Anti-Inflammatory Action of Dietary Wild Olive (Acebuche) Oil in the Retina of Hypertensive Mice
Abstract
This article belongs to the Special Issue Extraction, Characterization and Biological Activity of Food Bioactive Compounds.
Full text
foods Article Anti-Inflammatory Action of Dietary Wild Olive (Acebuche) Oil in the Retina of Hypertensive Mice Álvaro Santana-Garrido 1,2 , Claudia Reyes-Goya 1, Santiago Milla-Navarro 3, Pedro de la Villa 3,4, Helder André5, Carmen M. Vázquez 1,2 and Alfonso Mate 1,2,* Citation: Santana-Garrido, Á.; Reyes-Goya, C.; Milla-Navarro, S.; de la Villa, P.; André, H.; Vázquez, C.M.; Mate, A. Anti-Inflammatory Action of Dietary Wild Olive (Acebuche) Oil in the Retina of Hypertensive Mice. Foods 2021,10, 1993. https://doi.org/ 10.3390/foods10091993 Academic Editors: Ruth HornedoOrtega and Ana B. Cerezo Received: 26 July 2021 Accepted: 23 August 2021 Published: 25 August 2021 Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. Copyright: © 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https:// creativecommons.org/licenses/by/ 4.0/). 1Departamento de Fisiología, Facultad de Farmacia, Universidad de Sevilla, 41012 Sevilla, Spain; [email protected] (Á.S.-G.); [email protected] (C.R.-G.); [email protected] (C.M.V.) 2Epidemiología Clínica y Riesgo Cardiovascular, Instituto de Biomedicina de Sevilla (IBIS), Hospital Universitario Virgen del Rocío/Consejo Superior de Investigaciones Científicas/ Universidad de Sevilla, 41013 Sevilla, Spain 3Department of Systems Biology, University of Alcalá, 28871 Madrid, Spain; [email protected] (S.M.-N.); [email protected] (P.d.l.V.) 4Instituto Ramón y Cajal de Investigación Sanitaria (IRYCIS), 28034 Madrid, Spain 5 Department of Clinical Neuroscience, St. Erik Eye Hospital, Karolinska Institutet, 11282 Stockholm, Sweden; helder[email protected] *Correspondence: [email protected] Abstract: Inflammation plays a crucial role in the course of eye diseases, including many vascular retinopathies. Although olive oil is known to have beneficial effects against inflammatory processes, there is no information available on the anti-inflammatory potential of the wild olive tree (namely, acebuche (ACE) for the primitive Spanish lineages). Here we investigate the anti-inflammatory effects of ACE oil in the retina of a mouse model of arterial hypertension, which was experimentally induced by administration of L-NAME (NG-nitro-L-arginine-methyl-ester). The animals were fed supplements of ACE oil or extra virgin olive oil (EVOO, for comparative purposes). Retinal function was assessed by electroretinography (ERG), and different inflammation-related parameters were measured in the retina and choroid. Besides significant prevention of retinal dysfunction shown in ERG recordings, ACE oil-enriched diet upregulated the expression of the anti-inflammatory markers PPAR γ , PPAR α and IL-10, while reducing that of major proinflammatory biomarkers, IL-1 β , IL-6, TNFα and COX-2. This is the first report to highlight the anti-inflammatory properties of an ACE oil-enriched diet against hypertension-related retinal damage. Noteworthy, dietary supplementation with ACE oil yielded better results compared to a reference EVOO. Keywords: acebuche; arterial hypertension; inflammation; olive oil; retina; wild olive tree 1. Introduction Numerous authors have recognized the pivotal role of extra virgin olive oil (EVOO) (Olea europaea L.) in the context of the well-known Mediterranean diet, and the potential benefits of its multiple bioactive compounds [ 1 , 2 ]. In this sense, EVOO has been identified as a key to reducing the risk of various diseases [ 3 – 5 ]. The beneficial health outcomes derived from the regular consumption of olive oil rely on its nutritional components to which antioxidant, anti-inflammatory and antitumoral properties are ascribed. The major constituents of EVOO include acyclglycerols, free fatty acids, pigments and phosphatides, among others. A high proportion of monounsaturated fats also defines its distinctive biochemical profile [ 6 ], of which oleic acid (C18:1) is probably the most studied [ 7 ]. Polyunsaturated fatty acids (PUFAs) include linoleic (C18:2) and α -linolenic (C18:3) acids, whereas saturated fatty acids (SFA) account only for 8–14% [ 8 ]. Interestingly, EVOO also contains a wide range of minor components including sterols, tocopherols, triterpenic and phenolic compounds, which are involved in a profusion of pathways involved in homeostasis, inflammation and redox state [ 9 – 12 ]. Consequently, regular consumption of EVOO has been Foods 2021,10, 1993. https://doi.org/10.3390/foods10091993 https://www.mdpi.com/journal/foods
Foods 2021,10, 1993 2 of 18 proposed as a powerful nutraceutical tool to avert and mitigate cancer and cardiovascular or degenerative diseases [ 13 , 14 ], where noticeable contributions of hydroxytyrosol and its derivates (tyrosol, oleuropein and oleocanthal) have been reported [ 15 ]. Nonetheless, some authors have claimed the need to discover additional minor bioactive components of EVOO that might help understand its beneficial properties. Unlike the renowned reports concerning the consumption of fruits and oil obtained from the common olive tree (Olea europaea var. europaea) in the setting of the Mediterranean diet, the information available on the wild olive tree (Olea europaea var. sylvestris)—namely, acebuche (ACE) for the primitive Spanish lineages—is very limited. Thus, although different studies have addressed the composition and therapeutic effects of EVOO, very little is known specifically about ACE oil, a product of growing interest in specific regions such as Andalusia, Spain. The conservation of genuine wild olive lineages is desirable from an environmental point of view; however, these olive varieties have remained largely under-exploited, because the fruit of the wild olive yields little oil compared to cultivated olives. Therefore, the small amounts of commercially available ACE oil are typically consumed as “gourmet” products that are generally recognized as spicier, more bitter and fruitier than standard EVOOs, possibly due to slight differences in minor compounds [ 16 , 17 ]. Some of the first evidences have attributed a higher content of tocopherols (e.g., vitamin E), sterols and triterpene acids in ACE oil than in EVOO, and also a higher amount of secoiridoid compounds relative to ortodiphenols in the former [ 18 , 19 ]. Moreover, ACE oil has been reported to have lower antigenic and allergenic capacities compared to cultivated olive trees [20]. Despite the importance of EVOO in protecting against cardiovascular diseases (CV), its potential role as a bioactive supplement able to counteract the development/progression of ocular diseases is not well established yet. Previous population studies have suggested that EVOO might be useful to delay the occurrence of age-related macular degeneration (AMD) [ 21 – 23 ], while in vivo and in vitro experiments described neuronal protection of EVOO components (e.g., hydroxytyrosol and oleuropein) in diabetic retinopathy (DR) [ 24 – 27 ]. In this regard, we have recently demonstrated a retinoprotective action of EVOOand ACE oil-enriched diets, showing better results in the latter case, in a context of arterial hypertension (AH). The beneficial actions of these oils were ascribed to their capacity to counteract the progression of hypertensive eye disease by reducing superoxide anions (O 2·− ) and by modulating the enzymes NADPH oxidase and nitric oxide synthase, among others [ 19 ]. Therefore, ACE oil and EVOO-based diets could represent a strategical tool to reduce AH-related ocular damage in pathologies such AMD, DR or hypertensive retinopathy, among others. However, knowing the precise mechanisms responsible for the beneficial properties of olive oil consumption at the ocular level requires further research. Along with oxidative stress, inflammation has been extensively studied as a key mechanism in the pathogenesis of hypertension, especially in the context of persistent AH [ 28 , 29 ]. The expression of major inflammatory biomarkers, including tumor necrosis factor-alpha (TNFα ) [ 30 ], cyclooxygenase-2 (COX-2) [ 31 ] and interleukin (IL) isoforms [ 32 ], is known to be modulated during the course of AH. In addition, it is well known that low-grade inflammation in AH is associated with several pathways involved in the development and progression of different ocular pathologies [ 33 , 34 ], including DR [ 35 ], glaucoma [ 36 ] and AMD [ 37 ], among others. While it is also noteworthy that the literature on the interplay between inflammation and AH supports the involvement of the former in hypertensive retinopathy [ 38 ] and DR [ 39 ], how hypertension contributes to inflammation and its relevance in the development/progression of major retinopathies has not been previously studied. Some of the components of EVOO mentioned above have been postulated as possible contributors to reduce the inflammation process in different diseases, including hydroxytyrosol [ 40 ], oleocanthal [ 41 ] or triterpenes such as ursolic and oleanolic acids [ 42 ], among others. Novel dietary and/or therapeutic strategies could help reduce retinal inflammation (whether or not related to AH) and describe the possible implication of AH in this regard, thus contributing to unveil hypertension-associated target organ damage.
Foods 2021,10, 1993 3 of 18 The purpose of the current study was to test the ability of an ACE oil-enriched diet to counteract retinal inflammation, based on a plausible anti-inflammatory effect, in a rodent model of AH triggered by chronic administration of L-NAME (NG-nitro-L-arginine-methylester). Visual function was estimated by electroretinography in unconscious hypertensive mice after a 6-week period of ACE oil administration. Moreover, the expression of peroxisome proliferator-activated receptors (PPARs) and that of inflammation-related biomarkers (namely, interleukin isoforms (IL-1 β , IL-6 and IL-10), TNFα and COX-2) was assayed by immunohistofluorescence in retinal/choroid layers, and by Western blotting and realtime PCR in retinal homogenates. Additional experiments were carried out in parallel substituting EVOO for ACE oil, for comparative analysis. 2. Materials and Methods 2.1. Study Design The present study complies with the European Union (EU) Directive 2010/63/EU and the National (RD 53/2013) guidelines for the care and use of Laboratory animals and was approved by the relevant Institutional Animal Care and Use Committee (Dirección General de Producción Agrícola y Ganadería, Junta de Andalucía, reference #13/03/2019/031). 10–12-week-old male C57B/6J mice were supplied by the Center for Animal Production and Experimentation (University of Seville, Spain). The animals were randomly distributed into six groups: (1) Control (standard pellet diet), (2) ACE (standard pellet diet supplemented with 12% (w/w) of wild olive oil), (3) EVOO (standard pellet diet supplemented with 12% of extra virgin olive oil), (4) L-NAME (mice made hypertensive following treatment with 45 mg L-NAME/kg/day), (5) LN + ACE (L-NAME-treated hypertensive mice fed the same diet as in group 2; and (6) LN + EVOO group (L-NAME-treated hypertensive mice fed the same diet as in group 3). All treatments lasted 6 weeks under continuous monitoring of solid and liquid intake. Animals were housed under standard regulated conditions (23 ±1◦C, 12 h/12 h light/dark cycles). 2.2. Dietary Supplementation A commercial rodent chow (ROD14IRR, Sodispan Research, Altromin, Germany) was supplemented with 12% of ACE oil (groups 2 and 5) or EVOO (groups 3 and 6), as mentioned above. The specifications for the preparation of the diets and the chemical composition of ACE oil and EVOO were previously reported [ 19 ]. The oil-powder pellets were kept cool and protected from light until daily use. Both oils were produced in Sierra de las Nieves (Málaga, Spain) using exactly the same extraction methods, in accordance with standard protocols to comply with extra virgin olive oil definition. Briefly, oils were obtained by a process of grinding, mixing and extraction at room temperature by centrifugation in a two-phase system. Then, they were kept in an insulated cellar with controlled temperature, protected from light and away from any source of external flavors. The oils were analyzed prior to their use in animal experiments [ 19 ]. The required amount of L-NAME in the water bottles was adjusted every week after monitoring each animal’s body weight and water intake; the specific dose was chosen from prior studies performed routinely in our laboratory. 2.3. Animal Characteristics Systolic and diastolic blood pressure values (SBP, DBP) were recorded every week throughout treatment by the non-invasive, tail-cuff occlusion method in conscious animals by means of a pressure recorder (NIPREM 645, CIBERTEC S.A., Madrid, Spain). Blood pressure values were pooled and averaged from three to four consecutive measurements. 2.4. Electroretinography (ERG) Dark-adapted mice (12 h) were anaesthetized, under dim red light, with an intraperitoneal injection of a mix of ketamine (Ketamidor, Richter Pharma AG, Wels, Austria; 100 mg/mL) and xylazine (Xilagesic, CALIER, Barcelona, Spain; 20 mg/mL) in saline
Foods 2021,10, 1993 4 of 18 solution (NaCl 0.9%), at a final concentration of 0.5 mL/150 g body weight. The animals’ temperature was kept at 37 ◦ C with a water-content heating pad, to avoid electric noise during the recording. Pupil dilation was achieved with 1% tropicamide (Alcon CusíS.A., El Masnou, Barcelona, Spain). A needle was located at the base of the tail for grounding and a reference electrode was placed on the tongue. A gold band electrode was used to record ERGs from the right eye. The electrode was placed on the cornea, and a drop of 2% methyl-cellulose (Methocel 2%, Omnivision, Neuhausen, Switzerland) was placed between the cornea and the electrode to assure electrical conductivity and to protect the eye. Full-field flash ERG was performed with a Ganzfeld dome. Initially, a first scotopic phase was performed with flashes of increasing intensity ( − 4.0, − 3.0, − 2.0, − 1.5, − 1.0, − 0.5, − 0.0, 0.5, 1.0, and 1.5 log cd · s −1· m −2 ). The interval between flashes in scotopic conditions ranged from 1.2 s for dim flashes to 15 s for the highest intensity stimuli. ERG signals were amplified and filtered between 0.3 and 1000 Hz with a Grass amplifier (CP511 AC amplifier, Grass Instruments, Quincy, MA, USA, EE.UU.). In general, scotopic b-wave (b-scot) informs about rod-driven circuitry, mixed waves (mixed) indicate rod and cone photoreceptors (a-mix) and their postsynaptic circuitry (b-mix) activity, and photopic b-wave (b-photo) test how photopic conditions affect cone-driven circuitry through rodsaturating light stimulation. Moreover, oscillatory potentials (OP) were isolated using a bright flash (1.5 log cd · s −1· m −2 ) and band pass filter between 30 and 10,000 Hz. Conemediated responses were recorded on a rod-saturating background of 30 cd/m 2 , after 5 min of adaptation, with flashes of increasing intensity ( − 1.0, − 0.5, − 0.0, 0.5, 1.0 and 1.5 log cd · s −1· m −2 ). Under photopic conditions, the interval between light flashes was fixed at 1.2 s. Flicker (FL) response was recorded at different frequencies (20, 30 and 50 Hz) and an intensity of 1.5 log cd · s −1· m −2 . ERG wave components were measured manually using the commercial software LabChart Pro v.8.1.13 (ADInstruments Ltd., Oxfordshire, UK). 2.5. Sample Harvesting Animals were anesthetized with intraperitoneal injections of ketamine (75 mg/Kg) plus diazepam (10 mg mg/Kg), then subjected to cervical dislocation. The retinas were immediately isolated under a binocular stereo microscope, immersed in liquid nitrogen and maintained at − 80 ◦ C until use for gene/protein expression analyses. For immunodetection of proteins of interest in retinal/choroidal tissue, eyes were processed as described below (Section 2.8). 2.6. Western Blotting Analyses Retinal homogenates were prepared in protease inhibitor-containing phosphate buffer saline (50 mM PBS, Sigma Aldrich-Roche, Madrid, Spain) using a Potter-Elvehjem tissue grinder. Homogenized samples were centrifuged for 10 min at 10,000 × gand aliquots of the corresponding supernatants were set aside to estimate the protein concentration according to the method described by Bradford [ 43 ]. Western blotting analyses were performed in retinal homogenates containing 40–50 µ g of proteins, as previously described [ 19 ]. Specific primary and secondary antibodies are listed in Table 1. Blot signals were quantified by optical densitometry (Cytiva Europe GmbH, Barcelona, Spain), and constitutive β -actin was used as the loading control in all blots.
Foods 2021,10, 1993 5 of 18 Table 1. Antibodies used for Western blotting analysis. SCB = Santa Cruz Biotechnology (Santa Cruz, CA, USA). Primary Antibody Origin Dilution Secondary Antibody Dilution Reference Anti-PPARγMouse monoclonal 1:2000 Goat Anti-Mouse 1:4000 SCB Anti-PPARαMouse monoclonal 1:2000 Goat Anti-Mouse 1:4000 SCB Anti-IL-6 Mouse monoclonal 1:1000 Goat Anti-Rabbit 1:2000 SCB Anti-IL-1βMouse monoclonal 1:1000 Goat Anti-Mouse 1:2000 SCB Anti-IL-10 Mouse monoclonal 1:1000 Goat Anti-Mouse 1:2000 SCB Anti-TNF-αMouse monoclonal 1:1000 Goat Anti-Mouse 1:2000 SCB Anti-COX2 Mouse monoclonal 1:1000 Goat Anti-Mouse 1:2000 SCB Anti-β-Actin Mouse monoclonal 1:20,000 Goat Anti-Mouse 1:30,000 SCB 2.7. Real-Time PCR Total RNA from each retina sample was isolated with TRIzol ® (Thermo Fisher Scientific, Madrid, Spain); then, reverse transcription reactions were carried out as described elsewhere [ 44 ]. Specific primers are listed in Table 2. Gene products were amplified in a CFX96 real-time PCR system (Bio-Rad, Madrid, Spain), and relative mRNA expression was quantified by the standard 2 −∆∆Ct method, using glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as the housekeeping gene. Table 2. Primers used for real-time PCR. Gene Forward Primer (50→30) Reverse Primer (50→30) IL-6 CTCTGCAAGAGACTTCCATCC TTCTGCAAGTGCATCATCGT IL-1βCCGTGGACCTTCCAGGATGA GGGAAGGTCACACACCAGCA IL-10 CTGGACAACATACTGCTAACCG GGGCATCACTTCTACCAGGTAA TNF-αCCACGCTCTTCTGTCTACTG ACTTGGTGGTTTGCTACGAC GAPDH GCCAAAAGGGTCATCATCTCCGC GGATGACCTTGCCCACAGCCTTG 2.8. Immunohistofluorescence Paraffin-embedded sections (5 µ m thick) were obtained following intravitreal administration of 4% paraformaldehyde (PFA) in PBS; eyes were then post-fixed in 4% PFA for 24 h. The localization of PPAR isoforms (PPAR γ and PPAR α ) in the retina and choroid was evaluated by immunohistofluorescence staining after deparaffination of the sections. A heat retrieval solution (Diva Decloaker, Biocare Medical, LLC, Pacheco, CA, USA) was used prior to incubation with specific primary antibodies (Table 3). Goat anti-mouse Alexa Fluor ® 647 (Cat. No. CSA3808) or Goat anti-rabbit Alexa Fluor ® 488 (Cat. No. CSA3211), where appropriate, were chosen as fluorescent secondary antibodies, and DAPI Fluoromount-G®was used as a nuclear/chromosomal counterstain. Table 3. Primary antibodies used for immunofluorescence studies. Primary Antibody Origin Dilution Reference Anti-PPARγMouse monoclonal 1:200 Santa Cruz Biotechnology, Santa Cruz, CA, USA Anti-PPARαMouse monoclonal 1:200 Santa Cruz Biotechnology Anti-CD31 Rabbit monoclonal 1:200 Rockland Immunochemicals, Limerick, PA, USA 2.9. Statistical Analyses Results are expressed as means ± standard error of the mean (SEM). GraphPad InStat Software (v. 3.10, San Diego, CA, USA) was used to run one-way analysis of variance (ANOVA) followed by post-hoc Tukey’s multiple comparison test, and p< 0.05 was considered statistically different.
Foods 2021,10, 1993 6 of 18 3. Results 3.1. Validation of the Experimental Approach At the end of the 6-week experimental period, SBP/DBP values showed a significant (p< 0.05) rise of both parameters in the L-NAME group (189/110 mmHg, respectively), in comparison with all other animal groups (Figure 1A). Dietary supplementation with ACE oil counteracted the typical effect of L-NAME, such that the values recorded in the LN + ACE group fell slightly below the hypertensive threshold (136/85 mmHg). On the other hand, the blood pressure lowering effect of EVOO was milder than that of ACE oil (161/97 mmHg for LN + EVOO group). As shown in Figure 1A, the intake of either oil had no effect in normotensive (L-NAME-free) mice (126/83 and 134/89 mmHg for ACE and EVOO groups, respectively) when compared with the Control group (123/80 mmHg). In addition, no differences were observed among any of the study groups in terms of weight gain (Figure 1B) or solid/liquid intake (Figure 1C). Figure 1. General parameters. ( A ) Final blood pressure, ( B ) weight gain and ( C ) liquid and solid diet intake in the six experimental animal groups. Values are expressed as mean ± SEM of seven animals per group: a p< 0.05 vs. Control; b p< 0.05 vs. L-NAME; d p< 0.05 vs. LN + EVOO; e p< 0.05 vs. ACE. 3.2. Retinal Function Analyzed by Full-Field ERG Waveforms of the different recording conditions are depicted in Figure 2A–E. The analyses of these responses to light recorded after overnight dark-adaptation showed a significant (p< 0.05) reduction in amplitudes of scotopic waves b-scot (rods), a-mix and b-mix (mixed), and oscillatory potentials (OP), in the L-NAME group in comparison with Control animals (Figure 2F). Although no significant differences were observed in the bphot amplitude, indicating no modifications in retinal activity of cones, and flickers (FL), a decreasing trend in its amplitude secondary to treatment with L-NAME could be extracted from our results. Regarding the groups fed with oil-enriched diets, no disturbances were found in LN + ACE and LN + EVOO animals, thus demonstrating the efficacy of both oil diets to prevent the negative effects of L-NAME on retinal function. In addition, no differences were found between any of the oil-supplemented groups (with or without the hypertensive phenotype), which means that no better efficacy is displayed between the ACE oil and EVOO diets in terms of visual retinal function.
Foods 2021,10, 1993 7 of 18 Figure 2. Electroretinogram (ERG) responses. Waveforms of representative ERG recordings: ( A ) b-scot (rods), ( B ) a-mix, b-mix (mixed), ( C ) b-phot (cones), ( D ) oscillatory potentials (OP) and ( E ) flickers of each experimental group are represented. ( F ) Mean amplitude of all waves from the different experimental groups. Values are expressed as mean ± SEM of ten animals per group: a p< 0.05 vs. Control; c p< 0.05 vs. EVOO; d p< 0.05 vs. LN + EVOO; e p< 0.05 vs. ACE; f p< 0.05 vs. LN + ACE.
Foods 2021,10, 1993 8 of 18 3.3. PPARs Expression in Retina Layers Peroxisome proliferator-activated receptor (PPAR) γ and PPAR α expression and localization were quantified by Western blotting and by immunofluorescence. The hypertensive L-NAME group showed a significant (p< 0.05) decrease of both PPAR γ (36%) and PPAR α (42%) expression compared to the Control group (Figure 3A,B). Although normotensive animal groups fed ACE oil displayed upregulation of PPAR isoforms (1.6-fold), the LN + ACE group showed even higher overexpression of these receptors (2.4and 2-fold for PPAR γ and PPAR α , respectively). PPAR γ and PPAR α were also upregulated in EVOO (1.5and 1.3-fold, respectively) and in LN + EVOO (1.6and 1.5-fold, respectively) groups relative to normotensive animals. However, when comparing the global effects of ACE oil and EVOO, a significantly (p< 0.05) greater capacity to upregulate PPARs was observed in the former. Quantification of immunofluorescence signal of PPARs in the retinal layers yielded similar results to those obtained from Western blotting analysis (Figure 3C,D). As shown in Figure 3E, PPAR γ and PPAR α expression was localized at the ganglion cell layer (GCL), inner plexiform layer (IPL), outer plexiform layer (OPL), outer segments (OS) and retinal pigment epithelium/choroid (RPE/CH). Fluorescence signals dropped drastically for both PPAR γ (19%, 25%, 30%, 67% and 31% in RPE/CH, OS, OPL, IPL and GCL, respectively) and PPAR α (47%, 72%, 91%, 79% and 72% in the same respective layers) in retinal sections obtained from L-NAME-treated animals, in comparison with the Control group. Oil-supplemented groups displayed a clearly visible increase in the retinal expression of PPARs, with a more prominent effect in the case of ACE oil-fed hypertensive animals (PPAR γ : 1.5-, 1.3-, 4.6-, 3.2and 4.7-fold increase; PPAR α : 2.5-, 1.36.9-, 6.5and 7.4-fold increase in RPE/CH, OS, OPL, IPL and GCL, respectively, in comparison to Control group). In turn, upregulation of PPARs (relative to Control group) was only noted in some retinal layers in hypertensive mice fed EVOO (e.g., PPAR γ expression increased 3.6-, 2.3and 3.4-fold, and PPAR α increased 5.3-, 6.5and 2.44-fold, in OPL, IPL and GCL, respectively). Interestingly, PPAR α immunofluorescence signal was generally higher than that of PPAR γ in the different animal groups. In addition, PPAR γ seems to yield higher signals in GCL and OPL, whereas PPAR α signal was more abundant in IPL and OPL. Since the endothelial marker (anti-CD31) co-localized with PPAR immunofluorescence signals, these experiments confirmed the relevance of endothelial retinal cells in PPAR release. Figure 3. Cont.
Foods 2021,10, 1993 9 of 18 Figure 3. Cont.
Foods 2021,10, 1993 16 of 18 22. Merle, B.M.J.; Silver, R.E.; Rosner, B.; Seddon, J.M.; Mares, J.A.; Voland, R.P.; Sondel, S.A.; Millen, A.E.; LaRowe, T.; Moeller, S.M.; et al. Healthy lifestyles related to subsequent prevalence of age-related macular degeneration. Arch. Ophthalmol. 2011 ,129, 470–480. [CrossRef] 23. Cougnard-Grégoire, A.; Merle, B.M.J.; Rougier, J.F.K.M.B.; Delyfer, M.N.; Goff, M.L.; Samieri, C.; Dartigues, J.F.; Delcourt, C. Olive oil consumption and age-related macular degeneration: The alienor study. PLoS ONE 2016,11, e0160240. [CrossRef] 24. Zhu, L.; Liu, Z.; Feng, Z.; Hao, J.; Shen, W.; Li, X.; Sun, L.; Sharman, E.; Wang, Y.; Wertz, K.; et al. Hydroxytyrosol protects against oxidative damage by simultaneous activation of mitochondrial biogenesis and phase II detoxifying enzyme systems in retinal pigment epithelial cells. J. Nutr. Biochem. 2010,21, 1089–1098. [CrossRef] 25. Zou, X.; Feng, Z.; Li, Y.; Wang, Y.; Wertz, K.; Weber, P.; Fu, Y.; Liu, J. Stimulation of GSH synthesis to prevent oxidative stress-induced apoptosis by hydroxytyrosol in human retinal pigment epithelial cells: Activation of Nrf2 and JNK-p62/SQSTM1 pathways. J. Nutr. Biochem. 2012,23, 994–1006. [CrossRef] 26. González-Correa, J.A.; Rodríguez-Pérez, M.D.; Márquez-Estrada, L.; López-Villodres, J.A.; Reyes, J.J.; Rodriguez-Gutierrez, G.; Fernández-Bolaños, J.; De La Cruz, J.P. Neuroprotective Effect of Hydroxytyrosol in Experimental Diabetic Retinopathy: Relationship with Cardiovascular Biomarkers. J. Agric. Food Chem. 2018,66, 637–644. [CrossRef] 27. Benlarbi, M.; Jemai, H.; Hajri, K.; Mbarek, S.; Amri, E.; Jebbari, M.; Hammoun, I.; Baccouche, B.; Boudhrioua Mihoubi, N.; Zemmal, A.; et al. Neuroprotective effects of oleuropein on retina photoreceptors cells primary culture and olive leaf extract and oleuropein inhibitory effects on aldose reductase in a diabetic model: Meriones shawi. Arch. Physiol. Biochem. 2020 , 1–8. [CrossRef] 28. Agita, A.; Thaha, M.; Agita, A.; Alsagaff, M.T. Inflammation, Immunity, and Hypertension. Acta Med. Indones. 2017 ,49, 158–165. 29. Guzik, T.J.; Touyz, R.M. Oxidative stress, inflammation, and vascular aging in hypertension. Hypertension 2017 ,70, 660–667. [CrossRef] 30. Mehaffey, E.; Majid, D.S.A. Tumor necrosis factorα , kidney function, and hypertension. Am. J. Physiol.-Ren. Physiol. 2017 ,313, F1005–F1008. [CrossRef] 31. Pinheiro Júnior, J.E.G.; Moraes, P.Z.; Rodriguez, M.D.; Simões, M.R.; Cibin, F.; Pinton, S.; Barbosa Junior, F.; Peçanha, F.M.; Vassallo, D.V.; Miguel, M.; et al. Cadmium exposure activates NADPH oxidase, renin–angiotensin system and cyclooxygenase 2 pathways in arteries, inducing hypertension and vascular damage. Toxicol. Lett. 2020,333, 80–89. [CrossRef] 32. Tanase, D.M.; Gosav, E.M.; Radu, S.; Ouatu, A.; Rezus, C.; Ciocoiu, M.; Costea, C.F.; Floria, M. Arterial Hypertension and Interleukins: Potential Therapeutic Target or Future Diagnostic Marker? Int. J. Hypertens. 2019 ,2019, 3159283. [CrossRef] [PubMed] 33. McMaster, W.G.; Kirabo, A.; Madhur, M.S.; Harrison, D.G. Inflammation, Immunity, and Hypertensive End-Organ Damage. Circ. Res. 2015,116, 1022–1033. [CrossRef] 34. Formanowicz, D.; Rybarczyk, A.; Radom, M.; Formanowicz, P. A role of inflammation and immunity in essential hypertension— modeled and analyzed using Petri nets. Int. J. Mol. Sci. 2020,21, 3348. [CrossRef] [PubMed] 35. Wang, W.; Lo, A.C.Y. Diabetic retinopathy: Pathophysiology and treatments. Int. J. Mol. Sci. 2018 ,19, 1816. [CrossRef] [PubMed] 36. Baudouin, C.; Kolko, M.; Melik-Parsadaniantz, S.; Messmer, E.M. Inflammation in Glaucoma: From the back to the front of the eye, and beyond. Prog. Retin. Eye Res. 2020, 100916. [CrossRef] 37. Kauppinen, A.; Paterno, J.J.; Blasiak, J.; Salminen, A.; Kaarniranta, K. Inflammation and its role in age-related macular degeneration. Cell. Mol. Life Sci. 2016,73, 1765–1786. [CrossRef] [PubMed] 38. Coban, E.; Nizam, I.; Topal, C.; Akar, Y. The Association of Low-Grade Systemic Inflammation with Hypertensive Retinopathy. Clin. Exp. Hypertens. 2011,32, 528–531. [CrossRef] 39. Silva, K.C.; Pinto, C.C.; Biswas, S.K.; De Faria, J.B.L.; De Faria, J.M.L. Hypertension increases retinal inflammation in experimental diabetes: A possible mechanism for aggravation of diabetic retinopathy by hypertension. Curr. Eye Res. 2007 ,32, 533–541. [CrossRef] 40. Robles-Almazan, M.; Pulido-Moran, M.; Moreno-Fernandez, J.; Ramirez-Tortosa, C.; Rodriguez-Garcia, C.; Quiles, J.L.; RamirezTortosa, M. Hydroxytyrosol: Bioavailability, toxicity, and clinical applications. Food Res. Int. 2018,105, 654–667. [CrossRef] 41. Francisco, V.; Ruiz-Fernández, C.; Lahera, V.; Lago, F.; Pino, J.; Skaltsounis, L.; González-Gay, M.A.; Mobasheri, A.; Gómez, R.; Scotece, M.; et al. Natural Molecules for Healthy Lifestyles: Oleocanthal from Extra Virgin Olive Oil. J. Agric. Food Chem. 2019 ,67, 3845–3853. [CrossRef] 42. Kashyap, D.; Sharma, A.; Tuli, H.S.; Punia, S.; Sharma, A.K. Ursolic Acid and Oleanolic Acid: Pentacyclic Terpenoids with Promising Anti-Inflammatory Activities. Recent Pat. Inflamm. Allergy Drug Discov. 2016,10, 21–33. [CrossRef] 43. Bradford, M.M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 1976,72, 248–254. [CrossRef] 44. Santana-Garrido, Á.; Reyes-Goya, C.; André, H.; Aramburu, Ó.; Mate, A.; Vázquez, C.M. Sunitinib-induced oxidative imbalance and retinotoxic effects in rats. Life Sci. 2020,257, 118072. [CrossRef] 45. Whelton, P.K.; Carey, R.M.; Aronow, W.S.; Casey, D.E.; Collins, K.J.; Himmelfarb, C.D.; DePalma, S.M.; Gidding, S.; Jamerson, K.A.; Jones, D.W.; et al. 2017 ACC/AHA/AAPA/ABC/ACPM/AGS/APhA/ASH/ASPC/NMA/PCNA Guideline for the Prevention, Detection, Evaluation, and Management of High Blood Pressure in Adults: A Report of the American College of Cardiology/American Heart Association Task Force on Clinical Practice Guidelines. Hypertension 2018 ,71, e13–e115. [CrossRef]
Foods 2021,10, 1993 17 of 18 46. He, W.-S.; Zhu, H.; Chen, Z.-Y. Plant Sterols: Chemical and Enzymatic Structural Modifications and Effects on Their CholesterolLowering Activity. J. Agric. Food Chem. 2018,66, 3047–3062. [CrossRef] 47. Hernáez, A.; Farràs, M.; Fitó, M. Olive oil phenolic compounds and high-density lipoprotein function. Curr. Opin. Lipidol. 2016, 27, 47–53. [CrossRef] 48. Zarrouk, A.; Martine, L.; Grégoire, S.; Nury, T.; Meddeb, W.; Camus, E.; Badreddine, A.; Durand, P.; Namsi, A.; Yammine, A.; et al. Profile of Fatty Acids, Tocopherols, Phytosterols and Polyphenols in Mediterranean Oils (Argan Oils, Olive Oils, Milk Thistle Seed Oils and Nigella Seed Oil) and Evaluation of their Antioxidant and Cytoprotective Activities. Curr. Pharm. Des. 2019 ,25, 1791–1805. [CrossRef] 49. Saibandith, B.; Spencer, J.P.E.; Rowland, I.R.; Commane, D.M. Olive Polyphenols and the Metabolic Syndrome. Molecules 2017 ,22, 1082. [CrossRef] 50. Kelly, D.M.; Rothwell, P.M. Blood pressure and the brain: The neurology of hypertension. Pract. Neurol. 2020 ,20, 100–111. [CrossRef] 51. Sicard, P.; Acar, N.; Grégoire, S.; Lauzier, B.; Bron, A.M.; Creuzot-Garcher, C.; Bretillon, L.; Vergely, C.; Rochette, L. Influence of rosuvastatin on the NAD(P)H oxidase activity in the retina and electroretinographic response of spontaneously hypertensive rats. Br. J. Pharmacol. 2007,151, 979–986. [CrossRef] 52. Negretto, A.D.; Rosa, A.A.M.; Nakashima, A.A.; Ortega, K.C.; Mion Júnior, D.; Oyamada, M.K.; Nakashima, Y. Avaliação da retinopatia hipertensiva através do potencial oscilatório do eletrorretinograma. Arq. Bras. Oftalmol. 2008 ,71, 38–42. [CrossRef] [PubMed] 53. Santana-garrido, Á.; Reyes-goya, C.; Fernández-bobadilla, C.; Blanca, A.J.; Mate, A.; Vázquez, C.M. NADPH oxidase—Induced oxidative stress in the eyes of hypertensive rats. Mol. Vis. 2021,28, 161–178. 54. Akay, F.; Gundogan, F.C.; Yolcu, U.; Toyran, S.; Uzun, S. Choroidal thickness in systemic arterial hypertension. Eur. J. Ophthalmol. 2015,26, 152–157. [CrossRef] 55. Lim, H.B.; Lee, M.W.; Park, J.H.; Kim, K.; Jo, Y.J.; Kim, J.Y. Changes in Ganglion Cell–Inner Plexiform Layer Thickness and Retinal Microvasculature in Hypertension: An Optical Coherence Tomography Angiography Study. Am. J. Ophthalmol. 2019 ,199, 167–176. [CrossRef] 56. Machida, S.; Kondo, M.; Jamison, J.A.; Khan, N.W.; Kononen, L.T.; Sugawara, T.; Bush, R.A.; Sieving, P.A. P23H rhodopsin transgenic rat: Correlation of retinal function with histopathology. Investig. Ophthalmol. Vis. Sci. 2000,41, 3200–3209. 57. Hernandez-Quiles, M.; Broekema, M.F.; Kalkhoven, E. PPARgamma in Metabolism, Immunity, and Cancer: Unified and Diverse Mechanisms of Action. Front. Endocrinol. 2021,12, 624112. [CrossRef] 58. Doroshenko, E.R.; Drohomyrecky, P.C.; Gower, A.; Whetstone, H.; Cahill, L.S.; Ganguly, M.; Spring, S.; Yi, T.J.; Sled, J.G.; Dunn, S.E. Peroxisome Proliferator-Activated Receptorδ Deficiency in Microglia Results in Exacerbated Axonal Injury and Tissue Loss in Experimental Autoimmune Encephalomyelitis. Front. Immunol. 2021,12, 371. [CrossRef] 59. Shen, L.Q.; Child, A.; Weber, G.M.; Folkman, J.; Aiello, L.P. Rosiglitazone and delayed onset of proliferative diabetic retinopathy. Arch. Ophthalmol. 2008,126, 793–799. [CrossRef] 60. Ye, S.; Chen, Q.; Jiang, N.; Liang, X.; Li, J.; Zong, R.; Huang, C.; Qiu, Y.; Ma, J.X.; Liu, Z. PPAR α -dependent effects of palmitoylethanolamide against retinal neovascularization and fibrosis. Investig. Ophthalmol. Vis. Sci. 2020,61, 15. [CrossRef] 61. Joharapurkar, A.; Patel, V.; Kshirsagar, S.; Patel, M.S.; Savsani, H.; Jain, M. Effect of dual PPARα / γ agonist saroglitazar on diabetic retinopathy and oxygen-induced retinopathy. Eur. J. Pharmacol. 2021,899, 174032. [CrossRef] [PubMed] 62. Hu, Y.; Chen, Y.; Ding, L.; He, X.; Takahashi, Y.; Gao, Y.; Shen, W.; Cheng, R.; Chen, Q.; Qi, X.; et al. Pathogenic role of diabetes-induced PPARα down-regulation in microvascular dysfunction. Proc. Natl. Acad. Sci. USA 2013 ,110, 15401–15406. [CrossRef] [PubMed] 63. Kotlinowski, J.; Jozkowicz, A. PPAR Gamma and Angiogenesis: Endothelial Cells Perspective. J. Diabetes Res. 2016 ,2016, 8492353. [CrossRef] [PubMed] 64. Farràs, M.; Valls, R.M.; Fernández-Castillejo, S.; Giralt, M.; Solà, R.; Subirana, I.; Motilva, M.J.; Konstantinidou, V.; Covas, M.I.; Fitó, M. Olive oil polyphenols enhance the expression of cholesterol efflux related genes in vivo in humans. A randomized controlled trial. J. Nutr. Biochem. 2013,24, 1334–1339. [CrossRef] [PubMed] 65. Medeiros-De-Moraes, I.M.; Gonçalves-De-Albuquerque, C.F.; Kurz, A.R.M.; De Jesus Oliveira, F.M.; Pereira de Abreu, V.H.; Torres, R.C.; Carvalho, V.F.; Estato, V.; Bozza, P.T.; Sperandio, M.; et al. Omega-9 oleic acid, the main compound of olive oil, mitigates inflammation during experimental sepsis. Oxid. Med. Cell. Longev. 2018,2018, 6053492. [CrossRef] 66. Connor, K.M.; SanGiovanni, J.P.; Lofqvist, C.; Aderman, C.M.; Chen, J.; Higuchi, A.; Hong, S.; Pravda, E.A.; Majchrzak, S.; Carper, D.; et al. Omega-3 Reduces Pathological Retinal Angiogenesis. Nat. Med. 2007,13, 868–873. [CrossRef] 67. Rossino, M.G.; Casini, G. Nutraceuticals for the treatment of diabetic retinopathy. Nutrients 2019,11, 771. [CrossRef] 68. Pang, K.L.; Chin, K.Y. The biological activities of oleocanthal from a molecular perspective. Nutrients 2018,10, 570. [CrossRef] 69. Scotece, M.; Conde, J.; Abella, V.; López, V.; Francisco, V.; Ruiz, C.; Campos, V.; Lago, F.; Gomez, R.; Pino, J.; et al. Oleocanthal Inhibits Catabolic and Inflammatory Mediators in LPS-Activated Human Primary Osteoarthritis (OA) Chondrocytes Through MAPKs/NF-κB Pathways. Cell. Physiol. Biochem. 2018,49, 2414–2426. [CrossRef] 70. Bao, J.; Yan, W.; Xu, K.; Chen, M.; Chen, Z.; Ran, J.; Xiong, Y.; Wu, L. Oleanolic Acid Decreases IL-1 β -Induced Activation of Fibroblast-Like Synoviocytes via the SIRT3-NFκ B Axis in Osteoarthritis. Oxid. Med. Cell. Longev. 2020 ,2020, 7517219. [CrossRef]
Foods 2021,10, 1993 18 of 18 71. Castellano, J.M.; Garcia-Rodriguez, S.; Espinosa, J.M.; Millan-Linares, M.C.; Rada, M.; Perona, J.S. Oleanolic acid exerts a neuroprotective effect against microglial cell activation by modulating cytokine release and antioxidant defense systems. Biomolecules 2019,9, 683. [CrossRef] 72. Chen, Y.L.; Yan, D.Y.; Wu, C.Y.; Xuan, J.W.; Jin, C.Q.; Hu, X.L.; Bao, G.D.; Bian, Y.J.; Hu, Z.C.; Shen, Z.H.; et al. Maslinic acid prevents IL-1 β -induced inflammatory response in osteoarthritis via PI3K/AKT/NFκ B pathways. J. Cell. Physiol. 2021 ,236, 1939–1949. [CrossRef] 73. Lee, W.; Kim, J.; Park, E.K.; Bae, J.S. Maslinic acid ameliorates inflammation via the downregulation of NFκ B and STAT-1. Antioxidants 2020,9, 106. [CrossRef] 74. Da Silva Ferreira, D.; Esperandim, V.R.; Toldo, M.P.A.; Kuehn, C.C.; Do Prado Júnior, J.C.; Cunha, W.R.; Silva, M.L.A.e.; Albuquerque, S.d. In vivo activity of ursolic and oleanolic acids during the acute phase of Trypanosoma cruzi infection. Exp. Parasitol. 2013,134, 455–459. [CrossRef] 75. Giner, E.; Recio, M.C.; Ríos, J.L.; Giner, R.M. Oleuropein protects against dextran sodium sulfate-induced chronic colitis in mice. J. Nat. Prod. 2013,76, 1113–1120. [CrossRef] 76. Patti, A.M.; Carruba, G.; Cicero, A.F.G.; Banach, M.; Nikolic, D.; Giglio, R.V.; Terranova, A.; Soresi, M.; Giannitrapani, L.; Montalto, G.; et al. Daily use of extra virgin olive oil with high oleocanthal concentration reduced body weight, waist circumference, alanine transaminase, inflammatory cytokines and hepatic steatosis in subjects with the metabolic syndrome: A 2-month intervention study. Metabolites 2020,10, 392. [CrossRef]