Novel human polyomaviruses in pregnancy: higher prevalence of BKPyV, but no WUPyV, KIPyV and HPyV9

1 Novel human polyomaviruses in pregnancy: higher prevalence of BKPyV, but no WUPyV, 1 KIPyV and HPyV9 2 3 Eszter Csoma a, *, Tamás Sápyb, Beáta Mészárosa, Lajos Gergely a 4 5 a Department of Medical Microbiology, Medical and Health Science Centre, University of 6 Debrecen, Nagyerdei krt. 98., H-4032 Debrecen, Hungary 7 b Department of Obstetrics and Gynecology, Medical and Health Science Centre, University 8 of Debrecen, Nagyerdei krt. 98., H-4032 Debrecen, Hungary 9 10 * Corresponding author. Tel.: +36 52 255 425; fax: +36 52 255 424. Email address: 11 [email protected]. 12 13 Abbreviations: 14 WU polyomavirus (WUPyV), KI polyomavirus (KIPyV), human polyomavirus 9 (HPyV9), 15 BK polyomavirus (BKPyV), genome equivalent (GEq), polymerase chain reaction (PCR) 16 17 18 19 20 21 Number of words in the Abstract: 248 22 Number of words in the text: 1879 23 24 25 2 Abstract 26 Background: Immunosuppression due to pregnancy may lead to higher susceptibility to 27 infections and reactivation of latent infections, such as BK polyomavirus (BKPyV). There is 28 lack of information about the prevalence of novel human polyomavirus 9 (HPyV9), WU 29 (WUPyV) and KI (KIPyV) during pregnancy. 30 Objectives: To study whether pregnancy results in higher prevalence of HPyV9, WUPyV, 31 KIPyV and their correlation with BKPyV. 32 Study design: Plasma, urine and throat swab samples from 100 pregnant and 100 non 33 pregnant women were screened for the presence of WUPyV, KIPyV, HPyV9 and BKPyV by 34 PCR. 35 Results: No WUPyV DNA was detected in plasma, urine and respiratory samples from 36 pregnant and non pregnant women. KIPyV DNA was found in two plasma samples from non 37 pregnant women (2 %) and not detected in other samples from neither pregnant nor non 38 pregnant women. HPyV9 DNA was determined in all sample types of pregnant and non 39 pregnant women, respectively. There were no significant differences between pregnant and 40 non pregnant women in HPyV9 DNA frequencies for plasma (2 % vs. 6 %), urine (3 % vs. 2 41 %) and respiratory samples (2 % vs. 2 %). Prevalence of BKPyV in urine samples was 42 significantly higher (p=0.039) in pregnant women (13 %) then in non pregnant women (4 %); 43 co nfection with KIPyV and/or HPyV9 was not detected. 44 Conclusions: In contrast with BKPyV, infection with WUPyV, KIPyV and HPyV9 was not 45 detected more frequently during pregnancy. To our knowledge HPyV9 was detected first in 46 respiratory samples in our study. 47 48 Key words: human polyomaviruses, pregnancy 49 50 3 1. Background 51 Human polyomavirus BK (BKPyV) seroprevalence increases with age reaching high, 52 80-90 % in adult population.1 Similarly high, 55-90 % adult seropositivities were observed for 53 recently discovered KI2 and WU3 polyomaviruses (KIPyV, WUPyV).4-6 Investigation of 54 seropositivity against the newly discovered human polyomavirus 9 (HPyV9)7 revealed 47 % 55 positivity for healthy adults.8 It is well known that after the childhood primary infection with 56 BKPyV, lifelong persistent infection is established mainly in renal and urinary tract cells.1 57 Transient immunosuppression due to pregnancy may lead to reactivation of BKPyV resulting 58 in generally asymptomatic viruria with frequency of 3 to 54 %.1, 9-11 Beside viruria, BKPyV 59 viraemia was also detected in pregnant women. 11 The pathogenic role of the novel WUPyV, 60 KIPyV and HPyV9 is far from clear, only speculative. WU and KI viruses were found in 61 various sample types – respiratory samples, blood, faeces, cerebrospinal fluid, lymphoid 62 tissues, urine – and higher prevalence was observed in children and immunocompromised 63 patients.12-16 HPyV9 was described from blood and urine samples of kidney transplant 64 patients, then it was found in skin samples, but no in respiratory and fecal samples.7, 17 The 65 higher frequency of these viruses in immunocompromised patients suggests higher 66 susceptibility or reactivation due to immunosuppression. Up to now only four urine samples 67 from pregnant women were investigated for the presence of KIPyV and WUPyV DNA with 68 negative result.18 The genetic and possible transmission similarities to BKPyV, and the higher 69 PCR prevalence data among immunocopromised patients may suggest that 70 immunosuppression, thus pregnancy may lead to higher susceptibility to infection with 71 WUPyV , KIPyV and HPyV9 or may result in reactivation of possible latent infections. 72 73 2. Objective 74 4 The aim of the present study was to evaluate the prevalence of three new human 75 polyomaviruses (WUPyV, KIPyV and HPyV9) during pregnancy, to study whether 76 immunosuppression due to pregnancy may lead to higher prevalence as it was found in case 77 of BKPyV. The possible correlations of these viruses were also investigated. 78 79 3. Study design 80 3.1. Patients and samples 81 Urine, plasma (from EDTA blood samples) and throat swab samples were collected on 82 the same day from 100 healthy pregnant women (age 16.5-41.9 years, median 32.1 years; 83 pregnancy 5-39 weeks; median 26 weeks) and 100 non pregnant women (age 18-44.3 years, 84 median 31.6 years) between September 2011 and December 2011. Samples from pregnant 85 women were collected in all three trimesters: first trimester n=28; second trimester n=27; 86 third trimester n=45. The control samples were taken from healthy, non pregnant, fertility 87 exam visitor women. 88 Immediately after collection, nucleic acid was isolated from samples using High Pure 89 Viral Nucleic Acid Kit (Roche, Switzerland) according to the manufacturer’s instructions. 90 Briefly, nucleic acids from 200 µl plasma, 200 µl urine specimen and throat swab sample 91 washed in 200 µl buffer were eluted in 50 µl and stored at -20 °C until use. 92 The study was approved by Regional and Institutional Ethics Committee of 93 University of Debrecen. All patients were asked to sign written informed consent. 94 95 3.2. Nested and real-time PCR for WUPyV, KIPyV, HPyV9 and BKPyV 96 All PCR methods were carried out with 10 μl nucleic acid in a final volume of 25 μl. 97 For nested PCR AmpliTaq Gold 360 Master Mix, for WUPyV and KIPyV real-time PCR 98 TaqMan Universal PCR Master Mix (Applied Biosystems, USA) were used. The calibrants 99 5 for quantitative PCRs were serial dilutions of KIPyV plasmid (in which the genome of KI 100 polyomavirus isolate Stockholm 60 was incorporated) and AP-p003 plasmid (containing the 101 2228 bp half genome of WU polyomavirus) kindly provided by Tobias Allander and David 102 Wang. WUKI nested PCR and real-time PCR for WU and KI virus were performed as 103 described previously.16 HPyV9 PCR was carried out with diagnostic primers and annealing 104 temperature published by Scuda et al.7 For the first round of BKV nested PCR, k1 (5’ 105 TGAAGCATATGAAGATGGCC 3’) and k2 (5’ GTTACAGCCTCCCACATC 3’) primers 106 were used with 60 ºC annealing temperature, while for the second round b1 (5’ 107 GATGGCCCCAACCAAAAG 3’) and b2 (5’ CTAGAACTTCTACTCCTCC 3’) primers and 108 56 ºC annealing temperature were applied. PCR products were visualized by electrophoresis 109 in 1.5 % agarose gel containing ethidium bromide (0.5 µg/mL). The amplified PCR products 110 from WUKI and HPyV9 nested PCR were cut, purified with QIAquick Gel Extraction Kit 111 (Qiagen) according to the instructions and sequenced by using ABI PRISM 3100 Genetic 112 Analyzer (Applied Biosystems). To determine BKPyV viral load BKV virus R-gene 113 quantification kit was used (Argene, USA) according to the manufacturer’s instructions. 114 115 3.3. Statistical analysis 116 Difference in frequency for categorical variables was analysed by Fisher’s exact test. 117 For continuous variables Mann-Whitney U test was applied. Difference was considered 118 significant if p value was less then 0.05. 119 120 4. Results 121 4.1. Detection of WUPyV, KIPyV and HPyV9 DNA in plasma, urine and respiratory samples 122 Table 1 shows the results of PCR detections for the various samples. WUPyV DNA 123 was not detected in plasma, urine and respiratory samples neither from pregnant nor from non 124 6 pregnant women. KIPyV was found in two plasma samples of non pregnant women, but was 125 not determined in any other samples. To confirm the positive PCR results and to determine KI 126 or WU virus DNA was detected, PCR products were sequenced. The viral loads were below 127 the limit of detection (< 250 GEq/mL; genome equivalent/mL) by real-time PCR. HPyV9 128 DNA was detected in urine, plasma and respiratory samples from both studied groups. To 129 prove the results from PCR, all PCR products were sequenced. In details, the prevalence of 130 HPyV9 DNA in plasma samples was higher in control, non pregnant group then in pregnant 131 women (6/100; 6 % vs. 2/100; 2%), but the difference was not statistically significant. The 132 two positive samples were taken in the second trimester of pregnancy. Two samples from 133 control, non pregnant women with HPyV9 viraemia were also positive for KIPyV DNA. In 134 respiratory samples the frequency of HPyV9 DNA was the same in both studied groups 135 (2/100; 2% and 2/100; 2%). Both of the positive samples in pregnant women group were 136 collected in the first trimester. Three urine samples from pregnant women were HPyV9 PCR 137 positive (3/100; 3%), while in control group 2 samples were positive (2/100; 2%) which is not 138 statistically significant difference. 139 4.2. Prevalence of BKPyV in urine and plasma samples 140 BKPyV was not detected in plasma samples. Frequency for BKPyV viruria was 13 % 141 (13/100) in pregnant women and 4 % (4/100) in non pregnant, control group (Table 1.). The 142 difference is statistically significant (p=0.039). The BKPyV viral load in samples from 143 pregnant women (range 50-1.86 x 108; median 11.82 x 103 GEq/mL) did not show statistically 144 significant difference from the viral load in control samples (range 2.25 x 102-3.58 x 105; 145 median 2.98 x 102). BKPyV presence in urine samples was found in all trimesters. 146 147 5. Discussion 148 7 In our study significantly higher prevalence of BK viruria was observed in pregnant 149 women in contrast with non pregnant women. Human polyomavirus 9 was found in plasma, 150 urine and respiratory samples from pregnant women but not more frequently then in samples 151 from non pregnant women. WU and KI viruses were not detected in any of the studied 152 samples from pregnant women. 153 BK polyomavirus is ubiquitous in the human population, the primary infection 154 generally occurs during childhood without significant clinical consequences, respiratory 155 diseases might occur. Transmission of the viruses is not well clarified, but it is suggested that 156 these viruses are acquired mainly through respiratory, faecal-oral and urinary routes, 157 alternatively by blood transfusion and organ transplantation.1 After the primary infection, 158 lifelong persistence of the virus is established mainly in kidney and urinary tract.19, 20 Lytic 159 infection with viruria occurs in 5-10 % of immunocompetent individuals21, but more 160 frequently in immunocompromised patients.22 During pregnancy immunologic changes 161 together with hormonal effects may result in viral infections, reactivations. Viruria was 162 detected for 3-54 % of pregnant women, while viraemia was found to be less frequent.1, 10, 11, 163 23 In accordance with literature, in this study 13 % of pregnant women had active BKPyV 164 replication resulting in viruria, but no viraemia. The possible effect of BK virus replication 165 during pregnancy is not clarified. Although viral DNA was demonstrated in fetal tissues 24 the 166 hypothesis of transplacental transmission was not confirmed 10, 11. Recently serological 167 evidence for vertical transmission of BKPyV was published.9 168 Hitherto, there are no prevalence data about the novel WU, KI and human 169 polyomavirus 9 during pregnancy. Bofill-Mas et al. investigated 4 urine samples from 170 pregnant women, but WU and KI viruses were not found. 18 Foetal tissues were also negative 171 for WU and KI viruses. 25 In this study WU and KI viruses were not found in urine, plasma 172 and respiratory samples collected during pregnancy. KIPyV DNA was detected in two plasma 173 8 samples, but not in urine and respiratory samples from control, non pregnant women. The 174 high, 55-90 % seropositivity in adult population, and the higher PCR prevalence in samples 175 from children suggest childhood primary KI and WU virus infection. 6, 15 Viruses were found 176 with frequency 0.4-14 % in various samples types including respiratory samples, blood, 177 faeces, cerebrospinal fluid, lymphoid tissues and urine samples, with generally higher 178 frequency in immunocompromised patients. The possible way of transmission might be 179 respiratory and/or faecal-oral.2, 3, 12-16 The higher PCR prevalence data of 180 immunocompromised patients suggests that immunosuppression might result in reactivation 181 of these viruses, or might establish higher susceptibility to KIPyV and WUPyV infection.1 It 182 was hypothesized that similarly to BKPyV, transient immunosuppression due to pregnancy 183 might result in higher frequency of WU and/or KI viral infections, but no evidence for it was 184 found during this study. However it is important to note, that it was not a follow up study, 185 samples were collected once randomly during pregnancy. 186 Human polyomavirus 9 was described in 2011.7 Up to now, viral DNA was found in 187 blood and urine samples from immunocompromised patients and skin samples, but neither in 188 respiratory samples from patients with respiratory failure nor in faeces from children with 189 gastroenteritis.7, 17 Based on these data and the recently published 47 % adulthood 190 seropositivity 8 , Van Ghelue et al. hypothesized that HPyV9 is less frequent in the human 191 population6. We found HPyV9 DNA is all studied samples from pregnant and non pregnant 192 women with frequency of 2-6 %. There was no or not statistically significant difference 193 between the PCR prevalence in the respiratory (2 vs. 2 %), urine (3 vs. 2%) and plasma 194 samples (2 vs. 6 %) between pregnant and non pregnant women. To our knowledge we 195 published first HPyV9 presence in respiratory samples which may suggest respiratory 196 transmission of this virus. In this study higher prevalence of HPyV9 was not found during 197 pregnancy, but the viral loads were not examined which might have been different. Since 198 9 mother to foetus transmission of polyomaviruses BK and JC are suggested, this way of 199 transmission cannot excluded in case of the novel WUPyV, KIPyV and HPyV9. Even if this 200 study could not support evidence for higher susceptibility of infection by these viruses, 201 further, follow up study of pregnant women during the whole period of pregnancy might 202 answer this question. 203 In conclusion, KI and WU viruses were not found in urine, respiratory and blood 204 samples from pregnant women, while HPyV9 was detected in all sample types but with no 205 significantly higher frequency then it was observed for non pregnant women. 206 207 Conflict of interest 208 The authors have no conflict of interest. 209 210 Acknowledgements 211 We thank Tobias Allander from Karolinska Institute (Sweden), David Wang from 212 Washington University (USA) and Bernhard Ehlers from Robert Koch-Institut (Germany) for 213 providing KIPyV, WUPyV and HPyV9 plasmids, respectively. This work was supported by 214 grants from the Hungarian Scientific Research Found (OTKA 73145) and by the TÁMOP-215 4.2.2/B-10/1-2010-0024 project which is co-financed by the European Union and the European 216 Social Fund. 217 218 References 219 1. Jiang M, Abend JR, Johnson SF,Imperiale MJ. The role of polyomaviruses in human 220 disease. Virology 2009; 384(2):266-73. 221 2. Allander T, Andreasson K, Gupta S, Bjerkner A, Bogdanovic G, Persson MA, et al. 222 Identification of a third human polyomavirus. J Virol 2007; 81(8):4130-6. 223