HCT116 colorectal and MCF7 brest cancer cell lines xenografted into zebrafish embryos gives insight into the importance of microenviroment in tumor growth and metastasis for a future use of the model in clinical research

TESE DE DOUTORAMENTO HCT116 COLORECTAL AND MCF7 BREAST CANCER CELL LINES XENOGRAFTED INTO ZEBRAFISH EMBRYOS GIVE INSIGHT INTO THE IMPORTANCE OF MICROENVIRONMENT IN TUMOR GROWTH AND METASTASIS FOR A FUTURE USE OF THE MODEL IN CLINICAL RESEARCH Pablo Cabezas Sáinz ESCOLA DE DOUTORAMENTO INTERNACIONAL PROGRAMA DE DOUTORAMENTO EN MEDICINA MOLECULAR LUGO 2019 DECLARACIÓN DO AUTOR/A DA TESE HCT116 colorectal and MCF7 breast cancer cell lines xenografted into zebrafish embryos give insight into the importance of microenvironment in tumor growth and metastasis for a future use of the model in clinical research D./Dna. Pablo Cabezas Sáinz Presento a miña tese, seguindo o procedemento axeitado ao Regulamento, e declaro que: 1) A tese abarca os resultados da elaboración do meu traballo. 2) De selo caso, na tese faise referencia ás colaboracións que tivo este traballo. 3) A tese é a versión definitiva presentada para a súa defensa e coincide coa versión enviada en formato electrónico. 4) Confirmo que a tese non incorre en ningún tipo de plaxio doutros autores nin de traballos presentados por min para a obtención doutros títulos. En Lugo, 1 de Abril de 2019 Asdo Pablo Cabezas Sáinz AUTORIZACIÓN DO DIRECTOR / TITOR DA TESE HCT116 colorectal and MCF7 breast cancer cell lines xenografted into zebrafish embryos give insight into the importance of microenvironment in tumor growth and metastasis for a future use of the model in clinical research D./Dna. Laura Elena Sánchez Piñón D./Dna. Laura Muinelo Romay D./Dna. Rafael López López INFORMA/N: Que a presente tese, correspóndese co traballo realizado por D/Dna. Pablo Cabezas Sáinz, baixo a miña dirección, e a utorizo a súa presentación , considerando que reúne os r equisitos esixidos no R egulamento de Estudos de Doutoramento da USC, e que como director desta non incorre nas causas de abstención establecidas na Lei 40/2015. En Lugo, 1 de Abril de 2019 Asdo. Laura Elena Sánchez Piñón Asdo. Laura Muinelo Romay Asdo. Rafael López López COMPETING INTERESTS The PhD student declare that he has no competing interests in relation with the thesis presented. ‘Aut viam inveniam aut faciam’ A mi familia INDEX Chapter I - General Introduction 1. Zebrafish………………………………………………….……………...11 1.1 Taxonomy and distribution in the wild………………….……...11 1.2 Description……………………………………………......……13 1.3 Laboratory life cycle…………………………………...………15 1.4 Use of zebrafish for biomedical studies………………………...17 1.4.1 Cancer…………………….………………………....17 1.4.2 Drug discovery and toxicity…………………….…...18 1.4.3 Modeling human genetic diseases………………..….20 2. Cancer…………………………………………………………..…….….22 2.1 Hallmarks of cancer…………………………………................23 2.1.1 Sustained cell growth signaling……………….….….23 2.1.2 Unaffected by anti-proliferation signaling………..…23 2.1.3 Cell-death resistance……………………………...…24 2.1.4 Induction of angiogenesis……………………..…….24 2.1.5 Endless replication……………………………….….25 2.1.6 Invasion capacity and metastasis…………...........…..25 2.1.7 Immune evasion…………………………….……….28 2.1.8 Reprogramming cellular metabolism……….……….29 2.2 Cancer etiology………………………………………………...30 2.2.1 Heredity………………………………….………….30 2.2.2 Environmental factors……………………………….30 2.2.2.1 Chemicals……………………….……..…30 2.2.2.2 Lifestyle…………………………………..32 2.2.2.3 Infection and inflammation……………….32 2.2.3 Therapies………………………………………...…..32 2.2.3.1 Chemotherapy………………………...…..32 2.2.3.1.1 Empirical…………………...….33 2.2.3.1.2 Rational……………………...…33 2.2.3.1.3 Logistic…………………..…….34 2.2.3.1.4 Targeted…………………….….34 2.2.3.2 Radiation…………………………...……..34 2.3 Incidence of the disease around the world……………….…….36 2.4 Tumor microenvironment…………………………….………..36 2.4.1 Principal cellular components of microenvironment………………………………………...38 2.4.1.1 Cancer associated fibroblasts (CAFs)…….38 2.4.1.2 Endothelial cells and pericytes…….…...…39 2.4.1.3 Tumor associated macrophages (TAMs)....39 2.4.1.3.1 Facilitation of metastasis…….....42 2.4.1.3.2 Inhibition of the adaptive and innate immunity…………....…...42 2.4.1.3.3 Pro-angiogenic……………...….43 3. Xenotransplantation technique in zebrafish………………………..…….44 3.1 First steps in xenotransplants………………………………...…46 3.2 Advantages and limitations of xenograft assays in zebrafish…...48 3.2.1 Advantages………………………………………….50 3.2.2 Disadvantages……………………………….………50 3.3 Zebrafish, xenograft assays and personalized cancer medicine…………………………………………..........…50 3.4 Parameters of the xenotransplantation technique………....……52 3.4.1 Incubation temperature………………………..…….52 3.4.2 Image analysis………………………………….……52 3.5 Drug screening…………………………………………...…….54 3.5.1 Targets………………………………………………56 3.5.1.1 Physiology………………………….…….56 3.5.1.2 Drug distribution, metabolism and excretion………………………………………….56 3.6 Cell-host interaction……………………………...……………56 3.6.1 Innate immune system of the zebrafish embryos…...58 Chapter II - Objectives…………………...………………………...59 LIST OF ABBREVIATIONS 5-FU 5-Fluorouracil ADME-Tox Absorption, distribution, metabolism, excretion and toxicity ATCC American type culture collection ATP Adenosine triphosphate BEC Blood endothelial cells BM Bone marrow CAF Cancer associated fibroblast CHT Caudal hematopoietic tissue CSC Cancer stem cell CSF-1 Macrophage stimulation factor-1 CTC Circulating tumor cells DMSO Dimethyl sulfoxide DNA Deoxyribonucleic acid DPF Days post fertilization DPI Days post injection ECM Extracellular matrix EGF Epidermal growth factor EGF Epithelial growth factor EMT Epithelial–mesenchymal transition ENU N-ethyl-N-nitrosourea FAP Fibroblast activating protein FBS Fetal bovine serum FET Fish embryo acute toxicity test FGF Fibroblast growth factor GFP Green fluorescent protein GMV GFP intensity medium value HPC Hematopoietic progenitor cells HPI Hours post injection IFN Interferon IGF-1 Insulin-like growth factor-1 IL Interleukin IQR Interquartile range LEC Lymphatic endothelial cells LET Linear energy transfer MDSC Myeloid-derived suppressor cells MET Mesenchymal-to-epithelial transition MMP Metalloproteinase MSC Mesenchymal stem cells MTT 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide colorimetric assay nGFP Number of GFP pixels NK Natural killer NO Nitric oxide OECD Organization for Economic Cooperation and Development OXPHOS Oxidative phosphorylation PDGF Platelet-derived growth factor PDX Patient derived xenograft PI Proliferation index POU1F1 Homeobox 1 transcription factor RB Retinoblastoma protein RFP Red fluorescent protein RNA Ribonucleic acid ROS Reactive oxygen species RT Radiotherapy SDF-1 Stroma cell-derived factor-1 SDTW Salt dechlorinate tap water sgRNA Single guide RNA TAM Tumor associated macrophages TEM Tie2 expressing macrophages TGF-β Transforming growth factor beta TME Tumor microenvironment TNF Tumor necrosis factor VEGFR Vascular Endothelial Growth Factor Receptor WHO World Health Organization ABSTRACT In the last decades, zebrafish has emerged as one of the best tools for modeling different human diseases due to his genetic similarity (75% of orthologous genes), establishing a viable, fast and low-cost platform to test different strategies with the objective of getting a deeper insight into the mechanisms of action that lays underneath the diseases. One of the most studied diseases nowadays is cancer, a heterogeneous disease that constitutes a big deal for the oncologists all over the world, due to his complex behavior that corresponds with individual differences between patients. For this reason, zebrafish has been used in cancer research by means of the xenograft technique (injection of human cancer cells in embryos or adults of this model organism) since 2005, when Haldi et al. demonstrated that the injection of human cancer cells inside the yolk of the zebrafish embryo was reliable, being these cells able to proliferate. Since then, the number of publications in which people perform xenografts with human cancer cells lines, patient derived xenografts (PDX) or microenvironment components is constantly rising. The objective of this technique is to simulate a human-like microenvironment inside a model organism in which cancer cells from the patient could be able to proliferate, migrate and metastasize in different places providing a valuable tool for testing chemotherapeutic drugs with the objective of treating cancer patients with a more personalized approach, spending less time and costs and reaching more efficiency than the ‘mouse avatars’. This technology could be implemented in the hospitals all over the world to help the oncologists to make a better decision based on more robust data. As long as the xenograft technique has been implemented in zebrafish, mentioned before, there have been improvements to this technique and its experimental conditions. Nevertheless, there are some bottle necks that should be addressed with the objective of getting a more robust and informative technique in order to establish it in a near future in the personalized medicine field. One of the disadvantages of the xenograft technique is the one related to the incubation temperature of the embryos, trying to get a balance between their normal developmental temperature and the proper temperature of the injected cells. On the other hand, a more accurate and faster software for image analysis is required to track and quantify the injected cells in a more efficient way. Finally, it is important to be able to mimic the tumor microenvironment inside of the embryo by co-injecting different tumor components like macrophages or fibroblasts to determine how they behave against some therapies and, in this way, better reproduce the native state of the tumor inside the human body. Chapter I - General Introduction 11 CHAPTER I - GENERAL INTRODUCTION 1. ZEBRAFISH Zebrafish (Danio rerio) (Hamilton, 1822) is a freshwater fish, belonging to the Danio genus, which is native from the streams of the southeastern Himalayan region, including India, Pakistan, Bangladesh, Nepal and Myanmar. Zebrafish belongs to the family Cyprinidae of the order Cypriniformes (McCluskey and Postlethwait, 2015, Stock et al. 2007). Zebrafish owns its name because of its morphology, being fusiform, with horizontal stripes on each side, resembling a zebra. On the one hand, males have torpedo shape, being thinner and smaller; on the other hand, females are larger than the males and have a small white belly, containing the reproductive organs and the eggs (Talwar and Jhingran, 1991). The normal temperature of these fishes ranges between 12ºC and 39ºC in nature, while the best temperature for their development and healthy behavior in controlled conditions is 28’5ºC (Parichy, 2015, Westerfield, 2000). 1.1 TAXONOMY AND DISTRIBUTION IN THE WILD Zebrafish (Danio rerio) belongs to the kingdom Animalia, phylum Chordata, class Actinopterygii, order Cypriniformes, family Cyprinidae, subfamily Danionidae, genus Danio and species D. rerio. The name of this small fish, Danio, derives from the Bengali name ‘dhani’, which means ‘of the ricefield’ (Spence et al., 2008). The genus Danio, conforms a wide range of species, being different from zebrafish in pigmentation, size, morphology and behavior. As mentioned before, zebrafish has been described for the first time by Hamilton in 1822, with the name of Brachydanio rerio. This name has been used for many CABEZAS SÁINZ, PABLO 12 years and appears in the principal manuals for zebrafish all over the world (Westerfield, 2000). Recently, some studies were published giving the right name to the zebrafish, Danio rerio, and conforming a phylogenetic tree where the species most related to the zebrafish is Figure 1. Classification and phylogeography of Danio species. Danio rerio is mainly located in the west part, south of the Himalayan mountains, in Ganges and Brahmaputra rivers (McCluskey and Postlethwait, 2015. With permission of Oxford University Press). Chapter I - General Introduction 13 Danio aesculapii (Fig. 1) (McCluskey and Postlethwait, 2015). The biogeography locations of the Danio species are found across southeast Asia, each of the species normally belonging to one specific hydrological base. In the case of Danio rerio, the range of locations is wider, distributed all over India and the Ganges/Brahmaputra rivers, in the southern part of the Himalayan mountains (Fig. 1) and covers a range of altitudes from sea level to 1000m (McCluskey and Postlethwait, 2015). 1.2 DESCRIPTION Zebrafish is a small fish, usually not surpassing the 40mm of length. They have a fusiform and lateral compressed body, with the mouth pointing upwards and the lower jaw being more protruded than the upper one, in order to feed themselves in the water surface. In zebrafish, there are three types of cells responsible for the different color patterns: dark blue melanophores, gold xantophores and iridescent iridophores (Spence et al., 2008). Figure 2. Zebrafish dimorphisms. (A) Male zebrafish with a yellow coloration around the pectoral and anal fin. (B) Female zebrafish, with rounded body and a white belly (adapted from Parichy, 2015. From eLife, Creative Commons License). CABEZAS SÁINZ, PABLO 20 metabolized and excreted. Due to this capacity, a high number of compounds can be easily and rapidly tested in zebrafish to follow the next step in mammals (Goldstone et al., 2010; Li et al., 2011). 1.4.3 Modeling human genetic diseases Zebrafish has greatly evolved on the field of genetic manipulation of specific genes to study the consequences of human diseases in a model organism. On one hand, mutagenesis via ENU (N-ethyl-Nnitrosourea) has been the preferred choice over radiation (Wyatt et al., 2015). Nevertheless, this technique has some drawbacks regarding the identification of the site of mutagenesis and the affected gene, because the mutations generated via this technique of chemical mutagenesis are random. Apart from that, the duplication suffered by the ancestor of zebrafish 200 million years ago, gave these fishes two paralogues for many genes, but in mammals being a single orthologue, so the mutation in one of the paralogues does not need to affect the expression, suffering compensations from the other copies (Santini et al., 2009). On the other hand, there are different types of techniques that gained relevance on modeling human genetic diseases or alterations by knocking-down these genes responsible for the diseases in zebrafish and depending on the duration of the alteration of gene expression, are classified in transient or permanent (Fig. 6): -Morpholino oligonucleotides (also called antisense oligos) are a synthetic RNA where the deoxyribose ring is replaced with a morpholine ring, having water solubility, immune to nucleases and low production costs associated (Summerton and Weller, 1997). The main function of the antisense morpholinos is to decrease the gene expression of the gene of interest when we inject them into fertilized zebrafish eggs by either: splice blocking (inhibiting the spliceosome components and impeding pre-mRNA processing) or translational blocking (binding to a complementary RNA sequence near the translational start and blocking the ribosome union) (Nasevicius and Ekker, 2000; Bill et al., 2009). This is an easy technique due to the fact that zebrafish eggs in zygote state are robust, large to microinject them, transparent and as stated in the life cycle section, is easy to obtain a large number of Chapter I - General Introduction 21 offspring every day to perform injections at single cell stage. The effect of morpholinos is known because is the most used form of transitory knockdown or an incomplete form of knockdown because they work most efficiently during the first 2 days after injection (Kimmel et al., 2003; Bill et al., 2008). -Recently, CRISPR technique has emerged providing solutions for fast and more efficient genome editing. The origin of CRISPR is related to bacteria, which use this method as a defense for foreign DNA. Bacteria use RNA strands to guide the CRISPR associated 9 (Cas9) nuclease in order to cut or cleave the foreign DNA (Wyatt et al., 2015). The potential of CRISPR/Cas9 is the customization to target the required sequence, because the specificity is defined by small RNAs. From bacteria, this technique could be adapted to eukaryotic organisms by adding nuclear localization signals for Cas9 and simplifying the guide RNA into a single guide RNA (sgRNA) (Jinek et al., 2012). Although this is a new system, CRISPR has been used in human cells (Cong et al., 2013; Li et al., 2013 a,b,c; Wang et al., 2013) and even in vivo with the zebrafish model (Hruscha et al., 2013; Hwang et al., 2013 a,b; Jao et al., 2013), showing that this system is compatible across species. Figure 6. Techniques used for modifying the gene expression via transient or permanent alteration. (A) Representation of microinjection using a glass needle with a capillary inside on the animal pole of a zebrafish zygote. (B) Different molecules injected to achieve a transient (mRNA, DNA and morpholino) or permanent gene expression alteration (CRISPR). Scale bar in A is 250µm (adapted from Wyatt et al., 2015. With permission of John Wiley and Sons). CABEZAS SÁINZ, PABLO 22 2. CANCER Cancer is, by definition, a de-regulation of cell cycle leading to an abnormal cell growth with specific characteristics that provide those cells with the capacity of infiltrate blood torrent and spread to other parts of the host (Munkley and Elliot, 2016). Primary tumors are not the main cause of death of cancer, being the formation of secondary tumor masses in other parts of the individual, called metastasis, the responsible of the deterioration of the patient health, that often leads to death (Liu et al., 2017). The six main hallmarks of cancer disease could be summarized in: 1) uncontrollable cell growth without proper growth signals, 2) evasion of opposite growth signals, 3) capacity to avoid cell death, 4) limitless divisions, 5) secretion of factors promoting vessel growth in order to provide the tumor with enough nutrients to keep growing, 6) capacity of invading another tissues being transported by the blood torrent inside the body (Fig. 7). In the last years two hallmarks were added to these: 7) reprogram of energy metabolism, 8) evasion of immune system (Hanahan and Weinberg, 2011). Figure 7. Hallmarks of cancer (Hanahan and Weinberg, 2011. With permission of Elsevier). Chapter I - General Introduction 23 Cancer is one of the diseases with highest mortality in the developed countries (Siegel et al., 2016). Most people consider cancer as one disease, being the reality far from this assumption. Every type of cancer is different (e.g. breast and colon cancer), and even among different individual the cancer could be different due to the genetic differences between persons and the different mutations arising in cancer cells in each patient (Özdemir and Dotto, 2017). 2.1 HALLMARKS OF CANCER Cancer mechanisms of action can be divided into six hallmarks (Fig. 7) and in the last years they have increased to eight hallmarks, adding two new ones due to the contribution of research groups to cancer knowledge and insights: 2.1.1 Sustained cell growth signaling All of the tissues present in the body are controlled by growthpromoting signals produced by the cells and maintaining the homeostasis and normal architecture. On the contrary, cancer cells are able to avoid this homeostasis and maintain an abnormal growth by deregulating these growth-promoting signals and achieving a sustained cell growth over time (Munkley and Elliot, 2016). This property of cancer cells could affect other hallmarks of cancer related to cellbiological properties, such as cell viability and energetic metabolism by the uptake of glucose and amino acids, such as glucosamine to support the survival and biosynthesis of new cells (Pavlova and Thompson, 2016). In order to obtain the capacity of de-regulating these growth signals, cells can follow multiple pathways: via autocrine signaling to perform a positive-feedback or modifying the surrounding stroma cells (e.g. fibroblasts) to secrete fibroblast growth factor (FGF), capable of stimulate the growth and proliferation of the tumor cells via paracrine signaling (Cheng et al., 2008; Bhowmick et al., 2004). 2.1.2 Unaffected by anti-proliferation signaling Besides the capacity of de-regulation of growth factors to obtain the sustained cell growth over time, the cells need to avoid other type of signals: negative cell-proliferation signals (Deshpande et al., 2005). CABEZAS SÁINZ, PABLO 24 Most of the negative signals for cell proliferation are sent by tumor suppressor genes, being the most important and studied the retinoblastoma protein (RB) and P53, which regulates the decisions of the cells to proliferate or enter into a senescence/apoptotic state. These genes were discovered by studying different type of tumors and confirming that these genes were inactivated or down-regulated across all tumors (Burkhart and Sage, 2008). Nevertheless, another way of inhibition exists, provided by the surrounding cells contact. Contactinhibition has been studied in vitro by normal cells forming monolayers and inhibiting growth when they reach a full confluence, but not occurring in the same way with cancer cells (Curto et al., 2007). 2.1.3 Cell-death resistance Cell-death resistance is another characteristic of cancer cells that allows these cells to escape the programmed cell death by apoptosis once they enter the tumorigenic state. These mechanisms of action are triggered when the cells suffer physiologic stress conditions and the cells enter the tumorigenic transition (Hanahan and Weinberg, 2011). The caspases, intracellular proteases, carry out the apoptosis processes in the cell (Adams, 2003). There are two main pathways for apoptosis by the caspases to prevent the cancer cells to progress, being triggered by different factors: A) Stress response, ‘mitochondrial’ or ‘intrinsic’ pathway: regulated by Bcl-2 family, which is the result of cellular stress, and factors derived from damaged mitochondria that activate the caspase cascade resulting in the cell apoptosis. B) Death receptors or ‘extrinsic’ pathway: being the result of tumor necrosis factor (TNF) union in the cell surface with these death receptors, triggering the apoptosis of the targeted cell via cleavage of several cellular proteins (Adams and Cory, 2007; Lowe et al., 2004). 2.1.4 Induction of angiogenesis In relation with the exposed before, tumor cells need to be provided with oxygen, glucose, amino acids and all type of nutrients in order to sustain the cell growth. Due to this fact, another key point in tumor progression is the capacity of angiogenesis induction towards the tumor and supply it with nutrients, apart from removing metabolic wastes and Chapter I - General Introduction 25 carbon dioxide (Hanahan and Weinberg, 2011). The angiogenic switch is turned on under specific situations during adulthood, especially when the body suffers a wound and healing processes are ongoing or female reproductive cycling, otherwise, this switch is not activated. In tumorigenic processes, this switch suffers a de-regulation and is turned on permanently, in order to create new vessels towards the tumor to provide the nutrients needed for its proliferation and expansion. Besides that, this process is able to occur even in avascular regions of the body like the cornea, highlighting the capacity of the tumor cells to secrete angiogenesis inducers (Hanahan and Folkman, 1996) (Fig. 8). 2.1.5 Endless replication Replication of the cells in the body are limited to a determined number of divisions, and the responsible for that are the telomeres, triggering different mechanisms to stop the proliferation of these cells (Ennour-Idrissi et al., 2017). For that reason, there are two barriers or mechanisms to avoid proliferation of the cells: senescence, which maintains the cells in a quiescent and viable state, but inhibits proliferation; and crisis/apoptosis, involving cell death. Normally, cells suffer the first mechanism to avoid proliferation and they become senescence cells, keeping in a quiescent state. But there are other cells that are able to overcome this barrier, most of them entering the apoptosis process to die. Nevertheless, there are still some cells avoiding cell death by apoptosis in rare occasions, generating immortalized cells with an endless replication potential (Childs et al., 2014). Cancer cells are able to overcome these two barriers, considered the crucial mechanisms for anticancer defense, to avoid unlimited proliferation. Cancer cells achieve this state by protecting the ends of telomeres and stopping the trigger of senescence and apoptosis (Méndez-Pertuz et al., 2017). 2.1.6 Invasion capacity and metastasis Cancer cells have the capacity of colonize distant sites and perform metastasis in organs located far away from the primary tumor (Pantel et al., 2004). Metastasis is a multistep process consisting in a sequence of steps to colonize distant tissues or organs (Fig. 9): from the primary CABEZAS SÁINZ, PABLO 26 Figure 8. Induced angiogenesis and aberrant vessels. (A) Healthy tissue: epithelial and stromal cells support tissue integrity via growth factors and structural support. (B) Tumor tissue: the overexpression of pro-angiogenic against the anti-angiogenic factors results in a de-regulation and formation of disorganized and leaky vessels in the surroundings of the tumor mass. ECM = extracellular matrix, LEC = lymphatic endothelial cells, BEC = blood endothelial cells, CAF = cancer associated fibroblasts (Turley et al., 2015. With permission of Springer Nature). Chapter I - General Introduction 27 Figure 9. Metastasis process from primary tumor to distant site. ECM = extracellular matrix, EGF = epithelial growth factor, PDGF = platelet-derived growth factor, TGF-β = transforming growth factor beta, EMT = epithelial–mesenchymal transition, BM = bone marrow, VEGFR = vascular endothelial growth factor receptor, MET = mesenchymal-to-epithelial transition (Quail and Joyce, 2013. With permission of Springer Nature). CABEZAS SÁINZ, PABLO 28 tumor site, cells need to change their morphology, undergoing epithelial-mesenchymal transition (EMT) process to be able to perform intravasation into the blood torrent or the lymphatic vessels. These cells reach the targeted organ or tissue to suffer an extravasation via mesenchymal-epithelial transition (MET), colonizing and forming micrometastasis (Talmadge and Fidler, 2010). In the last years, this process is getting more attention due to the circulating tumor cells (CTCs) present in the blood that are the main responsible for distant metastasis formation (Massague and Obenauf, 2016). Apart from these main six hallmarks, another two were added recently (Fig. 10): 2.1.7 Immune evasion As we have seen in the previous six main hallmarks of cancer, we are still missing one important point, that forms part of the tumor microenvironment: the immune system. In a healthy individual, the immune system is in part responsible of detecting and killing abnormal cells or strange artifacts and represents the main defense barrier against pathogens (Muesnt et al., 2016). Considering this, cancer cells need to be able to avoid the innate and adaptive immune response detection and posterior attack, evading in this way, eradication (Teng et al., 2008). There are some factors that tumors used in their own benefit in order to avoid immune system: regulatory cells (regulatory T cells, called Tregs, and other types of suppressive cells) are one of the main mechanisms of immune suppression in the tumor microenvironment along with immune suppressive mediators (e.g. VEGF, RCAS1); downregulation of tumor antigens that can contribute to tumor proliferation and metastasis because the immune cells are no longer able to recognize the tumor cells by their antigens; and finally they can even evade the immune system by tolerance or immune deviation (shifting from Th1 to Th2) induced by TGF-β and IL-10 (Vinay et al., 2015). Chapter I - General Introduction 29 2.1.8 Reprogramming cellular metabolism Uncontrolled division and proliferation of cancer cells need to be supported by adjusting the energy metabolism of these cells. In normal non-dividing cells of the human body, the oxidative phosphorylation (OXPHOS) strategy is chosen over the glycolysis. Although being counterintuitive, these cancer cells perform the Warburg effect for obtaining energy, and being far less efficient than OXPHOS in the mitochondria, but they compensate this, by upregulating the expression of GLUT1, a glucose transporter to get more glucose inside of the cell. In this way, when there is an excess of glucose in the blood torrent, together with the upregulation of GLUT1 transporters, glycolysis has the potential of producing more ATP in less time than the OXPHOS pathway (Jones and Thompson, 2009; DeBerardinis et al., 2008). In the last years, it has been discovered that the population within a tumor is not homogeneous, indicating that cell subpopulations, with different molecular alterations, exist within the tumor. One of the most important subpopulations favoring the tumor generation and progression are the Figure 10. Emerging Hallmarks in cancer (Hanahan and Weinberg, 2011. With permission of Elsevier). CABEZAS SÁINZ, PABLO 36 Charged particles and protons are able to disrupt and break single and double strand DNA to cause an irreparable damage in the cancer cells leading them to death, also affecting tumor microenvironment (Fig. 13). Because of its low cost, it is one of the therapies most used around the world, with approximately 50% of the cancer patients being treated with radiation (Baskar et al., 2012). 2.3 INCIDENCE OF THE DISEASE AROUND THE WORLD Cancer is nowadays the second disease responsible of the majority of the deaths worldwide in persons under 70 years old in 91 out of 172 countries in the world according to World Health Organization (WHO) (Fig. 14). The increase in cancer cases around the world and, especially in developed countries, is caused by two main factors: aging of the population and the lifestyle change (Bray et al., 2018). In men, the most common cancer is lung cancer followed by prostate cancer. In women, most common cause of cancer is breast cancer followed by cervical cancer. Besides the risk factors mentioned before, considering the socioeconomic development of some countries and the consequence life expectancy of the population, there are variations between men and women in different countries and even specific incidence of certain types of cancer in specific regions like skin cancers in Australia or New Zealand or colon cancer in Asia. Finally, the mortality due to this disease worldwide is quite different among genders: males have 50% more chance of dying from cancer than women (Bray et al., 2018). 2.4 TUMOR MICROENVIRONMENT As stated before, cancer is a heterogeneous disease, characterized by the de-regulation of the cells in order to grow without control on the human body and acquiring the capacity of invading distant organs or tissues (Kim, 2005). Since the discover of this abnormal cells, the main focus of the researchers have been the genetic alterations of these cells in order to find the reason related with the de-regulation of the cell cycle. Even this, the acquisition of the capacities to invade, apart from the epigenetic changes that can occur upon the cells and the accumulation of mutations over time are important objectives that needs Chapter I - General Introduction 37 Figure 14. World map presenting cancer as a cause of death in people under 70 years old (Bray et al., 2018. From World Health Organization, Creative Commons). CABEZAS SÁINZ, PABLO 38 to be addressed (Stratton et al., 2009). Nevertheless, nowadays it is known that the surroundings of the tumor, called tumor microenvironment (TME), formed by stroma and different type of cells plays an important role in tumor progression (Fig. 15) (Sounni and Noel, 2013). The host-cell interaction takes places in this tumor microenvironment and modify, in one side, the host cells and, on the other side, the cancer cells. Both cells generate an interaction with cytokines and secrete growth factors, contributing to the control of cell proliferation and migration, facilitating the tumor proliferation in the primary site, dissemination to other parts of the body and their colonization (Kim and Tanner, 2015). 2.4.1 Principal cellular components of microenvironment 2.4.1.1 Cancer Associated Fibroblasts (CAFs) This type of cell is the most abundant in tumor’s stroma. When they are activated, expressing different cell surface markers, like fibroblastactivating protein (FAP) (Augsten, 2014; De Veirman et al., 2014), CAFs are able to promote new tumor formation and their proliferation by different ways. Figure 15. Representation of the tumor microenvironment (TME). Cancer cells of the primary tumor are surrounded by their stroma composed of different cells that can support tumor growth and progression (Adapted from Joyce and Pollard, 2009. With permission of Springer Nature). Chapter I - General Introduction 39 The first mechanism of promoting tumor initiation and proliferation is the secretion of multiple signaling molecules and cytokines: epithelial growth factor (EGF) family, insulin-like growth factor-1 (IGF-1) or stroma cell-derived factor-1 (SDF-1/CXCL12) (Fig. 16) (Orimo et al., 2005; Xing et al., 2010). The second way of contributing to tumor growth is by communicating with cancer cells, modifying the extracellular matrix of the tumor microenvironment to provide support for its constant growth through the production of different types of collagen and fibronectin (Xing et al., 2010; Simian et al., 2001). Besides producing support molecules for tumor growth, another important function is related to the remodeling of the extracellular matrix by degrading enzymes and matrix metalloproteinases (MMPs), contributing to cell migration and invasion (Chaffer and Weinberg, 2011; Cirri and Chiarugi, 2011; Kalluri and Zeisberg, 2006; Pietras and Ostman, 2010). Finally, CAFs can help tumor progression, generating pro-invasive and angiogenic molecules (VEGF and IL-6), increasing the motility and invasiveness of cancer cells (Nagasaki et al., 2014). 2.4.1.2 Endothelial cells and pericytes Endothelial cells have an important role in the formation of new vasculature from already formed vessels or recruiting bone marrowderived endothelial progenitor cells (Chouaib et al., 2010). The endothelial cells can produce surface markers that are valuable in the prognosis of cancer such as VEGF factors. All of these factors secreted by endothelial cells play an important role in controlling the leukocyte recruitment, tumor cell behavior, and metastasis (Policastro et al., 2012). On the other hand, pericytes are the responsible for stimulating endothelial cells proliferation, apart from modeling the extracellular matrix and leading the endothelial cells migration (Gee et al., 2003; Sennino et al., 2007; Cooke et al., 2012). 2.4.1.3 Tumor Associated Macrophages (TAMs) Macrophages are located in almost all organs and they have different capacities and are involved in physiological processes like inflammation and innate immunity, being classified in different CABEZAS SÁINZ, PABLO 40 Figure 16. The implication of cancer-associated fibroblasts (CAFs) in tumor growth. Fibroblasts present in the stroma of the host can be stimulated via TGF-β or cytokines to transform them into CAFs. Tumor cells and CAFs can secrete growth factors and enzymes to promote each other, CAFs modifying the stroma for the progression of tumor cells, and tumor cells converting the normal fibroblasts into CAFs (De Veirman et al., 2014. From MDPI, Creative Commons License). Chapter I - General Introduction 41 subpopulations of macrophages (Varol et al., 2015). The classical way of macrophage activation leads to a M1 phenotype with different functions, but there is another way of activation that leads to a M2 phenotype (Fig. 17). Besides this classification, other authors classified the macrophages taking into account their functions: angiogenic, immunosuppressive, invasive, metastasis-associated, perivascular and activated macrophages (Komohara et al., 2016). TAMs derive from circulating monocytes and are the most common cells in tumor microenvironment. The normal function of these M2 macrophages should be the promotion of innate and adaptive immunity and the phagocytosis of death cells. Nevertheless, tumors are able to modulate this activity and shift these M2-like macrophages to help the tumor by promoting cell growth and spread (Brown et al., 2017). Different subsets of TAMs coexist and have a specific activity in this TME: suppression of adaptive immunity, increase the angiogenesis towards the tumor, tumor cell extravasation and invasion via blood vessels (Qian and Pollard, 2010). Figure 17. Macrophages heterogeneity. Tumor-associated macrophages (TAMs) are derived from circulating monocytes that are shifted into the M2-like functions and phenotype, in this way contributing to tumor progression by remodeling of tissues, angiogenesis and tumor cells activation (Komohara et al., 2016. With permission of Elsevier). CABEZAS SÁINZ, PABLO 42 Besides, TAMs have different phenotypes to perform different activities within the tumor microenvironment in order to help tumor progression and spreading (Fig. 18), being the following the most important ones: 2.4.1.3.1 Facilitation of metastasis One of the mechanisms of TAMs to facilitate the invasion of tumor cells involves a paracrine loop. This loop starts with the TAMs producing epidermal growth factor (EGF), increasing the invasiveness of surrounding tumor cells that are able to respond to this factor by the EGF receptor (EGFR). On the other part of the loop, cancer cells express macrophage stimulation factor-1 (CSF-1), being a powerful chemoattractant for the TAMs in possession of the receptor for this signal (CSF1R) (Joyce and Pollard, 2009). In this way, macrophages carry the tumor cells near the blood vessels by remodeling the collagen fibers and once the tumor cell is located near the blood vessel, the TAMs facilitate the intravasation of the tumor cell into the vasculature (Condeelis and Pollard, 2006; Wyckoff et al., 2007). 2.4.1.3.2 Inhibition of the adaptive and innate immunity TAMs are the responsible for tumor growth by inhibiting immunity with diverse mechanisms. Secretion of molecules like TGF-β, IL-10, arginase-1 or nitric oxide, which act as immune suppressive molecules, blocking T-cell immune response against the tumor antigens (Terabe et al., 2003; Zea et al., 2005; Sica and Bronte, 2007). TGF-β has a direct effect over the conventional CD4+ and CD8+ T-cells that mediates immune response by blocking their stimulation, differentiation, proliferation and effector functions (Sheng et al., 2015; Yoshimura and Muto, 2011). Arginase-1 acts as a blocker for arginine in the conventional T-cells. Those T-cells requires arginine in order to be activated and react against certain antigens, therefore with the arginase1 acting as a blocker, they lose the capacity of generating immune effector cells (Bronte and Zanovello, 2005; Gallina et al., 2006; Rodriguez and Ochoa, 2008). Nitric oxide (NO) and ROS produced by TAMs, on the other side, has a synergic effect with the arginase-1 Chapter I - General Introduction 43 against the T-cells, being more efficient than the arginase-1 alone (Brown et al., 2017). 2.4.1.3.3 Pro-angiogenic The pro-angiogenic capacity of the TAMs is related to specific subpopulations of TAMs in the last side of the M2 spectrum, called the Tie2 expressing macrophages (TEMs). They are located mainly in the perivascular regions of the tumors and it has been demonstrated that they are crucial for vasculature recuperation after treatments (Brown et al., 2017). Figure 18. Principal macrophage phenotypes. Classification of macrophages in subpopulations depending on the supporting function provided to the tumor. Each of the subpopulations express different markers in their surface in order to perform their function (Qian and Pollard, 2010. With permission of Elsevier). CABEZAS SÁINZ, PABLO 44 3. XENOTRANSPLANTATION TECHNIQUE IN ZEBRAFISH Xenotransplantation technique in zebrafish, for its use in biomedicine assays, consists on the injection of cancer human cells into different parts of the zebrafish embryos to track their progression, behavior and interaction with the microenvironment of the host (Fig. 19) (Nicoli and Presta, 2007; Nicoli et al., 2007). The major sites of injection in zebrafish are divided as follows (Fig. 20): -Yolk sac: the yolk sac of the embryos is an acellular compartment where all the lipids are accumulated to provide the fish with energy for their development until they reach the 5dpf, the moment they are capable of feed themselves (Fraher et al., 2016). Human cancer cells can be injected in the yolk sac of the embryos which provides nutrients for tumor growth. Apart from that, in this compartment of the fish the Figure 19. Representation of xenotransplantation procedure in zebrafish embryos. (A) Labelled human cancer cells are loaded in a microneedle to perform the xenograft into the yolk sac of the embryo. (B) Tracking of the cells in real time at 24 hours post injection (hpi) and 96hpi to see their behavior and proliferation (Konantz et al., 2012. With permission of John Wiley and Sons). Chapter I - General Introduction 45 cells can be easily visualized post-injection over the days (Veinotte et al., 2014). -Duct of Cuvier: the injection of the cells directly into the circulation (Duct of Cuvier) allows the researchers to test another stages of the tumor development like mesenchymal-epithelium transition (MET) (Mercatali et al., 2016). Cells injected into the circulation are able to survive, invade and perform extravasation, normally near the caudal hematopoietic tissue (CHT) located in the tail of the embryo and metastasize forming tumors (Tulotta et al., 2016). In this way the cells can be tracked when they are labeled over-time and the proliferation and rate of invasion in the CHT of the embryos can be quantified (Drabsch et al., 2013). -Intraperitoneal cavity: although all the injections are normally performed in zebrafish embryos due to the lack of adaptive immune system, with the creation of a zebrafish immunocompromised cell line (Rag2 mutant line) (Tang et al., 2014), adult zebrafish can be used as an animal model for xenograft assays without the drawback of the human cancer cells being rejected by the immune system of the fish. Apart from that, other methods for immunosuppression exist like γirradiation or dexamethasone without the need of breeding a mutant line, but being more expensive and time consuming (Khan et al., 2019). Figure 20. Most common sites of cancer cell injection during different stages of development in zebrafish. (A) The yolk sac (yellow) in the 256-cell stage. (B) 2 days post fertilization (dpf) embryo: yolk sac (yellow) and Duct of Cuvier (orange) being the common sites of injection. (C) Adult zebrafish: intraperitoneal cavity is the chosen place to perform xenograft at this stage (Drabsh et al. 2017. From Sercrisma, Creative Commons license). CABEZAS SÁINZ, PABLO 52 3.4 PARAMETERS OF THE XENOTRANSPLANTATION TECHNIQUE Xenotransplantation technique stablished as a first standard protocol in 2006 (Haldi et al., 2006), have different parameters settled in order to obtain a balance between the human cells injected and the host, in this case, the zebrafish embryos. Zebrafish embryos develop at a temperature of 28ºC in controlled conditions and the human cancer cells at 37ºC (normal physiological temperature in the human body) (Westerfield, 2000). Apart from that, the image analysis was performed via disaggregation of the embryos at the end of the experiment and the cells were visually counted, but the number of cells injected at the beginning were an approximation of the real number (Haldi et al., 2006). Xenotransplantation technique has evolved over the past decade but there were little changes referred to incubation temperature and image analysis of the embryos: 3.4.1 Incubation temperature As mentioned before, incubation temperature of the zebrafish embryos during the xenograft experiments should be a compromise temperature between the normal development of the embryos under controlled conditions (28ºC) and the optimal temperature of the cells (37ºC). The most used temperature for performing xenograft experiments in the literature is 34ºC and an incubation between 3 and 6 days post injection (dpi) (Eguiara et al., 2011; Ghotra et al., 2012; He et al., 2012; Ban et al., 2014; van der Ent et al., 2015). This temperature is focused on the cell growth at best conditions, without harming the embryos based on mortality and phenotypic studies (Pype et al., 2015), but it is important to take into account the metabolic pathways that could be affected by increasing the incubation temperature of the zebrafish embryos (Long et al., 2012). 3.4.2 Image analysis The image analysis of the embryos in order to quantify the proliferation of the injected cells inside the embryo has been improving since the first xenograft experiments (Lee et al., 2005; Haldi et al., 2006). Some authors used Photoshop to quantify the intensity of the fluorescent injected cells transfected with GFP (green fluorescent Chapter I - General Introduction 53 Figure 22. Representative images of the invasion and proliferation of U87 glioma cells in a zebrafish model. (A) Different conditions of the U87 glioma cells yields different proliferation rates and invasion behavior. (B) The percentage of invasive cells within the total injected cells. The images were analyzed with ImageJ software through fluorescence intensity (Adapted from Yang et al., 2013. From Plos One, Creative Commons license). CABEZAS SÁINZ, PABLO 54 protein) or cells marked by lipophilic dyes (DiI, DiO, DiD) (Pruvot et al., 2011; Drabsh et al., 2013); although others authors improved the image analysis by using ImageJ or similar software (Fig. 22) (Corkery et al., 2011; Moshal et al., 2011; Yang et al., 2013). 3.5 DRUG SCREENING The drug screening of novel compounds is one of the advantages of the zebrafish embryos compared to mouse, due to the low concentration of the compounds needed to do a high-throughput screening and the phenotype-based screens of the compounds and their toxicity. In this way the costs are reduced and could be a first step in the in vivo research of compounds between in vitro studies with cells and rodents (Letrado et al., 2018). On the other hand, zebrafish has gained acceptance in the last years in order to test the toxicity of synthetic and small molecules (Puerto Galvis and Kouznetsov, 2019). In this sense, it is important to mention that the Organization for Economic Cooperation and Development (OECD) approved a guideline for testing chemicals in the embryos: ‘Test Guideline 236: Fish Embryo Acute Toxicity Test’ (FET) (OECD Guidelines for the testing of chemicals, 2013). Finally, more insights into the mechanism of the compound are assayed when we use a complete animal model like zebrafish. The majority of the phenotypic screens are carried out in cell cultures, lacking most of the organs and processes that characterize a whole organism (e.g. pain, tumor metastasis, vascular tone, gut motility) (Fig. 23). Zebrafish embryos can provide information about the absorption, distribution, metabolism, excretion and toxicity (ADME-Tox) because the organs and tissues of the zebrafish embryos are functional (MacRae and Peterson, 2015). But even with all of these advantages presented before, it is important to highlight the relevance of this tool when it comes to compare them to the human biology. Even with mammal models the researchers need to take into consideration all the advantages and limitations of each model, even more in zebrafish, which is more distant to human than rodents. Some of the considerations of zebrafish model relevance are: Chapter I - General Introduction 55 Figure 23. Is zebrafish relevant for discovering new human drugs? Apart from sharing 82% of disease-associated targets with humans, zebrafish has a highly conserved drug metabolism and physiology (e.g. cardiac electrophysiology) (MacRae and Peterson, 2015. With permission of Springer Nature). CABEZAS SÁINZ, PABLO 56 3.5.1 Targets Up to the 82% of proteins that cause human disease have an orthologue in zebrafish. The key point is that even when the sequence divergence between zebrafish and human is big, the active sites of the enzymes, and receptors that are the main target of pharmacological drugs are perfectly conserved between these two species (Howe et al., 2013b). 3.5.1.1 Physiology In terms of model systems, exist a large number of animal models suitable for drug screening (e.g. yeast, worms or flies) but zebrafish, being a vertebrate, stands over these models due to the highly conserved integrative physiology, except for some organs that differ between the two species like breast or lungs (MacRae and Peterson, 2015; Puerto Galvis and Kouznetsova, 2019) 3.5.1.2 Drug distribution, metabolism and excretion Apart from the toxicity and the phenotypic defects of individual human drugs, the zebrafish model resembles the drug-drug interaction of some compounds and the distribution in the body of the host and even across active physiological barriers like the blood-brain barrier (Eliceiri et al., 2011). One important point to highlight, related to the drug screening and toxicity of the compounds in the case of cancer disease, is that temperature conditions are normally stablished around the 31-34ºC to ensure that the cells growth in a normal way and the zebrafish embryos survive (Lee et al., 2016). Different authors already suggested that a temperature closer to 37ºC (physiological temperature or human body) would be desirable in order to test the drugs near the optimal potential of cells (Konantz et al., 2012). 3.6 CELL-HOST INTERACTION The cell-host interaction is a crucial point in the xenotransplantation technique but almost not well studied by the majority of researchers. Apart from considering the best conditions for Chapter I - General Introduction 57 the cells injected and their microenvironment, the host, in this case the zebrafish embryo, plays an important role in the proliferation of the cells. In xenograft technique, temperature is one of the most important parameters, determining the whole state of the embryos and their survival (Pype et al., 2015). As we mentioned, an incubation temperature of around 34ºC is the most used by researchers in the literature (Eguiara et al., 2011; Ghotra et al., 2012; He et al., 2012; Ban et al., 2014; van der Ent et al., 2014), but some researchers questioned whether this temperature is the optimal for seeing the full proliferation potential of the cells and their resistance to novel drugs (Konantz et al., 2012). In this way, even at 34ºC, some morphological (Fig. 24) and transcriptomic changes of the host could be affecting the proliferation of the cells inside the yolk sac or the circulation of the embryo, related to inflammation or immune response of the host to the xenografted cells (Long et al., 2012). Figure 24. Principal malformations caused by the temperature increment in zebrafish embryos. (A) Normal embryo at 28,5ºC. (B) Tail deviation of the embryo due to increase in temperature. (C, D) Embryos with several malformations due to a high incubation temperature of 36’5ºC. Abbreviations: B= blood accumulation; M= malformation mouth; N= non-hatching; O= edema; T= tail malformation; Y= yolk malformation (Pype et al., 2015. With permission of Elsevier). CABEZAS SÁINZ, PABLO 58 3.6.1 Innate immune system of the zebrafish embryos Zebrafish embryos are a suitable model for xenograft assays because there is no adaptive immune system present until day 12-14 post fertilization, and the complete maturation of the adaptive immune response is achieved between 4 and 6 weeks post fecundation (Lam et al., 2004). Nevertheless, they have an innate immune system provided by the mother, and this system includes macrophages and neutrophils that are distributed all over the embryo. This innate immune system reacts to different stimulus and stress responses of the embryo to the environment (e.g. bacteria, cancer cells, temperature changes) and modifying the inflammation response of the body (Novoa and Figueras, 2012). Following these, the increase in incubation temperature of the zebrafish embryos is modifying these parameters in a molecular basis by the changes in the transcriptional responses and, therefore, influencing the response of the host to the injected cells when the incubation is performed at different temperatures (Long et al., 2012). Chapter II - Objectives 59 CHAPTER II - OBJECTIVES The general objective of this thesis is the improvement of the xenotransplantation technique in zebrafish embryos to be able to study human cancer cell behavior with a more accurate method based on this model organism. This general objective can be divided into the following specific objectives: 1. IMPROVEMENT OF THE XENOTRANSPLANTATION TECHNIQUE BY MODIFYING THE INCUBATION TEMPERATURE OF THE EMBRYOS AND DEVELOPING A NEW IMAGE ANALYSIS SOFTWARE Obtaining a more accurate quantification of the injected cells inside the zebrafish embryos requires the optimal conditions for the injected cells to normally behave and proliferate compared to their natural environment, the human body. For this reason, the present study aims to determine the effect of using an incubation temperature of 34ºC in vitro (with different cell lines) and in vivo (in zebrafish embryos) in comparison with 36ºC. Apart from that, improvement of embryos image analysis is necessary with the objective of quantifying the cellular mass injected into the yolk of the zebrafish embryos. For this purpose, the development of a novel software based on Matlab for the automation of the image analysis process will be attempted. Finally, the analysis of 5-Fluorouracil (5-FU), a well-known chemotherapeutic drug, will serve us to determine the effect of the increment in the incubation temperature on drugs activity. CABEZAS SÁINZ, PABLO 60 2. COMPARISON OF THE DEVELOPMENT DEFECTS, MORTALITY AND METABOLISM OF THE ZEBRAFISH EMBRYOS INCUBATED AT 28ºC, 34ºC AND 36ºC The comparison between different incubation conditions at high temperatures (34ºC and 36ºC) will be performed in order to find a balance between the survival and cellular proliferation of the injected cells without falling into a high mortality of the injected embryos. The main reason for aiming to a higher incubation temperature, is because the injected cells should be nearly optimal conditions like the ones provided by the human body in terms of temperature. In this way, the cells should be able to provide the researchers with a more accurate proliferation ratio, without incurring in a higher mortality of the zebrafish embryos. The physiological condition of the zebrafish embryos being the host will be studied with two different approaches: -Morphological phenotyping: observable morphological defects can be quantified by imaging the embryos at different time points of their development to see the integrity of the host. Apart from that, is important to control the mortality of the embryos at the temperatures mentioned to compare this parameter between the conditions assayed. -Metabolism profile: obtaining a metabolic profile of different important pathways related to temperature increase (immune system, inflammation, development and general metabolism) will be important to assess how embryos react to higher incubation temperatures. 3. TESTING THE MICROENVIRONMENT EFFECTS: CO-INJECTION OF DIFFERENT CELL LINES WITH CONDITIONED MACROPHAGES One of the more important components of the human tumor microenvironment are the macrophages. Macrophages are recruited by cancer cells and transformed in tumor associated macrophages (TAMs), being able to help cancer cells with their proliferation and metastasis capacity. Chapter II - Objectives 61 For this reason, with the objective to test if the microenvironment of the human cancer cells will help with the development of the tumor inside the zebrafish embryos, we propose to co-injected MCF7 breast cancer cells with conditioned macrophages inside the yolk of this animal model. In this way, we would be able to analyze the interaction between the macrophages and the cancer cells, and measure the proliferation and spreading of the cells in the presence or absence of macrophages. CABEZAS SÁINZ, PABLO 68 2.4 CELL PROLIFERATION ASSAYS Cell proliferation was determined using xCELLigence Real-Time Cell Analyzer; Acea Biosciences (Roche) following the manufacturer instructions. In brief, cells were seeded on E-plates containing electric nodes in their surface that allow the measurement of changes in impedance attributed to cell proliferation. Measurements were performed in quadruplicate, normalizing the initial cell index once the cells were completely adhered. 2.5 CELL INJECTION Two days post fertilization (dpf), zebrafish embryos were dechorionated (if needed) and anesthetized with 0.003% tricaine (Sigma). Cells were suspended at 10,000-20,000 cells/µl in complete McCoy and maintained at room temperature for no longer than 2 hours before they were injected. The cell suspension was loaded into borosilicate glass capillary needles (1 mm O.D. x 0.78 mm I.D.; Harvard Apparatus), and injections were performed using IM-31 Electric Microinjector (Narishige) with an output pressure of 34 kPa and 30 ms injection time. The injections were performed manually right into the yolk of the embryo. Incorrectly injected embryos without cells inside of the yolk, or showing them in the circulation after xenotransplantation were discarded. 2.6 INCUBATION, IMAGING AND CELL QUANTIFICATION After injection, 2dpf embryos were incubated at two different conditions (34ºC or 36ºC) in 24-well plates with salt dechlorinate tap water (SDTW, chlorine free water obtained with a reverse osmosis filter system) for 72h to check the proliferation of the cell line by ZFtool. Each plate contained at least 2 negative controls (injected with complete McCoy medium) and 2 blanks (not injected). Apart from those plates, another plate with 12 negative controls and 12 blanks were included in some experiments to test the viability of the embryos. No development abnormalities were observed during incubation at this temperature. In order to reach a 36ºC incubation temperature without a large amount of embryo mortality, plates were covered with a transparent Chapter III - Improving zebrafish embryo xenotransplantation conditions by increasing incubation temperature and establishing a proliferation index with ZFtool 69 sealing tape (PCR Plastics) to prevent evaporation and reduction of dissolved oxygen. After that, plates were placed inside an incubator with minimal contact between the plate and the incubator structure to prevent water overheating. Each embryo was photographed with AZ100 Nikon fluorescence stereomicroscope at 0 hours post injection (hpi) and 72hpi to be analyzed by ZFtool software. The objective of this software is to automatize and improve the task of measuring the number and mean value of GFP pixels in order to compare them for these two conditions and compute the proliferation index. Finally, this analysis yields the number of GFP pixels in the image (nGFP), which represents the area of the cells inside the yolk sac at two different times and the GFP intensity Medium Value (GMV), which represents the medium intensity of the fluorescence inside the yolk. By multiplying the nGFP number by the GMV of each image, we determined the proliferation ratio between 0hpi and 72hpi to estimate the cell growth. The result obtained at 72hpi was divided by that obtained at 0hpi, yielding a proliferation index value (PI): 𝑛𝐺𝐹𝑃72ℎ𝑝𝑖 ∙ 𝐺𝑀𝑉72ℎ𝑝𝑖 𝑛𝐺𝐹𝑃0ℎ𝑝𝑖 ∙ 𝐺𝑀𝑉0ℎ𝑝𝑖 A PI value =1 means that cells remain stable during incubation, a PI higher than 1 indicates tumor cell proliferation and a PI lower than 1 indicates tumor cell death. Zebrafish embryos have variable autofluorescence, especially in the yolk area. To accurately quantify the injected cells fluorescence a pre-processing is needed to only count the GFP pixels belonging to injected cells filtering autofluorescence. To achieve this, the software counts the number of GFP pixels with different intensity thresholds, from 0 (no threshold) to 50 and the ZFtool algorithm provides a homogeneous measurement of the GFP area for all fish analyzed comparing nGFP for each threshold analyzed with nGFP for threshold=0, where fish auto fluorescence is mostly present. When the relation between measured nGFP compared to nGFP at threshold=0 surpass a fixed value, we consider the GFP area to be stable and the threshold is fixed at this point. In case there is no autofluorescence in CABEZAS SÁINZ, PABLO 70 the embryo, the threshold is established based on a tolerance parameter and a correction is included to assure the accuracy of the measurement in this cases. The ZFtool algorithm automatic thresholding for each analyzed embryo is one of the main automation components of the software, making it efficient in producing reliable fish to fish measurements. 2.7 CELL COUNTING SOFTWARE The ZFTool extension for cell counting was developed. A drop of cells was placed on a microscope slide and photographed to obtain a fluorescence image. The algorithm detects circular objects of the fluorescence input image with a fixed diameter. The output yields a fluorescence image with nearly every cell or group of cells delimited by a contour and an estimation of the number of cells inside the input image. This algorithm is based on the circular Hough transform and has several parameters fixing the strength of the edge, and a minimum and maximum radius of the circles to detect. As we know the approximate size of the cells, we can fix these parameters in order to obtain an estimation of the number of cells. The method will be more accurate as the cells are more isolated, but as the number of cells injected increases over 400, we do not need the exact number of cells, but only an estimation, so this method still fits our purposes. 2.8 ANTICANCER DRUGS TOXICITY AND TREATMENT In order to test the toxicity of an anticancer drug (5-Fluorouracil), experiments were performed according to the OECD (Organisation for Economic Co-operation and Development) guideline for the testing of chemicals (OECD Guidelines for the testing of chemicals, 2013). This procedure consists of exposing 0 hours post fecundation (hpf) eggs to dissolved chemicals in 24-well plates, for a period of 96 h. Various indicators (such as coagulation of embryos, lack of somite formation, non-detachment of the tail or lack of heartbeat) were checked every 24 h during the experiment, to test the mortality of the embryos and calculate the LC50 (lethal concentration 50%) at the end of the test. The drug was tested to determine a concentration range that included 0%- 100% mortality. Experiments were considered valid when egg Chapter III - Improving zebrafish embryo xenotransplantation conditions by increasing incubation temperature and establishing a proliferation index with ZFtool 71 fertilization was ≥70%. At the beginning, the oxygen concentration should have ≥80% saturation, and the water temperature should be 26±1ºC. During the test, the negative control embryos mortality could not be ≥10% at any time of the experiment. Exposure to the positive control resulted in a minimum mortality of 30% at the end, and the hatching rate of the negative control embryos was higher than 80% at 96 h. The concentrations tested were 250 µM, 500 µM, 1000 µM, 1500 µM, 2000 µM, with 1% DMSO (dimethyl sulfoxide). Another analog experiment was conducted changing the treatment starting point from 0hpf to 48hpf in order to evaluate how the toxicity changed with a dechorionated embryo at 36ºC. 2.9 STATISTICAL ANALYSIS Homoscedasticity and statistical analyses were performed using the SPSS software (IBM). An excel outlier analysis was performed using interquartile range (IQR), while the outliers were discarded. One factor ANOVA for non-parametrical data was applied to nonhomoscedastic data with confidence intervals of 95% or 99%, and a Student’s t-test was applied to homoscedastic data with confidence intervals of 95% or 99%. Number of embryos analyzed is represented by nrep and ntotal, being nrep the number of embryos in each replica, and ntotal the total number of embryos statistically analyzed for the experiment. 3. RESULTS 3.1 FISH VIABILITY AT 34ºC AND 36ºC Data from all experiments were analysed to determine fish viability between 34ºC and 36ºC for 72 h (experimental time range). Both the control (injected with medium) and blank (not injected) groups had a survival rate higher than 95%. Although the data showed that a difference existed between the survival rate at 34ºC (95.37%) and 36ºC (87.5%), statistical analysis found no significant differences (Tab. 2). At 36,5ºC or above the survival of the embryos is seriously affected and severe deformations were observed (data not shown). CABEZAS SÁINZ, PABLO 72 Table 2. Total survival percentage of each set of experiments for the zebrafish embryos at three different conditions tested HCT116-GFP 34ºC Experiments 72 h Injected Alive Initial embryos injected 1 12 12 2 47 48 3 44 48 TOTALS 103 108 Survival (% ± SD) 95.370 ± 0.043 HCT116-GFP 36ºC Experiments 72 h Injected Alive Initial embryos injected 1 42 48 2 18 24 3 24 24 TOTALS 84 96 Survival (% ± SD) 87.500 ± 0.125 HCT116-GFP 36ºC 5-FU Experiments 72 h Injected Alive Initial embryos injected 1 45 48 2 20 24 3 22 24 TOTALS 87 96 Survival (% ± SD) 90.625 ± 0.055 Despite the differences observed between the two temperatures, experiments at 36ºC show adequate fish viability in terms of cell proliferation, metabolism and behaviour of the injected cells if we are looking to simulate human body conditions. 3.2 IN VITRO ANALYSIS OF HCT116 CELL LINE PROLIFERATION The Xcelligence technology was used to test in vitro cell proliferation at 34ºC and 36ºC, starting with different initial cell concentrations per well (2.000 cells, 5.000 cells and 10.000 cells). As Chapter III - Improving zebrafish embryo xenotransplantation conditions by increasing incubation temperature and establishing a proliferation index with ZFtool 73 expected, a better proliferation rate was observed at 36ºC, confirming the data obtained in vivo (Fig. 1). 3.3 IMAGE ANALYSIS: ZFTOOL SOFTWARE ZFTool software has been designed to provide specific, intuitive and automated tools for zebrafish xenotransplantation and drug testing assays. This software has two main functionalities: cell counting prior to injection and cell proliferation measurement inside the yolk of the embryo. This can be achieved automatically, without programming knowledge in a very intuitive way. Afterwards, other packages could be implemented to enhance the analysis of the proliferating cells, for example a 3D analysis model. ZFTool software is currently being further developed and tested and for that reason is not available for use outside our group. After being thoroughly tested it will be made available for the scientific community. Image analysis with ZFTool was performed with the parameters established in the code, appropriate to different sets of images taken under different conditions. This tool automatically eliminates fish autofluorescence, as these pixels interfere with the measurement of GFP area (Fig. 2). Usually, the darkest GFP pixels correspond to fish autofluorescence, and these pixels must not be included when measuring GFP area and mean intensity. ZFtool automatically establishes a GFP threshold for each fish, taking into account the decay of the graph representing the GFP area at different thresholds. When the difference is lower than 10%, the threshold is fixed, yielding an image where only the GFP area of the tumor cell mass is highlighted, creating a more accurate result. Different thresholds could be obtained for 0hpi and 72hpi, so the highest is selected to compare the evolution of the GFP area with time. The tolerance parameter establishes the percentage of decay with respect to area for a 0 threshold (Fig. 3). While performing the experiments, we noticed that cell proliferation at the two temperatures tested varied depending on the initial cell load. To account for this variation, a ZFtool extension was developed to automatically count the number of cells prior to injection. For this, a microinjection with the same conditions of the experiment was performed over a microscope slide with low (100-200 cells) and CABEZAS SÁINZ, PABLO 74 Figure 1. Proliferation of HCT116 cells in vitro. XCELLigence technology was used to quantify the proliferation of the HCT116 cell line in vitro at 34°C and 36°C with different initial number of cells (A: 2.000, B: 5.000 and C: 10.000). A better proliferation rate can be observed at 36°C. The results shown are the media of 4 independent experiments. Chapter III - Improving zebrafish embryo xenotransplantation conditions by increasing incubation temperature and establishing a proliferation index with ZFtool 75 Figure 2. ZFtool automatically elimination of fish autofluorescence. ZFtool software detects all the green pixels in the image (red/pink-line) but eliminates all those pixels corresponding to fish autofluorescence and keeps pixels above an established threshold (blue line). CABEZAS SÁINZ, PABLO 76 Figure 3. Evolution of the number of GFP pixels based on GFP intensity thresholds for zebrafish embryos and regions of interest of fluorescent zebrafish applied with different thresholds. (A) Graphical representation of average GFP intensity thresholds on the x-axis and mean number of pixels greater than the threshold on the y-axis for the zebrafish embryos tested (n = 6). A progressive decay of the area, more evident at 72hpi (dotted lines), is shown. It can also be observed that as the threshold increases, the area decreases slightly. At a low threshold, autofluorescence can represent an important component of GFP intensity. However, as soon as this threshold is raised, auto-fluorescence drastically disappears. Blue line represents 0hpi embryos, and red line represent 72hpi embryos. (B) Example of segmentation in evolution with red outlines over the images with thresholds from 0 to 50. The region inside the red outline is reduced as the threshold increases. This way the brightest pixels with higher fluorescence are selected, eliminating the majority of auto-fluorescence from the zebrafish embryo. Chapter III - Improving zebrafish embryo xenotransplantation conditions by increasing incubation temperature and establishing a proliferation index with ZFtool 77 high (400-500) cell numbers, photographed under a fluorescence microscope and analysed, after that, these cells were discarded (Fig. 4). Afterwards, the embryos were injected with the same conditions. When the comparison of initial injected cells is performed between the range of 100-200 and 400-500 cells/injection at 34ºC, the proliferation after 72h remains the same, being not statistically significant when compared to 0h. However, when the injections with 100-200 and 400-500 cells/injection are performed at 36ºC, the proliferation at 72h is statistically significant, resulting in more proliferation of the injected cells when the number of those cells is in the range of 100-200 cells/injection (Fig. 5). This could be due to the space they have in the yolk and the sub estimation of the ZFtool when the number of cells is in the range of 400-500. In any case, the proliferation differences after 72h, despite the initial number of injected cells, are statistically significant between 34ºC and 36ºC. 3.4 IN VIVO COMPARATIVE PROLIFERATION ANALYSIS AT TWO DIFFERENT TEMPERATURES The aim of this experiment was to test whether a better proliferation index exists at a temperature close to the human body (36.5ºC). Embryo post-transplant incubations were performed at two different temperatures (34ºC and 36ºC) to assay tumor cells behaving differently at both temperatures. Cultured HCT116 cells expressing GFP constitutively were microinjected into the embryos at 48hpf. After microinjection, embryos were photographed and placed in an incubator at 34ºC or 36ºC for 72 h. At 72 hours post injection (hpi) embryos were photographed again. The results showed proliferation of HCT116 cells at 36ºC (2.4237). When compared to cells at 34ºC (0.6253), no proliferation was detected in this condition, but on the contrary, cell death appeared as a possibility, based on the lack of fluorescence (Fig. 6). These results are consistent compared with the results obtained in vitro. CABEZAS SÁINZ, PABLO 84 Table 4. Toxicity test and mortality rates at 36ºC from 48hpf to 144hpf 24 h 34ºC 36ºC 48 h 34ºC 36ºC Control - 0/24 0/24 Control - 0/24 0/24 Conc.* 5-FU IC^ 5-FU IC^ Conc.* 5-FU IC^ 5-FU IC^ 250 µM 0/20 0/4 0/20 0/4 250 µM 0/20 0/4 1/20 0/4 500 µM 0/20 0/4 0/20 0/4 500 µM 0/20 0/4 0/20 0/4 1000 µM 0/20 0/4 0/20 0/4 1000 µM 0/20 0/4 3/20 0/4 1500 µM 0/20 0/4 1/20 0/4 1500 µM 1/20 0/4 3/20 0/4 2000 µM 1/20 0/4 2/20 0/4 2000 µM 1/20 0/4 10/20 0/4 72 h 34ºC 36ºC 96 h 34ºC 36ºC Control - 0/24 0/24 Control - 0/24 1/24 Conc.* 5-FU IC^ 5-FU IC^ Conc.* 5-FU IC^ 5-FU IC^ 250 µM 0/20 0/4 2/20 0/4 250 µM 0/20 1/4 2/20 0/4 500 µM 0/20 0/4 0/20 0/4 500 µM 0/20 0/4 0/20 0/4 1000 µM 0/20 0/4 5/20 0/4 1000 µM 0/20 1/4 5/20 0/4 1500 µM 2/20 0/4 5/20 0/4 1500 µM 2/20 0/4 6/20 1/4 2000 µM 2/20 0/4 11/20 0/4 2000 µM 3/20 0/4 14/20 0/4 *Conc, concentration; ^IC, internal control. Negative control embryos were assayed in a separate 24 well plate. Additionally, four negative internal controls were placed in 4 of the 24 wells in each 5-FU treated plate being the other 20 wells 5-FU treatment. At 36ºC the control group showed a proliferation ratio of 2.6653, while the 5-FU treated fish had a proliferation ratio of 1.9592. Again, the proliferation index performing this analysis was statistical significant. The statistical analysis demonstrated significant differences between the control and the treated group at this temperature (Fig. 9). Chapter III - Improving zebrafish embryo xenotransplantation conditions by increasing incubation temperature and establishing a proliferation index with ZFtool 85 Figure 7. Cell proliferation inside the zebrafish embryos at 34ºC and 34ºC with 5-FU. (A) Zebrafish embryo incubation at 34ºC analyzed with ZFtool yielding a proliferation index of 0.4748. (B) Zebrafish embryo incubation at 34ºC, with 5-FU analyzed with the ZFtool yielding a proliferation index of 0.5415. All images are a superposition of a fluorescence field image over a bright field image. In all panels, the left image is a 48hpf or 0hpi zebrafish embryo, and the right image is the same zebrafish embryo with 120hpf or 72hpi. Scale bar = 100µm. CABEZAS SÁINZ, PABLO 86 Figure 8. Cell proliferation inside the zebrafish embryos at 36ºC and 36ºC with 5FU. (A) Zebrafish embryo incubation at 36ºC analyzed with ZFtool yielding a proliferation index of 2.6653. (B) Zebrafish embryo incubation at 36ºC, with 5-FU analyzed with the ZFtool yielding a proliferation index of 1.9592. All images are a superposition of a fluorescence field image over a bright field image. In all panels, the left image is a 48hpf or 0hpi zebrafish embryo, and the right image is the same zebrafish embryo with 120hpf or 72hpi. Scale bar = 100µm. Chapter III - Improving zebrafish embryo xenotransplantation conditions by increasing incubation temperature and establishing a proliferation index with ZFtool 87 Figure 9. Cell proliferation inside the zebrafish embryos between 34°C/34°C 5FU and 36°C/36°C 5-FU. Xenografted tumor cell proliferation at 34°C/34°C 5-FU and 36°C/36°C 5-FU. Proliferation at 34°C=0.4748; 34°C 5-FU=0.5415; 36°C=2.6652; 36°C 5-FU=1.9592. Each column is an average representation of four independent experiments (nrep=81-102, ntotal=300, *p<0.01; +p<0.01). Chapter IV - Quantification of morphological abnormalities and metabolism related changes in xenografted zebrafish embryos at different incubation temperatures 89 CHAPTER IV - QUANTIFICATION OF MORPHOLOGICAL ABNORMALITIES AND METABOLISM RELATED CHANGES IN XENOGRAFTED ZEBRAFISH EMBRYOS AT DIFFERENT INCUBATION TEMPERATURES 1. INTRODUCTION Zebrafish embryos have been widely used as a tool for cancer research since 2006 (Haldi et al., 2006) by means of the xenograft technique. This involves the injection of human cancer cells inside the yolk (Tonon et al., 2016) or in the circulation of the zebrafish embryo at 48 hours post fertilization (hpf) (Ikonomopoulou et al., 2018). Although many aspects of the technique had been taken into account in the last decade (site of injection, number of cells, image analysis, etc) to develop the most similar model to mimic the human body (Cabezas-Sainz et al., 2018), the temperature have not received much attention. Due to this, most of the studies focus their efforts on the proliferation/invasion of the cells without taking into account the effect of the incubation temperature on the host, and the cell-host interaction underlying this process. The zebrafish embryos carrying the cells have an optimal developmental temperature of 28ºC, and it is necessary to find a compromise temperature between this temperature and that ideal for the human injected cells (37ºC). This temperature should be high enough for xenografted cells to growth properly while allowing the embryos to stay alive and without malformations that compromises the survival of the embryos during the incubation to promote a normal cell-host interaction. Apart from that, gene expression changes are expected depending on the embryos incubation CABEZAS SÁINZ, PABLO 90 temperature at different levels including stress response, immune response and development (Long et al., 2012). As mentioned, temperature plays an important role for the proliferation and metastatic potential of the injected cells, being optimal the human body physiological temperature (36-37ºC). In this context, a wide range of incubation temperatures (31°C to 36°C) have been assayed in xenografted zebrafish embryos to understand injected cancer cells behavior, metabolic phenotype, or invasion; always keeping a balance between mortality and malformations of the embryos and the full proliferative potential of the human cells (Lee et al., 2005; Yang et al., 2013; Zhang et al., 2014; Bansal et al., 2014). Based on the in vitro behavior (proliferation, migration, invasion) of tumor cells at different temperatures (31ºC-37ºC), it has been suggested that a higher temperature would be a better approach to deeply understand the fate of the injected cells and propose working at a temperature range closer to that of the human body (Konantz et al., 2012). Increasing the incubation temperature of the zebrafish embryos could lead to heat induced teratogenic effects, previously described in other species (Ornsrud, et al., 2004) and should be quantified to determine the effect of different temperatures in the xenografted embryos. For this purpose, we selected specific malformations of the embryos to quantify the teratogenic effects at different time points of the developmental stages based on previous studies (Pype et al., 2015). While most of the xenograft studies in the literature perform the incubation at 34ºC, our precious studies (Cabezas-Sainz et al., 2018) showed the possibility of performing this technique raising the temperature to 36ºC and reducing the incubation time of the embryos, obtaining different proliferation rates of the injected cells without incurring in excessive mortality. Considering this, we focused in the quantification of malformations due to the teratogenic effects of the temperature and tested if they were enough to cause mortality of the embryos. Apart from malformations, temperature modifies metabolic pathways in the zebrafish embryos involved in immune/stress response, inflammation, metabolism, and development interfering with the Chapter IV - Quantification of morphological abnormalities and metabolism related changes in xenografted zebrafish embryos at different incubation temperatures 91 overall state of the host in xenograft experiments (Long et al., 2012; Laux et al., 2017). While lacking of an adaptive immune system, zebrafish embryos still have an innate immune system when the xenotransplantation of the cells takes place at 48hpf (Meijer, 2016; van der Ent et al., 2015). Therefore, immune and stress response could be interfering in the behavior of the innate immune system of the embryo and the reaction to the human injected cells inside the embryo depending on the incubation temperature and activation of these metabolic pathways. So, to better characterize the effect of zebrafish incubation at 36ºC and determine if differences exist respect to that observed at 34ºC, we selected genes, previously shown to be affected by temperature (Pype et al., 2015), involved in development (Lft2, Mmp9, Haus3, Junb-a and Lum), immune response (Socs3a, Junb-a), stress response (Apex1, Hspa9), and metabolism (Per2, Wisp) and quantified their expression at 28, 34, and 36ºC. 2. MATERIALS AND METHODS 2.1 ZEBRAFISH HANDLING One-year-old adult zebrafish (Danio rerio, wild-type, strain AB) were maintained at 28ºC in 30 L aquaria at a rate of 1 fish per liter of water, with a light-dark cycle of 14:10 hours. Zebrafish embryos were obtained from mating adults according to previously described procedures (Westerfield, 2000). Zebrafish care, use and treatment were performed in agreement with the Animal Care and Use Committee of the University of Santiago de Compostela and the standard protocols of Spain (Directive 2010-63-UE) and was performed under the experimental project permission MR110250 in the center authorized with REGA code ES270280346401. 2.2 CELL CULTURE AND GFP LABELING The MCF7 human breast cancer cell line was obtained from the American Type Culture Collection (ATCC) and cultured using RPMI medium (GIBCO, Invitrogen) containing 10% FBS (GIBCO, Invitrogen) and 1% Pen/Strep (GIBCO, Invitrogen) at 37ºC with 5% CABEZAS SÁINZ, PABLO 92 CO2 in a humidified atmosphere. MCF7 cells were transduced using a lentiviral-driven GFP construct (Sigma, Mission TurboGFP, SHC003 V). GFP positive cells were selected 72 hours post infection using 10 µg/ml puromycin. 2.3 CELL INJECTION IN ZEBRAFISH EMBRYOS Embryos were collected and placed in Petri dishes at a ratio of 50 embryos/plate at 28ºC. Two days post fertilization (dpf) embryos were dechorionized (if needed) and anesthetized with 0.003% tricaine (Sigma). MCF7 breast cancer cells (10.000-20.000 cells/µl) were loaded into borosilicate glass capillary needles (1 mm O.D. x 0.75 mm I.D.; World Precision Instruments), and injected into embryos yolk sac using IM-31 Electric Microinjector (Narishige). Embryos showing cells outside the yolk were discarded. 2.4 INCUBATION AND ASSAYS CONDITIONS The incubation of the zebrafish embryos was performed in incubators without CO2 at different temperatures depending on the experiment. Embryos were incubated at 28ºC, 34ºC and/or 36ºC in 140mm x 20mm Petri dishes (DeltaLab) for the duration of the experiments at the ratio of 50 embryos/plate, preventing the plates from touching the metal parts of the incubator to avoid water overheating. Every 24h, the egg water (salt dechlorinate tap water, SDTW) was refreshed to account for evaporation, oxygen reduction or accumulation of substances from the embryos. Each assay was performed in triplicate. To determine and compare the effects produced by higher temperatures (34ºC and 36ºC) in different zebrafish embryos developmental stages (0hpf and 48hpf) two types of assays were performed: 2.4.1 Assay starting at 0hpf Embryos were collected at 0hpf and screened after 1hpf to guarantee a normal cell division. Eggs showing abnormal or asymmetric cell division were discarded and replaced by normal ones in order to reach the selected number of embryos for each treatment. Embryos were placed before 2hpf in Petri dishes at two different temperatures (28ºC and 36°C) and incubated for 48hpf, screening the Chapter IV - Quantification of morphological abnormalities and metabolism related changes in xenografted zebrafish embryos at different incubation temperatures 93 embryos for different malformations and mortality at different critical developmental time points (5h, 10h, 24h, 48h) as reported before (Pype et al., 2015). When the 48hs has elapsed, the embryos were placed at 28ºC and the mortality was quantified at different time points up to 336hpf (Fig. 1). 2.4.2 Assay starting at 48hpf In this case embryos were maintained at 28ºC until 48hpf. The embryos showing a normal developmental pattern were divided in four groups. One was injected with the breast cancer cell line MCF7 labeled in GFP, a second group was injected with complete RPMI medium (vehicle), a third group was a blank group (no injection) at 34ºC or 36ºC, and last group was another blank group incubated at 28ºC. Each treatment was then incubated until the 4dpf at 28ºC, 34ºC and 36ºC and finally incubated at 28ºC until 14dpf. Embryos were screened for mortality on a daily basis, and morphological abnormalities were screened at 0, 2, 6, and 12dpi (Fig. 1). Figure 1. Overview of the two assays starting at two different start points. Hpf = hours post fecundation. Dpi = days post injection. CABEZAS SÁINZ, PABLO 100 Figure 5. Mortality quantification at different time points comparing the different incubation conditions of the zebrafish embryos. (A) Mortality quantified at 2dpi. (B) Mortality quantified at 6dpi. (C) Mortality quantified at 12dpi. Parameters are expressed as percentages from the total number of embryos assayed for each condition comparing the incubation of the embryos from 2dpi to 12dpi at 28ºC, 34ºC and 36ºC. One-way ANOVA was performed and differences were considered significant when *p<0.05. Chapter IV - Quantification of morphological abnormalities and metabolism related changes in xenografted zebrafish embryos at different incubation temperatures 101 Figure 6. Morphological abnormalities quantification comparing the different time points and incubation temperatures. (A) Spinal deviation comparison at different time points. (B) Edema comparison at different time points. (C) Head deformation comparison at different time points. Parameters are expressed in percentage of the total number of embryos assayed for each condition comparing the incubation of the embryos for 48h at 28ºC, 34ºC and 36ºC and the posterior recovery at 28ºC until the end of the experiment. One-way ANOVA was performed and differences were considered significant when *p<0.05. CABEZAS SÁINZ, PABLO 102 3.3 GENE EXPRESSION QUANTIFICATION Embryos were incubated at 34ºC and 36ºC for 48h (from 48hpf to 96hpf) and then returned to an optimal temperature of 28ºC for another 72h, with the control group incubated at 28ºC permanently. Gene expression varied for genes analyzed (Tab. 1) in embryos incubated at 34ºC and 36ºC when compared to those at 28ºC after 48h. Some genes did not return to normal expression levels in embryos incubated at 28ºC for another 72h. 3.3.1 Gene expression after 48h of incubation After 48h of incubation at 28ºC, 34ºC and 36ºC the expression of developmental genes (Lft2, Mmp9, Junba and Haus3) and a stress response gene (Hspa9) showed no significant differences. On the contrary, we observed upregulation of Socs3a related to immune response and inflammation, and downregulation of genes involved in stress response (Apex1), metabolism (Wisp and Per2) and structural function (Lum). Of these only Per2 showed a significant difference in embryos grown at 34ºC and 36ºC (Fig. 7A). These results show that except for one gene, there are no significant expression differences in selected genes between 34ºC and 36ºC after 2 days of incubation. 3.3.2 Gene expression after 72h of recovery The expression of the same genes was analyzed in fish incubated at 34ºC and 36ºC and then returned at 28ºC for another 72h. Most of the genes return to normal expression levels except for Socs3a and Per2, this last showing an inverted expression pattern compared to that observed after 48h for the 36ºC condition (Fig. 7B). Apart from that, the expression of Hspa9 is down-regulated probably due to the recovery at a normal temperature for the embryos. Chapter IV - Quantification of morphological abnormalities and metabolism related changes in xenografted zebrafish embryos at different incubation temperatures 103 Name Short name Forward Primer Reverse Primer Amplicon Size Apurinic/Apyrimidinic Endodeoxyribonuclease 1 Apex1 5’- AAAAGGGGAAAGAGCCCGAG-3’ 5’- GTTCTTTTTGACCCACGCCC-3’ 137bp HAUS Augmin Like Complex Subunit 3 Haus3 5’- CCGCTCTGCATTACGAGACT -3’ 5’- AAGCTGGTCACGAACCTCAG -3’ 124bp Left-Right Determination Factor 2 Lft2 5’- GATGGCCGAACTGAAGCTCT -3’ 5’- ACTCTGGCGTGGTTTATCGG -3’ 90bp Lumican Lum 5’-GCCATGTACTGCAATGAGCG-3’ 5’- GGTCGGTGGCATTGTCAAAC -3’ 127bp WNT1 Inducible Signaling Pathway Protein Wisp3 5’- AGGGAAAACCTGCAAACCCA -3’ 5’- TCTTCCAGCGCACATTGGAT -3’ 194bp Period Circadian Regulator 2 Per2 5’- TGGGTTTGACCAAGCAGGTT -3’ 5’- CTGCTTCAGACGTGACCTGT -3’ 153bp Matrix Metallopeptidase 9 Mmp9 5’- AGACGATGCCTGCCAAATCA -3’ 5’- GAGATCTTCCAGTAGCGCCC -3’ 93bp Heat Shock Protein Family A (Hsp70) Member 9 Hspa9 5’- CGGTGCATGTCAAAGCACAA -3’ 5’- TCTCTTTCGCTGGTTTCGCT -3’ 193bp Suppressor Of Cytokine Signaling 3 Socs3a 5’- AGTTCGGACAATCGGCACTT -3’ 5’- GGAGTCCGTCTGCAGGAAAA -3’ 108bp JunB Proto-Oncogene, AP1 Transcription Factor Subunit Junb-a 5’- ACGCCGAAGATCAAGTCGTT -3’ 5’- TCCGTTCGGCTGAAAGTACC -3’ 198bp Beta Actin β-Actin (housekeeping) 5’-CATCAGCATGGCTTCTGCTCTGTATGG-3’ 5’-GACTTGTCAGTGTACAGAGACACCCT-3’ Table 1. qPCR primers sequence CABEZAS SÁINZ, PABLO 104 Figure 7. Gene expression analyzed by qPCR after incubation at different temperatures for 48h or 48h+72h of recovery. (A) Results obtained after incubation of the embryos at 28ºC, 34ºC and 36ºC during 48h. (B) Results obtained after 72h of recovery at 28ºC when the incubation at higher temperatures for 48h had finished. Chapter V - Microenvironment: co-injection of different cell lines with conditioned macrophages 105 CHAPTER V - MICROENVIRONMENT: COINJECTION OF DIFFERENT CELL LINES WITH CONDITIONED MACROPHAGES 1. INTRODUCTION The majority of the breast cancer-related deaths occurs due to metastases, which correlate with a poor clinical outcome (Lambert et al., 2017). Metastases are mainly produced in lung, bone, liver and brain, and are produced by spreading cells from the initial site of the primary tumor through the bloodstream or lymph system to the secondary sites (Nguyen et al., 2009). Tumor microenvironment plays a crucial role in facilitating and enhancing the metastasis processes and the communication between the tumor cells with the surrounding cells (endothelial cells, fibroblast, adipocytes and immune cells). One of the most important cells in tumor microenvironment are the macrophages, being the largest population of infiltrating inflammatory cells (Pollard, 2004; Lewis and Pollard, 2006). Macrophages are divided into different categories attending to the effect produced in the tumor microenvironment: activated M1 macrophages, also known as ‘good macrophages’, are able to kill tumor cells by producing pro-inflammatory cytokines and reactive oxygen/nitrogen species; and activated M2 macrophages, known as ‘bad macrophages’, being the responsible for the promotion of tumor progression, producing anti-inflammatory cytokines (Mills, 2012; Mantovani et al., 2017). In tumor microenvironment, another type of macrophages appears, called tumor-associated macrophages or TAMs, exhibiting a behavior closer to the M2 or ‘bad macrophages’. As a result, these macrophages promote key steps in tumor progression, CABEZAS SÁINZ, PABLO 106 including angiogenesis, tumor cell migration/invasion and metastasis (Noy and Pollard, 2014; Williams et al., 2016). Apart from that, and related to breast cancer progression, the homeobox 1 transcription factor (POU1F1), known as Pit-1, apart from the regulation of the growth hormone and the prolactin gene transcription in the human pituitary gland, is also expressed in human mammary gland (Lefevre et al., 1987; Nelson et al., 1988). Its expression is higher in tumor than in normal breast (Gil-Puig et al., 2005). This Pit-1 overexpression in the mammary gland when a tumor is present, can be considered as a tumor promoting factor, increasing cell proliferation, reducing apoptosis and up-regulating certain factors like Snail, metalloproteases, and CXCR4/CXCL12 (Ben-Batalla et al., 2010; Sendon-Lago et al., 2014; Martinez-Ordoñez et al., 2018), all factors involved in breast cancer progression (Vizoso et al., 2007; Nieto et al., 2016; Müller et al., 2001). Taking this into account, studies performed correlates the Pit-1 overexpression with spreading of the cells, distant metastasis and poor prognosis of patients with breast cancer (Ben-Batalla et al., 2010; Martinez-Ordoñez et al., 2018; Gao et al., 2016). However, some mediators of Pit-1 actions are still unknown like CXCR4 chemokine receptor and its ligand CXCL12 that could play a critical role in the pro-tumoral process induced by Pit-1. Zebrafish has emerged as an ideal model to get a broader view of the behavior of human cancer injected cells inside the embryos and the development of the tumor in an in vivo situation (Lee et al., 2005; Nicoli and Presta, 2007; Fior et al., 2017; Ikonomopoulou et al., 2018). The cells can be labeled with fluorescent proteins like GFP and the macrophages can be easily dyed with commercial lipophilic dyes (DiI, DiO, DiD), in order to track the progression of the proliferation of the cells and the distribution of the macrophages inside the yolk sac of the fish (Pruvot et al., 2011; Drabsh et al., 2013). Here, we propose to evaluate, through the co-injection of the Pit-1 breast cancer tumor cells and the tumor-associated macrophages (TAMs) inside the yolk sac of the embryo, the interaction between the Chapter V - Microenvironment: co-injection of different cell lines with conditioned macrophages 107 injected cells and the microenvironment; and try to know how conditioned TAMs may affect breast cancer progression. Apart from that, the spread of the cells supported by the macrophages were measured to test if this important component of the tumor stroma is helping the cells in their process of dispersion and metastasis. Finally, we evaluated the role of the CXCR4 chemokine receptor and its ligand CXCL12 by knocking-down the CXCR4 chemokine receptor in MCF7Pit-1 cells and injecting them into the yolk sac of zebrafish embryos. 2. MATERIALS AND METHODS 2.1 CELL LINES AND CULTURES The human breast adenocarcinoma MCF7-GFP cell line was purchased from Cell Biolabs (San Diego, USA). The human monocyte U937 cell line was obtained from the European Collection of Cell Culture (ECACC; Porton Down, UK). MCF7-GFP cell line was cultured using DMEM Medium (GIBCO, Invitrogen) containing 10% FBS (GIBCO, Invitrogen) and 1% Pen/Strep (GIBCO, Invitrogen) at 37°C with 5% CO2 in a humidified atmosphere. 2.2 ZEBRAFISH CARE AND BREEDING Adult zebrafish (Danio rerio) were maintained in 30L aquaria with a ratio of 1 fish per liter of water, with 14:10 day/night cycle and a temperature of 28,5ºC according to the standard procedures (Westerfield, 2000). Zebrafish embryos were obtained mating adult zebrafish in a proportion of 2 females / 1 male. All the procedures used in the experiments, fish care and treatment were performed in agreement with the Animal Care and Use Committee of the University of Santiago de Compostela and the standard protocols of Spain (Directive 2010-63-UE) and was performed under the experimental project permission MR110250 in the center authorized with REGA code ES270280346401. At the final point of the experiments, zebrafish embryos were euthanized by tricaine overdose. CABEZAS SÁINZ, PABLO 108 2.3 ZEBRAFISH TUMOR XENOGRAFT ASSAY AND COMPUTERIZED IMAGE ANALYSIS In order to perform the xenografts, 48 hours post fecundation (hpf) zebrafish embryos were anesthetized with 0.003% tricaine (Sigma). MCF7, MCF7-Pit-1 and MCF7-Pit-1shCXCR4 cells expressing GFP were incubated at 37ºC and 5% CO2 before injection until they reach 80% confluence. Macrophages were conditioned to each cell line medium, TAMlowCD163 or TAMhighCD163 corresponding to MCF7-GFP and MCF7-Pit-1-GFP respectively; collected before injection and dyed with Vybrant Dil (red) cell-tracker dye (Thermo Scientific) following manufacturer protocol. Afterwards, cells and macrophages were collected and resuspended at 10,000-20,000 cells/µl and with a proportion of 3:1 cells/macrophages in complete DMEM and maintained at room temperature for no longer than two hours before they were injected. Borosilicate glass capillary needles (1 mm O.D. x 0.78 mm I.D.; Harvard Apparatus) were used in order to inject cells into the yolk manually using IM-31 Electric Microinjector (Narishige) with an output pressure of 34 kPa and 30 ms injection time. Poorly or noninjected embryos were discarded. After the injection, zebrafish embryos were incubated for 48hpi at 36ºC in 24-well plates with salt de-chlorinated tap water (SDTW) and a PCR-tape covering the plate to avoid evaporation. Each of the embryos was photographed at 0hpi and 72hpi with AZ-100 Nikon fluorescence stereomicroscope in order to track the proliferation of the injected GFP cells and DiI macrophages. The analysis was performed with ZFtool software yielding the number of GFP pixel in each image, which represents the area of the cells inside the yolk sac of the embryo and the GFP Intensity Medium Value, which represents the medium intensity of the GFP inside the embryo. This analysis is executed at 0hpi and 48hpi to obtain a comparison between them. The results were processed to obtain a proliferation ratio (1: the number at which the cells are maintained during incubation, >1: tumor cell proliferation during incubation, and <1: tumor cell death during incubation). Chapter V - Microenvironment: co-injection of different cell lines with conditioned macrophages 109 2.4 STATISTICS Statistical analyses were performed using SPSS Software (IBM). Homoscedasticity was tested for all the data and then an excel outlier analysis was carry out using interquartile range (IQR) to discard possible outliers. U Mann-Whitney test for non-parametrical data was applied to non-homoscedastic data with confidence intervals of 95%. 3. RESULTS Based on a collaboration with another research group (Román Perez, CIMUS), we assayed the co-injection of human breast cancer cells (MCF7-GFP) with conditioned macrophages in order to test if the addition of a principal component of the human stroma is crucial for the progression and spreading of tumor cancer cells in vivo. Besides that, another assay was carried out to confirm that the axis CXCL12 chemokine and its CXCR4 receptor mediates tumor growth and migration in vivo. As we stated in the introduction of this chapter, the Pit-1 gene overexpression in the cells is related with tumor environment in the breast of the patients and it is considered as a tumor promoting factor. The overexpression of this gene causes a poor prognosis and we wanted to assay in vivo with the zebrafish as a model organism the relation between the overexpression of this gene in the human tumor cells and the TAMs that arises when a tumor is present. In this way, normal monocytes were exposed to the medium of MCF7-Pit-1 human breast cancer cells and isolated to perform the co-injection of MCF7-Pit-1 cancer cells and the macrophages conditioned to a normal MCF7 cell line against macrophages conditioned with MCF7-Pit-1 cell line, in order to see the differences between them. The CXCR4 chemokine receptor could be influencing the tumor growth and spreading of the cells. To test this hypothesis, MCF7-GFP cells were knocked-down for this CRCR4 receptor, in order to test whether this receptor could be interfering in the cell spread. CABEZAS SÁINZ, PABLO 116 considered as one disease, the reality is far from that, due to the fact that each case of cancer has their own peculiarities even in the same type of cancer (e.g. breast cancer) (Özdemir and Dotto, 2017). Considering the differences that exists between types of cancer, and on the other hand the differences between individuals, the necessity of animal modeling for personalized medicine has increased in the last years. Being mice nowadays the main avatar model for cancer personalized medicine due to the genome similarity with the human (Mouse Genome Sequencing et al., 2002), zebrafish can offer a more affordable alternative to mice, being able to perform in this small embryos high-throughput screening of different combinations of chemotherapeutic drugs and reducing the time needed to obtain an accurate result (MacRae and Peterson, 2015; Letrado et al., 2018). In the present thesis, we tested overall conditions of the xenograft technique improving image analysis and temperature, demonstrating that the temperature of 36ºC is an important factor for obtaining more accurate and precise results (Cabezas-Sainz et al., 2018). Besides that, these results were complemented by testing how this temperature affects the zebrafish embryos at different levels (malformations and metabolism related changes) and highlighting that this temperature is, in terms of abnormalities, close to the most used temperature in the bibliography, 34ºC (Eguiara et al., 2011; Ghotra et al., 2012; He et al., 2012; Ban et al., 2014; Ent et al., 2014). Finally, we tested this improved technique, and advance another step in the way of the model for reaching the personalized medicine, by measuring the proliferation and spreading of the MCF7 breast cancer cells injected in the zebrafish embryo with another component of the human stroma present on all of the tumors: the macrophages (Brown et al., 2017). 1. IMPROVEMENT OF THE XENOTRANSPLANTATION TECHNIQUE BY MODIFYING THE INCUBATION TEMPERATURE OF THE EMBRYOS AND DEVELOPING A NEW IMAGE ANALYSIS SOFTWARE An enhancement of the xenotransplantation technique is required, together with accurate imaging analysis software to verify the behavior of the cells inside the zebrafish embryo. This study describes an Chapter VI - Discussion 117 improvement in the xenotransplantation conditions in relation to temperature and the establishment of a proliferation index of the injected cells in combination with the new image analysis ZFtool software. Different authors reported normal development of zebrafish embryos up to 35.5ºC (Nicoli and Presta, 2007; Stoletov et al., 2010), but a range of temperatures was tested in order to reduce the mortality of the embryos. Some authors noted that more assays would be needed to check the proliferation, migration, and response of the cells to drugs at higher temperatures despite the potential increase in mortality (Konantz et al., 2012). We have set the temperature of the cells xenotransplanted into the zebrafish embryos closer to human temperature by raising the temperature from 28ºC (normal temperature at which zebrafish embryos develop) to 36ºC, with no significant change in mortality and no developmental defects on the surviving embryos at three days post injection. Embryo incubation temperature is important to test the effects of anticancer drugs (Jung et al., 2012; Bentley et al., 2015), otherwise the temperature could affect the proliferation rate of the injected cells, and the drug effect is underestimated. The results in this study clearly showed that the proliferation of injected cells and their response to anticancer drugs is better at 36ºC than at 34ºC. Importantly, 36ºC is more close to the cell optimal growth temperature of 37ºC in the human body. The number of injected cells is very relevant in terms of the proliferation and migration of these cells and should be considered for improving xenotransplantation and anticancer drug proliferation assays. The growth rate of the cells injected inside the embryos decays when the number of initial cells is insufficient at 34ºC. This may be due to cell-cell interactions: the cells injected appear to be isolated and cannot interact among themselves in order to proliferate properly. Nevertheless, even if we reduce the number of injected cells at the initial time point of 0hpi, when the embryos are incubated at 36ºC, a higher proliferation rate exists, when compared to 34ºC and low number of cells injected. This previous point was assayed in vivo, demonstrating CABEZAS SÁINZ, PABLO 118 that, despite the number of injected cells and mortality, 36ºC is an optimal temperature for cell growth. On the other hand, cell migration can also be modified, depending on the number of cells injected. Cells will not be able to migrate when the number of injected cells is insufficient. It is reported that 400 cells are the optimal number of injected cells to study these behaviors. The injection of different numbers of the colorectal cancer cell line HCT116 remained in the yolk of the embryo from 0hpi to 72hpi, consistent with other authors that used the HCT116 cell line. In fact, this cell line has a low dissemination ratio (Jung et al., 2012; Spaink et al., 2013). Using in vitro studies, other authors have performed proliferation assays with the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide colorimetric assay (MTT). The initial cell density seeded on the plates was the same for each experiment, therefore, there was no assessment of how the proliferation could change with different concentrations of the initial cells seeded (Jung et al., 2012; Zhao et al., 2011). In this study, we show that, at least for the cell line HCT116, the temperature and number of initially seeded cells are critical factors for the proliferation of injected cells. Together with the work done for the improvement of incubation temperature in zebrafish xenotransplantation, a new software (ZFTool) was developed to measure the cell proliferation inside the yolk of the embryo, that could be extrapolated to other sites of injection. This method was designed to fill the gap present in the current methodology that does not adequately quantify cell proliferation at different times in vivo. For example, flow cytometry is not sensitive enough to quantify the number of cells in dispersed embryos (Pruvot et al., 2011), and software used by other authors, such as ImageJ or Photoshop, do not automatically quantify proliferation in an accurate, reliable or reproducible way enough to compare different injected embryos (Corkery et al., 2011; Moshal et al., 2011; Yang et al., 2013). This software establishes in each pair of images analyzed an automatic threshold in order to measure the fluorescence of the cells, discarding the autofluorescence of the embryo, yielding more accurate results. Chapter VI - Discussion 119 In summary, we demonstrated that at 36ºC, a better proliferation rate exists for the injected cells inside the embryos, with no significant mortality changes compared with 34ºC. Our results also revealed a correlation between the number of initially injected cells and the proliferation ratio when comparing the two different temperatures. In addition, we used a new image analysis software, the ZFtool, which improves tumor cell quantification in vivo with accuracy and speed. One of the future challenges will be the quantification of these cells with a 3D method with much greater accuracy, reaching the count of each cell individually. 2. COMPARISON OF THE DEVELOPMENT DEFECTS, MORTALITY AND METABOLISM OF THE ZEBRAFISH EMBRYOS INCUBATED AT 28ºC, 34ºC AND 36ºC One of the most important parameters of the xenograft affecting the proliferation rate of the cells and the integrity of the host, is temperature. Higher incubation temperatures result is a boost of cells proliferation in detriment of integrity of the host (Konantz et al., 2012), but it is important in order to obtain accurate results, even if a treatment is applied to the injected cells. This last point is highlighted in recent works assaying 5-Fluorouracil in xenografted colorectal cancer cells at different temperatures and obtaining different inhibition ratios (Cabezas-Sainz et al., 2018). We have previously shown that incubating embryos at 36ºC for up to three days is feasible and no higher mortality is observed when compared to embryos incubated a 34ºC (Cabezas-Sainz et al., 2018). Temperature induced malformations is less clear, while it was recently reported that incubation of zebrafish embryos at 32,5ºC and above causes malformations on the fishes (Pype et al., 2015), other authors reported normal development up to 35,5ºC (Nicoli and Presta, 2007; Stoletov et al., 2010). In this work, we aimed to study the effect of the temperature range used in xenograft experiments on the host and further explore the possibility of increasing the temperature of xenograft assays up to 36ºC. CABEZAS SÁINZ, PABLO 120 In a first experiment, embryos were incubated at 36ºC from 0hpf to 48hpf to confirm if they could be more sensitive in this stage of development to temperature. While mortality was not different at 48hpf when compared to previous reports (Pype et al., 2015), malformations were present in most of the embryos incubated at 36ºC, being significant the spinal deviation and the edema. Apart from that, at this point (48hpf), the hatching rate of the embryos was higher at 36ºC due to the increase in development speed produced by temperature. Interestingly, the hatching rate of 36’5ºC is 0% (Pype et al., 2015) pointing to an inflexion point in the tolerated temperature between 36ºC and 36’5ºC. No differences in mortality were observed between treatments at 336hpf. Based on this data, the most sensitive stage in terms of temperature for the zebrafish embryos development appears to be between 5hpf and 24hpf. In a second experiment, we incubated xenografted and noxenografted embryos during 2 days at 34ºC (this is the normal temperature for this type of experiment (Eguiara et al., 2011, He et al., 2012, Spaink et al., 2013)) and 36ºC to compare mortality, morphological effects, and metabolism. Compared to the first stage of development (0hpf - 48hpf, previous experiment), the incubation at 36ºC for 48h (48hpf to 96hpf, range we stablished for xenograft assays at 36ºC (Cabezas-Sainz et al., 2018)) and the posterior recovery of the embryos showed different results. At this stage of development and under different conditions (control, injected with medium or injected with cells), the embryos are less sensitive to temperature changes than in the first 48h. This could be related to a higher incidence of temperature on development between 0hpf and 48hpf yielding more abnormalities and mortality of the embryos. Hatched embryos in larval stage of development incubated at 36ºC and injected with medium or cells could lead to higher mortality compared to 34ºC. For example, when the embryos are injected and incubated at 36ºC, there is an increased tendency to spinal deviation and edema. The absence of differences in mortality and malformations in injected embryos (medium and cells) between 34ºC and 36ºC at 2dpi open up to the possibility of reducing the incubation time to 2dpi to see xenografted cells proliferation, invasion or drug effects. The optimal temperature Chapter VI - Discussion 121 would be 36ºC to assure a nearly optimal temperature for the cells, allowing more consistent and realistic results, taking into account the state of the host and the cell-host interaction. Otherwise, lower temperatures could lead to lower tumor cell proliferation (Fior et al., 2017; Wu et al., 2017), ending up in an overestimation of the chemotherapeutic effect for assayed drugs (Cabezas-Sainz et al., 2018). A gene expression analysis of different genes related to development, immune system, stress, and metabolism based on a previous work (Long et al., 2012) was performed to assess the effect of different incubation temperatures and xenograft conditions on zebrafish embryos. Despite the incubation start point between our work and Long’s work (Long et al., 2012) (48hpf vs 96hpf) and the incubation period (48h vs 2h/48h), the results for the negatively regulated genes (Apex1, Haus3, Lft2, Lum and Wisp3) was concordant. This was also the case for the up-regulated genes (Hspa9, Junb-a and Socs3a), except for Per2 and Mmp9. Mmp9 appeared repressed when the incubation was performed at 34ºC while up-regulated at 36ºC. After 72h of recovery these two values switched, but without significant differences between temperatures. After the 48h incubation at 34ºC and 36ºC, Per2, involved in the circadian cycle regulation (Kim et al., 2018) and metabolism, was affected, being repressed to a higher degree at 36ºC than at 34ºC. After the 72h recovery period the gene differentially expressed according to the temperature was Socs3a (pro-inflammatory and immune response) (Yee et al., 2011), with up-regulation at 34ºC and down-regulation at 36ºC, highlighting an unusual behavior when we raise the temperature from 34ºC to 36ºC. While there is a recovery of this component of the immune system for embryos incubated at 34ºC no such thing happens for embryos incubated at 36ºC. In relation with Per2, down-regulation of this gene induces the expression of pro-inflammatory cytokines in zebrafish. Generally, these pro-inflammatory cytokines show an expression pattern related to the light-dark cycle showing a peak during the dark period. So one explanation for the expression profile of Per2 could be that when the zebrafish embryos are in dark as occurs in this study (embryos are CABEZAS SÁINZ, PABLO 122 incubated in the dark at 34ºC and 36ºC), the down-regulation of this gene probably induces the expression of pro-inflammatory cytokines (Ren et al., 2018). Also, the strong down-regulation of Per2 after 48h at 34ºC and even more at 36ºC could be due an effect of the temperature upon the expression of this gene. This makes sense if the embryos are subject to increased temperatures: genes related to the immune and inflammatory response (as for example Socs3a) are up-regulated, highlighting that the embryo is reacting to thermal stress. At this point, Per2, related to pro-inflammatory cytokines, is down-regulated to promote the inflammatory response of the embryo to high temperatures. Socs3a, apart from being involved in immune response and inflammatory pathways, is related to tissue regeneration, acting as a negative regulator of the STAT3 signaling pathway. This pathway is involved in regeneration of the liver, skin, fin, retinas, and the sensory epithelium hair cells of the inner ear of zebrafish embryos, apart from being involved in cell proliferation, migration, and survival (Khaliq et al., 2018; Liang et al., 2012). Socs3a is differentially regulated after the 72h of embryo recovery, being slightly up-regulated at 34ºC and downregulated at 36ºC. The down-regulation we observed in this gene after the 72h of recovery at 28ºC after incubation at 36ºC could be a consequence of the embryo tissue damage after incubation at 36ºC during 48h that needs to be compensated by continued activation the STAT3 pathway. At 34ºC tissue damage could be lower and/or be already repaired by the time we assayed the Socs3a expression. In conclusion, no significant differences exist in mortality or malformations in control and xenografted zebrafish embryos incubated at 34ºC and 36ºC for 48h. Gene expression changes between these two temperatures may affect the inflammatory response and regeneration differentially. Considering this, 36ºC should be the temperature of choice in experiments with a duration of 48h in order to get robust and accurate results in terms of tumor cell proliferation and/or invasion, and drug testing in vivo. Chapter VI - Discussion 123 3. TESTING THE MICROENVIRONMENT EFFECTS: CO-INJECTION OF DIFFERENT CELL LINES WITH CONDITIONED MACROPHAGES In this study, we performed the in vivo part with zebrafish embryos as a model organism in order to measure and test the different conditions of MCF7-Pit-1-GFP cell line with different conditioned macrophages acting as a microenvironment inside the yolk sac of the embryos. The communication that takes place between the tumor and the surrounding microenvironment is crucial for the cancer progression inside the human body (Lazennec and Richmond, 2010). Pit-1 overexpression in MCF7 breast cancer cells produce an increase in secretion of different factors like cytokines and chemokines (Lazennec and Richmond, 2010) that are relevant for the mobilization of macrophages to tumor area and transforming them into tumor associated macrophages (TAM’s) (Quail and Joice, 2013; Bin-Zhi and Pollard, 2010). Besides that, this overexpression is related to more tumor growth, angiogenesis and cell spreading (Lewis et al., 2000). The most important consequence of cell spreading is the metastasis, mostly occurring in lung in this case. Considering this, patients with high Pit1 expression have poor prognosis and a high risk of lung metastasis. In this study we applied our own developed methodology to test the involvement of TAMhighCD163 and the TAMlowCD163 in the processes underlying the interaction between these conditioned macrophages and the MCF7-Pit-1-GFP tumor cells inside the yolk sac of the embryo in terms of proliferation and the spreading of the tumor cells. Interestingly, our data agree with a recent study performed in zebrafish using tumor cells co-injected with TAMs isolated from metastatic human primary tumors that exhibit high invasion and metastasis capacity compared to TAMs isolated from non-metastatic tumors, demonstrating that tumor cells are highly dependent on macrophages for their dissemination (Wang et al., 2015). Zebrafish as an animal model, compared to the murine model, still has some drawbacks in terms of metastatic potential of tumors and the spreading of the cells due to the fact that the organs of the zebrafish are CABEZAS SÁINZ, PABLO 124 pre-formed at 2 days post fertilization (Howe et al., 2013a), but the mouse model provides more information about the metastatic potential of the cells and the preferred site of implantation when they spread from the primary tumor site (Paschall and Liu, 2016; Jäger et al., 2018). The tropism of the cells injected into zebrafish embryos is difficult to evaluate, as previously mentioned, and in this case, because zebrafish lacks some analog organs compared to human in the case of breast cancer. Even more, the organ where breast cancer metastasizes with higher probability, the lung, is missing in zebrafish. Considering this, there are some experiments easily performed in zebrafish that could be worth before testing them in mice, being the two animal models complementary for different situations. Finally, some authors highlighted another problem regarding the innate immune system of the embryos. Zebrafish embryos develop the adaptive immune system from day 12-14 of life and afterwards the only immune system is the innate immune system that the female provides (Renshaw and Trede, 2012). This innate system includes mostly macrophages and neutrophils and it has been demonstrated that this innate immune system interacts with the xenografted cells inside the embryos (Tulotta et al., 2016). Considering this, the innate immune system could be playing a role in the proliferation and spread of the primary tumor of the fish. In summary, the data obtained indicates that the zebrafish is a valid model to test the microenvironment of human tumor cells with the coinjection of conditioned macrophages. Being Pit-1 overexpression the cause of recruiting and differentiating normal macrophages into TAM’s with high expression of CD163. The cells where co-injected with different conditions of macrophages and the results showed an increase in proliferation of the cells injected with TAMhighCD163, supporting the results obtained in vitro prior to the in vivo assays. Apart from that, it could be possible to measure the spreading of the cells inside the yolk sac of the embryos within different conditions due to the influence of the TAMhighCD163 macrophages. Chapter VII - Conclusions 125 CHAPTER VII - CONCLUSIONS The work summarized in these three chapters aimed to improve the xenotransplantation technique in zebrafish embryos through raising the incubation temperature to 36ºC and analyzing the phenotypic and metabolism effects of this temperature in the zebrafish embryos, to finally add the effect of the microenvironment and reach closest conditions to the human body. The results allowed us to withdraw the following conclusions: 1.- ZFtool software allows the researcher for an accurate and automatized analysis of the images of the zebrafish embryos and, on the other hand, human colorectal cancer cell line HCT116 injected into zebrafish embryos has a better proliferation index at 36ºC rather than at 34ºC. Furthermore, 36ºC is the most suitable temperature for testing chemotherapeutic drugs like the 5-Fluorouracil. 2.- No significant differences exist in mortality or malformations in control and xenografted zebrafish embryos incubated at 34ºC and 36ºC for 48h. Gene expression changes between these temperatures may affect the inflammatory response and regeneration during the incubation through Per2 down-regulation and afterwards, after the recovery period through Socs3a of the embryos at 36ºC. Taking this into account, experiments with a duration of 48h and an incubation temperature of 36ºC should be the choice in order to get robust and accurate results in terms of tumor cell proliferation and/or invasion, and drug testing in vivo. 3.- Co-injection of conditioned macrophages with human MCF7 breast cancer cell line demonstrates that the microenvironment components are important to reach the full potential of the injected human cancer cells inside the yolk of the embryos, giving support and enhancing the proliferation and spreading of the cells. This study CABEZAS SÁINZ, PABLO 132 controls human breast cancer metastasis in a zebrafish xenograft model", Breast cancer research: BCR, vol. 15, no. 6, pp. R106. Drabsch, Y., Snaar-Jagalska, B.E. & Ten Dijke, P. 2017, "Fish tales: The use of zebrafish xenograft human cancer cell models", Histology and histopathology, vol. 32, no. 7, pp. 673-686. Eguiara, A., Holgado, O., Beloqui, I., Abalde, L., Sanchez, Y., Callol, C. & Martin, A.G. 2011, "Xenografts in zebrafish embryos as a rapid functional assay for breast cancer stem-like cell identification", Cell cycle (Georgetown, Tex.), vol. 10, no. 21, pp. 3751-3757. Eliceiri, B.P., Gonzalez, A.M. & Baird, A. 2011, "Zebrafish model of the blood-brain barrier: morphological and permeability studies", Methods in molecular biology (Clifton, N.J.), vol. 686, pp. 371-378. Ennour-Idrissi, K., Maunsell, E. & Diorio, C. 2017, "Telomere Length and Breast Cancer Prognosis: A Systematic Review", Cancer epidemiology, biomarkers & prevention: a publication of the American Association for Cancer Research, cosponsored by the American Society of Preventive Oncology, vol. 26, no. 1, pp. 310. FARBER, S. & DIAMOND, L.K. 1948, "Temporary remissions in acute leukemia in children produced by folic acid antagonist, 4-aminopteroyl-glutamic acid", The New England journal of medicine, vol. 238, no. 23, pp. 787-793. Fior, R., Povoa, V., Mendes, R.V., Carvalho, T., Gomes, A., Figueiredo, N. & Ferreira, M.G. 2017, "Single-cell functional and chemosensitive profiling of combinatorial colorectal therapy in zebrafish xenografts", Proceedings of the National Academy of Sciences of the United States of America, vol. 114, no. 39, pp. E8234-E8243. References 133 Fraher, D., Sanigorski, A., Mellett, N.A., Meikle, P.J., Sinclair, A.J. & Gibert, Y. 2016, "Zebrafish Embryonic Lipidomic Analysis Reveals that the Yolk Cell Is Metabolically Active in Processing Lipid", Cell reports, vol. 14, no. 6, pp. 1317-1329. Gallina, G., Dolcetti, L., Serafini, P., De Santo, C., Marigo, I., Colombo, M.P., Basso, G., Brombacher, F., Borrello, I., Zanovello, P., Bicciato, S. & Bronte, V. 2006, "Tumors induce a subset of inflammatory monocytes with immunosuppressive activity on CD8+ T cells", The Journal of clinical investigation, vol. 116, no. 10, pp. 2777-2790. Galmarini, D., Galmarini, C.M. & Galmarini, F.C. 2012, "Cancer chemotherapy: a critical analysis of its 60 years of history", Critical reviews in oncology/hematology, vol. 84, no. 2, pp. 181-199. Gao, Z., Xue, K., Zhang, L. & Wei, M. 2016, "OverExpression of POU Class 1 Homeobox 1 Transcription Factor (Pit1) Predicts Poor Prognosis for Breast Cancer Patients", Medical science monitor: international medical journal of experimental and clinical research, vol. 22, pp. 4121-4125. Gee, M.S., Procopio, W.N., Makonnen, S., Feldman, M.D., Yeilding, N.M. & Lee, W.M. 2003, "Tumor vessel development and maturation impose limits on the effectiveness of anti-vascular therapy", The American journal of pathology, vol. 162, no. 1, pp. 183-193. Ghotra, V.P., He, S., de Bont, H., van der Ent, W., Spaink, H.P., van de Water, B., Snaar-Jagalska, B.E. & Danen, E.H. 2012, "Automated whole animal bio-imaging assay for human cancer dissemination", PloS one, vol. 7, no. 2, pp. e31281. Gil-Puig, C., Seoane, S., Blanco, M., Macia, M., GarciaCaballero, T., Segura, C. & Perez-Fernandez, R. 2005, "Pit-1 is CABEZAS SÁINZ, PABLO 134 expressed in normal and tumorous human breast and regulates GH secretion and cell proliferation", European journal of endocrinology, vol. 153, no. 2, pp. 335-344. Goldstone, J.V., McArthur, A.G., Kubota, A., Zanette, J., Parente, T., Jonsson, M.E., Nelson, D.R. & Stegeman, J.J. 2010, "Identification and developmental expression of the full complement of Cytochrome P450 genes in Zebrafish", BMC genomics, vol. 11, pp. 643-2164-11-643. Grosso, G., Bella, F., Godos, J., Sciacca, S., Del Rio, D., Ray, S., Galvano, F. & Giovannucci, E.L. 2017, "Possible role of diet in cancer: systematic review and multiple meta-analyses of dietary patterns, lifestyle factors, and cancer risk", Nutrition reviews, vol. 75, no. 6, pp. 405-419. Haldi, M., Ton, C., Seng, W.L. & McGrath, P. 2006, "Human melanoma cells transplanted into zebrafish proliferate, migrate, produce melanin, form masses and stimulate angiogenesis in zebrafish", Angiogenesis, vol. 9, no. 3, pp. 139-151. Hamilton, F. (1822) An Account of the Fishes Found in the River Ganges and its Branches. Edinburgh and London, Archibald Constable and Co.:321, 390, and 405 Hanahan, D. & Folkman, J. 1996, "Patterns and emerging mechanisms of the angiogenic switch during tumorigenesis", Cell, vol. 86, no. 3, pp. 353-364. Hanahan, D. & Weinberg, R.A. 2011, "Hallmarks of cancer: the next generation", Cell, vol. 144, no. 5, pp. 646-674. He, S., Lamers, G.E., Beenakker, J.W., Cui, C., Ghotra, V.P., Danen, E.H., Meijer, A.H., Spaink, H.P. & Snaar-Jagalska, B.E. 2012, "Neutrophil-mediated experimental metastasis is enhanced References 135 by VEGFR inhibition in a zebrafish xenograft model", The Journal of pathology, vol. 227, no. 4, pp. 431-445. Hidalgo, M., Bruckheimer, E., Rajeshkumar, N.V., GarridoLaguna, I., De Oliveira, E., Rubio-Viqueira, B., Strawn, S., Wick, M.J., Martell, J. & Sidransky, D. 2011, "A pilot clinical study of treatment guided by personalized tumorgrafts in patients with advanced cancer", Molecular cancer therapeutics, vol. 10, no. 8, pp. 1311-1316. Hodgson, S. 2008, "Mechanisms of inherited cancer susceptibility", Journal of Zhejiang University.Science.B, vol. 9, no. 1, pp. 1-4. Howe DG, Bradford YM, Conlin T, Eagle AE, Fashena D, Frazer K, Knight J, Mani P, Martin R, Moxon SA, Paddock H, Pich C, Ramachandran S, Ruef BJ, Ruzicka L, Schaper K, Shao X, Singer A, Sprunger B, Van Slyke CE, Westerfield M. 2013a. ZFIN, the Zebrafish Model Organism Database: increased support for mutants and transgenics. Nucleic Acids Research. Jan;41(Database issue): D854-60. Howe, K., Clark, M.D., Torroja, C.F., Torrance, J., Berthelot, C., Muffato, M., Collins, J.E., Humphray, S., McLaren, K., Matthews, L., McLaren, S., Sealy, I., Caccamo, M., Churcher, C., Scott, C., Barrett, J.C., Koch, R., Rauch, G.J., White, S., Chow, W., Kilian, B., Quintais, L.T., Guerra-Assuncao, J.A., Zhou, Y., Gu, Y., Yen, J., Vogel, J.H., Eyre, T., Redmond, S., Banerjee, R., Chi, J., Fu, B., Langley, E., Maguire, S.F., Laird, G.K., Lloyd, D., Kenyon, E., Donaldson, S., Sehra, H., Almeida-King, J., Loveland, J., Trevanion, S., Jones, M., Quail, M., Willey, D., Hunt, A., Burton, J., Sims, S., McLay, K., Plumb, B., Davis, J., Clee, C., Oliver, K., Clark, R., Riddle, C., Elliot, D., Threadgold, G., Harden, G., Ware, D., Begum, S., Mortimore, B., Kerry, G., Heath, P., Phillimore, B., Tracey, A., Corby, N., Dunn, M., Johnson, C., Wood, J., Clark, S., Pelan, S., Griffiths, G., Smith, M., Glithero, CABEZAS SÁINZ, PABLO 136 R., Howden, P., Barker, N., Lloyd, C., Stevens, C., Harley, J., Holt, K., Panagiotidis, G., Lovell, J., Beasley, H., Henderson, C., Gordon, D., Auger, K., Wright, D., Collins, J., Raisen, C., Dyer, L., Leung, K., Robertson, L., Ambridge, K., Leongamornlert, D., McGuire, S., Gilderthorp, R., Griffiths, C., Manthravadi, D., Nichol, S., Barker, G., Whitehead, S., Kay, M., Brown, J., Murnane, C., Gray, E., Humphries, M., Sycamore, N., Barker, D., Saunders, D., Wallis, J., Babbage, A., Hammond, S., MashreghiMohammadi, M., Barr, L., Martin, S., Wray, P., Ellington, A., Matthews, N., Ellwood, M., Woodmansey, R., Clark, G., Cooper, J., Tromans, A., Grafham, D., Skuce, C., Pandian, R., Andrews, R., Harrison, E., Kimberley, A., Garnett, J., Fosker, N., Hall, R., Garner, P., Kelly, D., Bird, C., Palmer, S., Gehring, I., Berger, A., Dooley, C.M., Ersan-Urun, Z., Eser, C., Geiger, H., Geisler, M., Karotki, L., Kirn, A., Konantz, J., Konantz, M., Oberlander, M., Rudolph-Geiger, S., Teucke, M., Lanz, C., Raddatz, G., Osoegawa, K., Zhu, B., Rapp, A., Widaa, S., Langford, C., Yang, F., Schuster, S.C., Carter, N.P., Harrow, J., Ning, Z., Herrero, J., Searle, S.M., Enright, A., Geisler, R., Plasterk, R.H., Lee, C., Westerfield, M., de Jong, P.J., Zon, L.I., Postlethwait, J.H., Nusslein-Volhard, C., Hubbard, T.J., Roest Crollius, H., Rogers, J. & Stemple, D.L. 2013b, "The zebrafish reference genome sequence and its relationship to the human genome", Nature, vol. 496, no. 7446, pp. 498-503. Hruscha, A., Krawitz, P., Rechenberg, A., Heinrich, V., Hecht, J., Haass, C. & Schmid, B. 2013, "Efficient CRISPR/Cas9 genome editing with low off-target effects in zebrafish", Development (Cambridge, England), vol. 140, no. 24, pp. 4982-4987. Ignatius, M.S. & Langenau, D.M. 2011, "Fluorescent imaging of cancer in zebrafish", Methods in cell biology, vol. 105, pp. 437459. Ikonomopoulou, M.P., Fernandez-Rojo, M.A., Pineda, S.S., Cabezas-Sainz, P., Winnen, B., Morales, R.A.V., Brust, A., References 137 Sanchez, L., Alewood, P.F., Ramm, G.A., Miles, J.J. & King, G.F. 2018, "Gomesin inhibits melanoma growth by manipulating key signaling cascades that control cell death and proliferation", Scientific reports, vol. 8, no. 1, pp. 11519-018-29826-4. Jao, L.E., Wente, S.R. & Chen, W. 2013, "Efficient multiplex biallelic zebrafish genome editing using a CRISPR nuclease system", Proceedings of the National Academy of Sciences of the United States of America, vol. 110, no. 34, pp. 13904-13909. Jinek, M., Chylinski, K., Fonfara, I., Hauer, M., Doudna, J.A. & Charpentier, E. 2012, "A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity", Science (New York, N.Y.), vol. 337, no. 6096, pp. 816-821. Jones, R.G. & Thompson, C.B. 2009, "Tumor suppressors and cell metabolism: a recipe for cancer growth", Genes & development, vol. 23, no. 5, pp. 537-548. Joyce, J.A. & Pollard, J.W. 2009, "Microenvironmental regulation of metastasis", Nature reviews. Cancer, vol. 9, no. 4, pp. 239-252. Jung, D.W., Oh, E.S., Park, S.H., Chang, Y.T., Kim, C.H., Choi, S.Y. & Williams, D.R. 2012, "A novel zebrafish human tumor xenograft model validated for anti-cancer drug screening", Molecular bioSystems, vol. 8, no. 7, pp. 1930-1939. Kalluri, R. & Zeisberg, M. 2006, "Fibroblasts in cancer", Nature reviews. Cancer, vol. 6, no. 5, pp. 392-401. Khaliq, M., Ko, S., Liu, Y., Wang, H., Sun, Y., SolnicaKrezel, L. & Shin, D. 2018, "Stat3 Regulates Liver Progenitor Cell-Driven Liver Regeneration in Zebrafish", Gene expression, vol. 18, no. 3, pp. 157-170. CABEZAS SÁINZ, PABLO 138 Khan, N., Mahajan, N.K., Sinha, P. & Jayandharan, G.R. 2019, "An efficient method to generate xenograft tumor models of acute myeloid leukemia and hepatocellular carcinoma in adult zebrafish", Blood cells, molecules & diseases, vol. 75, pp. 48-55. Kim, J. & Tanner, K. 2015, "Recapitulating the Tumor Ecosystem Along the Metastatic Cascade Using 3D Culture Models", Frontiers in oncology, vol. 5, pp. 170. Kim, J.B. 2005, "Three-dimensional tissue culture models in cancer biology", Seminars in cancer biology, vol. 15, no. 5, pp. 365-377. Kim, M., de la Pena, J.B., Cheong, J.H. & Kim, H.J. 2018, "Neurobiological Functions of the Period Circadian Clock 2 Gene, Per2", Biomolecules & therapeutics, vol. 26, no. 4, pp. 358-367. Kimmel, C.B., Ullmann, B., Walker, M., Miller, C.T. & Crump, J.G. 2003, "Endothelin 1-mediated regulation of pharyngeal bone development in zebrafish", Development (Cambridge, England), vol. 130, no. 7, pp. 1339-1351. Kinth, P., Mahesh, G. & Panwar, Y. 2013, "Mapping of zebrafish research: a global outlook", Zebrafish, vol. 10, no. 4, pp. 510-517. Kirchberger, S., Sturtzel, C., Pascoal, S. & Distel, M. 2017, "Quo natas, Danio? - Recent Progress in Modeling Cancer in Zebrafish", Frontiers i n oncology, vol. 7, pp. 186. Komohara, Y., Fujiwara, Y., Ohnishi, K. & Takeya, M. 2016, "Tumor-associated macrophages: Potential therapeutic targets for anti-cancer therapy", Advanced Drug Delivery Reviews, vol. 99, no. Pt B, pp. 180-185. References 139 Konantz, M., Balci, T.B., Hartwig, U.F., Dellaire, G., Andre, M.C., Berman, J.N. & Lengerke, C. 2012, "Zebrafish xenografts as a tool for in vivo studies on human cancer", Annals of the New York Academy of Sciences, vol. 1266, pp. 124-137. Kovacs, R., Bakos, K., Urbanyi, B., Kovesi, J., Gazsi, G., Csepeli, A., Appl, A.J., Bencsik, D., Csenki, Z. & Horvath, A. 2016, "Acute and sub-chronic toxicity of four cytostatic drugs in zebrafish", Environmental science and pollution research international, vol. 23, no. 15, pp. 14718-14729. Lam, S.H., Chua, H.L., Gong, Z., Lam, T.J. & Sin, Y.M. 2004, "Development and maturation of the immune system in zebrafish, Danio rerio: a gene expression profiling, in situ hybridization and immunological study", Developmental and comparative immunology, vol. 28, no. 1, pp. 9-28. Lambert, A.W., Pattabiraman, D.R. & Weinberg, R.A. 2017, "Emerging Biological Principles of Metastasis", Cell, vol. 168, no. 4, pp. 670-691. Laux, D.W., Kelly, L., Bravo, I.R., Ramezani, T. & Feng, Y. 2017, "Live imaging the earliest host innate immune response to preneoplastic cells using a zebrafish inducible KalTA4ER(T2)/UAS system", Methods in cell biology, vol. 138, pp. 137150. Lazennec, G. & Richmond, A. 2010, "Chemokines and chemokine receptors: new insights into cancer-related inflammation", Trends in molecular medicine, vol. 16, no. 3, pp. 133-144. Lee, H.J., Yang, Y.J., Jeong, S., Lee, J.D., Choi, S.Y., Jung, D.W. & Moon, I.S. 2016, "Development of a vestibular schwannoma xenograft zebrafish model for in vivo antitumor drug screening", The Laryngoscope, vol. 126, no. 12, pp. E409-E415. CABEZAS SÁINZ, PABLO 140 Lee, L.M., Seftor, E.A., Bonde, G., Cornell, R.A. & Hendrix, M.J. 2005, "The fate of human malignant melanoma cells transplanted into zebrafish embryos: assessment of migration and cell division in the absence of tumor formation", Developmental dynamics: an official publication of the American Association of Anatomists, vol. 233, no. 4, pp. 1560-1570. Lee, S.L., Rouhi, P., Dahl Jensen, L., Zhang, D., Ji, H., Hauptmann, G., Ingham, P. & Cao, Y. 2009, "Hypoxia-induced pathological angiogenesis mediates tumor cell dissemination, invasion, and metastasis in a zebrafish tumor model", Proceedings of the National Academy of Sciences of the United States of America, vol. 106, no. 46, pp. 19485-19490. Lefevre, C., Imagawa, M., Dana, S., Grindlay, J., Bodner, M. & Karin, M. 1987, "Tissue-specific expression of the human growth hormone gene is conferred in part by the binding of a specific trans-acting factor", The EMBO journal, vol. 6, no. 4, pp. 971-981. Letrado, P., de Miguel, I., Lamberto, I., Diez-Martinez, R. & Oyarzabal, J. 2018, "Zebrafish: Speeding Up the Cancer Drug Discovery Process", Cancer research, vol. 78, no. 21, pp. 60486058. Lewis, C.E. & Pollard, J.W. 2006, "Distinct role of macrophages in different tumor microenvironments", Cancer research, vol. 66, no. 2, pp. 605-612. Lewis, J.S., Landers, R.J., Underwood, J.C., Harris, A.L. & Lewis, C.E. 2000, "Expression of vascular endothelial growth factor by macrophages is up-regulated in poorly vascularized areas of breast carcinomas", The Journal of pathology, vol. 192, no. 2, pp. 150-158. References 141 Li, D., Qiu, Z., Shao, Y., Chen, Y., Guan, Y., Liu, M., Li, Y., Gao, N., Wang, L., Lu, X., Zhao, Y. & Liu, M. 2013a, "Heritable gene targeting in the mouse and rat using a CRISPR-Cas system", Nature biotechnology, vol. 31, no. 8, pp. 681-683. Li, J.F., Norville, J.E., Aach, J., McCormack, M., Zhang, D., Bush, J., Church, G.M. & Sheen, J. 2013b, "Multiplex and homologous recombination-mediated genome editing in Arabidopsis and Nicotiana benthamiana using guide RNA and Cas9", Nature biotechnology, vol. 31, no. 8, pp. 688-691. Li, W., Teng, F., Li, T. & Zhou, Q. 2013c, "Simultaneous generation and germline transmission of multiple gene mutations in rat using CRISPR-Cas systems", Nature biotechnology, vol. 31, no. 8, pp. 684-686. Li, Z.H., Alex, D., Siu, S.O., Chu, I.K., Renn, J., Winkler, C., Lou, S., Tsui, S.K., Zhao, H.Y., Yan, W.R., Mahady, G.B., Li, G.H., Kwan, Y.W., Wang, Y.T. & Lee, S.M. 2011, "Combined in vivo imaging and omics approaches reveal metabolism of icaritin and its glycosides in zebrafish larvae", Molecular bioSystems, vol. 7, no. 7, pp. 2128-2138. Liang, J., Wang, D., Renaud, G., Wolfsberg, T.G., Wilson, A.F. & Burgess, S.M. 2012, "The stat3/socs3a pathway is a key regulator of hair cell regeneration in zebrafish. (corrected", The Journal of neuroscience: the official journal of the Society for Neuroscience, vol. 32, no. 31, pp. 10662-10673. Lieschke, G.J. & Currie, P.D. 2007, "Animal models of human disease: zebrafish swim into view", Nature reviews. Genetics, vol. 8, no. 5, pp. 353-367. Liu, Q., Zhang, H., Jiang, X., Qian, C., Liu, Z. & Luo, D. 2017, "Factors involved in cancer metastasis: a better understanding to