain, peroxisomes, neurodegeneration, lipodystrophy. INTRODUCTION The BSCL2 gene encodes seipin, a resident endoplasmic reticulum (ER) protein with two transmembrane domains, a luminal loop, and two amino and carboxy-terminal tails in the cytoplasm. The BSCL2 gene principally encodes three seipin isoforms under natural conditions, 462 (BSCL2-203, ENST00000360796.9; CCDS44627), 398 (BSCL2-205/207/ 210, ENST00000403550.5; ENST00000407022.7; ENST00000421906.5; CCDS8031), and 287 (BSCL2201, ENST00000278893.11; CCDS55769) amino acids long, respectively. BSCL2-210/207/205 was the first transcript to be described (Magre et al., 2001), and BSCL2-203 is the same as BSCL2-210/207/205 except for an N-terminal extension of 64 amino acids encoded by exon 1 and part of exon 2. The protein translated from the short transcript is different from the other transcripts, as exon 7 is skipped in BSCL2-201 and the reading frame is different from exon 6 to exon 10 (Guillen-Navarro et al., 2013). In humans, seipin forms 12-unit homoligomers that form a toroid (Sim et al., 2013; Sim et al., 2014). BSCL2 variants can cause different diseases, such as generalized congenital lipodystrophy type 2 (MIM: # 269700), seipinopathies of first and/or second motor neurons (MIM: # 600794, MIM: # 270685) (Ito and Suzuki, 2009), https://doi.org/10.1016/j.neuroscience.2018.11.004 0306-4522/Ó2018 The Authors. Published by Elsevier Ltd on behalf of IBRO. This is an open access article under the CC BY license (http://creativecommons.org/licenses/by/4.0/). *Corresponding author. Address: U.E.T.eM, Department of Psychiatry, Radiology, Public Health, Nursing and Medicine – IDIS, CIMUS, Avda. de Barcelona 3, University of Santiago de Compostela, 15707 Santiago de Compostela, Spain. Fax: +34 981559937. E-mail address: [email protected] (D. Arau ´jo-Vilar). Abbreviations: CAT, catalase; CNS, central nervous system; ER, endoplasmic reticulum; ET, extraneural tissues; MOI, multiplicity of infection; PBS, phosphate-buffered saline; PELD, Progressive Encephalopathy with or without lipodystrophy; PEX, peroxisomal biogenesis factor; PNS, peripheral nervous system; PPARG, peroxisome proliferator-activated receptor gamma; SOD, superoxide dismutase. NEUROSCIENCE RESEARCH ARTICLE S. Sa ´nchez-Iglesias et al. / Neuroscience 396 (2019) 119–137 119 or Progressive Encephalopathy with or without lipodystrophy, also called Celia’s Encephalopathy (PELD, MIM: # 615924) (Guillen-Navarro et al., 2013). PELD is an infantile neurodegenerative disease with a fatal prognosis before 9 years previously described by our group (Guillen-Navarro et al., 2013). Neurological regression of Celia’s Encephalopathy begins at age 3–4, with early signs of severe myoclonic epilepsy, spastic tetraparesis, and severe encephalopathy leading to death before age 9. This disease is extraordinarily rare, and is a consequence of the BSCL2 gene c.985C > T variant in homozygosis or compound heterozygosis (Alaei et al., 2016; Guillen-Navarro et al., 2013). This variant gives rise to a branch site in exon 7 of the BSCL2 gene, producing the intronization of that exon leading to an aberrant seipin with a different amino acid sequence than wild-type (BSCL2-203) from exon 6 (Guillen-Navarro et al., 2013). The formation of large aberrant seipin macroaggregates leading to ER stress and nuclear accumulation of this abnormal protein are the pathogenetic mechanisms ultimately responsible for Celia’s Encephalopathy (Ruiz-Riquelme et al., 2015). Seipin is a highly evolutionarily conserved protein functioning primarily to modulate the formation of lipid droplets and identified in yeast, Saccharomyces cerevisiae,Caenorhabditis elegans, zebrafish, fruit fly, and mammals (Cartwright and Goodman, 2012; Salo et al., 2016; Wang et al., 2016). While this gene is mainly expressed in the central nervous system (CNS), pituitary gland, and testis in humans (Guillen-Navarro et al., 2013; Magre et al., 2001), little is known about the function of seipin in the CNS. Recent studies in seipin KO mice have shown a particular action for this protein in the CNS that appears to be mediated by peroxisome proliferator-activated receptor gamma (PPARG) and that influences synaptic transmission primarily through a-amino-3-hydroxy-5-methyl-4-isoxazole propionic acid receptors, and also promotes neuronal differentiation and modulates the behavior and motor skills of these animals (Ebihara et al., 2015; Li et al., 2015; Zhou et al., 2016). Here we evaluate the expression of the various BSCL2 transcripts across human brain regions and extraneural tissues and investigate the putative functions of seipin in the CNS. EXPERIMENTAL PROCEDURES This study was approved by the Ethics Review panel of Xunta de Galicia (Spain) and performed in accordance with the ethical guidelines of the Helsinki Declaration. Tissue samples Thirteen post-mortem donors were selected, seven men and six women (aged 21–86 years), primarily deceased by suicide, traffic accident, or natural causes (Table 1) in accordance with the current Spanish legislation, and tissue samples were obtained during autopsy conducted within 24 h of death. Brains were removed and sliced coronally into 12 sections. The frontal cortices in the third slice, parietal and temporal cortices with hippocampi in the seventh slice, occipital lobes in the eleventh, insular cortices, amygdalae, thalami, heads of caudate and putamen nuclei, and cerebellum samples were accurately dissected and collected separately from both cerebral and cerebellar hemispheres, along with the right and left sides of the hypothalamus, mesencephalon, protuberance, and medulla oblongata, as well as the dorsal and ventral spinal cord, anterior pituitary, vagus and trigeminal nerves, skeletal muscles (rectus abdominis and gastrocnemius), adipose tissue from Bichat’s fat pad, abdominal subcutaneous tissue, visceral areas and lower limbs, renal cortex and medulla, and liver and gonad samples. These tissues were immediately submerged in liquid nitrogen after removal and subsequently stored at 80 °C until RNA preparation. These dissections yielded a total of 44 tissues for real-time RT–PCR analysis. RNA extraction and retrotranscription Total RNA was isolated with the ReliaPrep TM RNA Tissue Miniprep System (Promega, Madrid, Spain). Frozen tissue samples (20 mg of each tissue sample, except for adipose and muscle tissues which required 100 mg) were weighed and then homogenized in 250 ml lysis buffer (LBA previously supplemented with 2% 1thioglycerol) using a Tissue Ruptor (Qiagen, Hilden, Germany). 750 ml of Trizol reagent (Invitrogen, Madrid, Spain) was added to the homogenized samples, which were then vortexed for 10 s and incubated for 5 min at room temperature to permit complete dissociation of the nucleoprotein complex. Adipose tissue samples required an additional centrifugation step at 12,000gfor 10 minutes at 4 °C to remove insoluble material, and the fatty layer was removed and discarded while the cleared supernatant was transferred to a new tube. 200 mlof chloroform (Sigma, Madrid, Spain) was then added to the supernatant, which was subsequently shaken vigorously by hand for 15 s and incubated for 2 min at room temperature. This was followed by a centrifugation at 12,000gfor 15 min at 4 °C, after which the aqueous phase was transferred to a new tube. 35 mlof 2-propanol (Sigma) was added for each 100 mlof supernatant, samples were vortexed for 5 s, and the lysate was transferred to a ReliaPrep column and centrifuged at 14,000gfor 30 s at room temperature. Subsequent RNA purification was as follows: 200 mlof wash solution was added followed by a centrifugation step at 14,000gfor 15 s at room temperature; 500 mlof RNA wash solution was added and followed by centrifugation at 14,000gfor 30 s at room temperature; 300 ml of RNA wash solution was added followed by centrifugation at 20,000gfor 2 min at room temperature. Finally, RNA was eluted with 30 ml of nuclease and RNase-free water in a last centrifugation step performed at 14,000gfor 1 min at room temperature. The concentration and purity of each sample was determined by spectrophotometer (ND2000; Nanodrop), and RNA samples were stored at 80 °C until use. The RNA was reverse transcribed using M-MLV reverse transcriptase (Invitrogen), as previously described (Victoria et al., 2010). 120 S. Sa ´nchez-Iglesias et al. / Neuroscience 396 (2019) 119–137 Real-time RT–PCR Specific primers and probes designed by the Universal ProbeLibrary (Roche Diagnostics, Sant Cugat del Valles, Spain) were used in a Light Cycler 2.0 (Roche Diagnostics) to determine the specific expression of the following genes: CAT,NESTIN,PEX1,PEX11G, PEX16,PPARG,RBFOX3/NeuN,SOD1,SOD2 (Table 2), and three distinct BSCL2 transcripts (Fig. 1). Real-time RT–PCR conditions are available upon request. Results were normalized to the 18S and RNA polymerase II genes using the 2 DD CT method (Livak and Schmittgen, 2001). Cell culture The SH-SY5Y neuroblastoma cell line was kindly provided by Dr. Jesu ´s Rodrı´guez-Requena (Santiago de Compostela, Spain). Undifferentiated cells were maintained in a 1:1 mixture of Ham’s F12 (cat. N4888, Sigma–Aldrich) and Minimum Essential Eagle’s Medium (cat. M2279, Sigma–Aldrich) supplemented with 15% heat-inactivated fetal bovine serum (cat. 10270-106, Gibco), 1% GlutaMax-I TM (cat. 35050-061, Gibco), 100 units/ml penicillin, 100 mg/ml streptomycin (cat. 15140-122, Gibco), and 1% MEM non-essential amino acids solution (NEAA, cat. 11140050, Gibco). Cells were grown in the presence of 5% CO 2 in a humidified incubator at 37 °C. The cell medium was replaced every 3 days, and the cells were sub-cultured once 90% confluence was reached. The cells were used at early passages (below P17) in all experiments. Plasmids A plasmid containing wild-type human seipin fused to a myc tag (6x myc-wt seipin pCS2+MT) was generously provided by D. Ito (Keio University, Japan), and the myc fused seipin expression plasmid was described previously (Guillen-Navarro et al., 2013). The wild-type lentiviral plasmid was generated as follows: wt seipin cDNA was amplified by PCR using specific primers (forward: 5 0 -TAAGCAGGTACCTCTTTTTGCAGGATCC CATCGA-3 0 ; reverse: 5 0 - TAAGCATCTAGAGCCTT GAATTCGCCCTTGAC-3 0 ), then digested with the fastdigest restriction enzymes KpnI and XbaI (cat. FD0524 and FD0684, ThermoFisher Scientific), and purified and inserted into pLenti-CMV-GFP-2A-Puro-Blank (cat. LV073, Applied Biological Materials Inc.) vector. This GFP bicistronic lentiviral plasmid is a replicationTable 1. Demographic and clinical characteristics of subjects Subjects Gender Age Height (cm) Weight (kg) 1 Woman 67 165 65 2 Man 73 160 80 3 Man 40 167 75 4 Woman 83 160 90 5 Man 29 184 90 6 Man 61 165 90 7 Man 21 184 80 8 Woman 86 169 69 9 Man 43 178 120 10 Man 43 174 80 11 Woman 21 153 65 12 Woman 66 154 73 13 Woman 77 150 60 Table 2. Primer sequences and probes Genes Forward Primer Reverse Primer Probe number Probe sequence Amplicon length [nt] 18S GCAATTATTCCCCATGAACG GGGACTTAATCAACGCAAGC 48 TTCCCAGT 68 BSCL2 ex1 AGGAGGAAGCTGGGGAAA CAGCAGCTGGTGGTTCCT 54 CTGGTCTC 78 BSCL2 ex7 TGCGCCTTCATAGGTGTTG ACCCACTGCATGTAGCTGAA 73 TCCTCAGC 74 BSCL2 ex6-8 AGCGATCATTGAGATCCACA TTTTCGGATGTTAACCTGAGC 42 CATCCAGC 96 CAT GGGATCCCATATTGTTTCCAT ATGTCCGGATCCTTCAGATG 76 TGGCTGTG 76 NESTIN GAGTTGGGTTCTGGGGAGAT TCATCCTCCTCGCTCTCTTC 69 CTTCCTCC 77 PEX1 CATTTTCAAAAGCTGATGCTGA TGCTTGGTTTGAAGTTCTTTCAT 54 CTGGTCTC 88 PEX11G GCGCTGGAGTCGTACAGG ACCAGAACTCCACCAACCAG 74 CTGCTGCC 80 PEX16 CCCTCAGTTGCTAAGGGCTAC CTTCCTGCTTCCGGTCTTAG 73 TCCTCAGC 143 PPARG GACCTGAAACTTCAAGAGTACCAAA TGAGGCTTATTGTAGAGCTGAGTC 39 CTCCACCT 95 RBFOX3/NeuN CCCAACAGAAAGGGCTGAC CTGGGCTTCCTTCGTCCT 1 CCTGGAGC 68 RPII GCATCATGAACAGCGATGAG TCATCCATCTTGTCCACCAC 69 CTTCCTCC 86 SOD1 TCCATGTTCATGAGTTTGGAGAT TCTGGATAGAGGATTAAAGTGAGGA 40 CAGCAGGC 74 SOD2 GCACTAGCAGCATGTTGAGC CCGTAGTCGTAGGGCAGGT 1 CCTGGAGC 118 Primer sequences and probes from Universal ProbeLibrary used in qPCR analysis. S. Sa ´nchez-Iglesias et al. / Neuroscience 396 (2019) 119–137 121 Fig. 1. Three main transcripts of the BSCL2 gene. The BSCL2-203 transcript (ENST00000360796.9; CCDS44627) contains 11 exons coding for a 462-amino-acid-long protein. The BSCL2-205/207/ 210 transcript (ENST00000403550.5; ENST00000407022.7; ENST00000421906.5; CCDS8031) is identical to BSCL2-203 except that it lacks the first 192 nucleotides (exon 1 and part of exon 2 of BSCL2-203), resulting in a 398-amino-acid-long protein. The BSCL2-201 transcript (ENST00000278893.11; CCDS55769) features exon 7 skipping and generates a protein of 287 amino acids. The probe #73 (TCCTCAGC) used with forward: 5 0 -TGCGCCTTCATAGGTGTTG-3 0 and reverse primer: 5 0 -ACCCACTGCATGTAGCTGAA-3 0 hybridizes with exon 7 of BSCL2 gen (amplicon 74 nucleotides), while the reverse primer: 5 0 -AGCGATCATTGAGATCCACA-3 0 used with the probe #42 (CATCCAGC) and the forward primer: 5 0 -TTTTCGGATGTTAACCTGAGC-3 0 hybridizes with the union of exon 6 and exon 8 (amplicon 96 nucleotides). The probe #54 (GAGACCAG) used with the forward: 5 0 -AGGAGGAAGCTGGGGAAA-3 0 and the reverse primer: 5 0 -CAGCAGCTGGTGGTTCCT3 0 (amplicon 78 nucleotides) hybridizes with exon 1 of BSCL2 gen. Expression of BSCL2-203 transcript corresponds to the values obtained from real-time RT–PCR using the probe #54. Expression of BSCL2-205/207/210 transcript was calculated by subtracting the values obtained from real-time RT–PCR using probe #73 minus the values obtained from real-time RT–PCR using probe #54. Expression of BSCL2-201 transcript corresponds to the values obtained from real-time RT–PCR using probe #42. 122 S. Sa ´nchez-Iglesias et al. / Neuroscience 396 (2019) 119–137 incompetent third-generation vector, and is depicted in Fig. 2. Full sequences were confirmed by sequencing. Lentiviral transduction Cells were seeded into 6-well plates (cat. 3516, Corning, Costar) at a density of 5000 cells per cm 2 . The medium was removed twenty-four hours after seeding and the cells were washed with phosphate-buffered saline (PBS). Viral particles (wild-type seipin), and the empty vector as a control, all with functional titers >10 9 transducing units/ml produced by Cyagen Biosciences (Guangzhou, China) were added at a multiplicity of infection (MOI) of 200 viral particles/cell to a serum-free medium in the presence of Lentiblast A/B (1:100/1:1000, Oz Biosciences, Marseille, France). Serum was added 4 hours after initial infection (final infection volume 1 ml), the medium was removed twenty-four hours after infection, and the cells were washed with phosphatebuffered saline (PBS). Cells were then cultured with typical SH-SY5Y medium and puromycin dihydrochloride (2 lg/ml final concentration, cat. P8833, Sigma–Aldrich) was subsequently added to the cell culture medium every 2–3 days until resistant stable cells were formed. Cells were then routinely grown as described above. Differentiation Stably transfected cells were seeded into six-well plates at density of 10,000 cells per cm 2 and allowed to adhere for 2 days. Pre-differentiation was then started in DMEM high glucose (D5796, Sigma–Aldrich) supplemented with 3% heat-inactivated fetal bovine serum, 100 units/ml penicillin, and 100 mg/ml streptomycin with 10 mM retinoic acid (cat. R2625, Sigma–Aldrich), freshly prepared in DMSO and kept in the dark. Undifferentiated cells were cultured in identical medium without retinoic acid. The second phase of differentiation was initiated after 3 days in these conditions (day 4) with Neurobasal medium (cat. 21103-049, Gibco), 50 ng/ml BDNF (cat. 450-02, Peprotech), 1 mM dibutyryl-cAMP (cat. sc-201567A, Santa Cruz), 20 mM KCl (cat. 131494, Panreac), 10 mM retinoic acid, 1% B27 (cat. 17504-044, Gibco), 1% Glutamax 100,1% N-2 supplement (cat. 17502-048, Gibco), 100 units/ml penicillin, and 100 mg/ml streptomycin. Undifferentiated cells were maintained in high glucose DMEM, supplemented with 1% heat-inactivated fetal bovine serum, 100 units/ml penicillin, and 100 mg/ml streptomycin. The culture medium was changed every 2 days and supplemented with fresh additives. Differences in cell morphology between proliferative and differentiated cells were evaluated under phase contrast light microscopy with an Olympus IX51 microscope (Olympus Corporation, Tokyo, Japan) and photographed with an Olympus DP72 digital camera using the cellSens software (Olympus Corporation). Cells were harvested on day 8. Immunostaining The hypothalamus of the homozygous index case c.985C > T and of two control cases (male and female, 59 and 75 years at death, respectively) were fixed previously with 10% neutral buffered formalin (BioOptica, cat. 05-K01022) for 24 h at room temperature and embedded in paraffin. After deparaffinization and rehydration, slides were pre-treated with PT-link (Dako, California, USA) for 20 min at 95 °C in Tris/EDTA buffer, pH 9. Slides were then washed four times with PBS and incubated with 1:250 anti PEX16 antibody (Santa Cruz Biotechnology) and 1:125 anti-seipin antibody HPA042394 (Sigma–Aldrich, The Human Protein Atlas) overnight at 4 °C. The next day, the slides were washed four times with PBS and incubated with Alexa Fluor 555 (Thermo-Fisher Scientific, cat. A31572) conjugated antimouse secondary antibody, and Alexa Fluor 488 (Thermo-Fisher Scientific, cat. A21202) conjugated antirabbit secondary antibody for 1 h in darkness, washed with double-distilled water. Slides were then treated to quench autofluorescence background with 0.1% Sudan Black B (Sigma, cat. 199664) in 70% ethanol for less than 5 min at room temperature and washed three times, for 5 min each with double-distilled water. Finally, they were mounted in aqueous medium containing 1:1000 DAPI (Sigma–Aldrich, cat. D9542). Confocal fluorescence microscopy Immunofluorescence staining was assessed with a Leica TCS SP2 confocal microscope using a HCX PL APO 63/1.3 glycerol-immersion objective and Leica Confocal Software (Leica Microsystems Heidelberg GmbH, Mannheim, Germany). Images were obtained by a sequential scan method and three different laser lines to avoid simultaneous excitation and possible overlap. Confocal acquisition of the fluorescence labels was performed as follows: DAPI, color-coded in blue (Blue-Diode, excited at 405 nm and recorded on 425– 470 nm), Alexa Fluor 488 nm, color-coded in green (Argon laser, excited at 488 nm and recorded at 500– 555 nm), and Alexa Fluor 555 nm, color-coded in red Fig. 2. Lentiviral BSCL2 plasmid. Plasmid map of lentiviral expression vector used in this study. This pLenti vector includes a CMV promoter for robust and consistent ORF expression, a GFP reporter driven by a separate promoter to the gene of interest to monitor transfection and infection, and a selectable marker expression that confers puromycin resistance. S. Sa ´nchez-Iglesias et al. / Neuroscience 396 (2019) 119–137 123 Fig. 3. BSCL2 transcripts’ expression. (A) Summary of the relative expression of the three BSCL2 transcripts across the primary brain divisions, the peripheral nervous system (PNS), and the extraneural tissues (ET). Details are available in Table 3. (B) Percent expression of BSCL2 transcripts in CNS, PNS and ET. BSCL2-203 (blue), BSCL2-205/207/210 (red), and BSCL2-201 (green) expression are referred to as BSCL2 total expression. (C) Percentage expression of BSCL2 transcripts in primary brain divisions: telencephalon (T), diencephalon (D), mesencephalon (M), metencephalon (Me), myelencephalon (My), spinal cord (SC); peripheral nervous system (PNS) and extraneural tissues (ET). All samples were analyzed in duplicate, n= 13. All results were normalized to the 18S gene. 124 S. Sa ´nchez-Iglesias et al. / Neuroscience 396 (2019) 119–137 (DPS diode, excited at 561 nm and recorded at 581– 675 nm). Two random visual fields were analyzed for each group. Statistical analysis Real-time PCR analyses were done by duplicates, and statistical significance was determined using a nonparametric Kruskal–Wallis test followed by a Mann– Whitney U post-hoc with Bonferroni’s correction. Correlations were tested using the Spearman R correlation coefficient and partial correlations were utilized to correlate two variables while adjusting for other one. Data are presented as mean ± SD with statistical significance set at p< 0.05. All statistical analyses were performed using SPSS for Mac (release 22.0; SPSS, Chicago, IL, USA). RESULTS Patterns of BSCL2 expression in human tissues We evaluated the relative expression of seipin transcripts in the CNS, the peripheral nervous system (PNS), and extraneural tissues (ET) in 13 subjects (Fig. 3A, detailed with significance in Table 3). The total expression of BSCL2 was 6.9 times higher in the CNS than in any of the other tissues (p< 0.001): 86.3% in CNS, 1.3% in Table 3. Relative expression of BSCL2 transcripts # Tissues BSCL2-203 BSCL2-205/207/210 BSCL2-201 1 Frontal Lobe R 1.222 ± 0.723 *,# 0.0107 ± 0.0375 * 0.0058 ± 0.00379 # 2 Frontal lobe L 0.977 ± 0.799 *,# 0.0812 ± 0.160 * 0.0082 ± 0.0077 # 3 Parietal lobe R 1.423 ± 0.827 *,# 0.0206 ± 0.059 *,§ 0.0081 ± 0.005 #,§ 4 Parietal lobe L 1.269 ± 0.895 *,# 0.110 ± 0.159 *,§ 0.01 ± 0.0082 #,§ 5 Temporal lobe R 1.177 ± 0.709 *,# 0.0197 ± 0.041 *,§ 0.0051 ± 0.0029 #,§ 6 Temporal lobe L 1.012 ± 0.574 *,# 0.19 ± 0.199 *,§ 0.0054 ± 0.0036 #,§ 7 Occipital lobe R 1.051 ± 0.820 *,# 0.0732 ± 0.240 *,§ 0.0058 ± 0.0053 #,§ 8 Occipital lobe L 0.859 ± 0.775 *,# 0.0642 ± 0.127 *,§ 0.0072 ± 0.0053 #,§ 9 Insula R 1.306 ± 0.905 *,# 0.301 ± 0.305 *,§ 0.0067 ± 0.004 #,§ 10 Insula L 1.178 ± 0.680 *,# 0.0756 ± 0.084 *,§ 0.0083 ± 0.0073 #,§ 11 Amygdala R 1.046 ± 0.643 *,# 0.0511 ± 0.066 *,§ 0.0048 ± 0.0032 #,§ 12 Amygdala L 1.116 ± 0.744 *,# 0.037 ± 0.079 *,§ 0.0052 ± 0.0033 #,§ 13 Thalamus R 0.955 ± 0.521 *,# 0.0669 ± 0.0830 *,§ 0.007 ± 0.0059 #,§ 14 Thalamus L 0.667 ± 0.448 *,# 0.0889 ± 0.071 *,§ 0.014 ± 0.022 #,§ 15 Caudate R 1.459 ± 0.729 *,# 0.044 ± 0.094 * 0.0194 ± 0.0178 # 16 Caudate L 1.852 ± 0.933 *,# 0.0268 ± 0.0760 * 0.0126 ± 0.0076 # 17 Putamen R 1.441 ± 0.660 *,# 0.1228 ± 0.1841 *,§ 0.0088 ± 0.0047 #,§ 18 Putamen L 1.292 ± 0.520 *,# 0.0686 ± 0.198 *,§ 0.0079 ± 0.0039 #,§ 19 Hypothalamus R 0.981 ± 0.645 *,# 0.1 ± 0.1449 *,§ 0.0076 ± 0.0056 #,§ 20 Hypothalamus L 0.746 ± 0.461 *,# 0.0937 ± 0.083 *,§ 0.0065 ± 0.0054 #,§ 21 Pituitary 2.021 ± 0.716 *,# 0.1451 ± 0.214 *,§ 0.0130 ± 0.0055 #,§ 22 Cerebellum R 1.172 ± 0.793 *,# 0.1584 ± 0.427 *,§ 0.0147 ± 0.0192 #,§ 23 Cerebellum L 1.521 ± 0.879 *,# 0.0566 ± 0.1220 * 0.0104 ± 0.0074 # 24 Mesencephalon R 0.611 ± 0.524 *,# 0.1804 ± 0.126 *,§ 0.0072 ± 0.0066 #,§ 25 Mesencephalon L 0.804 ± 0.777 *,# 0.07126 ± 0.0928 *,§ 0.0068 ± 0.0066 #,§ 26 Protuberance R 1.680 ± 1.022 *,# 0.0773 ± 0.197 *,§ 0.0106 ± 0.0068 #,§ 27 Protuberance L 1.559 ± 0.932 *,# 0.189 ± 0.290 *,§ 0.0122 ± 0.0088 #,§ 28 Medulla oblongata R 0.711 ± 0.554 *,# 0.1176 ± 0.151 *,§ 0.00358 ± 0.0035 #,§ 29 Medulla oblongata L 0.816 ± 0.620 *,# 0.128 ± 0.1324 *,§ 0.004 ± 0.0041 #,§ 30 Spinal cord D 0.397 ± 0.275 *,# 0.0561 ± 0.050 *,§ 0.0023 ± 0.0023 #,§ 31 Spinal cord V 0.472 ± 0.405 *,# 0.1467 ± 0.086 *,§ 0.0034 ± 0.0024 #,§ 32 Bichat fat pad 0.033 ± 0.008 *,# 0.1165 ± 0.052 *,§ 0.00048 ± 0.00023 #,§ 33 SC abdominal fat 0.025 ± 0.026 *,# 0.0836 ± 0.041 *,§ 0.003 ± 0.0029 #,§ 34 SC L.L. fat 0.029 ± 0.012 *,# 0.144 ± 0.054 *,§ 0.0014 ± 0.0007 #,§ 35 Visceral fat 0.025 ± 0.013 # 0.09 ± 0.074 § 0.0015 ± 0.00097 #,§ 36 Rectus abdominis muscle 0.050 ± 0.015 *,# 0.123 ± 0.0709 *,§ 0.00159 ± 0.00079 #,§ 37 Gastrocnemius muscle 0.034 ± 0.016 # 0.0479 ± 0.045 § 0.005 ± 0.0092 #,§ 38 Myocardium 0.015 ± 0.006 *,# 0.0357 ± 0.0165 *,§ 0.0004 ± 0.0002 #,§ 39 Liver 0.019 ± 0.009 *,# 0.038 ± 0.0227 *,§ 0.0005 ± 0.00032 #,§ 40 Vagus nerve 0.085 ± 0.035 # 0.0924 ± 0.041 § 0.0005 ± 0.0002 #,§ 41 Trigeminal nerve 0.239 ± 0.144 *,# 0.1239 ± 0.097 *,§ 0.0019 ± 0.0016 #,§ 42 Renal cortex 0.075 ± 0.023 # 0.378 ± 0.786 § 0.0023 ± 0.0018 #,§ 43 Renal medulla 0.092 ± 0.051 *,# 0.4049 ± 0.507 *,§ 0.0053 ± 0.0049 #,§ 44 Gonads 0.427 ± 0.456 # 0.651 ± 0.647 § 0.0057 ± 0.0044 #,§ Relative expression of the three BSCL2 transcripts in encephalic and non-encephalic post-mortem tissues. * p< 0.05, BSCL2-203 transcript referred to BSCL2-205/207/210 transcripts; # p< 0.05, BSCL2-203 transcript referred to BSCL2-201 transcript; § p< 0.05, BSCL2-205/207/210 transcripts referred to BSCL2-201 transcript. All samples were analyzed in duplicate, n= 13. Results were normalized for the 18S gene. R: right, L: left, V: ventral, D: dorsal, L.L.: lower limbs, SC: subcutaneous. S. Sa ´nchez-Iglesias et al. / Neuroscience 396 (2019) 119–137 125 Table 4. BSCL2 transcripts expression in men and women Tissues Side BSCL2-203 BSCL2-205/207/210 BSCL2-201 Male (n= 7) Female (n=6) D% Male (n= 7) Female (n=6) D% Male (n= 7) Female (n=6) D% Frontal lobe R 1.27 ± 0.83 1.17 ± 0.62 0.02 ± 0.05 0 0.006 ± 0.005 0.005 ± 0.002 L 1.14 ± 0.87 0.79 ± 0.69 0.045 ± 0.14 * 0.124 ± 0.177 63 0.0089 ± 0.005 0.0074 ± 0.01 Parietal lobe R 1.27 ± 0.93 1.59 ± 0.68 0.028 ± 0.078 0.012 ± 0.029 0.0066 ± 0.0053 0.0099 ± 0.0044 L 1.12 ± 0.93 1.44 ± 0.85 0.074 ± 0.108 0.15 ± 0.20 0.0086 ± 0.0084 0.0126 ± 0.0078 Temporal lobe R 1.41 ± 0.74 * 0.899 ± 0.58 +57 0.023 ± 0.045 0.016 ± 0.038 0.0058 ± 0.0028 0.0044 ± 0.0030 L 1.185 ± 0.6 * 0.81 ± 0.49 +46 0.30 ± 0.20 * 0.059 ± 0.096 +408 0.0062 ± 0.0037 0.0045 ± 0.0035 Occipital lobe R 0.92 ± 0.7 1.2 ± 0.95 0.009 ± 0.024 0.15 ± 0.35 0.0041 ± 0.0024 0.0080 ± 0.0070 L 0.69 ± 0.58 1.06 ± 0.94 0.036 ± 0.037 0.097 ± 0.18 0.0072 ± 0.0061 0.0072 ± 0.0046 Insula R 1.51 ± 0.91 1.07 ± 0.88 0.40 ± 0.35 0.19 ± 0.20 0.0071 ± 0.0031 0.0059 ± 0.0049 L 1.18 ± 0.67 1.17 ± 0.73 0.109 ± 0.087 * 0.037 ± 0.064 +194 0.0087 ± 0.0077 0.0080 ± 0.0072 Amygdala R 1.24 ± 0.62 0.77 ± 0.60 0.067 ± 0.078 0.029 ± 0.038 0.0056 ± 0.0034 0.0039 ± 0.0028 L 1.39 ± 0.73 0.73 ± 0.59 0.034 ± 0.058 0.42 ± 0.11 0.0057 ± 0.0032 0.0046 ± 0.0036 Thalamus R 1.03 ± 0.49 0.87 ± 0.57 0.065 ± 0.086 0.069 ± 0.083 0.0084 ± 0.0072 0.0056 ± 0.0040 L 0.63 ± 0.36 0.71 ± 0.55 0.12 ± 0.056 0.05 ± 0.07 0.0189 ± 0.0289 0.0083 ± 0.0079 Caudate R 1.59 ± 0.56 1.31 ± 0.89 0.042 ± 0.094 0.047 ± 0.099 0.0158 ± 0.0143 0.0238 ± 0.0212 L 2.24 ± 0.95 1.40 ± 0.70 0.018 ± 0.048 0.037 ± 0.1 0.0139 ± 0.0058 0.0112 ± 0.0095 Putamen R 1.65 ± 0.66 1.2 ± 0.59 0.149 ± 0.208 0.093 ± 0.156 0.0098 ± 0.0044 0.0078 ± 0.0052 L 1.29 ± 0.51 1.30 ± 0.56 0.02 ± 0.03 0.125 ± 0.287 0.0075 ± 0.0037 0.0084 ± 0.0044 Hypothalamus R 0.97 ± 0.56 1.0 ± 0.76 0.108 ± 0.13 0.091 ± 0.166 0.0072 ± 0.0048 0.0083 ± 0.0067 L 0.87 ± 0.46 0.61 ± 0.43 0.13 ± 0.066 * 0.051 ± 0.084 +155 0.0080 ± 0.0064 0.0049 ± 0.0035 Pituitary 1.97 ± 0.79 2.08 ± 0.66 0.193 ± 0.270 0.089 ± 0.11 0.0099 ± 0.0037 * 0.0166 ± 0.0052 40 Cerebellum R 0.94 ± 0.80 1.44 ± 0.72 0.077 ± 0.13 0.25 ± 0.61 0.0076 ± 0.0067 * 0.0230 ± 0.0255 67 L 1.53 ± 0.84 1.51 ± 0.97 0.07 ± 0.155 0.042 ± 0.071 0.0116 ± 0.0090 0.0091 ± 0.0052 Mesencephalon R 0.53 ± 0.52 0.71 ± 0.53 0.198 ± 0.142 0.16 ± 0.11 0.0062 ± 0.0073 0.0084 ± 0.0059 L 0.90 ± 0.90 0.69 ± 0.63 0.066 ± 0.09 0.078 ± 0.099 0.0074 ± 0.0075 0.0062 ± 0.0058 Protuberance R 1.99 ± 0.95 1.32 ± 1.03 0.121 ± 0.256 0.027 ± 0.077 0.0123 ± 0.0071 0.0087 ± 0.0063 L 1.7 ± 0.75 1.39 ± 1.12 0.17 ± 0.17 0.21 ± 0.39 0.0140 ± 0.0090 0.0103 ± 0.0086 Medulla oblongata R 0.83 ± 0.63 0.54 ± 0.41 0.153 ± 0.156 0.076 ± 0.139 0.0043 ± 0.0044 0.0027 ± 0.0019 L 0.96 ± 0.64 0.64 ± 0.57 0.168 ± 0.16 0.084 ± 0.074 0.0051 ± 0.0049 0.0028 ± 0.0025 Spinal cord D 0.42 ± 0.32 0.37 ± 0.22 0.070 ± 0.052 0.040 ± 0.044 0.0017 ± 0.0009 0.0031 ± 0.0032 V 0.66 ± 0.46 * 0.25 ± 0.17 +164 0.182 ± 0.088 * 0.106 ± 0.066 +71 0.0044 ± 0.0027 0.0023 ± 0.0016 Bichat fat pad – 0.034 ± 0.010 0.033 ± 0.008 0.135 ± 0.054 0.095 ± 0.053 0.0004 ± 0.0002 0.0006 ± 0.0003 SC abdominal fat – 0.034 ± 0.034 0.016 ± 0.003 0.10 ± 0.047 * 0.059 ± 0.012 +69 0.0032 ± 0.0033 0.0028 ± 0.0026 SC lower limbs fat – 0.029 ± 0.009 0.030 ± 0.015 0.145 ± 0.042 0.144 ± 0.068 0.0016 ± 0.0007 0.0012 ± 0.0007 Visceral fat – 0.030 ± 0.013 * 0.020 ± 0.013 33 0.091 ± 0.028 0.090 ± 0.11 0.0012 ± 0.0007 0.0019 ± 0.0011 Rectus abdominis muscle – 0.047 ± 0.019 0.054 ± 0.008 0.092 ± 0.039 * 0.16 ± 0.08 42 0.0016 ± 0.0009 0.0016 ± 0.0007 Gastrocnemius muscle – 0.034 ± 0.016 0.035 ± 0.019 0.056 ± 0.056 0.039 ± 0.030 0.0031 ± 0.0051 0.0073 ± 0.0123 Myocardium – 0.016 ± 0.009 0.014 ± 0.003 0.037 ± 0.01 0.035 ± 0.022 0.0005 ± 0.0002 0.0004 ± 0.0002 Liver – 0.021 ± 0.01 0.018 ± 0.009 0.041 ± 0.022 0.036 ± 0.024 0.0005 ± 0.0004 0.0005 ± 0.0003 Vagus nerve – 0.10 ± 0.03 * 0.07 ± 0.03 +43 0.117 ± 0.032 * 0.064 ± 0.031 +83 0.0005 ± 0.0002 0.0006 ± 0.0003 Trigeminal nerve – 0.25 ± 0.18 0.23 ± 0.09 0.16 ± 0.10 * 0.077 ± 0.070 +108 0.0021 ± 0.0019 0.0017 ± 0.0013 Renal cortex – 0.085 ± 0.026 0.064 ± 0.014 0.57 ± 1.05 0.16 ± 0.052 0.0029 ± 0.0023 0.0018 ± 0.0009 Renal medulla – 0.089 ± 0.053 0.096 ± 0.051 0.42 ± 0.56 0.39 ± 0.46 0.0037 ± 0.0025 0.0072 ± 0.0064 Gonads – 0.51 ± 0.14 * 0.33 ± 0.66 +54 1.17 ± 0.42 * 0.044 ± 0.051 +2559 0.0089 ± 0.0030 * 0.0020 ± 0.003 +345 Relative expression of the encephalic and non-encephalic post-mortem tissues in female and male subjects, * p< 0.05. All samples were analyzed in duplicate, n= 13. Results were normalized for the 18S gene. 126 S. Sa ´nchez-Iglesias et al. / Neuroscience 396 (2019) 119–137 Table 5. BSCL2 transcripts expression in young and old subjects (median age 61 years) Tissues Side BSCL2-203 BSCL2-205/207/210 BSCL2-201 <61 y. (n=6) 61 y. (n=7) D% <61 y. (n=6) 61 y. (n=7) D% <61 y. (n=6) 61 y. (n=7) D% Frontal lobe R 1.68 ± 0.69 * 0.83 ± 0.49 51 0.023 ± 0.053 0.0003 ± 0.001 0.0079 ± 0.004 * 0.004 ± 0.0025 49 L 0.99 ± 0.72 0.96 ± 0.89 0.07 ± 0.18 0.088 ± 0.15 0.009 ± 0.0049 0.0075 ± 0.0096 Parietal lobe R 1.71 ± 0.76 1.18 ± 0.83 0.03 ± 0.08 0.012 ± 0.03 0.009 ± 0.004 0.007 ± 0.0055 L 1.39 ± 1.08 1.17 ± 0.73 0.15 ± 0.19 0.076 ± 0.124 0.011 ± 0.009 0.01 ± 0.007 Temporal lobe R 1.5 ± 0.57 * 0.9 ± 0.72 40 0.014 ± 0.032 0.024 ± 0.048 0.0065 ± 0.002 * 0.0038 ± 0.0028 42 L 1.48 ± 0.28 * 0.61 ± 0.43 58 0.33 ± 0.20 * 0.069 ± 0.09 79 0.0076 ± 0.0025 * 0.0035 ± 0.003 54 Occipital lobe R 1.14 ± 0.66 0.97 ± 0.95 0.02 ± 0.046 0.12 ± 0.32 0.005 ± 0.0028 0.006 ± 0.0068 L 0.93 ± 0.77 0.8 ± 0.80 0.019 ± 0.025 0.102 ± 0.17 0.0083 ± 0.0064 0.0061 ± 0.004 Insula R 1.72 ± 0.79 * 0.95 ± 0.87 45 0.42 ± 0.3 0.19 ± 0.27 0.0084 ± 0.0028 0.0052 ± 0.004 L 1.25 ± 0.55 1.11 ± 0.79 0.099 ± 0.1 0.054 ± 0.06 0.0081 ± 0.0068 0.0086 ± 0.0079 Amygdala R 1.44 ± 0.39 * 0.66 ± 0.62 54 0.079 ± 0.078 0.023 ± 0.035 0.0064 ± 0.0028 * 0.0033 ± 0.0028 48 L 1.59 ± 0.53 * 0.65 ± 0.63 59 0.072 ± 0.1 * 0.0019 ± 0.007 97 0.0075 ± 0.0029 * 0.0029 ± 0.0019 61 Thalamus R 1.21 ± 0.26 * 0.73 ± 0.59 40 0.087 ± 0.089 0.049 ± 0.076 0.0099 ± 0.0067 0.0046 ± 0.0039 L 0.7 ± 0.24 0.64 ± 0.58 0.135 ± 0.06 * 0.049 ± 0.055 64 0.0213 ± 0.030 0.0077 ± 0.0076 Caudate R 1.85 ± 0.27 * 1.12 ± 0.83 39 0.049 ± 0.10 0.04 ± 0.092 0.0121 ± 0.0084 0.0258 ± 0.0214 L 2.36 ± 0.73 * 1.41 ± 0.87 40 0.022 ± 0.05 0.031 ± 0.093 0.0160 ± 0.0044 * 0.0097 ± 0.0087 39 Putamen R 1.81 ± 0.35 * 1.13 ± 0.71 38 0.10 ± 0.16 0.14 ± 0.21 0.0108 ± 0.0031 0.0072 ± 0.005 L 1.48 ± 0.26 1.13 ± 0.63 0.022 ± 0.035 0.108 ± 0.27 0.0086 ± 0.003 0.0072 ± 0.004 Hypothalamus R 1.2 ± 0.35 0.79 ± 0.78 0.099 ± 0.14 0.101 ± 0.15 0.0089 ± 0.0035 0.0066 ± 0.0069 L 1.13 ± 0.27 * 0.41 ± 0.30 64 0.097 ± 0.075 0.091 ± 0.09 0.0101 ± 0.0055 * 0.0035 ± 0.0030 65 Pituitary – 2.05 ± 0.46 2.0 ± 0.89 0.22 ± 0.28 0.08 ± 0.11 0.0121 ± 0.0025 0.0137 ± 0.007 Cerebellum R 1.11 ± 0.88 1.22 ± 0.73 0.045 ± 0.056 0.26 ± 0.57 0.008 ± 0.006 0.0199 ± 0.024 L 1.63 ± 0.72 1.42 ± 1.00 0.08 ± 0.166 0.036 ± 0.067 0.013 ± 0.0085 0.0079 ± 0.0055 Mesencephalon R 0.64 ± 0.51 0.58 ± 0.54 0.23 ± 0.13 0.14 ± 0.11 0.008 ± 0.007 0.006 ± 0.005 L 1.14 ± 0.93 0.52 ± 0.47 0.117 ± 0.11 * 0.032 ± 0.052 73 0.0097 ± 0.008 0.0043 ± 0.0038 Protuberance R 2.33 ± 0.50 * 1.12 ± 1.03 52 0.128 ± 0.28 0.033 ± 0.073 0.014 ± 0.0055 0.0077 ± 0.0066 L 2.1 ± 0.39 * 1.09 ± 1.01 48 0.194 ± 0.18 0.185 ± 0.37 0.0173 ± 0.007 * 0.0078 ± 0.0077 55 Medulla oblongata R 1.12 ± 0.43 * 0.35 ± 0.37 69 0.156 ± 0.17 0.085 ± 0.13 0.0056 ± 0.004 * 0.0018 ± 0.0017 68 L 1.22 ± 0.57 * 0.47 ± 0.43 61 0.17 ± 0.17 0.095 ± 0.089 0.0066 ± 0.0047 * 0.0018 ± 0.0014 72 Spinal cord D 0.42 ± 0.17 0.38 ± 0.35 0.053 ± 0.052 0.059 ± 0.05 0.0018 ± 0.0006 0.003 ± 0.003 V 0.72 ± 0.44 * 0.26 ± 0.23 63 0.196 ± 0.09 * 0.104 ± 0.058 47 0.005 ± 0.0022 * 0.0021 ± 0.0018 58 Bichat fat pad – 0.033 ± 0.009 0.033 ± 0.009 0.136 ± 0.056 0.1 ± 0.044 0.0004 ± 0.0002 0.0005 ± 0.0003 SC abdominal fat – 0.036 ± 0.036 0.017 ± 0.007 0.095 ± 0.041 * 0.073 ± 0.041 23 0.0023 ± 0.002 0.0036 ± 0.0033 SC lower limbs fat – 0.029 ± 0.007 0.03 ± 0.015 0.167 ± 0.053 0.124 ± 0.049 0.0017 ± 0.0006 * 0.0011 ± 0.0006 35 Visceral fat – 0.03 ± 0.01 * 0.020 ± 0.01 33 0.130 ± 0.086 * 0.056 ± 0.039 57 0.0013 ± 0.0009 0.0017 ± 0.001 (continued on next page) S. Sa ´nchez-Iglesias et al. / Neuroscience 396 (2019) 119–137 127 recently showed that PEX16 is a PPARG target gene whose expression regulates peroxisome number and lipid metabolism, and demonstrated that it is also required for adipogenesis (Hofer et al., 2017). Studies in rodents have shown the beneficial effects of the pharmacological activation of peroxisome proliferator-activated receptors in Parkinson’s disease and dyskinesia models (Barbiero et al., 2014; Grover et al., 2013). The profiles observed in the confocal images suggest that seipin is involved in peroxisome biogenesis, probably at an early phase. The juxtaposition of seipin and PEX16 observed in some neurons is consistent with the potential close proximity of peroxisomes and lipid droplet biogenesis areas (Binns et al., 2006), suggesting that peroxisomes and seipin are intimately associated. We can further speculate that peroxisomes with vesicle-like shapes may be pre-peroxisomal vesicles emerging from the ER. It should be noted that the structure of the lipid droplets and the peroxisomes are similar, both emerge from the ER, and there is a dialog between both organelles (Shai et al., 2016). In this line, very recently and during the course of the review of this manuscript, Wang et al. 2018 identify in yeasts Pex30 as a factor cooperating with seipin in the biogenesis of both lipid droplets and pre-peroxisomal vesicles from the ER. In our opinion, this recent Wang’s paper reinforces our hypothesis about the role of seipin in peroxisomes biogenesis. On the other hand, peroxisomes are very abundant in neurons and play a key role in protection against oxidative stress, and are also critical for the synthesis of phospholipids. Finally, the peroxisome biomarker PEX16 is barely detectable in the brain of the PELD case, where seipin is also scarce. Taken together, these data may suggest that seipin is playing a role in peroxisome biogenesis as a regulator of peroxisomal protein sorting during the first steps of biogenesis from the ER, similarly to what happens in the nascent lipid droplets (Shai et al., 2016; Wang et al. 2018), or could act as an essential factor in the recruitment of other peroxisomal membrane proteins to the ER together with PEX16, which subsequently transports them to the peroxisomes (Kim and Mullen, 2013). Correlation studies of gene expression, lentiviral overexpression experiments, as well as immunohistochemical and localization studies have allowed us to consolidate our hypotheses regarding the pathogenetic mechanisms of Celia’s Encephalopathy (Ruiz-Riquelme et al., 2015). Seipin appears to have specific functions in the CNS, and could act as a neuroprotector, modulating the expression of SOD and CAT via PPARG by unknown mechanisms and promoting the proliferation of peroxisomes, Fig. 10. Seipin topology and homology. (A) The 462-residue-long form of seipin has two transmembrane helices, the Nand C-cytosolic-termini appear to be variable among species, but the central domain loop at the lumen of the ER is highly conserved (B). CYT: cytoplasmic, TMD: transmembrane, LUM: lumenal. 134 S. Sa ´nchez-Iglesias et al. / Neuroscience 396 (2019) 119–137 Fig. 10 (continued) S. Sa ´nchez-Iglesias et al. / Neuroscience 396 (2019) 119–137 135 thus decreasing free radicals and consequently protecting against neurodegeneration. The fact that seipin may be playing a role in peroxisome biogenesis makes them an interesting potential therapeutic target. ACKNOWLEDGMENTS We are indebted to the parents of the patient for their collaboration in this study. We acknowledge confocal technical assistance by Mercedes Rivas Cascallar. This work was supported by the Instituto de Salud Carlos III and the European Regional Development Fund, FEDER (grants number PI10/02873 and PI13/00314), by the Consellerı´a de Industria, Xunta de Galicia (grants number 10PXIB208013PR and ED341b 2017/19), and by Fundacio ´n Mutua Madrilen˜ a (Call 2015). COMPETING INTERESTS The authors have no conflicts of interest to declare. REFERENCES Alaei MR, Talebi S, Ghofrani M, Taghizadeh M, Keramatipour M (2016) Whole exome sequencing reveals a BSCL2 mutation causing progressive encephalopathy with lipodystrophy (PELD) in an Iranian pediatric patient. Iran Biomed J 20:295–301. Araujo-Vilar D, Domingo-Jime ´nez R, Ruibal A ´, Aguiar P, Iba ´n˜ ez-Mico ´ S, Garrido-Pumar M, Martı´nez-Olmos MA ´,Lo ´pez-Soler C, Guillı´nAmarelle C, Gonza ´lez-Rodrı´guez M, et al. (2018) Association of metreleptin treatment and dietary intervention with neurological outcomes in Celia’s encephalopathy. Eur J Hum Genet 26:396–406. https://doi.org/10.1038/s41431-017-0052-8. Barbiero JK, Santiago RM, Persike DS, da Silva Fernandes MJ, Tonin FS, da Cunha C, Lucio Boschen S, Lima MM, Vital MA (2014) Neuroprotective effects of peroxisome proliferatoractivated receptor alpha and gamma agonists in model of parkinsonism induced by intranigral 1-methyl-4-phenyl-1,2,3,6tetrahyropyridine. Behav Brain Res 274:390–399. https://doi.org/ 10.1016/j.bbr.2014.08.014. Binns D, Januszewski T, Chen Y, Hill J, Markin VS, Zhao Y, Gilpin C, Chapman KD, Anderson RG, Goodman JM (2006) An intimate collaboration between peroxisomes and lipid bodies. J Cell Biol 173:719–731. https://doi.org/10.1083/jcb.200511125. Cartwright BR, Goodman JM (2012) Seipin: from human disease to molecular mechanism. J Lipid Res 53:1042–1055. https://doi.org/ 10.1194/jlr.R023754. Cipolla CM, Lodhi IJ (2017) Peroxisomal dysfunction in age-related diseases. Trends Endocrinol Metab 28:297–308. https://doi.org/ 10.1016/j.tem.2016.12.003. Ebihara C, Ebihara K, Aizawa-Abe M, Mashimo T, Tomita T, Zhao M, Gumbilai V, Kusakabe T, Yamamoto Y, Aotani D (2015) Seipin is necessary for normal brain development and spermatogenesis in addition to adipogenesis. Hum Mol Genet 24:4238–4249. https:// doi.org/10.1093/hmg/ddv156. Garfield AS, Chan WS, Dennis RJ, Ito D, Heisler LK, Rochford JJ (2012) Neuroanatomical characterisation of the expression of the lipodystrophy and motor-neuropathy gene Bscl2 in adult mouse brain. PLoS One 7(9). https://doi.org/10.1371/journal.pone. 0045790 e45790. Grover S, Kumar P, Singh K, Vikram V, Budhiraja RD (2013) Possible beneficial effect of peroxisome proliferator-activated receptor (PPAR)-alpha and gamma agonist against a rat model of oral dyskinesia. Pharmacol Biochem Behav 111:17–23. https://doi. org/10.1016/j.pbb.2013.08.001. Guillen-Navarro E, Sa ´nchez-Iglesias S, Domingo-Jime ´nez R, Victoria B, Ruiz-Riquelme A, Ra ´bano A, Loidi L, Beiras A, Gonza ´lezMe ´ndez B, Ramos A, et al. (2013) A new seipin-associated neurodegenerative syndrome. J Med Genet 50:401–409. https:// doi.org/10.1136/jmedgenet-2013-101525. Hofer DC, Pessentheiner AR, Pelzmann HJ, Schlager S, MadreiterSokolowski CT, Kolb D, Eichmann TO, Rechberger G, Bilban M, Graier WF, et al. (2017) Critical role of the peroxisomal protein PEX16 in white adipocyte development and lipid homeostasis. Biochim Biophys Acta Mol Cell Biol Lipids 1862:358–368. https:// doi.org/10.1016/j.bbalip.2016.12.009. Hua R, Gidda SK, Aranovich A, Mullen RT, Kim PK (2015) Multiple domains in PEX16 mediate its trafficking and recruitment of peroxisomal proteins to the ER. Traffic 16:832–852. https://doi. org/10.1111/tra.12292. Ito D, Suzuki N (2009) Seipinopathy: a novel endoplasmic reticulum stress-associated disease. Brain 132:8–15. https://doi.org/ 10.1093/brain/awn216. Kim KK, Adelstein RS, Kawamoto S (2009) Identification of neuronal nuclei (NeuN) as Fox-3, a new member of the Fox-1 gene family of splicing factors. J Biol Chem 284:31052–31061. https://doi.org/ 10.1074/jbc.M109.052969. Kim KK, Nam J, Mukouyama YS, Kawamoto S (2013) Rbfox3regulated alternative splicing of Numb promotes neuronal differentiation during development. J Cell Biol 200:443–458. https://doi.org/10.1083/jcb.201206146. Kim PK, Mullen RT (2013) PEX16: a multifaceted regulator of peroxisome biogenesis. Front Physiol 4:241. https://doi.org/ 10.3389/fphys.2013.00241. Kim PK, Mullen RT, Schumann U, Lippincott-Schwartz J (2006) The origin and maintenance of mammalian peroxisomes involves a de novo PEX16-dependent pathway from the ER. J Cell Biol 173:521–532. https://doi.org/10.1083/jcb.200601036. Li G, Zhou L, Zhu Y, Wang C, Sha S, Xian X, Ji Y, Liu G, Chen L (2015) Seipin knockout in mice impairs stem cell proliferation and progenitor cell differentiation in the adult hippocampal dentate gyrus via reduced levels of PPARgamma. Dis Model Mech 8:1615–1624. https://doi.org/10.1242/dmm.021550. Liu X, Xie B, Qi Y, Du X, Wang S, Zhang Y, Paxinos G, Yang H, Liang H (2016) The expression of SEIPIN in the mouse central nervous system. Brain Struct Funct 221:4111–4127. https://doi.org/ 10.1007/s00429-015-1151-3. Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2(Delta Delta C (T)) method. Methods 25:402–408. https://doi.org/10.1006/ meth.2001.1262. Lo ´pez-Otı´n C, Blasco MA, Partridge L, Serrano M, Kroemer G (2013) The hallmarks of aging. Cell 153:1194–1217. https://doi.org/ 10.1016/j.cell.2013.05.039. Magre J, Dele ´pine M, Khallouf E, Gedde-Dahl Jr T, Van Maldergem L, Sobel E, Papp J, Meier M, Me ´garbane ´A, Bachy A, et al. (2001) Identification of the gene altered in Berardinelli-Seip congenital lipodystrophy on chromosome 11q13. Nat Genet 28:365–370. https://doi.org/10.1038/ng585. Nordgren M, Fransen M (2014) Peroxisomal metabolism and oxidative stress. Biochimie 98:56–62. https://doi.org/10.1016/j. biochi.2013.07.026. Qian Y, Yin J, Hong J, Li G, Zhang B, Liu G, Wan Q, Chen L (2016) Neuronal seipin knockout facilitates Abeta-induced neuroinflammation and neurotoxicity via reduction of PPARgamma in hippocampus of mouse. J Neuroinflammation 13:145. https://doi.org/10.1186/s12974-016-0598-3. Ruiz-Riquelme A, Sa ´nchez-Iglesias S, Ra ´bano A, Guille ´n-Navarro E, Domingo-Jime ´nez R, Ramos A, Rosa I, Senra A, Nilsson P, Garcı´aA ´, et al. (2015) Larger aggregates of mutant seipin in Celia’s encephalopathy, a new protein misfolding neurodegenerative disease. Neurobiol Dis 83:44–53. https://doi. org/10.1016/j.nbd.2015.08.006. Salo VT, Belevich I, Li S, Karhinen L, Vihinen H, Vigouroux C, Magre ´ J, Thiele C, Ho ¨ltta ¨-Vuori M, Jokitalo E, Ikonen E (2016) Seipin regulates ER-lipid droplet contacts and cargo delivery. EMBO J 35:2699–2716. https://doi.org/10.15252/embj.201695170. Santos MJ, Quintanilla RA, Toro A, Grandy R, Dinamarca MC, Godoy JA, Inestrosa NC (2005) Peroxisomal proliferation protects from 136 S. Sa ´nchez-Iglesias et al. / Neuroscience 396 (2019) 119–137 b-amyloid neurodegeneration. J Biol Chem 280:41057–41068. https://doi.org/10.1074/jbc.M505160200. Shai N, Schuldiner M, Zalckvar E (2016) No peroxisome is an island – peroxisome contact sites. Biochim Biophys Acta Mol Cell Biol Lipids 1863:1061–1069. https://doi.org/10.1016/j.bbamcr.2015. 09.016. Sim MF, Talukder MM, Dennis RJ, O’Rahilly S, Edwardson JM, Rochford JJ (2013) Analysis of naturally occurring mutations in the human lipodystrophy protein seipin reveals multiple potential pathogenic mechanisms. Diabetologia 56:2498–2506. https://doi. org/10.1007/s00125-013-3029-3. Sim MF, Talukder MU, Dennis RJ, Edwardson JM, Rochford JJ (2014) Analyzing the functions and structure of the human lipodystrophy protein seipin. Methods Enzymol 537:161–175. https://doi.org/10.1016/B978-0-12-411619-1.00009-4. Victoria B, Cabezas-Agrı´cola JM, Gonza ´lez-Me ´ndez B, Lattanzi G, Del Coco R, Loidi L, Barreiro F, Calvo C, Lado-Abeal J, Arau ´joVilar D (2010) Reduced adipogenic gene expression in fibroblasts from a patient with type 2 congenital generalized lipodystrophy. Diabet Med 27:1178–1187. https://doi.org/10.1111/j.14645491.2010.03052.x. Wang H, Becuwe M, Housden BE, Chitraju C, Porras AJ, Graham MM, Liu XN, Thiam AR, Savage DB, Agarwal AK, et al. (2016) Seipin is required for converting nascent to mature lipid droplets. eLife 5. https://doi.org/10.7554/eLife. 16582. Wang S, Idrissi FZ, Hermansson M, Grippa A, Ejsing CS, Carvalho P (2018) Seipin and the membrane-shaping protein Pex30 cooperate in organelle budding from the endoplasmic reticulum. Nat Commun 9:2939. https://doi.org/10.1038/s41467-018-05278-2. Zhou L, Chen T, Li G, Wu C, Wang C, Li L, Sha S, Chen L, Liu G, Chen L (2016) Activation of PPARgamma ameliorates spatial cognitive deficits through restoring expression of AMPA receptors in seipin knock-out mice. J Neurosci. 36:1242–1253. https://doi. org/10.1523/JNEUROSCI.3280-15.2016. (Received 26 May 2018, Accepted 3 November 2018) (Available online 15 November 2018) S. Sa ´nchez-Iglesias et al. / Neuroscience 396 (2019) 119–137 137