Re-establishment of the genus Pseudalbizzia (Leguminosae, Caesalpinioideae, mimosoid clade): the New World species formerly placed in Albizia

Re-establishment of the genus Pseudalbizzia (Leguminosae, Caesalpinioideae, mimosoid clade): the New World species formerly placed in Albizia Gabriela Aviles Peraza1*, Erik J. M. Koenen2*, Ricarda Riina3, Colin E. Hughes4, Jens J. Ringelberg4, German Carnevali Fernández-Concha1,5, Ivón Mercedes Ramírez Morillo1, Lilia Lorena Can Itza1, Ivan Tamayo-Cen1, Jorge Humberto Ramírez Prado6, Xavier Cornejo7, Sawai Mattapha8, Rodrigo Duno de Stefano1 1Herbarium CICY, Centro de Investigación Científica de Yucatán, A.C. (CICY), Calle 43 No. 130, Col. Chuburna de Hidalgo, 97200, Mérida, Yucatán, Mexico 2Evolutionary Biology & Ecology, Université Libre de Bruxelles, Av. F.D. Roosevelt, 50, CP 160/12, Brussels B-1050, Belgium 3Real Jardín Botánico, CSIC. Plaza de Murillo, 2. Madrid 28014, Spain 4Department of Systematic and Evolutionary Botany, University of Zurich, Zollikerstrasse 107, Zurich CH-8008, Switzerland 5Orchid Herbarium of Oakes Ames, Harvard University Herbaria, 22 Divinity Avenue, Cambridge, Massachusetts 02138, USA 6Unidad Biotecnología Centro de Investigación Científica de Yucatán, A.C. (CICY), Calle 43 No. 130, Col. Chuburna de Hidalgo, 97200, Mérida, Yucatán, Mexico 7Herbario GUAY, Facultad de Ciencias Naturales, Universidad de Guayaquil, Avenida Juan Tanca Marengo s/n y Avenida de las Aguas Casilla 09-01-10634, Guayaquil, Ecuador 8Department of Biology, Faculty of Science, Udon Thani Rajabhat University, Udon, 41000 Thailand Corresponding author: Rodrigo Duno De Stefano ([email protected]) Academic editor: Gwilym P. Lewis|Received 20 October 2021|Accepted 18 March 2022|Published 22 August 2022 Citation: Aviles Peraza G, Koenen EJM, Riina R, Hughes CE, Ringelberg JJ, Carnevali Fernández-Concha G, Ramírez Morillo IM, Can Itza LL, Tamayo-Cen I, Ramírez Prado JH, Cornejo X, Mattapha S, Duno de Stefano R (2022) Re-establishment of the genus Pseudalbizzia (Leguminosae, Caesalpinioideae, mimosoid clade): the New World species formerly placed in Albizia. In: Hughes CE, de Queiroz LP, Lewis GP (Eds) Advances in Legume Systematics 14. Classification of Caesalpinioideae Part 1: New generic delimitations. PhytoKeys 205: 371–400. https://doi. org/10.3897/phytokeys.205.76821 Abstract Following recent mimosoid phylogenetic and phylogenomic studies demonstrating the non-monophyly of the genus Albizia, we present a new molecular phylogeny focused on the neotropical species in the genus, with much denser taxon sampling than previous studies. Our aims were to test the monophyly of the neotropical section Arthrosamanea, resolve species relationships, and gain insights into the evolution * These authors made equal contributions to this paper. Copyright Gabriela Aviles Peraza et al. This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. PhytoKeys 205: 371–400 (2022) doi: 10.3897/phytokeys.205.76821 https://phytokeys.pensoft.net RESEARCH ARTICLE Launched to accelerate biodiversity research A peer-reviewed open-access journal Gabriela Aviles Peraza et al. / PhytoKeys 205: 371–400 (2022) 372 of fruit morphology. We perform a Bayesian phylogenetic analysis of sequences of nuclear internal and external transcribed spacer regions and trace the evolution of fruit dehiscence and lomentiform pods. Our results find further support for the non-monophyly of the genus Albizia, and confirm the previously proposed segregation of Hesperalbizia, Hydrochorea, Balizia and Pseudosamanea. All species that were sampled from section Arthrosamanea form a clade that is sister to a clade composed of Jupunba, Punjuba, Balizia and Hydrochorea. We find that lomentiform fruits are independently derived from indehiscent septate fruits in both Hydrochorea and section Arthrosamanea. Our results show that morphological adaptations to hydrochory, associated with shifts into seasonally flooded habitats, have occurred several times independently in different geographic areas and different lineages within the ingoid clade. This suggests that environmental conditions have likely played a key role in the evolution of fruit types in Albizia and related genera. We resurrect the name Pseudalbizzia to accommodate the species of section Arthrosamanea, except for two species that were not sampled here but have been shown in other studies to be more closely related to other ingoid genera and we restrict the name Albizia s.s. to the species from Africa, Madagascar, Asia, Australia, and the Pacific. Twenty-one new nomenclatural combinations in Pseudalbizzia are proposed, including 16 species and 5 infraspecific varietal names. In addition to the type species Pseudalbizzia berteroana, the genus has 17 species distributed across tropical regions of the Americas, including the Caribbean. Finally, a new infrageneric classification into five sections is proposed and a distribution map of the species of Pseudalbizzia is presented. Keywords Arthrosamanea, hydrochory, monophyly, Neotropics, phylogeny, taxonomy Introduction The genus Albizia Durazz. has a complicated taxonomic history but has generally been treated as a pantropical genus with 120–140 species, of which 36 are endemic to Africa, with c. 30 species in Madagascar, of which c. 24 are endemic, c. 35 species in Asia, one in Australia, and 22 in tropical America (Lewis and Rico Arce 2005; Rico Arce et al. 2008). All species are woody, forming trees of variable stature and inhabit a wide range of lowland tropical biomes (Figs 1 and 2), including rain forests, seasonally dry tropical forests, and savannas, with one species, Albizia julibrissin Durazz., the type species of the genus, in subtropical and warm temperate forests in Asia. However, Albizia remains poorly defined; its delimitation remains one of the most challenging taxonomic problems in the legume family, and it is currently considered the main “dustbin” genus in tribe Ingeae (Koenen et al. 2020). In the past, the most problematic genus of tribe Ingeae was Pithecellobium Mart., but its taxonomy has been gradually clarified (Barneby and Grimes 1996). Resolution of the taxonomic status of Albizia has lagged behind that of Pithecellobium and only really started at the end of the twentieth century. For example, several new neotropical genera have been segregated from Albizia: Balizia Barneby & J.W. Grimes; Hesperalbizia Barneby & J.W. Grimes, and Hydrochorea Barneby & J.W. Grimes. Barneby and Grimes (1996) also re-established the genus Pseudosamanea Harms, which previously had been treated as a synonym within Albizia (Table 1). However, at the time they were established, the monophyly of these new and re-established genera had not been tested using phylogenetic analyses of molecular data. Re-establishment of the genus Pseudalbizzia 373 Figure 1. Morphology of Albizia s.l. showing selected members of the genera Albizia and Pseudalbizzia a–c Albizia ferruginea (Guill. & Perr.) Benth. in Congo a detail of leaf rachis and gland between terminal pinnae b detail of leaflets of a terminal pinna c seed and funiculus attached to the valve d Albizia glaberrima (Schumach. & Thonn.) Benth. in Malawi, detail of inflorescence e Albizia anthelmintica Brongn. in Malawi, habit f Albizia adianthifolia (Schumach.) W. Wight in Congo, habit g Albizia glaberrima in Malawi, branches and inflorescences h Albizia chinensis (Osbeck) Merr. in Thailand, inflorescences iAlbizia odoratissima (L. f.) Benth. in Thailand, fruits j Albizia procera (Roxb.) Benth. in Thailand, fruits k Albizia splendens Miq. in Thailand, woody fruit l Pseudalbizzia multiflora var. multiflora in Ecuador, woody fruit m, n Pseudalbizzia pistaciifolia (Willd.) E.J.M Koenen & Duno in Ecuador m habit n woody fruit. Photos: a, b David J. Harris / With permission from RBG Edinburgh c Claude Boucher Chisale d–fGünter Baumann g Jos Stevens h Natcha Sutjaritjai i–k Prateep Panyadee l–n Xavier Cornejo. Gabriela Aviles Peraza et al. / PhytoKeys 205: 371–400 (2022) 374 Figure 2. Habit, flower and fruit variation in the genus Pseudalbizzia a P. adinocephala pods (Hughes 1913) b P. coripatensis inflorescence (Hughes 2433) c P. coripatensis pods (Hughes 2433) d P. inundata pods (JRI Wood 26530) e P. multiflora habit (Hughes 2214) f P. multiflora leaves and pods (Hughes 2214) g P.pistaciifolia leaves and inflorescence (Cornejo 8426, GUAY) h P. niopoides habit (Hughes 419) iP.niopoides pods (Rivera 2245) j P. polycephala inflorescence (de Queiroz 15515) k P. tomentosa inflorescence (Hughes 1143) l P. sinaloensis pods (Hughes 1576) m P. tomentosa habit (Hughes 1335) n P. tomentosa pods (Hughes 1307). All photos by Colin Hughes except g, Xavier Cornejo. Re-establishment of the genus Pseudalbizzia 375 Barneby and Grimes (1996) placed the remaining New World species of Albizia in their section Arthrosamanea (Britton & Rose) Barneby & J.W. Grimes. They characterized this section as forming a group that is homogeneous in most respects, but diverse in the late developmental stages of the fruit, which vary in: 1) fruit opening type: dehiscent, indehiscent, or breaking, 2) lateral shape: flat to conspicuously raised above the seed chambers, 3) texture and consistency of the valves: papery, chartaceous or woody, 4) longitudinal shape: straight to weakly falcate (Barneby and Grimes 1996) (Figs 1, 2 and 4). Within section Arthrosamanea, four series were proposed by Barneby and Grimes (1996): series Paniculatae with papery, plano-compressed, inertly dehiscent pods with continuous valves (13 species); series Arthrosamanea comprising 3 species with lomentiform, plano-compressed pods, where the ripe valves crack transversely between seeds but the wiry sutures persist at maturity; series Multiflorae (2 species) characterized by lomentiform fruits only reluctantly separating into articles, the thicktextured valves and sutural keels breaking transversely under pressure; and the monospecific series Inundatae which bears crypto-lomentiform pods, dehiscent through the sutures and with the valves differentiating into a continuous exocarp and a segmented endocarp separating into 1-seeded segments (Barneby and Grimes 1996). Series Paniculatae is widespread across Mexico, Central and South America, occurring mainly in seasonally dry forests, grasslands, and less often in humid forests (in South America). All species of series Paniculatae have papyraceous, dehiscent fruits with one exception, A. berteroana (DC.) Fawc. & Rendle (the earlier combination A. berteroana (DC.) M. Gómez was invalidly published due to incorrect citation of the basionym, see Barneby and Grimes 1996), whose fruits are indehiscent and fall to the ground entire. In contrast, the other three series are distributed from Panama to South America and are most diverse in the Amazon basin (Barneby and Grimes 1996), and usually have more or less woody fruits, which are articulated and indehiscent, some dividing into monospermous segments through the grooves of the valves, considered to be an adaptation for hydrochory, i.e., seed dispersal in riparian and seasonally inundated forests (e.g., A. inundata (Mart.) Barneby & J.W. Grimes, A. pistaciifolia (Willd.) Barneby & J.W. Grimes, and A. subdimidiata (Splitg.) Barneby & J.W. Grimes). The segregate genera established by Barneby and Grimes (1996) have not been universally accepted. For example, in the most recent taxonomic treatment of Albizia for Mexico and Central America (Rico Arce et al. 2008), the genera Balizia, Hesperalbizia, Table 1. Main taxonomic changes related to Albizia, Ingeae tribe [1981–2008]. Modified from Rico Arce et al. (2008). Nielsen (1981) Barneby and Grimes (1996) Lewis and Rico Arce (2005) Rico Arce et al. (2008) Iganci et al. 2015 Albizia Albizia Albizia Albizia Albizia Balizia Balizia Cathormion Cathormion Cathormion * * Hydrochorea *Hydrochorea Hesperalbizia Hesperalbizia Pseudosamanea Pseudosamanea * Not explicitly mentioned in the study. Gabriela Aviles Peraza et al. / PhytoKeys 205: 371–400 (2022) 376 and Pseudosamanea were not recognized (Table 1). However, subsequent phylogenetic analyses have confirmed that these genera were rightfully segregated as distinct evolutionary lineages, Hesperalbizia being more closely related to Lysiloma Benth. (Duno de Stefano et al. 2021), and the closely related Balizia and Hydrochorea (the former reduced to synonymy of the latter, Soares et al. 2022) being placed as the sister-group of Jupunba Britton & Rose (Iganci et al. 2015; Soares et al. 2021, 2022). Phylogenomic analysis of the mimosoid clade, based on DNA sequences of 964 targeted nuclear genes confirmed these findings and, furthermore, showed that the species from the Americas (i.e., sect. Arthrosamanea) form a separate lineage from the African, Madagascan and Asian species (Koenen et al. 2020). Koenen et al. (2020) also showed that Pseudosamanea, although difficult to place in any clade, is not closely related to either Albizia s.s. or section Arthrosamanea and is perhaps most closely related to Samanea Merr. and Chloroleucon Britton & Rose ex Record. While the data of Koenen et al. (2020) provided a robust phylogenomic backbone for the mimosoid and ingoid clades, and clearly demonstrated the non-monophyly of Albizia by sampling 25 species of that genus, only three of the 19 species from Central and South American sect. Arthrosamanea were included in that study, leaving doubts about the monophyly of that section and whether it should be segregated under the circumscription of Barneby and Grimes (1996), or whether there are further potential segregates, given the possibility that some of these species are more closely related to other neotropical genera. That possibility was suggested by the occurrence of lomentiform fruits in some species of section Arthrosamanea as reflected in the classification into separate series by Barneby and Grimes (1996). Similar lomentiform fruits also occur in Hydrochorea (Barneby and Grimes 1996; Soares et al. 2022) and Albizia s.s. (Albizia dolichadena (Kosterm.) I.C. Nielsen, Albizia moniliformis (DC.) F. Muell., Albizia rosulata (Kosterm.) I.C. Nielsen and Albizia umbellata (Vahl) E.J.M. Koenen), as well as a few other ingoid lineages (Barneby and Grimes 1996: 204; Koenen 2022a). For this reason, several species of neotropical Albizia have homotypic synonyms in Arthrosamanea Britton & Rose, Samanea or Cathormion Hassk., genera which previously had been recognized and defined based mainly on characters of fruit texture and dehiscence (Barneby and Grimes 1996). Barneby and Grimes (1996: 204) considered these fruit types to have arisen multiple times in parallel in different genera, and this was confirmed by subsequent phylogenetic (Iganci et al. 2015; Soares et al. 2021) and phylogenomic studies (Koenen et al. 2020), although the neotropical lomentiform Albizia species were not included in these studies, or remained unresolved. Here we investigate whether Albizia sect. Arthrosamanea is monophyletic and thereby provide a more rigorous basis for recognizing its evolutionary distinctiveness from Albizia s.s. as a segregate genus. We infer a new phylogeny with emphasis on the neotropical species and make use of further insights offered by the phylogenomic analysis of Ringelberg et al. (2022). In addition, we use a tree topology inferred from data from the latter study to evaluate whether lomentiform fruits in Albizia sect. Arthrosamanea are independently derived from other lineages in which this fruit type occurs. Re-establishment of the genus Pseudalbizzia 377 Based on our phylogenetic results and the recent findings of Koenen et al. (2020) and Ringelberg et al. (2022), we update the taxonomy of neotropical Albizia by resurrecting the genus Pseudalbizzia Britton & Rose. Materials and methods We used the nuclear ribosomal External and Internal Transcribed Spacer (ETS and ITS) regions that previously been used to study sister-group relationships within tribe Ingeae (Brown et al. 2008; Iganci et al. 2015; Souza et al. 2016). Our combined dataset included 123 accessions, of which 50 are from Genbank and 73 are newly sequenced here, including 25 species of Albizia s.l. sequenced for the first time. The outgroup, Vachellia farnesiana (L.) Wight & Arn., was designated to root the tree (Table 2). The plastid trnK region was initially explored but preliminary analyses suggested it is not sufficiently phylogenetically informative and these data were excluded from this study. Fresh leaf material collected in the field plus herbarium material from the Jardín Botánico Regional Roger Orellana (CICY) were used for DNA extraction. Herbarium specimens used in these analyses came from AAU, CICY, FCME, MA, MEXU, and MO (acronyms as in Thiers 2016). Additional sequences were downloaded from GenBank (Table 2). DNA from leaf fragments was obtained using the DNeasy Plant Mini Kit (QIAGEN Inc., Valencia, California) following the manufacturer’s specifications. To assess concentration and relative quality of DNA, 3 µl of final volume plus 2 µl loading buffer were run for 30 minutes at 6 V cm-1 on a 1% agarose gel prepared with 0.5× TBE. The resulting gel was developed by immersion for 20–30 minutes in a 0.1 µg ml-1 ethidium bromide solution and later observed in a DigiDoc-It Imaging System (version 6.7.1; UVP, Inc., Cambridge, UK) transilluminator. DNA purity and concentration were quantified with a NanoDrop 2000c. Afterwards, DNA samples were standardized to 10 ng µl-1. PCR amplifications were performed in an Applied Biosytems Veriti 96 Well Thermal Cycler. Volumes of reagents and conditions for the amplifications were as follows: ITS: 30 µL of mix containing 3 µl 10× Buffer, 2.5 µl MgCl2,, 0.6 µl (~10 ng) primer, 4 µl Q solution, 1 µl 1.25 mM L-1 dNTP, 0.2 µl (1 U) TAQ polymerase, 2µl (~10ng) DNA, then completed to volume (approx. 16.1 µl) with ultra-pure water. PCRs were conducted under the following protocol: 94 °C × 3 min + 30 cycles (94°C × 1 min + 60.5 °C × 1 min + 72 °C × 2 min) + 72 °C × 7 min. Primers were S3 (AACCTGCGGAAGGATCATTG) (Käss and Wink 1997), and 26S (TAGAATTCCCCGGTTCGCTCGCCGTTAC) (Sun et al. 1994). ETS: 30 µl of mix containing 3 µl 10× Buffer, 2.5 µl MgCl2, 0.6 µl (~10 ng) primer, 4 µl Q solution, 1 µl 1.25 mM l-1 dNTP, 0.2 µl (1 U) TAQ polymerase, 2 µl (~10 ng) DNA, then completed to volume (approx. 16.1 µl) with ultra-pure water. PCR amplifications were conducted under the following protocol: 94 °C × 3 min + 30 cycles (94 °C × 1 min + 60.5 °C × 1 min + 72 °C × 2 min) + 72 °C × 7 min. Primers used were 18S-IGS (5’-GAGACAAGCATATGACTACTGGCAGGATCAACCAG-3’) and 26S-IGS (5’-GGATTGTTCACCCACCAATAGGGAACGTGAGCTG-3’) (Baldwin and Markos 1998). Gabriela Aviles Peraza et al. / PhytoKeys 205: 371–400 (2022) 378 Table 2. Voucher information of taxa included in the phylogenetic analysis with their corresponding GenBank accession numbers. Accessions ITS Accessions ETS Albizia adianthifolia (Schumach.) W. Wight, MW699934, BGRO 001 Albizia adianthifolia, MW699372, BGRO 001 Albizia amara (Roxb.) Boivin, MW699936, BGRO 003 Albizia amara, MW699374, BGRO 003 Albizia anthelmintica Brongn., MW699937, BGRO 004 Albizia anthelmintica, MW699375, BGRO 004 Albizia arenicola R. Vig., MW699938, R. Randrianaivo 642, MO Albizia antunesiana Harms, MW699376, S.H.C.P. 966, MO Albizia brevifolia Schinz, MW699940, BGRO 005 Albizia arenicola, MW699377, R. Randrianaivo 642, MO Albizia glaberrima Hutch. & Dalziel, MW699943, R.E. Gereau 6203, MA Albizia brevifolia, MW699378, BGRO 005 Albizia gummifera (J.F. Gmel.) C.A. Sm., MW699944, J.E. Lawesson 5094, AAU Albizia chinensis (Osbeck) Merr., MW69379, A. Ntemi & A. Athumani 478, MO Albizia harveyi E. Fourn., MW699945, BGRO 006 Albizia crassiramea Lace, MW699380, K. Larsen et al. 46378, AAU Albizia julibrissin Durazz., MW699946, BGRO 007 Albizia ferruginea (Guill. & Perr.) Benth., MW699382, C.H. Jongkind 2098, MA Albizia kalkora (Roxb.) Prain, MW699947, E. Bouflord 26356, MO Albizia glaberrima, MW699383, R.E. Gereau 6203, MA Albizia lebbeck (L.) Benth., MW699948, C. Chan 7539, CICY Albizia gummifera, MW699384, J.E. Lawesson 5094, AAU Albizia petersiana (Bolle) Oliv., MW699950, BGRO 008 Albizia harveyi, MW699385, BGRO 006 Albizia procera (Roxb.) Benth., MW699953, BGRO 009 Albizia julibrissin, MW699387, BGRO 007 Albizia retusa Benth., MW699954, K. Yasuda 1804, MO Albizia kalkora, MW699388, E. Bouflord 26356, MO Albizia tanganyicensis Baker f., MW699956, BGRO 010 Albizia lebbeck (L.) Benth., MW699389, C. Chan 7539, CICY Albizia umbellata (Vahl) E. J. M. Koenen, EF638182.1 Albizia lebbekioides (DC.) Benth., MW699390, H. Balslev 9333, AAU Balizia leucocalyx (Britton & Rose) Barneby & J.W. Grimes, MW699959, S. Aguilar & F. Aguilar 1833, M Albizia lucidior (Steud.) I.C. Nielsen ex H. Hara, MW699391, J.F. Maxwell 95–259, MO Lysiloma acapulcense (Kunth) Benth., MW699960, H. Gómez D. 2003, MO Albizia petersiana (Bolle) Oliv., MW699394, BGRO 008 Lysiloma latisiliquum (L.) Benth., MW699961, P. Simá 2287, CICY Albizia procera, MW699396, BGRO 009 Pseudalbizzia adinocephala (Donn. Sm.) E.J.M. Koenen & Duno, MW699935, BGRO 002 Albizia retusa, MW699397, K. Yasuda 1804, MO MW699958, J.L. Linares 5406, FCME Albizia sahafariensis Capuron, MW699398, R. Randrianaivo et al. 1387, MO Pseudalbizzia berteroana (Balb. Ex DC.) Britton & Rose, MW699939, A. Jimenez 2113, MO Albizia tanganyicensis, MW699400, BGRO 010 Pseudalbizzia edwallii (Hoehne) E.J.M. Koenen & Duno, MW699942, J.M. Silva & L.M. Abe 4237, MEXU Albizia umbellata, EF638157.1 Pseudalbizzia multiflora (Kunth) E.J.M. Koenen & Duno, MW699949, X. Cornejo 1922, GUAY Balizia leucocalyx, MW699403, S. Aguilar & F. Aguilar 1833, M Pseudalbizzia pistaciifolia (Willd.) E.J.M. Koenen & Duno, MW699951, X. Cornejo 5323, GUAY Balizia pedicellaris (DC.) Barneby & J.W. Grimes, MW699404, P.R. House 1880, MA Pseudalbizzia polycephala (Benth.) E.J.M. Koenen & Duno, MW699952, L.P. Queiroz 9578, MEXU Havardia mexicana, MW699405, S. Foldi s.n., CICY Pseudalbizzia sinaloensis (Britton & Rose) E.J.M. Koenen & Duno, MW699955, C.E. Hughes et al. 1576, FCME Hesperalbizia occidentalis, MW699406, J.G. Hernandez Oria 21, FCME Pseudalbizzia tomentosa (Micheli) E.J.M. Koenen & Duno, MW699957, A. Dorantes et al. 165, CICY Lysiloma acapulcense, MW699407, H. Gómez D. 2003, MO Pseudosamanea cubana (Britton & P. Wilson) Barneby & J.W. Grimes, MW699941, GHBG 001 Lysiloma latisiliquum, MW699408, P. Simá 2287, CICY Pseudosamanea guachapele (Kunth) Harms, MW699962, BGRO 011 Paraserianthes lophantha, MW699409, H. Balslev et al. 62450, AAU Zapoteca formosa (Kunth) H.M. Hern., MW699963, R. Duno s.n. CICY. Additional accessions (ITS): Acacia acradenia F.Muell., AF487765.1 Pithecellobium diversifolium, MW699410, J.F.B. Pastore & R.M. Harley 2599 MO Acacia longifolia (Andrews) Willd., HM007655.1 Pithecellobium excelsum, MW699411, G. P. Lewis et al 2339, MO Acaciella angustissima (Mill.) Britton & Rose, EF638169.1 Pseudalbizzia adinocephala, MW699373, BGRO 002 Balizia pedicellaris (DC.) Barneby & J.W. Grimes, JX870657.1 MW699402, J.L. Linares 5406, FCME Calliandra dysantha Benth., JX870684.1 Pseudalbizzia edwallii, MW699381, J.M. Silva & L.M. Abe 4237, MEXU Re-establishment of the genus Pseudalbizzia 379 Accessions ITS Accessions ETS Calliandra foliosa Benth., EF638181.1 Pseudalbizzia inundata (Mart.) E.J.M. Koenen & Duno, MW699386, H. Balslev et al. 97355, AAU Cojoba arborea (L.) Britton & Rose, JX870758.1 Pseudalbizzia multiflora (Kunth) E.J.M. Koenen & Duno, MW699392, X. Cornejo & T. Andres 8705, GUAY Cojoba undulatomarginata L. Rico, EF638187.1 Pseudalbizzia niopoides (Spruce ex Benth.) E.J.M. Koenen & Duno, MW699393, J.R. Grande 374, VEN Ebenopsis ebano (Berland.) Barneby & J.W. Grimes, JX870759.1 Pseudalbizzia polycephala MW699395, L.P. Queiroz 9578, MEXU Enterolobium contortisiliquum (Vell.) Morong, EF638190.1 Pseudalbizzia sinaloensis, MW699399, C.E. Hughes et al. 1576, FCME Enterolobium cyclocarpum (Jacq.) Griseb., EF638191.1 Pseudalbizzia tomentosa, MW699401, A. Dorantes et al. 165, CICY Enterolobium timbouva Mart., JX870760.1 Pseudosamanea cubana (Britton & P. Wilson) Barneby & J.W. Grimes, MW699412, BJ FTGH 2000 Faidherbia albida (Delile) A. Chev., EU812008.1 Pseudosamanea guachapele, MW699413, BGRO 011 Havardia mexicana (Rose) Britton & Rose, JX870762.1 Samanea tubulosa (Benth.) Barneby & J.W. Grimes, MW699414, G.A. Parada & V.D. Rojas 2480, MO. Additional accessions: Acacia acradenia, EF638116.1 Havardia pallens (Benth.) Britton & Rose, KF921656.1 Acacia longifolia, EF638115.1 Hesperalbizia occidentalis (Brandegee) Barneby & J.W. Grimes, EF638195.1 Acaciella angustissima EF638082.1 Hycrochorea corymbosa (Rich.) Barneby & J.W. Grimes, JX870763.1 Pseudalbizzia adinocephala EF638144.1 Jupunba trapezifolia (Vahl.) Moldenke, EF638166.1 Albizia kalkora EF638158.1 Mariosousa coulteri (Benth.) Seigler & Ebinger, EF638198.1 Albizia lebbeck EF638155.1 Mariosousa dolichostachya (S.F. Blake) Seigler & Ebinger, EF638199.1 Albizia saponaria (Lour.) Blume, EF638085.1 Paraserianthes lophantha (Willd.) I.C. Nielsen, EF638204.1 Archidendropsis basaltica (F. Muell.) I.C. Nielsen, EF638141.1 Pithecellobium diversifolium Benth., JX870768.1 Archidendropsis thozetiana (F. Muell.) I.C. Nielsen, EF638140.1 Pithecellobium dulce (Roxb.) Benth., EF638207.1 Calliandra dysantha EF638121.1 Pithecellobium excelsum (Kunth) Mart., EF638208.1 Calliandra foliosa EF638122.1 Samanea saman (Jacq.) Merr., JX870770.1 Cojoba arborea EF638095.1 Samanea tubulosa (Benth.) Barneby & J.W. Grimes, EF638212.1 Cojoba undulatomarginata EF638096.1 Pseudosamanea guachapele (Kunth) Harms, JX870769.1 Ebenopsis confinis (Standl.) Britton & Rose, EF638100.1 Senegalia berlandieri (Benth.) Britton & Rose, KY688777.1 Ebenopsis ebano EF638101.1 Sphinga acatlensis (Benth.) Barneby & J.W. Grimes, EF638214.1 Enterolobium contortisiliquum EF638151.1 Vachellia campechiana (Mill.) Seigler & Ebinger, EF638215.1 Enterolobium cyclocarpum EF638149.1 Vachellia farnesiana (L.) Wight & Arn., EF638219.1 Faidherbia albida EF638163.1 Viguieranthus ambongensis (R. Vig.) Villiers, JX870773.1 Havardia pallens EF638146.1 Viguieranthus densinervus Villiers, JX870774.1 Hesperalbizia occidentalis EF638139.1 Viguieranthus megalophyllus (R. Vig.) Villiers, JX870776.1 Hycrochorea corymbosa EF638138.1 Viguieranthus subauriculatus Villiers, JX870778.1 Jupunba trapezifolia (Vahl.) Moldenke, EF638110.1 Zapoteca tetragona (Willd.) H.M. Hern., JX870784.1 Mariosousa coulteri (Benth.) Seigler & Ebinger, EF638124.1 Mariosousa dolichostachya EF638084.1 Pararchidendron pruinosum (Benth.) I.C. Nielsen, EF638129.1 Paraserianthes toona (Bailey) I.C. Nielsen, EF638106.1 Pithecellobium dulce EF638142.1 Pseudosamanea guachapele EF638160.1 Samanea saman EF638136.1 Samanea tubulosa EF638135.1 Senegalia berlandieri EF638162.1 Sphinga acatlensis EF638145.1 Vachellia farnesiana EF638128.1 Viguieranthus ambongensis KR997873.1 Viguieranthus densinervus JX870891.1 Viguieranthus megalophyllus KR997871.1 Viguieranthus subauriculatus KR997076.1 Zapoteca formosa EF638134.1 Zapoteca tetragona EF638133.1. Gabriela Aviles Peraza et al. / PhytoKeys 205: 371–400 (2022) 386 Code of Nomenclature (Turland et al. 2018), we reinstate Pseudalbizzia, the earlier name associated with this clade, and provide the corresponding new combinations for its constituent species. Pseudalbizzia Britton & Rose, N. Am. Fl. 23: 48. 1928. Type. Pseudalbizzia berteroana Britton & Rose. Arthrosamanea Britton & Rose, in Britton & Killip, Ann. New York Acad. Sci. 35: 128, 1936. Albizia section Arthrosamanea (Britton & Rose) Barneby & J.W. Grimes, Mem. New York Bot. Gard. 74(1): 206. 1996. Type: Arthrosamanea pistaciifolia Britton & Rose. Description. Unarmed trees with sympodial growth, up to 30 m, rarely small treelets of c. 3m, microphyllidious to macrophyllidious; trunk 35–120(–150) cm dbh; young stems and all leaves and inflorescence-axes more or less densely tomentellous to pilosulous; stipules puberulent to glabrous, deltate, narrowly triangular, triangularovate, narrowly ovate, or narrowly lanceolate, veinless or faintly 3-veined, falling early to tardily, perhaps sometimes obsolete and/or lacking on mature leaves. Leaves bipinnate, not sensitive, (1–)2–15(–19) pairs of pinnae; leaflets (2–)16–52(–63) pairs per pinna; a nectary immediately below first pair of pinnae, near or well below mid-petiole, sometimes lacking or reduced to a minute pore, round, elliptic or vertically elongate, either shallow-cupular or almost plane, thick-rimmed, sometimes immersed in petiolar groove or even obsolete, much smaller nectaries at some distal pinnae, at the tip of most pinnae, and between 1–2 furthest pairs of leaflets; leaflets gently decrescent toward each end of the rachis or toward the base of the rachis or sub-equilong, the first pair of leaflets often reduced to paraphyllidia, sometimes minute, sometimes absent or perhaps falling early, the blades of the remaining leaflets elliptic, elliptic-ovate, oblongelliptic, narrowly oblong-elliptic, lance-oblong to linear-lanceolate, base obliquely truncate to shallowly semi-cordate, apex deltately subacute, deltately acute to subacute, obtuse or apiculate, the larger ones (1.5–)2–4(–6) times as long as wide, margin strongly to slightly revolute; venation generally palmate, of 2–4(–5) veins from the pulvinule, the nearly straight main vein a little forwardly displaced and giving rise on each side to 2–13 major secondary veins, the inner of 2(–3) posterior primary veins incurvedascending to anastomose slightly beyond mid-blade, the outer posterior vein and sometimes a faint anterior one very short and weak, all venation immersed on upper face. Inflorescence primary axis up to 30 cm long; peduncles (1–)2–8(–10) per node of the capitulate or corymbose-umbellate inflorescence, capitula 8–26(–40)-flowered; bracts heteromorphic or homomorphic, ovate, oblong-obovate or spatulate, linear-spatulate, falling early or persistent, sessile or shortly pedicellate, the flowers moderately to strongly dimorphic, the terminal ones generally longer. Flowers 5-merous, rarely 6-merous, glabrous to densely pubescent externally. Peripheral flowers: calyx campanulate, turbinate, turbinate-campanulate or narrowly campanulate, sessile or short pedicellate, lobes very short, depressed-deltate, ovate or triangular, glabrous or puberulent; corolla narrowly trumpet-shaped, erect or recurved, lobes ovate to lance-ovate; androecium with Re-establishment of the genus Pseudalbizzia 387 9–30(–32) stamens, up to 20 mm long, united at the base forming a clear stemonozone, the staminal tube as long or longer than the stemonozone; ovary sessile or shortly stipitate, slenderly ellipsoid, conical at apex, glabrous or pubescent; style a little longer than the stamens, slightly dilated at the stigma. Terminal flowers: sessile or almost so, calyx shallowly campanulate to broadly campanulate, corolla tubular; androecium with 16–38(–42) stamens, 8.5–11.5(–13) mm long, united at the base forming a clear stemonozone, staminal tube equalling or longer than the stemonozone. Fruits solitary, or rarely 2–4 per capitulum, sessile, subsessile or cuneately contracted at base into a short pseudo-stipe, the body linear, linear-elliptic, narrowly elliptic-oblong, straight or nearly straight, sometimes decurved, plano-compressed, apex rounded but minutely apiculate to obtuse, (8–)13(–15)-seeded; valves papery, coriaceous, or grossly ligneous, olivaceous, castaneous, fuscous-greenish, or brown becoming tan-brown, closely transverse venulose, minutely puberulous, tomentulose, glabrescent to glabrous, framed by straight sutures or dilated, sometimes 3-angulate but not winged, transversely or horizontally, dehiscence tardy to very tardy, inert, through both sutures or dehiscence 0, in the latter, the pod crypto-lomentiform, incipiently lomentiform or lomentiform, then the whole fruit long persistent on the tree, commonly falling entire and breaking on the ground into 8–12 individually indehiscent segments, funicle apically sigmoid or ribbon-like (not sigmoid), lentiform; seeds obliquely ascending or straight, disciform, oblong-ellipsoid, elliptic, strongly compressed, the translucent, brownish or greyish testa produced as a peripheral wing, adherent to the embryo, which does not fill the testa-cavity, the pleurogram small, inversely U-shaped or U-shaped. Notes. The genus forms a group that is homogeneous in most respects, but diverse in the late developmental stages of the fruit, including: 1) fruit opening type: dehiscent, indehiscent, or irregularly breaking, 2) lateral shape: flat to conspicuously raised over the seed chambers, 3) texture and consistency of the valves: papery, chartaceous to woody (Barneby and Grimes 1996). Figs 1, 2 and 4. Pseudalbizzia (clade D) is the sister group of the Jupunba-Punjuba-Balizia-Hydrochorea clade (Fig. 3). Jupunba and Punjuba are markedly different morphologically, having spirally twisted dehiscent fruits with a red or ochre endocarp, reminiscent of the fruits of several other genera in tribe Ingeae (e.g., some Pithecellobium species, and some species of Archidendron F. Muell. and Cojoba Britton & Rose). The red or redbrown testa of the seeds of Jupunba and Punjuba are very distinctive, and are never black, and the embryo is nearly always aniline-blue due to the presence of delphinidin (an anthocyanidin). Punjuba is furthermore distinguished by its spicate inflorescences, which are not seen in Pseudalbizzia. Balizia has ligneous, indehiscent or tardily dehiscent pods, their seeds being released sometimes only after decay of the valves on the floor of terra firme forest, whereas in Hydrochorea the fruits are lomentiform, adapted to dispersal by water. The fruits of Hydrochorea recall some species of Pseudalbizzia adapted to similar riparian habitats. However, the species of Pseudalbizzia are markedly different in form of inflorescence, leaflet-venation, and shape of the ovary. Two species previously placed in Albizia from the New World which were not included in our phylogenetic analysis, Albizia carbonaria and A. leonardii, have since been shown to be placed outside the New World Albizia clade (Ringelberg Gabriela Aviles Peraza et al. / PhytoKeys 205: 371–400 (2022) 388 et al. 2022; Koenen 2022b; Terra et al. 2022). Two other species, also not sampled here, nor by Ringelberg et al. (2022), are here tentatively included in Pseudalbizzia: Albiziabarinensis L. Cárdenas and Albizia buntingii Barneby & J.W. Grimes (see below for discussion about the placement of these species). The genus Pseudalbizzia was published in the Flora of North America (Britton and Rose 1928) and included just a single species, P. berteroana. The original description of Pseudalbizzia closely matches Albizia and no characters distinguishing the two genera were discussed by Britton and Rose (1928). The generic name Arthrosamanea was also published by Britton & Rose, again with a single species, A. pistaciifolia (Willd.) Britton & Rose, in an account of the Mimosaceae and Caesalpiniaceae of Colombia (Britton and Killip 1936), but again no differences between the genus and Albizia or Pseudalbizzia were mentioned. Pseudalbizzia as circumscribed here comprises 17 species and 5 varieties ranging in distribution from northwestern Mexico to northern Argentina and including the Greater Antilles (Figs 5 and 6). Full synonymy, detailed species descriptions, geographical distributions, representative samples of all species and keys for their identification can be found (under the name Albizia) in Barneby and Grimes (1996), Linares (2005) and Rico Arce et al. (2008). Finally, we propose a new sectional classification of Figure 5. Distribution map of Pseudalbizzia sections Paniculata, Pseudalbizzia, Uninervia and Pseudalbizzia buntingii (incertae sedis), as per the legend. Re-establishment of the genus Pseudalbizzia 389 Figure 6. Distribution map of Pseudalbizzia sections Arthrosamanea and Pterocarpa, as per the legend. Pseudalbizzia to account for the non-monophyly of the series of Barneby and Grimes (1996), based on the phylogenies (Figs 3 and 4) which sampled nearly all species. A key to the sections is provided. Key to the sections of the genus Pseudalbizzia 1 Leaflets with a single vein from the pulvinule .......................sect. Uninervia – Leaflets with 3–5 veins from the pulvinule ..................................................2 2 Fruits with a narrowly winged margin, seeds oblique, foliage microphyllidious ......................................................................................sect. Pterocarpa – Fruit margins not winged, or if winged, then foliage macrophyllidious and seeds straight ...............................................................................................3 3 Fruits indehiscent and septate or lomentiform .............sect. Arthrosamanea – Fruits dehiscent, plano-compressed, valves papery, not septate .................... 4 4 Microto mesophyllidious foliage, distributed in South America .................. ...........................................................................................sect. Paniculata – Macroor microphyllidious foliage, distributed in Mexico, Central America and the Caribbean .........................................................sect. Pseudalbizzia Gabriela Aviles Peraza et al. / PhytoKeys 205: 371–400 (2022) 390 Pseudalbizzia sect. Paniculatae (Benth.) E.J.M. Koenen & Duno, stat. nov. and sect. nov. urn:lsid:ipni.org:names:77303802-1 Pithecellobium sect. Samanea ser. Paniculatae Benth. pro parte, London J. Bot. 3: 219. 1844. Albizia sect. Arthrosamanea ser. Paniculatae (Benth.) Barneby & J.W. Grimes pro parte, Mem. New York Bot. Gard. 74(1): 208. 1996. Type species (designated by Barneby and Grimes, Mem. New York Bot. Gard. 74(1): 208. 1996.): Pithecellobium polycephalum Benth. = Pseudalbizzia polycephala (Benth.) E.J.M. Koenen & Duno. Pithecellobium sect. Samanea ser. Parviflorae [sic] Benth. pro parte, Trans. Linn. Soc. London 30: 591 (exclus. sp. 77). 1875 & in Martius, Fl. Bras. 15(2): 445. 1876. Type species (designated by Barneby and Grimes, Mem. New York Bot. Gard. 74(1): 208. 1996.): Pithecellobium polycephalum Benth. = Pseudalbizzia polycephala (Benth.) E.J.M. Koenen & Duno. Type. Pithecellobium polycephalum Benth. = Pseudalbizzia polycephala (Benth.) E.J.M. Koenen & Duno. Notes. Microto mesophyllidious trees with paniculate compound inflorescences of efoliate pseudoracemes and dehiscent plano-compressed papery fruits. Four species of humid, semi-deciduous and seasonally dry tropical and extratropical forests and woodland in South America (Fig. 5). Pseudalbizzia barinensis (L. Cárdenas) E.J.M. Koenen & Duno, comb. nov. urn:lsid:ipni.org:names:77303803-1 Basionym. Albizia barinensis L. Cárdenas, Ernstia 21: 5, f. sn. 1983. Type. Venezuela. Barinas, muy cerca de Punta de Piedra, 3 Apr 1976, L. Cardenas de Guevara 2273 (holotype: MY; isotypes: BM!, F! [F0093839F], K! [K000527984], NY! [NY00001781], RB! [RB00539860], US! [US00385615], VEN). Notes. This species has not been included in any phylogenetic analysis, but its foliage, efoliate pseudoracemes and plano-compressed papery fruits leave little doubt that it should be placed in Pseudalbizzia. It is here included in section Paniculata based on these characters and its South American distribution. Pseudalbizzia coripatensis (Rusby) E.J.M. Koenen & Duno, comb. nov. urn:lsid:ipni.org:names:77303804-1 Basionym. Pithecellobium coripatense Rusby, Bull. New York Bot. Gard. 4: 349. 1907. Type. Bolivia. La Paz, Sur Yungas, at Coripata, 6 May 1894, M. Bang 2176 (holotype: NY! [NY00334642]; isotypes: BM! [BM000952433], G-2! [G00364414, G00364429], GH-2! [GH00064010, GH00064011], M! [M0218258], K! [K000527985], MINN, MO! [MO-954213], US). Re-establishment of the genus Pseudalbizzia 391 Pseudalbizzia edwallii (Hoehne) E.J.M. Koenen & Duno, comb. nov. urn:lsid:ipni.org:names:77303805-1 Basionym. Pithecellobium edwallii Hoehne, Bol. Inst. Brasil. Sci. 2: 243. 1926. Type. Brazil, São Paulo, G. Edwall 5608 (lectotype: SP, designated by Barneby and Grimes, Mem. New York Bot. Gard. 74(1): 209. 1996). Pseudalbizzia polycephala (Benth.) E.J.M. Koenen & Duno, comb. nov. urn:lsid:ipni.org:names:77303806-1 Basionym. Pithecellobium polycephalum Benth., London J. Bot. 3: 219. 1844. Type. Brazil. Rio de Janeiro, J.B.E. Pohl 1420 (lectotype: K! (herb. Bentham) [K000528000], designated by Barneby and Grimes, Mem. New York Bot. Gard. 74(1): 208. 1996). Pseudalbizzia sect. Uninervia E.J.M. Koenen & Duno, sect. nov. urn:lsid:ipni.org:names:77303807-1 Type. Albizia burkartiana Barneby & J.W. Grimes = Pseudalbizzia burkartiana (Barneby & J.W. Grimes) E.J.M. Koenen & Duno. Notes. Microphyllidious trees with the inflorescences of section Paniculata, but with a single vein from the pulvinule at the base of the leaflets. A single, narrowly endemic species in Paraná pine woodland and the Southern Mata Atlantica of Brazil (Fig. 5). Pseudalbizzia burkartiana (Barneby & J.W. Grimes) E.J.M. Koenen & Duno, comb. nov. urn:lsid:ipni.org:names:77303808-1 Basionym. Albizia burkartiana Barneby & J.W. Grimes, Mem. New York Bot. Gard. 74(1): 211–212. 1996. Type. Brazil. Santa Catarina, Capinzal, on upper Rio Uruguai, 700 m, 21 Dec 1973, P.R. Reitz & R. M. Klein 14359 (holotype: NY! [NY00001783]; isotype: US! [US00811452]). Notes. In the protologue the fruits were not described as these were not known at that time. This rare, locally endemic species has since been collected in fruit (Stival-Santos 678, BR), and we here provide a description of these. Fruits sessile but with a narrow pseudo-stipitate base, dehiscent along both slightly thickened sutures, the valves plano-compressed, papery in texture, light brown with finely prominent transverse veins, 6.5–12 × 1.2–1.6 cm, 7–12-seeded when wellfertilized. Gabriela Aviles Peraza et al. / PhytoKeys 205: 371–400 (2022) 392 Pseudalbizzia sect. Pseudalbizzia. Type as for the genus. Notes. Trees with microor macrophyllidious foliage, inflorescences composed of efoliate pseudoracemes arising singly from a leaf axil or sometimes the capitula solitary or paired in the leaf axils, or the pseudoracemes combined into a terminal panicle, fruits plano-compressed with papery valves, dehiscent along both sutures or more rarely indehiscent (in P. berteroana), sometimes with a winged margin, seeds straight. Four species predominantly of seasonally dry tropical forests in Mexico, Central America and the Caribbean (Fig. 5). Pseudalbizzia adinocephala (Donn. Sm.) E.J.M. Koenen & Duno, comb. nov. urn:lsid:ipni.org:names:77303809-1 Albizia xerophytica J. Linares, syn. nov., Revista Mex. Biodiversidad 76: 7. 2005. Type: Honduras. El Paraíso, Municipio Morocelí, orillas de Quebrada Grande c. 3.9km al NE de Morocelí por el camino hacia El Plan. 2002. J.L. Linares et al. 5674 (holotype: MEXU! [MEXU01160777]; isotype: EAP). Basionym. Pithecellobium adinocephalum Donn. Sm., Bot. Gaz. Crawfordsville. 57: 419. 1914. Type. Costa Rica. San José, Ad fundum La Verbena prope Alajuelita, 100 m, Aug 1894, A. Tonduz 8932 (US-3); Dec 1894 (lectotype: A. Tonduz 9077 [US-212774]!; isolectotypes: BR-3! [BR0000005189519, BR0000005189182, BR0000005189847], G! [G00364416], designated by Barneby and Grimes, Mem. New York Bot. Gard. 74(1): 218. 1996). Notes. Albizia xerophytica was described from material from dry forest habitats in southern Honduras based on minor differences in leaf and fruit morphology, but we do not consider these to be significantly different from the range of variation that is observed in P. adinocephala and prefer the broader concept of the species as described in Barneby and Grimes (1996: 218–220). The difference in habitat (i.e., lower rainfall regions) also appears to be minor, as some specimens from wetter sites have been identified as A. xerophytica (see map in Rico Arce et al. 2008) while specimens of P.adinocephala have been collected across the full range of drier and wetter sites. Finally, the distribution of A. xerophytica is entirely enclosed by the much wider range of P.adinocephala. Pseudalbizzia berteroana (Balb. ex DC.) Britton & Rose, N. Amer. Fl. 23: 48. 1928. Basionym. Acacia berteroana Balb. ex DC., Prodr. 2: 470. 1825. Re-establishment of the genus Pseudalbizzia 393 Type. Republica Dominicana, Sto. Domingo, C.L.G. Bertero, herb. Balbis s.n., 1821 (holotype: G; isotype: M! [M0218254]). Pseudalbizzia sinaloensis (Britton & Rose) E.J.M. Koenen & Duno, comb. nov. urn:lsid:ipni.org:names:77303810-1 Basionym. Albizia sinaloënsis in Britton & Rose, N. Amer. Fl. 23(1): 45. 1928. Type. Mexico. Sinaloa, vicinity of Fuerte, 26 March 1910, J.N. Rose, P.C. Standley & Russell 13559 (holotype: NY! [NY00001775]; isotype: US! [US00000483]). Pseudalbizzia tomentosa (M. Micheli) E.J.M. Koenen & Duno, comb. nov. urn:lsid:ipni.org:names:77303811-1 Basionym. Pithecellobium tomentosum M. Micheli, Mém. Soc. Phys. Genève 34: 285, t. 28. 1903. Type. Mexico. Michoacán, rives de l’Espiritu Santo, 600 m, 19 April 1898 [E. Langlassé] 107 (G): Zilmatango, 30 m, aout 1898, n 280 (G). (lectotype: E. Langlassé 107 G-385667!; isolectotypes: K! [K000082098], NY (fragm.)! [NY00001777], designated by Standley, Contr. U.S. Natl. Herb. 23: 396. 1922). Pseudalbizzia tomentosa var. nayaritensis (Britton & Rose) E.J.M. Koenen & Duno, comb. nov. urn:lsid:ipni.org:names:77303812-1 Basionym. Albizzia nayaritensis Britton & Rose, N. Amer. Fl. 23: 47. 1928. Type. Mexico. Nayarit; San Blas, La Palma, 20 m, 1923, J. González Ortega 90N (holotype: US! [US00918691]; isotypes: K! [K000082100], NY-2! [NY00001768, NY00001769]). Pseudalbizzia tomentosa var. purpusii (Britton & Rose) E.J.M. Koenen & Duno, comb. nov. urn:lsid:ipni.org:names:77303813-1 Basionym. Albizzia purpusii Britton & Rose, N. Amer. Fl. 23: 45. 1928. Type. Mexico. Veracruz, Rancho Remudadero, 19°15'N, 96°34'W, April 1922, C.A. Purpus 8723 (holotype: NY! [NY00001773]; isotypes: GH! [GH00069252], MO! [MO-120564], UC! [UC214372], US! [US00000479]). Gabriela Aviles Peraza et al. / PhytoKeys 205: 371–400 (2022) 394 Pseudalbizzia tomentosa var. tomentosa Pseudalbizzia sect. Pterocarpa E.J.M. Koenen & Duno, sect. nov. urn:lsid:ipni.org:names:77303814-1 Type. Pithecellobium niopoides Spruce ex Benth. = Pseudalbizzia niopoides (Spruce ex Benth.) E.J.M. Koenen & Duno. Notes. Microphyllidious trees with the inflorescence usually composed of axillary efoliate pseudoracemes, sometimes a partly or wholly terminal panicle (but not surpassing the foliage), the fruit with a narrowly winged margin and seeds oblique. A single widespread species found in deciduous seasonally dry forests, gallery forest, and evergreen forests in Mexico, Central and South America (Fig. 6). Pseudalbizzia niopoides (Spruce ex Benth.) E.J.M. Koenen & Duno, comb. nov. urn:lsid:ipni.org:names:77303815-1 Basionym. Pithecellobium niopoides Spruce ex Benth., Trans. Linn. Soc. London 30: 591. 1875. Type. Brazil, Pará, Santarem, Nov 1851, R. Spruce 1088, Herb. Bentham (holotype: K! [K000528013]). Pseudalbizzia niopoides var. colombiana (Britton) E.J.M. Koenen & Duno, comb. nov. urn:lsid:ipni.org:names:77303816-1 Albizia niopoides var. colombiana (Britton) Barneby & J.W. Grimes, Mem. New York Bot. Gard. 74(1): 222. 1996. Basionym. Albizzia colombiana Britton, in Britton & Killip, Ann. New York Acad. Sci. 35: 131. 1936. Type. Colombia. Magdalena, near Bonda, Santa Marta, 3 August 1899, H.H. Smith 38 (holotype: NY! [NY00001784]; isotypes: BR! [BR0000005111176], E! [E00313853], K! [K000527990], NY!, U-2! [U0003354, U1253389]). Pseudalbizzia niopoides var. niopoides Pseudalbizzia sect. Arthrosamanea (Britton & Rose) E.J.M. Koenen & Duno, comb. nov. urn:lsid:ipni.org:names:77303817-1 Arthrosamanea Britton & Rose, Ann. New York Acad. Sci. 35: 128, pro gen. 1936, sensu stricto. Albizia sect. Arthrosamanea (Britton & Rose) Barneby & J.W. Grimes Re-establishment of the genus Pseudalbizzia 395 pro parte, Mem. New York Bot. Gard. 74(1): 206. 1996. Type species: Arthrosamanea pistaciifolia (Willd.) Britton & Rose = Mimosa pistaciifolia Willd. = Pseudalbizzia pistaciifolia (Willd.) E.J.M. Koenen & Duno. Albizia sect. Arthrosamanea ser. Multiflorae Barneby & J.W. Grimes, Mem. New York Bot. Gard. 74(1): 234. 1996. Albizia sect. Arthrosamanea ser. Inundatae Barneby & J.W. Grimes, Mem. New York Bot. Gard. 74(1): 238. 1996. Notes. Microor macrophyllidious trees, usually the efoliate pseudoracemes arising singly and only rarely arranged in panicles, fruits indehiscent and septate, or lomentiform, one species crypto-lomentiform. Six species of usually humid, often seasonally inundated forest or riparian habitats in South America (Fig. 6). Pseudalbizzia decandra (Ducke) E.J.M. Koenen & Duno, comb. nov. urn:lsid:ipni.org:names:77303818-1 Basionym. Pithecellobium decandrum Ducke, Arch. Jard. Bot. Rio de Janeiro 5: 121. 1930. Type. Brazil. Pará, habitat in silvis non inundatis civitatis Pará circa Óbidos, A. Ducke (Herb. Amaz. Mus. Pará 15.724, et H.J.B.R. 10.174) et loco Serra do Dedal ad lacum Faro, A. Ducke (H.J.B.R. 20.198), ubi florebat Januario 1927, A. Ducke (lectotype: A. Ducke 10174 RB!; isolectotypes: G! [G00364418], K-2!: [K000527990, K000527998], U-2! [U0003349, U0003350], designated by Barneby and Grimes, Mem. New York Bot. Gard. 74(1): 234. 1996.). Pseudalbizzia glabripetala (H.S. Irwin) E.J.M. Koenen & Duno, comb. nov. urn:lsid:ipni.org:names:77303819-1 Basionym. Pithecellobium glabripetalum H.S. Irwin, in Mem. New York Bot. Gard. 15(1): 109. 1966. Type. Guyana. Orealla, Corantyne River, Oct 1879, G.S. Jenman 364 (holotype: NY! [NY00334664]; isotypes: BM!, P!). Pseudalbizzia inundata (Mart.) E.J.M. Koenen & Duno, comb. nov. urn:lsid:ipni.org:names:77303820-1 Basionym. Acacia inundata Mart., Spix & Mart. in Reise Bras. 1: 555. 1823. Type. Brazil. Minas Gerais, Rio Sao Francisco, 1818, C.F.P. von Martius 1659 (holotype: M! [M0218478]; isotypes: K! [K000797598], NY!).