Streptococcus pneumoniae: a plethora of temperate bacteriophages with a role in host genome rearrangement

Streptococcus pneumoniae: a Plethora of Temperate Bacteriophages With a Role in Host Genome Rearrangement Antonio J. Martı ´n-Galiano 1 and Ernesto Garcı ´a 2,3 * 1 Intrahospital Infections Laboratory, National Centre for Microbiology, Instituto de Salud Carlos III (ISCIII), Majadahonda, Spain, 2 Departamento de Biotecnologı ´a Microbiana y de Plantas, Centro de Investigaciones Biolo ´gicas Margarita Salas (CSIC), Madrid, Spain, 3 Centro de Investigación Biomédica en Red de Enfermedades Respiratorias (CIBERES), Madrid, Spain Bacteriophages (phages) are viruses that infect bacteria. They are the most abundant biological entity on Earth (current estimates suggest there to be perhaps 10 31 particles) and are found nearly everywhere. Temperate phages can integrate into the chromosome of their host, and prophages have been found in abundance in sequenced bacterial genomes. Prophages may modulate the virulence of their host in different ways, e.g., by the secretion of phage-encoded toxins or by mediating bacterial infectivity. Some 70% of Streptococcus pneumoniae (the pneumococcus)—a frequent cause of otitis media, pneumonia, bacteremia and meningitis—isolates harbor one or more prophages. In the present study, over 4000 S. pneumoniae genomes were examined for the presence of prophages, and nearly 90% were found to contain at least one prophage, either defective (47%) or present in full (43%). More than 7000 complete putative integrases, either of the tyrosine (6243) or serine (957) families, and 1210 full-sized endolysins (among them 1180 enzymes corresponding to 318 amino acid-long N-acetylmuramoyl-L-alanine amidases [LytA PPH ]) were found. Based on their integration site, 26 different pneumococcal prophage groups were documented. Prophages coding for tRNAs, putative virulence factors and different methyltransferases were also detected. The members of one group of diverse prophages (PPH090) were found to integrate into the 3’end of the host lytA Spn gene encoding the major S. pneumoniae autolysin without disrupting it. The great similarity of the lytA Spn and lytA PPH genes (85–92% identity) allowed them to recombine, via an apparent integrase-independent mechanism, to produce different DNA rearrangements within the pneumococcal chromosome. This study provides a complete dataset that can be used to further analyze pneumococcal prophages, their evolutionary relationships, and their role in the pathogenesis of pneumococcal disease. Keywords: Streptococcus pneumoniae, prophage, integrase, endolysin, lytic enzymes, tRNAs, virulence factors, genomic rearrangements Frontiers in Cellular and Infection Microbiology | www.frontiersin.org November 2021 | Volume 11 | Article 7754021 Edited by: Xueqing Wu, Zhejiang University, China Reviewed by: Jeremy Brown, University College London, United Kingdom Jorge Moura de Sousa, Institut Pasteur, France Yujiro Hirose, Osaka University, Japan *Correspondence: Ernesto Garcı ´a [email protected] Specialty section: This article was submitted to Molecular Bacterial Pathogenesis, a section of the journal Frontiers in Cellular and Infection Microbiology Received: 13 September 2021 Accepted: 29 October 2021 Published: 18 November 2021 Citation: Martı ´n-Galiano AJ and Garcı ´a E (2021) Streptococcus pneumoniae: a Plethora of Temperate Bacteriophages With a Role in Host Genome Rearrangement. Front. Cell. Infect. Microbiol. 11:775402. doi: 10.3389/fcimb.2021.775402 ORIGINAL RESEARCH published: 18 November 2021 doi: 10.3389/fcimb.2021.775402 INTRODUCTION Bacteriophages (phages) are viruses that infect bacteria. They are the most abundant biological entities on Earth —current estimates suggest there to be close to 10 31 phage particles (Mushegian, 2020)—and can be found nearly everywhere. Temperate bacteriophages infect and kill bacteria to release phage progeny, but on occasion they may integrate into the host genome via site‐specific recombination events, and replicate vertically. Integrated phages are stably maintained in the chromosome (i.e., as a prophage) in a state known as lysogeny (Lwoff, 1953). Campbell (1962) was the first to propose a model for the integration of lprophage into the bacterial chromosome. This model consists of two phases: (1) the circularization of the linear phage DNA molecule injected into the cell, and (2) the linear insertion of the phage DNA into the bacterial chromosome via the activity of a specific integrase (Int) that catalyzes the sitespecific recombination of the phage attachment site (attP) and bacterial attachment site (attB). These two sequences generally share a short stretch of identical bases (the core sequence) where this site-specific recombination occurs. After recombination, the phage genome is left integrated into the bacterial chromosome, flanked by two duplicated hybrid att sites: attL and attR. Under certain circumstances (prophage induction), the prophage becomes excised from the bacterial chromosome and viral replication begins via the lytic cycle. Endolysins are phage-encoded enzymes capable of hydrolyzing the bacterial cell wall; they are synthesized at the end of the lytic cycle to allow the release of phage progeny. In this era of global increase in antibacterial resistance, endolysins are being tested as an alternative (or complement) to the use of antibiotics (for recent reviews see Vazquez et al., 2018;Fernandez et al., 2021;Murray et al., 2021). It is well documented that, while integrated into the host genome, genes encoding Ints and endolysins are located at either end of Streptococcus prophages (Canchaya et al., 2003). Prophages are often found in sequenced bacterial genomes. Indeed, nearly half of bacterial genomes appear to contain at least one prophage. The minimum doubling time is the trait most strongly correlated with lysogeny, followed by genome size and, interestingly, pathogenicity (Touchon et al., 2016). Streptococcus pneumoniae (the pneumococcus) is a major human pathogen and a frequent cause of non-invasive diseases such as otitis, conjunctivitis and pneumonia, but also lifethreatening invasive sepsis, bacteremic pneumonia, and meningitis. Pneumococcal pneumonia ranks first in terms of associated mortality among all lower respiratory tract diseases, and is responsible for more than one million deaths every year (GBD 2016 Lower Respiratory Infections Collaborators, 2018). That prophages may contribute to bacterial virulence is well established, particularly in Pseudomonas aeruginosa, Salmonella enterica, Escherichia coli, Vibrio cholerae, Staphylococcus spp., and Clostridium spp. (Schroven et al., 2021). Prophages can alter the phenotype of their hosts at different levels, e.g., by causing them to secrete toxins, by modifying the bacterial envelope, and/ or impacting bacterial infectivity and bacterial cell regulation. High-throughput next generation sequencing techniques have now provided numerous de novo sequenced and assembled bacterial genomes, and over 8000 pneumococcal genomes are currently included in the NCBI Reference Sequence Database (RefSeq) database. However, while first reported in 1977 and suggested to be widespread (Bernheimer, 1977;Ramirez et al., 1999), pneumococcal prophages (PPHs) have remained relatively unexamined —that is until recently (Garcıa et al., 2005). Based on comparisons of complete prophages and their predicted encoded proteins, PPHs have been grouped into three major groups with only a small number of prophages falling outside these classes (Romero et al., 2009a;Romero et al., 2009b). More recently, pairwise comparisons of prophage sequences showed four major prophage clusters and one single prophage (Brueggemann et al., 2017). Phages belonging to the same phylogenetic group share high sequence similarity in their packaging, morphology, and lysis modules, and are typically associated with one or two main integrase types. Besides, incomplete pneumococcal prophages can be highly conserved over long periods of time and clustered into five major groups that differed from those of intact PPHs (Rezaei Javan et al., 2019). In 2017, a pan-genome-wide association study identified PPHs as being associated with reduced pneumococcal carriage duration, although this was attributed more to the disruption caused by the integration of the phage genome and the genetic transformation competence system than to any property of the prophage itself (Lees et al., 2017). Other data have shown that a role for prophages in pneumococcal virulence and patient mortality is linked to PblA and/or PblB, two prophageencoded proteins known to be involved in enhanced platelet activation together with higher formation of platelet-monocyte complexes (Tunjungputri et al., 2017). Prophages may naturally enter the lytic cycle, or be induced to do so via exposure to fluoroquinolones (Lopez et al., 2014)(withaconcomitant increase in PblA/PblB expression). A recent study involving patients with invasive pneumococcal disease determined that the 30-day mortality of pneumococcal meningitis was 11% in pblB-positive patients compared to <1% in pblB-negative patients, although the authors recognize that this finding does not prove causality (Cremers et al., 2019). It has also recently been suggested that incomplete PPHs and certain prophage genes may be involved in pneumococcal pathogenesis (Rezaei Javan et al., 2019). In addition, transcriptomic analyses have shown that a defective PPH may serve as a switch that controls the expression of a bacterial gene (ychF) located immediately downstream of the prophage int gene that is involved in nasopharyngeal colonization (Chen et al., 2019). A review is Abbreviations: aa, amino acid(s); CHAP, a cysteine, histidine-dependent amidohydrolase/peptidase domain; csRNA, cia-dependent small RNA; GPSCs, Global Pneumococcal Sequence Clusters; Int, integrase; IS, insertion sequence; lytA Spn , gene coding for the major pneumococcal autolysin; lytA PPH , phage gene encoding a NAM-amidase of the Amidase_2 family; NAM-amidase, Nacetylmuramoyl-L-alanine amidase; NCBI, National Center for Biotechnology Information; Mtase, DNA methyltransferase; NT, non-typeable; PMEN, Pneumococcal Molecular Epidemiology Network; PPH, pneumococcal prophage; RefSeq, NCBI Reference Sequence Dabatase; R-M, restrictionmodification; ST, sequence type. Martı ´n-Galiano and Garcı ´a Pneumococcal Prophages and Chromosomal Reorganization Frontiers in Cellular and Infection Microbiology | www.frontiersin.org November 2021 | Volume 11 | Article 7754022 available on the recent advances in the genomic and functional characterization of pneumococcal temperate phages, and their contribution to pneumococcal pathogenesis and genome evolution (Garriss and Henriques-Normark, 2020). In the present study, the genomic sequences of over 4000 S. pneumoniae isolates from diverse lineages were examined to obtain the broadest possible picture of PPH diversity. The precise integration sites and the att core sequences of most of them were elucidated and used to identify the families to which a number of previously reported but incompletely studied PPHs belong. In addition, recombination between prophage and host lytA genes isshowntobeanimportantsource of chromosomal rearrangement in S. pneumoniae. MATERIALS AND METHODS Compilation of the Pneumococcal Genome Dataset This study was performed using a dataset mined from the National Center for Biotechnology Information (NCBI) database (available at https://www.ncbi.nlm.nih.gov/genome/? term=Streptococcus+pneumoniae). The latter contains wholegenome sequences (assembled or otherwise) for more than 8500 pneumococcal genomes (last accessed January 30, 2021). Sequence types (STs) (Enright and Spratt, 1998;Jolley et al., 2018) of the strains included in the dataset were determined on the basis of whole genome sequencing data (Larsen et al., 2012). Search for Pneumococcal Prophages To detect PPHs, the dataset was searched, using the BLAST platform (Johnson et al., 2008), for homologs of int-and lytA PPH -like genes encoding (respectively) Ints and endolysins [with respect to the latter, only N-acetylmuramoyl-L-alanine amidases (NAM-amidases; EC 3.5.1.28) of the Amidase_2 family (Pfam database identifier: PF01510) (Morales et al., 2010) are currently known]. The corresponding genes/proteins of previously characterized PPHs, such as MM1 (Obregon et al., 2003a), фSpn_OXC, фSpn_6, and фSpn_18 (Romero et al., 2009a), and others (Càmara et al., 2018). The endolysins encoded by various virulent pneumococcal phages (see below) were used as query sequences. The original and newly found genes/proteins with a coverage ≥90% and ≥50% identity were used in searches in an iterative manner. Bioinformatic Analyses Sequence comparison and alignments were performed using the BLAST platform and/or Clustal Omega package (Sievers and Higgins, 2021) running at the European Bioinformatics Institute (EMBL-EBI) website (https://www.ebi.ac.uk). Potential tRNAs genes were identified using ARAGORN (Laslett and Canback, 2004)andtRNAscan-SE(Schattner et al., 2005)software. Detections were recorded only when both programs coincided in the results returned. The codon usage of S. pneumoniae D39 was obtained from the corresponding database (Nakamura et al., 2000). Protein domains were preliminarily identified using CDD/SPARCLE (Lu et al., 2020). PHASTER (running at https://phaster.ca/) was also employed to identify phagehomologous regions in bacterial genomes (Arndt et al., 2016). To ascertain equivalent detection of protein datasets, open reading frames were identified and translated from prophage sequences using Prodigal v2.6.3 (Hyatt et al., 2010). Prophage proteomes were then compared all against all through the calculation of the weighted gene repertoire relatedness (wGRR) (Pfeifer et al., 2021). Best bi-directional hits were found from hits detected by the ‘easy-search’workflow of MMseqs2 (Mirdita et al., 2019) with e-value < 10 −4 , identity ≥35%, coverage ≥50% thresholds. Agglomerative hierarchical clustering from the resulting wGRR matrix was carried out by the linkage tool of the scipy.cluster.hierarchy python library using the ‘ward’ method on euclidean distances. RESULTS Temperate Bacteriophages Are Abundant in S. pneumoniae The dataset produced contained 4003 strains, including 126 whose genomes were sequenced to complete or near-complete (chromosome) assembly level and deposited in the RefSeq database (O'Leary et al., 2016) (last accessed, October 11, 2020) (labeled in green in Table S1). The strains included in the dataset represent 447 different STs. Moreover, up to 50% of the strains belonged to one of 35 (out of a possible 43) Pneumococcal Molecular Epidemiology Network (PMEN) clones [including single and double locus variants (McGee et al., 2001)]. PMEN clones are resistant to one or more antibiotics in wide clinical use and dominate the population of antibiotic-resistant pneumococci. Globally susceptible clones known to be important in disease are also included in the PMEN clone dataset (https://www.pneumogen.net/pmen/, last accessed September 15, 2020). Further, 2557 strains in the dataset were assigned to one of the 169 Global Pneumococcal Sequence Clusters (GPSCs) and, among these strains, 1096 could be classified as belonging to one of the 35 dominant GPSCs (Gladstone et al., 2019). From a total of 46 serogroups (numbered 1–48) described to date (numbers 26 and 30 are not in use) (Lund and Henrichsen, 1978), 3573 strains belonged to one of 40 serogroups. In addition, the dataset included 4 nonencapsulated laboratory mutants and 426 non-typeable (NT) isolates (Table S1). In agreement with data reported in previous studies (Ramirez et al., 1999;Brueggemann et al., 2017), PPHs were seen to be widely distributed across different S. pneumoniae isolates. Indeed, only 434 strains in the dataset (10.8%) (highlighted with a red background in Table S1)appearedtolack temperate phages. In addition, among the 126 RefSeq strains with complete (or near complete) genomes (see above), only 26 (20.6%) lacked any discernible prophage. On the basis of their Ints, more than 7000 putative PPHs (including putatively fulllength and partial prophage sequences) were found in the dataset. Visual inspection of bacterial genes flanking the Martı ´n-Galiano and Garcı ´a Pneumococcal Prophages and Chromosomal Reorganization Frontiers in Cellular and Infection Microbiology | www.frontiersin.org November 2021 | Volume 11 | Article 7754023 prophages revealed up to 26 different integration sites (Table 1). PPHs were clustered into 26 groups [named from PPH005 to PPH130 (in steps of 5)] according to their purported insertion sites, and arranged in order using the genome of the nonlysogenic S. pneumoniae D39 (Acc. No. NC_008533.2) as a reference. It is worth noting that many more complete Ints (7234) than endolysins (1210) could be identified. In addition, the proportion of partial sequences was much higher for the endolysin genes than the Ints genes. Thus, 42% of the endolysins were found incomplete (887 incomplete out of 2097 total proteins), whereas only 7% of the Ints were apparently incomplete or partly deleted (548 out of a total of 7782) (Table 1). This might be because endolysin-coding genes are among those known to be difficult to assemble from short read data due to the presence of choline-binding motif clusters (Croucher et al., 2017). In sharp contrast to the moderate number of endolysins compared to Ints in the current dataset, the number of different PPH endolysin alleles (362) was similar to that of the Int alleles (293). This strongly suggests that the PPH endolysin-coding gene shows great genetic variability. Nevertheless, 11 PPH groups, namely005,020,025,030,045,055,060,070,095,110,and115, appeared to completely lack an endolysin gene and thus were understood to represent incomplete (or defective) prophages. Taking into account the number of full Ints, these incomplete prophages correspond to nearly half (47%) of the total PPHs. PPH Integrases On the basis of amino acid (aa) sequence similarities and catalytic residues, site-specific Ints (recombinases) can be classified into two major families: the tyrosine or serine families (Groth and Calos, 2004). These have different structures and functional mechanisms indicating that they have evolved separately. Thus, serine Ints are usually larger than tyrosine Ints, and the aa residues important for catalysis and structure, as well as their locations, can be very different. For example, the N-terminal domain of tyrosine Ints is involved in binding the arm-type sites of attP and the C-terminal domains involved in catalysis, whereas in serine Ints the opposite is true (Groth and Calos, 2004;Van Duyne and Rutherford, 2013). TABLE 1 | Number and distribution of integrases and endolysins in the pneumococcal prophages (PPHs) analyzed. PPH group Integrases Endolysins No. a Alleles (No.) Size (aa) Identity (%) Incomplete No. Alleles (No.) Size (aa) Incomplete 005 1090 (21) 34 388 >86.5 196 010 938 (35) 35 382 >95.8 21 286 86 318 102 015 486 (25) 30 380 >96.8 265 60 32 318 457 020 40 (4) 3 388 >58.6 b 0 025 1 (1) 1 388 –0 030 1151 (25) 17 388 >95.8 52 035 1 (1) 1 382 –0 1 1 318 0 040 1 (1) 1 375 –0 1 1 318 0 045 674 (10) 16 406 >70.0 c 1 050 1 (1) 1 375 –0 1 1 318 0 055 121 (3) 6 388 >98.9 4 060 5 (2) 2 405 >99.5 0 065 20 (3) 3 380 >99.4 0 22 d 1 314 0 070 170 (11) 5 387 >98.7 0 075 1 (1) 1 375 –0 1 1 318 0 080 1376 (22) 61 375 >96.7 7 586 165 318 180 1 e 1 288 0 085 70 (3) 8 475 >99.1 0 10 9 318 13 090 34 (5) 18 375−481 >17.3 2 6 5 318 4 095 4 (1) 1 388 –0 100 885 (5) 56 481 >94.3 1 220 71 318 131 105 6 (1) 4 381 >95.7 0 6 d 4 334 0 110 47 (1) 3 388 >99.4 0 115 109 (4) 7 388 >98.1 1 120 1 (1) 1 479 –01 f 1 328 0 125 1 (1) 1 475 –0 7 5 318 0 130 1 (1) 1 382 –0 1 1 318 0 (316) (385) Total 7234 (189) 293 g 548 1210 362 h 887 a Figures in parentheses correspond to the number of integrases found in 100 complete genomes (176) and 13 contigs of different isolates (13). b Alleles WP_001866856 and WP_033705527 are 99.7% identical. c Amino acid identity reached >89.1% when allele WP_050271463 was excluded from alignments. d Lysozyme (= muramidase; EC 3.2.1.17) of the Glyco_hydro_25 (PF01183) family instead of NAM-amidase. e Putative NAM-amidase, but with a cysteine, histidine-dependent amidohydrolase/peptidase (CHAP; PF05257) domain. f Putative NAM-amidase but with a divergent Amidase_2 domain. g Due to allele redundancy between different PPH groups, the actual number of Int alleles is 293 rather than 315. h Corresponds to different prophage-encoded endolysins (357 NAM-amidases plus 5 muramidases). Martı ´n-Galiano and Garcı ´a Pneumococcal Prophages and Chromosomal Reorganization Frontiers in Cellular and Infection Microbiology | www.frontiersin.org November 2021 | Volume 11 | Article 7754024 Table S2 shows the complete catalog of the Ints found in this study. Excluding the prophages of the PPH090 group, which will be analyzedseparately,onlythreeIntswerefoundinmore than one PPH group. These corresponded to the most frequent type of each group, i.e., WP_00876735 (in PPH010 and PPH130), WP_00266847 (in PPH040, PPH075, and PPH080), and WP_000704678 (in PPH055, PPH095, and PPH110). This observation agrees with the common idea that strong (albeit not absolute) specificity exists between prophage Ints and attB/attP sequences. For example, it has long been recognized that Int-mediated recombination occurs between attP of phage land the secondary attachment sites in the host genome, although the frequency is low (Shimada et al., 1975). In the present work, sequence identities between Ints were usually >90% within each PPH group. The PPHs contained either tyrosine or serine Ints,althoughPPHswithtyrosineIntswere6.5timesmorecommon (6243) than the latter (957) in the dataset (the Ints of PPH090 were not taken into account) (Table 2). Serine Ints (groups PPH085, PPH100, PPH120, and PPH125) were much more similar to each other than were the tyrosine Ints (Table 3). Among the tyrosine Ints, those from groups PPH010/PPH130 and PPH035 diverged greatly from the rest. PPH Endolysins Endolysins encoded by virulent (lytic) phages infecting S. pneumoniae have been extensively reviewed (Lopez and Garcıa, 2004;Garcıa et al., 2005;Galan-Bartual et al., 2015;Maestro and Sanz, 2016;Vazquez et al., 2018). Briefly, three biochemically and structurally different peptidoglycan hydrolases of phage origin have been described so far. Two of them are choline-binding proteins: the NAM-amidase Pal (YP_004306947; 296 aa), with an Amidase_5 domain (PF05382), and the Cpl-1 lysozyme (=muramidase) (NP_044837; 339 aa) with a Glyco_hydro_25 (PF01183) domain. Both enzymes contain a C-terminal cell wallbinding domain composed of six choline-binding repeats (Choline_bind_1; PF01473). Cpl-7 (YP_009623604; 342 aa) is a choline-independent muramidase that differs from Cpl-1 in the C-terminal domain responsible for peptidoglycan binding (CW_7 repeats; PF08230). Pal is encoded by phage Dp-1, whereas Cpl-1 and Cpl-7 are the endolysins of phages Cp-1 and Cp-7, respectively. The endolysin from a recently isolated virulent podovirus very similar to Cp-1 (SOCP) (Ouennane et al., 2015) (NP_044837; 339 aa), is a muramidase 100% identical to Cpl-1. Similarly, the NAM-amidase (AQY55407; 295 aa) of the MS1 pneumococcal siphovirus (Kot et al., 2017;Silva et al., 2020) is 81% identical (89% similar) to Pal. Taking into account that only a few virulent S. pneumoniaeinfecting phages have been currently isolated, the diversity of their endolysins contrasts with the lytic enzymes encoded by PPHs. The latter are 318 aa-long, belong to the Amidase_2 family (PF01510) of NAM-amidases, and contain six Choline_bind_1 TABLE 2 | Active site residues of PPH tyrosine and serine recombinases a . Name (amino acid residues) Amino acid residue and position Tyrosine integrases b lInt (356) R212 D215 K235 H308 R311 H333 Y342 PPH005 (388) R220 E223 K255 H315 R318 H353 Y363 PPH010/PPH130 (382) R212 D215 K252 H327 R330 H353 Y362 PPH015 (380) R218 E221 K255 H324 R327 H350 Y360 PPH020 (388) R223 E226 K258 H330 R333 H356 Y366 PPH025 (388) R220 E223 K255 H327 R330 H353 Y363 PPH030 (388) R223 E226 K258 H330 R333 H356 Y366 PPH035 (382) R220 D223 K252 H327 R330 H353 Y362 PPH040/PPH075/PPH080 (375) R211 E214 K247 H320 R323 H346 Y356 PPH045 (406) R234 E237 K269 H349 R352 H375 Y384 PPH050 (375) R211 E214 K247 H320 R323 H346 Y356 PPH055/PPH095/PPH110 (388) R220 E223 K255 H327 R330 H353 Y363 PPH060 (405) R234 E237 K269 H349 R352 H375 Y384 PPH065 (380) R217 E219 K249 H326 R329 H352 Y362 PPH070 (387) R222 E235 K257 H329 R332 H355 Y365 PPH105 (381) R208 E211 K246 H323 R326 H349 Y359 PPH115 (388) R220 E223 K255 H327 R330 H353 Y363 Serine integrases c TP901-1 Int (485) Y8 R10 S12 Q26 V41 D47 R57 P58 D73 V77 D81 R82 L83 R85 G119 E133 PPH085 (475) Y10 R12 S14 Q28 I43 D49 R59 P60 D75 V79 D83 R84 L85 R87 G121 E135 PPH100 (481) Y10 R12 S14 Q28 V43 D49 R59 P60 D75 V79 D83 R84 L85 R87 G121 E135 PPH120 (479) Y7 R9 S11 Q25 I40 D46 R56 P57 N72 V76 K80 R81 L82 R84 G118 D132 PPH125 (475) Y10 R12 S14 Q28 I43 D49 R59 P60 D75 V79 D83 R84 L85 R87 G121 E135 a PPH090 integrases were not included. b The active site residues of the phage lintegrase (lInt; Acc. No. P03700) have been previously described (Gibb et al., 2010). The catalytic nucleophile, Tyr342, is boldface. The accession numbers for the other tyrosine integrases studied here are: PPH005, WP_000704676; PPH010/PPH130, WP_000876735; PPH015, WP_000266841; PPH020, WP_033705527; PPH025, WP_000704686; PPH030, WP_000704664; PPH035, WP_000876736; PPH040/PPH075/PPH080, WP_000266847; PPH045, WP_000219075; PPH050, WP_061816163; PPH055/PPH095/PPH110, WP_000704678; PPH060, WP_001863308; PPH065, WP_000266851; PPH070, WP_001021836; PPH105, WP_054368747; and PPH115, WP_001866671. c The active site residues of the Lactococcus lactis phage TP901-1 integrase (TP901-1 Int; Acc. No. CAA59475) have been previously described (Yuan et al., 2008). The catalytic nucleophile, Ser12, is boldface. The accession numbers for the other serine integrases studied are: PPH085, WP_050199652; PPH100, WP_024478469; PPH120, WP_130892475; and PPH125, WP_023396450. Martı ´n-Galiano and Garcı ´a Pneumococcal Prophages and Chromosomal Reorganization Frontiers in Cellular and Infection Microbiology | www.frontiersin.org November 2021 | Volume 11 | Article 7754025 repeats in the C-terminal domain (Morales et al., 2010;Morales et al., 2015). Remarkably, in addition to having the same length (957 bp), the known phage genes coding for these endolysins (lytA PPH ) are closely related (85–92% identity) to lytA Spn , which encodes the major pneumococcal autolysin —also a NAMamidase of the Amidase_2 family (Morales et al., 2010). LytA Spn is a well-known virulence factor that plays a role(s) during different steps of infection (Canvin et al., 1995;RamosSevillano et al., 2015;Ramos-Sevillano et al., 2016;Corsini et al., 2021). Taking into account the strong similarities between bacterial and phage NAM-amidases, the latter may also be important in pneumococcal pathogenesis. The current notion of an exclusive presence for lytA-like genes among PPHs could not be fully confirmed in the present study. As already mentioned, 1210 full-length endolysins were identified in the dataset (Table 1 and Table S3). Among those, 29 proteins (≈2.5%) did not correspond to NAM-amidases of the Amidase_2 family. There were 28 proteins homologous to the Cpl-1 lysozyme, with one containing a cysteine, histidinedependent amidohydrolase/peptidase (CHAP) domain (PF05257) instead of an Amidase_2 domain at the N-terminal moiety. The lysozymes were endolysins of PPH065 (22 identical proteins; WP_000739159) and PPH105 (6 proteins; 4 alleles: WP_054365577, WP_054368721, WP_054380492, and WP_054392100), which are 314 aaand 334 aa-long respectively. Notably, all strains harboring PPH065 are members of GPSC19 and have serotype 22F (the only exception is strain 2245STDY6178828 which belongs to serotype 42) (see below). The main differences between Cpl-1 and the PPH lysozymes detected in the present study are located in the linker region connecting the Nand the C-terminal domains. Thus, in Cpl-1, the linker (189-DDEEDDKPKTA-199) (Hermoso et al., 2003)is longer than (and different to) that of the newly discovered endolysins (188-DDEEAKAK-195). Moreover, WP_000739159 lacks the fourth Choline_bind_1 repeat that forms part of the Cterminal domain of the enzyme, and which is responsible for binding the enzyme to the cell wall. A detailed analysis of other PPHs (156 additional genomes, either complete or not) revealed four additional examples of 334 aa-long Cpl-1 homologs, specifically those encoded by prophages IPP16, IPP25, IPP27, and by a nameless prophage harbored by S. pneumoniae strain R34-3131 (Table S4). The latter prophage (which belongs to the PPH105 family) was already present in the dataset (Table S1). The CHAP domain-containing endolysin (WP_057595562; 288 aa) found in the genome of S. pneumoniae strain SMRU392 (serotype 35F) is encoded by one of the PPH080 group of phages, and is identical to that of prophage 33888. The sequence of the latter was recently reported in an independent study (van Tonder et al., 2019)(Table S4). Since the host strain of prophage 33888 was the same as in the present study (SMRU392), and the Ints were also identical (WP_ 050256063), both prophages are probably the same. The WP_057595562 PPH endolysin is 63% identical (77% similar) to Skl, a proven NAM-amidase (WP_033686260; 288 aa) of an unnamed temperate phage of Streptococcus mitis SK137 (Llull et al., 2006). The complete genomic sequence of, presumably, the same S. mitis prophage (now designated as Javan331; MK448732) has recently been reported (Rezaei Javan et al., 2019). Remarkably, the existence of putative CHAP-endolysins encoded by those prophages was not mentioned in any study from other laboratories. Among the 1181 endolysins with a predicted Amidase_2 domain, the presence of one atypical protein was noted. This protein (WP_130892444; PPH120) is a 328 aa-long, putative NAM-amidase with a divergent Amidase_2 domain. It is an endolysin encoded by the 36.7 kb-long prophage inserted into TABLE 3 | Sequence similarities among tyrosine and serine integrases of PPHs a . Integrases 2 3 45678910111213141516 PPH group Tyrosine integrases 005 (1) WP_000704676 −7−26 −145 ≤−180 −143 −7−21 −11 −21 ≤−180 −7−14 −122 −55 ≤−180 010/130 (2) WP_000876735 −6−5−4−3≤−180 −3−6−3−4−10 −4−2−12 −5 015 (3) WP_000266841 −30 −25 −27 −5−112 −9−110 −25 −8−65 −17 −26 −25 020 (4) WP_033705527 −146 ≤−180 −4−21 −16 −20 −146 −13 −18 −154 −56 −148 025 (5) WP_000704686 −144 −4−21 −11 −21 ≤−180 −6−14 −123 −57 ≤−180 030 (6) WP_000704664 −3−25 −13 −24 −144 −12 −18 −151 −54 −146 035 (7) WP_000876736 −2−6−2−4−10 −4NS−12 −5 040/075/080 (8) WP_000266847 −12 ≤−180 −21 −12 −63 −60 −31 −22 045 (9) WP_000219075 −11 −11 ≤−180 −9−20 −24 −10 050 (10) WP_061816163 −21 −12 −61 −19 −31 −22 055/095/110 (11) WP_000704678 −6−14 −123 −57 ≤−180 060 (12) WP_001863308 −9−16 −24 −6 065 (13) WP_000266851 −18 −17 −21 070 (14) WP_001021836 −50 −120 105 (15) WP_054368747 −56 115 (16) WP_001866671 Serine integrases 085 (1) WP_050199652 ≤−170 −146 ≤−180 100 (2) WP_024478469 −179 −171 120 (3) WP_130892475 −148 125 (4) WP_023396450 a Figures correspond to Log 10 Evalues calculated by pairwise alignments. NS, not significant. Martı ´n-Galiano and Garcı ´a Pneumococcal Prophages and Chromosomal Reorganization Frontiers in Cellular and Infection Microbiology | www.frontiersin.org November 2021 | Volume 11 | Article 7754026 PPH010_4, giving rise to PPH120 (see below). Searches for proteins very similar (≥87% identity) to WP_13089244 revealed several endolysins of the same length encoded by prophages of three members of the Mitis group streptococci, i.e., Streptococcus pseudopneumoniae, S. mitis, and Streptococcus oralis. Specifically, these prophages are 277_SPSE, 289_SPSE, and 380_SPSE (WP_049511163) from S. pseudopneumoniae (Roach et al., 2015), S. mitis strains SK564 (WP_000238871) (Kilian et al., 2014) and DD22 (WP_061864892) (Denapaite et al., 2016), S. oralis U-o11 (Javan367; QBX17588) (Rezaei Javan et al., 2019), and S. oralis subsp. tigurinus 859 (WP_084868230) (Diene et al., 2016). Sequence alignments also revealed the variant domain of WP_130892444 to be remarkably similar to that of the Amidase_2 domain of LysGH15, the endolysin encoded by a myovirus phage (GH15) that infects Staphylococcus aureus (Gu et al., 2011). This lysin possesses a modular structure containing an N-terminal CHAP domain, a central Amidase_2 domain, and a C-terminal SH3_5 (PF08460) bacterial-binding domain. Elucidation of the crystal structure of the Amidase_2 domain of LysGH15 (Gu et al., 2014) revealed the aa residues involved in Zn 2+ binding (H214, H324, and C332), catalysis (E282, and T330), as well as other important residues (W263, and N75), to be conserved in WP_130892444 at comparable positions (Figure S1). In sharp contrast, some of the equivalent residues in the NAM-amidase of S. pneumoniae TIGR4 (Mellroth et al., 2014;Li et al., 2015)—namely H26 and D149, as zinc ligands, and the catalytic residue H147—differed from those of WP_130892444 (and LysGH15) but were fully conserved among the widespread 318 aa-long NAM-amidases (Figure S1). Insights Into the PPH Genomes and Identification of Their Attachment Sites Only four att core sequences for PPHs were reported in studies published up until 2009 (Gindreau et al., 2000;Obregon et al., 2003b;Romero et al., 2009a), and additional core sequences have only been seldom reported in more recent papers (Càmara et al., 2018;Garriss and Henriques-Normark, 2020). To the best of our knowledge, only seven different attB core sequences have been previously described (Table S5). Remarkably, genome examination of many PPHs currently deposited in public databases (131 out of 158; last accessed, January 30, 2021) allow for no precise identification of the attP core site because most of the reported phage genomes only include the DNA region running from the first nucleotide of the int gene to the last one of the endolysin-coding gene (even though the definition was that of ‘complete genome’). Further, they lack the corresponding intermediate sequence where attP ought to be located (Table S4). To gain insight into the sequences and locations of the integration sites of the PPHs described in the present study, a detailed analysis of all the PPHs harbored by 126 strains with near complete (chromosome assembly level) genomes was performed. The strains included in this subset represent 88 different STs, 27 PMEN clones, 66 GPSCs, and 27 different serotypes. In addition, the dataset included one nonencapsulated laboratory mutant and four NT isolates (Table S6). As mentioned above, 100 out of 126 strains (79.4%) were lysogenic and fulfilled the above assembly requirements in the original dataset. Fifty one isolates harbored only one PPH per genome whereas 49 were polylysogenic, and one of them (strain GPSC72) contained up to five different prophages (Table S6). Taking advantage of previously determined locations of int genes, the genomes of these strains were examined in detail and the sequences corresponding to the attL and attR sites of 176 prophages belonging to 20 different PPH groups recorded. The sequences and locations for the remaining six groups (PPH035, PPH065, PPH090, PPH095, PPH105, and PPH110) were estimated using the partial genomes (either at the contig or scaffold assembly level) of nine additional strains included in the dataset. Prophage genomes were defined as the DNA sequence running from the first nucleotide of attL to the last one preceding attR. The attL sequences (obviously identical or near identical to their corresponding attR within each PPH group) were used as queries to map the corresponding attB sites on the S. pneumoniae D39 genome (Table 4). With the exception of PPH130, the core sequence of 24 different attB could be determined. As mentioned above, seven of them had been already reported, namely, PPH005, PPH010, PPH015, PPH035, PPH080, PPH085, and PPH100 (compare the data of Table 4 with those of Table S5). With the exception of PPH075, PPH125 and PPH130, in which attB sites appear to be located inside insertion sequences (ISs), the precise chromosomal location of the different attB sites could be established. Although many PPH insertion sites are located in intergenic spaces (something typical among prophages), six core attachment sites mapped within the 3’region of genes annotated for the D39 genome, and included the termination codon (TAA) of the gene where the prophage was integrated (Table 4). In addition, attB PPH035 was found to partially overlap (but apparently not interrupt) the 3’part of ccnB encoding csRNA2, one of the five small non-coding csRNAs (ciadependent small RNAs) that form part of the two-component regulatory system CiaRH (Sinha et al., 2019). It should be underlined that ccnB is not annotated for the S. pneumoniae D39 genome. On the contrary, seven prophage groups potentially interrupt gene translation: 1) the core integration site of PPH010 viruses (attB PPH010 ), previously reported to lie between SPD_RS00115 and SPD_RS00120 (Romero et al., 2009a) but actually located in ccnC coding for csRNA3 (Furi et al., 2019); 2) PPH015, which integrates into SPD_RS00125 encoding the signal recognition particle sRNA involved in membrane protein targeting (Steinberg et al., 2018); 3) PPH040, which integrates into SPD_RS01460, potentially encoding an intramembrane metalloprotease of the CAAX proteases and bacteriocin-processing enzymes (CPBP) family (Pei et al., 2011); 4) PPH050, inserted into SPD_RS01935 encoding a frameshifted choline-binding protein (CbpG) in D39 (Frolet et al., 2010); 5) a gene (SPD_RS09795) encoding UlaR [a transcriptional activator of the ula operon in the presence of ascorbic acid (Afzal et al., 2015)], which may be inactivated by the insertion of bacteriophages of the PPH095 group; 6) PPH100, which integrates into SPD_RS09885 encoding Martı ´n-Galiano and Garcı ´a Pneumococcal Prophages and Chromosomal Reorganization Frontiers in Cellular and Infection Microbiology | www.frontiersin.org November 2021 | Volume 11 | Article 7754027 ComGC, the major subunit of the competence pilus (Laurenceau et al., 2015); 7) and bacteriophages of the PPH120 group, which disrupt SPD_RS10405, i.e., the gene encoding for the PcpA choline-binding protein (Sanchez-Beato et al., 1998) (now an important component of several new protein-based, pneumococcal vaccines currently under evaluation) (Masomian et al., 2020). Table S6 attempts to organize the different PPHs in a manner that takes into account their wide genetic diversity. For this, a concept of ‘equivalent PPH genomes’was followed, i.e., genomes that overlapped for ≥90% of their total length and showed ≥90% sequence identity were considered ‘equivalent’, and only one of them was used in further comparisons. Figure S2 shows a comparison of the different PPH genomes. PPH095 and PPH110 are not depicted since, although they inserted into two different attBs, these PPHs were equivalent to PPH055 (see below). Due to the evident sequence variability of prophage genomes, pairwise nucleotide alignments were TABLE 4 | Localization of attB sites for S. pneumoniae temperate prophage integration. Prophage attB (5’!3’) a Flanking locus tags (SPD_RS) (Product) PPH005 2935 TTAGCACTTTATCCCTTTTTGTGTTA 2960 00015 (DUF951 family protein)/00020 (redox-regulated ATPase YchF) PPH010 24016 CTTTTTCATAATAATCTCCCT 24036 b 00115 (adenylosuccinate synthase/00120 (nucleoside deaminase) PPH015 24694 TTGTGTGCTCTTTTTTTCGTGC 24715 00125 (signal recognition particle sRNA small type) PPH020 86374 TACAACAAAATGTTGTAATATTT 86396 00445 (30S ribosomal protein S4) PPH025 163831 ATTCCTTTACAA 163842 00880 (response regulator transcription factor)/00885 (hypothetical protein) PPH030 179128 ATTATACTACAAAATCGGCCTTTT 179151 00970 (magnesium transporter CorA family protein)/00975 (excinuclease ABC subunit UvrA) PPH035 231378 CTTTTTCATAATAATCTCCCT TAACTCCACCCAATCAGGTGGAGTTTTTT AGCTCTATTTCAGGCTTTTGGGGACTATTCTAAAAATA ATTTTTCGATATTTTTCGGTATTTTTCGGATTTTGGT CGGGGAATTGGCGGGGACTTTTT 231525 c 01305 (GNAT family N-acetyltransferase)/01310 (type I toxin-antitoxin system Fst family toxin) PPH040 267293 GGTCTTTTTACTTGCCG 267309 01460 (CPBP family intramembrane metalloprotease) PPH045 273279 GTAAAGCATCACAATTTAGTAAACGTTAAT 273308 01495 (30S ribosomal protein S9) PPH050 358211 AGTCAAGAACTATTT 358225 01935 (choline-binding protein CbpG; frameshifted) PPH055 619559 CATATTATTTTGAAAT 619574 03210 (DUF3165 family protein)/03215 (lactococcin 972 family bacteriocin) PPH060 693388 AACCAGATCTTAAGAAAGCTCGTAAAG 693414 d 03620 (hypothetical protein)/03630 (hypothetical protein) PPH065 1006452 CTCTTAAAGACGCTGTTAAATAAT 1006475 05350 (HU family DNA-binding protein) PPH070 1027141 TACAACCTTAAAAAATAA 1027158 05425 (phosphopyruvate hydratase) PPH075 ATGCCGATGAATTATAA Prophage located 3’of SPD_RS06250 (cyclically-permuted mutarotase family protein) PPH080 1415148 TTATAATTCATCCGC 1415162 07415 (DNA-binding protein WhiA) PPH085 1712415 TTCCTCCTACTTATCTATTCGTAG 1712438 09110 (single-stranded DNA-binding protein)/09115 (SDR family NAD(P)- dependent oxidoreductase) PPH090 1729602 TTATTTTACTGTAATCAAGCCATCTGGCTCTACTGTGAATTCTGGC 1729647 09250 (N-acetylmuramoyl-L-alanine amidase family protein) PPH095 1826920 CATTACGAAATATATT 1826935 09795 (transcription anti-terminator) PPH100 1841058 ACCAACATCTCCACCAA 1841074 09885 (comG operon protein ComGC) PPH105 1849319 TATGGTATAA 1849328 d 09920 (tRNA guanosine(34) transglycosylase Tgt)/09925 (DUF975 family protein) PPH110 1901612 ATAA 1901615 e 10215 (methyltransferase domain-containing protein)/10225 (membrane protein) PPH115 1911323 ACTTGAAATAAAGCGCATTTCTCTATA 1911349 10255 (sugar ABC transporter permease)/10265 (DUF1189 domaincontaining protein) PPH120 1933870 ATTCGTTTAAGTAATACCATAAACCTTTGTCTTTAACCCAACCAGTAGCCA 1933920 f 10405 (Choline-binding protein PcpA) PPH125 ATGTTATTTCTCTCGTTACAAATTACAACCTTAAAAAATAA Prophage located 3’of SPD_RS10665 (tRNA dihydrouridine synthase DusB). The predicted attB forms part of ISSpn5 (IS1380 family). PPH130 Not known Prophage located 5’of SPD_RS10885 encoding a transposase. a The coordinates correspond to those in the S. pneumoniae D39 genome (NC_008533.2). This strain was recently renamed ‘D39W’(Sinha et al., 2019) and showed some differences to another cultivar of the same strain (D39V) (Slager et al., 2018). Termination codons (TAA) are bold and underlined. b This attB is located inside the ccnC gene (23,967−24,065) encoding a small non-coding csRNA (cia-dependent small RNA) named csRNA3 (Sinha et al., 2019). This gene is not annotated for the pneumococcal D39 genome. Two additional potential attB sequences are present in the S. pneumoniae D39 genome, i.e., between SPD_RS01305 and SPD_RS01310 (231,378–231,398) (see shadowed sequence in PPH035), and between SPD_RS01320 and SPD_RS01325 (233,750–233,770). c The shadowed sequence is identical to that of attB PPH010 . The part of the sequence overlapping the 3’end of the ccnB gene (231,331–231,427) coding for csRNA1 (Sinha et al., 2019), is underlined. This gene is not annotated for the pneumococcal D39 genome. d Another potential attB sequence (273,258-AACCAGgTCTTAAGAAAGCTCGTAAAG-273,284) is present in the S. pneumoniae D39 genome, i.e., inside the SPD_RS01495 gene, encoding the 30S ribosomal protein S9. e Identical sequences are present at many other positions. f Seven additional potential attB sequences are present in this gene. Martı ´n-Galiano and Garcı ´a Pneumococcal Prophages and Chromosomal Reorganization Frontiers in Cellular and Infection Microbiology | www.frontiersin.org November 2021 | Volume 11 | Article 7754028 initially performed only among PPHs of the same group. Several main conclusions were then drawn: 1) int genes were present in every prophage found, but this was not the case for endolysincoding genes; 2) two major PPH groups were recognized, one with genome lengths ranging from ≈10–20 kb on one side (e.g., PPH005 and PPH030 groups), and the other from ≈35–45 kb on the other side (e.g., PPH010 and PPH080 groups); 3) major differences can still be seen among the members of a PPH group (e.g., PPH015, PPH020, PPH045 and PPH090 show large differences); 5) several PPHs with genomes of 51–92 kb appear to result from recombination events between two different prophages, e.g., i) PPH075 is the result of the insertion of an unknown defective prophage (12,227 bp) into a PPH085_5 equivalent. This defective prophage is flanked by a 33 bp-long sequence (5’-CCCTAGACTTGAAATAAAGCGCATTTCT CTATA-3’) located at positions 32,873–32,905 and 45,100– 45,132 of the PPH075 genome; a near-identical sequence (1,911,317-TCCTAGACTTGAAATAAAGCGCATTTCT CTATA-1,911,349) may contain part of the promoter region of SPD_RS10265 (malA) in the D39 genome (Nieto et al., 1997); ii) PPH080_11 appears to result from the integration of a PPH010like prophage into a PPH080_3 equivalent; as expected, the insertion of the PPH010-like phage occurs in the sequence 5’- CTTTTTCATAATAATCTCCCT-3’at positions 2069–2089 and 32,251–32,271 of the PPH080_11 genome; iii) the insertion and rearrangement of a PPH010_4-equivalent into a previously unknown prophage gives rise to PPH120, possibly with the assistance of two ISs (ISSpn5 and IS1167) and the addition of a gene cluster encoding several tRNAs. Sequence comparison revealed this prophage to be very similar (82–85% query coverage and >95% nucleotidesequenceidentity)totwo Streptococcus anginosus prophages, namely Javan83 (Rezaei Javan et al., 2019)andSA01(van der Kamp et al., 2020); interestingly, the latter two prophages appear to harbor no tRNA genes. In addition, both encode an endolysin 76% identical (88% similar) to Cpl-7 (see above), whereas, as already discussed, the new component of PPH120 codes for a peculiar 328 aa-long NAM-amidase of the Amidase_2 family of proteins; iv) a tandem insertion of two near identical PPHs (PPH080_1A and PPH080_1B) gives rise to the 92 kb-long hybrid prophage PPH080_1AB. Among the various prophage identification tools, we used the PHASTER program to analyze the 109 genomes included in Table S6 (186 PPH). Up to 263 putative PPHs were predicted; 40 of them were designated as ‘intact’by the program and actually corresponded to real prophages (Table S6). The predicted limits of the PPHs did match the real coordinates in only few cases (e.g., PPH030 from strain SP64 was almost correctly located (real: 177,043–189,925; predicted: 177,043–189,926). Unfortunately, in most instances, this was not the case. For example, in strain GPSC47 (NZ_LR216060), PPH010_9 is located between coordinates 3152 and 36,649 whereas PHASTER predicted the range 1771–42,683). Of note, the existence of PPHs of the groups 010, 015, 080, and 110 was well predicted, whereas that of those belonging to groups 020, 045 and 115 were not (Table S7). In our hands, the sensitivity of PHASTER (0.74) was similar to that previously reported (Lopes de Sousa et al., 2018;Reis-Cunha et al., 2019). Pairwise nucleotide alignments were then performed among genomes belonging to different PPH groups. In addition to equivalent PPHs (see above), a second level of similarity was allowed, i.e., those prophages with an overlap of between 80 and 89% of their genomes and showing nucleotide identities of ≥90%. Figure 1A shows ‘equivalent’and ‘very similar’genomes on white or gray backgrounds respectively. It should be underlined that equivalent prophages were distributed between different PPH groups. Thus, in addition to the equivalency between the defective prophages PPH055, PPH095, PPH110 and PPH115_2 partly mentioned above, other equivalent, putatively complete prophages of different groups were seen: 1) PPH010_2, PPH035 and PPH130; 2) PPH015_1, PPH080_8 and PPH090_3; and 3) PPH040 and PPH080_3. As expected, most of the ‘very similar’ category of prophages corresponded to different members of the same group, as exemplified by members of the PPH010 group such as PPH010_7–PPH010_10 and PPH010_12–PPH010_14 (Figure 1A). Pairwise comparison of 80 PPH sequences and a dendrogram depicted seven major prophage clusters, and three singletons (Figure 1B). Four of the clusters matched those described by Brueggemann et al. (2017) and one more to the defective prophages mentioned by Rezaei Javan et al. (2019) that were recognized as separate entities from full-length PPHs. The remaining PPHs (either clustered or not) correspond to previously undescribed prophages. Other Features of Pneumococcal Prophages Many prophages from both Gram-negative and Gram-positive bacteria integrate into tRNA genes (Williams, 2002) although this is not the case for PPHs (see above). Nevertheless, sequence analysis revealed the presence of potential tRNA genes in some PPH genomes (Table S8). Of note, PPH120 has nine tRNA genes located at the right end of the prophage, whereas other PPHs have these genes located closer to the middle. A search of PPH genomes reported elsewhere revealed that five previously sequenced phages (namely, IP8, IP16, IP25, IP26, and IP27) also harbor a tRNA-Ser gene, a feature not mentioned in previous reports (Table S8). PblB may be an important virulence determinant in some PPHs. PblB has been described as a phage minor tail protein (a putative anti-receptor) that behaves as an adhesin mediating the galactose-specific adhesion activity of pneumococci to platelets and human lung epithelial cells in vitro. It is also required for nasopharyngeal and lung colonization in a mouse model of infection (Hsieh et al., 2015). The sequence diversity of PblB is notable (Brueggemann et al., 2017). Amino acid sequence alignments in the PPH dataset fully confirmed this (as shown diagramatically in Figure S3), even among PPHs of the same group (e.g., in PPH010_7, in which the length of PblB was 2134 aa in strain GPSC97 but 3256 aa in GPSC25). It is also reported that the PblB encoded by the temperate phage SM1 infecting S. mitis (1062 aa) (Bensing et al., 2001) is very different to the protein (P15; 1987 aa) previously analyzed in the S. pneumoniae Martı ´n-Galiano and Garcı ´a Pneumococcal Prophages and Chromosomal Reorganization Frontiers in Cellular and Infection Microbiology | www.frontiersin.org November 2021 | Volume 11 | Article 7754029 Most S. pneumoniae isolates express either the DpnI or DpnII R-M system, although a DpnIII system has also been reported (Eutsey et al., 2015). Interestingly, the virulent pneumophage Cp-1 cannot be restricted in S. pneumoniae because it does not contain the corresponding target sequence (5’-GATC-3’)initsgenome(Martın et al., 1996). The virulent pneumophage Dp-1 probably defends against host-induced DNA restriction by incorporating modified bases into it (Garcıa et al., 2005). This is consistent with a more recent report showing that resistance to Dp-1 in S. pneumoniae results from mutations in a single gene (SPD_RS05930) coding for a type IV restriction endonuclease (Leprohon et al., 2015). It is noteworthy that type IV restriction systems differ from other types in that the Mtase and endonuclease activities are combined inasingleenzymethatrequiresbasemodification to act (Loenen and Raleigh, 2014). A phase-variable type I R-M system has also been identified in various strains of S. pneumoniae.Thissystem operates as an epigenetic switch that regulates gene expression, virulence, and phase variation (opaque versus transparent phenotype) in pneumococci (Li and Zhang, 2019). Moreover, the importance that phase-variable type I R-M systems have in the multifunctional defense against prophage SpSL1 infection in S. pneumoniae has been demonstrated (Furi et al., 2019). The present study provides clear evidence of recombination events between pneumococcal and phage lytA homologs. Recombination is apparently independent of the phage Int and is facilitated by the noticeable sequence similarity between the phage and host genes (≥85% identity). Although uncommon, a similar process has been reported to occur between the thyP3 and the thyA genes encoding the thymidylate synthase of the temperate bacteriophage j3T and that of the Bacillus subtilis host (Tucker, 1969;Stroynowski, 1981;Stout et al., 1998;Fox et al., 1999). In this case,the nucleotide sequenceidentity reaches96%(Kennyetal.,1985; FIGURE 6 | Diagram of the region located immediately downstream of the termination codon of lytA Spn * in 14 pneumococcal strains with differently rearranged genomes. The region corresponds to that indicated with a gray square in Figure 4. DNA regions sharing ≥95% nucleotide identity are shown with the same color and shadowing. The type of arrangement (A to E) is indicated in parentheses to the right of the name of each strain. The different core attachment sites are shown as diamonds. The deep blue rectangles represent the conserved 51 bp-long sequence mentioned in the text. The red rectangles correspond to the reverse complement of positions 24037–24121 of the S. pneumoniae D39 genome (between SPD_RS00120 encoding a nucleoside deaminase and SPD_RS00115 coding for an adenylosuccinate synthase). The purple rectangle corresponds to positions 1,712,485–1,712,386 (between SPD_RS09110 and SPD_RS09115 in the D39 chromosome). For additional information see Tables S6 and S8. At the bottom, the nucleotide sequence surrounding the initiation codon of SPD_RS09110 in strains D39 and SMRU1319 (arrangement D2) is shown. The correct initiation codon is shown in red, bold font, and underlined. Another in-frame initiation codon is not underlined and apparently lacks a potential ribosome-binding site (RBS) (Acc. No. CRIC01000015). The predicted RBS of SPD_RS09110 is shown in pink lettering. The 14 bp-long repeat potentially responsible for a chromosomal inversion in strain SMRU1319 is inserted in a gray box. The att core sequence of PPH085 is underlined. Martı ´n-Galiano and Garcı ´a Pneumococcal Prophages and Chromosomal Reorganization Frontiers in Cellular and Infection Microbiology | www.frontiersin.org November 2021 | Volume 11 | Article 77540216 Tam and Borriss, 1995). Unfortunately, whether recombination between the B. subtilis and the phage j3T genes also causes genome rearrangements, as is the case of the PPH090 group, is unknown. The present results provide a comprehensive view of the lysogenic state ofphagesin S.pneumoniae. As in most phage genomes currently under study, the majority of the PPH genes play uncharacterized roles. There is increasing evidence that although bacteriophages do not infect eukaryotic cells, they do interact with innate immune cells via Toll-like receptors (which appears to be particularly true for temperate bacteriophages) (Cieslik et al., 2021;Podlacha et al., 2021; Popescu et al., 2021), but the phage components involved in this are virtually unknown. Finally, the consequences of genome rearrangements involving lytA genes in bacteria and phage physiology deserve to be further studied. AUTHOR’S NOTE This work is dedicated to our mentor and friend, Concepcion Ronda, who fostered the research on pneumococcal bacteriophages in our laboratory. DATA AVAILABILITY STATEMENT The original contributions presented in the study are included in the article/Supplementary Material. Further inquiries can be directed to the corresponding author. AUTHORS CONTRIBUTIONS EG designed the study. AM-G and EG conducted the analyses and wrote the article. All authors contributed to the article and approved the submitted version. ACKNOWLEDGMENTS The help of Carmen Ascaso, who granted the infrastructure and peaceful environment required for this study to be completed, is greatly acknowledged. We thank P. Garcıa (CIB, CSIC) for carefully revising the article and suggestions. This research was supported by grants MPY 509/19 from the Instituto de Salud Carlos III (ISCIII) and SAF2017-88664-R from the Spanish Ministerio de Economı a, Industria y Competitividad (MEICOM). The Centro de Investigacion Biomedica en Red de Enfermedades Respiratorias (CIBERES) is an initiative of the Instituto de Salud Carlos III (ISCIII). AM-G is the recipient of a Miguel Servet contract by the ISCIII. SUPPLEMENTARY MATERIAL The Supplementary Material for this article can be found online at: https://www.frontiersin.org/articles/10.3389/fcimb.2021. 775402/full#supplementary-material REFERENCES Achaz, G., Coissac, E., Netter, P., and Rocha, E. P. C. (2003). Associations Between Inverted Repeats and the Structural Evolution of Bacterial Genomes. Genetics 164, 1279–1289. doi: 10.1093/genetics/164.4.1279 Afzal, M., Shafeeq, S., Henriques-Normark, B., and Kuipers, O. P. (2015). UlaR Activates Expression of the Ula Operon in Streptococcus Pneumoniae in the Presence of Ascorbic Acid. Microbiology 161, 41–49. doi: 10.1099/ mic.0.083899-0 Andam, C. P., Worby, C. J., Gierke, R., McGee, L., Pilishvili, T., and Hanage, W. P. (2017). Penicillin Resistance of Nonvaccine Type Pneumococcus Before and After PCV13 Introduction, United States. Emerg. Infect. Dis. 23, 1012–1015. doi: 10.3201/eid2306.161331 Arndt, D., Grant, J. R., Marcu, A., Sajed, T., Pon, A., Liang, Y., et al (2016). PHASTER: A Better, Faster Version of the PHAST Phage Search Tool. Nucleic Acids Res. 44, W16–W21. doi: 10.1093/nar/gkw387 Bailly-Bechet, M., Vergassola, M., and Rocha, E. (2007). Causes for the Intriguing Presence of tRNAs in Phages. Genome Res. 17, 1486–1495. doi: 10.1101/ gr.6649807 Bensing, B. A., Siboo, I. R., and Sullam, P. M. (2001). Proteins PblA and PblB of Streptococcus Mitis, Which Promote Binding to Human Platelets, are Encoded Within a Lysogenic Bacteriophage. Infect. Immun. 69, 6186–6192. doi: 10.1128/IAI.69.10.6186-6192.2001 Bernheimer, H. P. (1977). Lysogeny in Pneumococci Freshly Isolated From Man. Science 195, 66–68. doi: 10.1126/science.12565 Bikard, D., Hatoum-Aslan, A., Mucida, D., and Marraffini, L. A. (2012). CRISPR Interference can Prevent Natural Transformation and Virulence Acquisition During In Vivo Bacterial Infection. Cell Host Microbe 12, 177–186. doi: 10.1016/j.chom.2012.06.003 Billington, S. J., Johnston, J. L., and Rood, J. I. (1996). Virulence Regions and Virulence Factors of the Ovine Footrot Pathogen, Dichelobacter Nodosus. FEMS Microbiol. Lett. 145, 147–156. doi: 10.1111/j.1574-6968.1996.tb08570.x Bobay, L.-M., Touchon, M., and Rocha, E. P. C. (2014). Pervasive Domestication of Defective Prophages by Bacteria. Proc. Natl. Acad. Sci. U.S.A. 111, 12127– 12132. doi: 10.1073/pnas.1405336111 Brantl, S., and Brückner, R. (2014). Small Regulatory RNAs From Low-GC GramPositive Bacteria. RNA Biol. 11, 443–456. doi: 10.4161/rna.28036 Brueggemann, A. B., Harrold, C. L., Javan, R. R., van Tonder, A. J., McDonnell, A. J., and Edwards, B. A. (2017). Pneumococcal Prophages are Diverse, But Not Without Structure or History. Sci. Rep. 7, 42976. doi: 10.1038/srep42976 Càmara, J., Cubero, M., Martın-Galiano, A. J., Garcıa, E., Grau, I., Nielsen, J. B., et al (2018). Evolution of the b-Lactam-Resistant Streptococcus Pneumoniae PMEN3 Clone Over a 30-Year Period in Barcelona, Spain. J. Antimicrob. Chemother. 73, 2941–2951. doi: 10.1093/jac/dky305 Campbell, A. M. (1962). Episomes. Adv. Genet. 11, 101–145. doi: 10.1016/S00652660(08)60286-2 Canchaya, C., Fournous, G., and Brüssow, H. (2004). The Impact of Prophages on Bacterial Chromosomes. Mol. Microbiol. 53, 9–18. doi: 10.1111/j.13652958.2004.04113.x Canchaya, C., Proux, C., Fournous, G., Bruttin, A., and Brüssow, H. (2003). Prophage Genomics. Microbiol. Mol. Biol. Rev. 67, 238–276. doi: 10.1128/ mmbr.67.2.238-276.2003 Canvin, J. R., Marvin, A. P., Sivakumaran, M., Paton, J. C., Boulnois, G. J., Andrew, P. W., et al (1995). The Role of Pneumolysin and Autolysin in the Pathology of Pneumonia and Septicemia in Mice Infected With a Type 2 Pneumococcus. J. Infect. Dis. 172, 119–123. doi: 10.1093/infdis/172.1.119 Carrolo, M., Frias, M. J., Pinto, F. R., Melo-Cristino, J., and Ramirez, M. (2010). Prophage Spontaneous Activation Promotes DNA Release Enhancing Biofilm Martı ´n-Galiano and Garcı ´a Pneumococcal Prophages and Chromosomal Reorganization Frontiers in Cellular and Infection Microbiology | www.frontiersin.org November 2021 | Volume 11 | Article 77540217 Formation in Streptococcus Pneumoniae.PLoS One 5, e15678. doi: 10.1371/ journal.pone.0015678 Casjens, S. (2003). Prophages and Bacterial Genomics: What Have We Learned So Far? Mol. Microbiol. 49, 277–300. doi: 10.1046/j.1365-2958.2003.03580.x Chen, H.-J., Chang, Y.-C., Tsai, J.-C., Hung, W.-C., Lin, Y.-T., You, S.-J., et al (2013). New Structure of Phage-Related Islands Carrying fusB and a Virulence Gene in Fusidic Acid-Resistant Staphylococcus Epidermidis.Antimicrob. Agents Chemother. 57, 5737–5739. doi: 10.1128/AAC.01433-13 Chen, Y.-Y., Wang, J.-T., Lin, T.-L., Gong, Y.-N., Li, T.-H., Huang, Y.-Y., et al (2019). Prophage Excision in Streptococcus Pneumoniae Serotype 19A ST320 Promote Colonization: Insight Into its Evolution From the Ancestral Clone Taiwan 19F-14 (ST236). Front. Microbiol. 10, 205. doi: 10.3389/ fmicb.2019.00205 Cieslik, M., Baginska, N., Jonczyk-Matysiak, E., Węgrzyn, A., Węgrzyn, G., and Gorski, A. (2021). Temperate Bacteriophages—The Powerful Indirect Modulators of Eukaryotic Cells and Immune Functions. Viruses 13, 1013. doi: 10.3390/v13061013 Corsini, B., Aguinagalde, L., Ruiz, S., Domenech, M., and Yuste, J. (2021). Vaccination With LytA, LytC, or Pce of Streptococcus Pneumoniae Protects Against Sepsis by Inducing IgGs That Activate the Complement System. Vaccines 9, 186. doi: 10.3390/vaccines9020186 Cremers, A. J. H., Mobegi, F. M., van der Gaast-de Jongh, C., van Weert, M., van Opzeeland, F. J., Vehkala, M., et al (2019). The Contribution of Genetic Variation of Streptococcus Pneumoniae to the Clinical Manifestation of Invasive Pneumococcal Disease. Clin. Infect. Dis. 68, 61–69. doi: 10.1093/cid/ciy417 Croucher, N. J., Campo, J. J., Leb, T. Q., Liang, X., Bentley, S. D., Hanage, W. P., et al (2017). Diverse Evolutionary Patterns of Pneumococcal Antigens Identified by Pangenome-Wide Immunological Screening. Proc. Natl. Acad. Sci. U.S.A. 114, E357–E366. doi: 10.1073/pnas.1613937114 Croucher, N. J., Hanage, W. P., Harris, S. R., McGee, L., van der Linden, M., de Lencastre, H., et al (2014). Variable Recombination Dynamics During the Emergence, Transmission and 'Disarming' of a Multidrug-Resistant Pneumococcal Clone. BMC Biol. 12, 49. doi: 10.1186/1741-7007-12-49 Croucher, N. J., Harris, S. R., Fraser, C., Quail, M. A., Burton, J., van der Linden, M., et al (2011). Rapid Pneumococcal Evolution in Response to Clinical Interventions. Science 331, 430–434. doi: 10.1126/science.1198545 Croucher, N. J., Mostowy, R., Wymant, C., Turner, P., Bentley, S. D., and Fraser, C. (2016). Horizontal DNA Transfer Mechanisms of Bacteria as Weapons of Intragenomic Conflict. PLoS Biol. 14, e1002394. doi: 10.1371/ journal.pbio.1002394 Delesalle, V. A., Tanke, N. T., Vill, A. C., and Krukonis, G. P. (2016). Testing Hypotheses for the Presence of tRNA Genes in Mycobacteriophage Genomes. Bacteriophage 6, e1219441. doi: 10.1080/21597081.2016.1219441 Denapaite, D., Rieger, M., Köndgen, S., Brückner, R., Ochigava, I., Kappeler, P., et al (2016). Highly Variable Streptococcus Oralis Strains are Common Among Viridans Streptococci Isolated From Primates. mSphere 1, e00041–e00015. doi: 10.1128/mSphere.00041-15 Dıaz, E., and Garcıa, J. L. (1990). Characterization of the Transcription Unit Encoding the Major Pneumococcal Autolysin. Gene 90, 157–162. doi: 10.1016/ 0378-1119(90)90454-y Diene, S. M., Francois, P., Zbinden, A., Entenza, J. M., and Resch, G. (2016). Comparative Genomics Analysis of Streptococcus Tigurinus Strains Identifies Genetic Elements Specifically and Uniquely Present in Highly Virulent Strains. PLoS One 11, e0160554. doi: 10.1371/journal.pone.0160554 Domenech, M., Damian, D., Ardanuy, C., Liñares, J., Fenoll, A., and Garcıa, E. (2015). Emerging, non-PCV13 Serotypes 11A and 35B of Streptococcus Pneumoniae Show High Potential for Biofilm Formation In Vitro.PLoS One 10, e0125636. doi: 10.1371/journal.pone.0125636 Domenech, M., Garcıa, E., and Moscoso, M. (2011). In Vitro Destruction of Streptococcus Pneumoniae Biofilms With Bacterial and Phage Peptidoglycan Hydrolases. Antimicrob. Agents Chemother. 55, 4144–4148. doi: 10.1128/ aac.00492-11 Enright, M. C., and Spratt, B. G. (1998). A Multilocus Sequence Typing Scheme for Streptococcus Pneumoniae: Identification of Clones Associated With Serious Invasive Disease. Microbiology 144, 3049–3060. doi: 10.1099/00221287-14411-3049 Eutsey, R. A., Powell, E., Dordel, J., Salter, S. J., Clark, T. A., Korlach, J., et al (2015). Genetic Stabilization of the Drug-Resistant PMEN1 Pneumococcus Lineage by its Distinctive DpnIII Restriction-Modification System. mBio 6, e00173. doi: 10.1128/mBio.00173-15 Fernandez, L., Cima-Cabal, M. D., Duarte, A. C., Rodrıguez, A., Garcıa-Suarez, M., and Garcıa, P. (2021). Gram-Positive Pneumonia: Possibilities Offered by Phage Therapy. Antibiotics (Basel) 10, 1000. doi: 10.3390/antibiotics10081000 Fox, K. M., Maley, F., Garibian, A., Changchien, L. M., and Van Roey, P. (1999). Crystal Structure of Thymidylate Synthase A From Bacillus Subtilis.Protein Sci. 8, 538–544. doi: 10.1110/ps.8.3.538 Frolet, C., Beniazza, M., Roux, L., Gallet, B., Noirclerc-Savoye, M., Vernet, T., et al (2010). New Adhesin Functions of Surface-Exposed Pneumococcal Proteins. BMC Microbiol. 10, 190. doi: 10.1186/1471-2180-10-190 Furi, L., Crawford, L. A., Rangel-Pineros, G., Manso, A. S., De Ste Croix, M., Haigh, R. D., et al (2019). Methylation Warfare: Interaction of Pneumococcal Bacteriophages With Their Host. J. Bacteriol. 201, e00370–e00319. doi: 10.1128/jb.00370-19 Galan-Bartual, S., Perez-Dorado, I., Garcıa, P., and Hermoso, J. A. (2015). “Structure and Function of Choline-Binding Proteins,”in Streptococcus Pneumoniae. Molecular Mechanisms of Host-Pathogen Interactions. Eds. J. Brown, S. Hammerschimdt and C. Orihuela (Amsterdam: Academic Press), 207–230. doi: 10.1016/b978-0-12-410530-0.00011-9 Garcıa, P., Garcıa, J. L., Lopez, R., and Garcıa, E. (2005). “Pneumococcal Phages,” in Phages: Their Role in Bacterial Pathogenesis and Biotechnology. Eds. M. K. Waldor, D. L. I. Friedman and S. Adhya (Washington, D.C: ASM Press), 335– 361. doi: 10.1128/9781555816506.ch17 Garriss, G., and Henriques-Normark, B. (2020). Lysogeny in Streptococcus Pneumoniae.Microorganisms 8, 1546. doi: 10.3390/microorganisms8101546 GBD 2016 Lower Respiratory Infections Collaborators (2018). Estimates of the Global, Regional, and National Morbidity, Mortality, and Aetiologies of Lower Respiratory Infections in 195 Countries 1990–2016: A Systematic Analysis for the Global Burden of Disease Study 2016. Lancet Infect. Dis. 18, 1191–1210. doi: 10.1016/S1473-3099(18)30310-4 Gibb, B., Gupta, K., Ghosh, K., Sharp, R., Chen, J., and Van Duyne, G. D. (2010). Requirements for Catalysis in the Cre Recombinase Active Site. Nucleic Acids Res. 38, 5817–5832. doi: 10.1093/nar/gkq384 Gindreau, E., Lopez, R., and Garcıa, P. (2000). MM1, a Temperate Bacteriophage of the 23F Spanish/USA Multiresistant Epidemic Clone of Streptococcus Pneumoniae: Structural Analysis of the Site-Specific Integration System. J. Virol. 74, 7803–7813. doi: 10.1128/jvi.74.17.7803-7813.2000 Gladstone, R. A., Lo, S. W., Lees, J. A., Croucher, N. J., van Tonder, A. J., Corander, J., et al (2019). International Genomic Definition of Pneumococcal Lineages, to Contextualise Disease, Antibiotic Resistance and Vaccine Impact. EBioMedicine 43, 338–346. doi: 10.1016/j.ebiom.2019.04.021 Groth, A. C., and Calos, M. P. (2004). Phage Integrases: Biology and Applications. J. Mol. Biol. 335, 667–678. doi: 10.1016/j.jmb.2003.09.082 Gu, J., Feng, Y., Feng, X., Sun, C., Lei, L., Ding, W., et al (2014). Structural and Biochemical Characterization Reveals LysGH15 as an Unprecedented "EFHand-Like" Calcium-Binding Phage Lysin. PLoS Pathog. 10, e1004109. doi: 10.1371/journal.ppat.1004109 Gu, J., Xu, W., Lei, L., Huang, J., Feng, X., Sun, C., et al (2011). LysGH15, a Novel Bacteriophage Lysin, Protects a Murine Bacteremia Model Efficiently Against Lethal Methicillin-Resistant Staphylococcus Aureus Infection. J. Clin. Microbiol. 49, 111–117. doi: 10.1128/JCM.01144-10 Harvey, R. M., Trappetti, C., Mahdi, L. K., Wang, H., McAllister, L. J., Scalvini, A., et al (2016). The Variable Region of Pneumococcal Pathogenicity Island 1 is Responsible for Unusually High Virulence of a Serotype 1 Isolate. Infect. Immun. 84, 822–832. doi: 10.1128/IAI.01454-15 Hermoso, J. A., Monterroso, B., Albert, A., Galan, B., Ahrazem, O., Garcıa, P., et al (2003). Structural Basis for Selective Recognition of Pneumococcal Cell Wall by Modular Endolysin From Phage Cp-1. Structure 11, 1239–1249. doi: 10.1016/j.str.2003.09.005 Hsieh, Y.-C., Lin, T.-L., Lin, C.-M., and Wang, J.-T. (2015). Identification of PblB Mediating Galactose-SpecificAdhesioninaSuccessfulStreptococcus Pneumoniae Clone. Sci. Rep. 5, 12265. doi: 10.1038/srep12265 Hughes, D. (2000). Evaluating Genome Dynamics: The Constraints on Rearrangements Within Bacterial Genomes. Genome Biol. 1, REVIEWS0006. doi: 10.1186/gb-2000-1-6-reviews0006 Hyatt, D., Chen, G.-L., LoCascio, P. F., Land, M. L., Larimer, F. W., and Hauser, L. J. (2010). Prodigal: Prokaryotic Gene Recognition and Translation Initiation Martı ´n-Galiano and Garcı ´a Pneumococcal Prophages and Chromosomal Reorganization Frontiers in Cellular and Infection Microbiology | www.frontiersin.org November 2021 | Volume 11 | Article 77540218 Site Identification. BMC Bioinformatics 11, 119. doi: 10.1186/1471-2105-11119 Ji, X., Sun, Y., Liu, J., Zhu, L., Guo, X., Lang, X., et al (2016). A Novel VirulenceAssociated Protein, VapE, in Streptococcus Suis Serotype 2. Mol. Med. Rep. 13, 2871–2877. doi: 10.3892/mmr.2016.4818 Johnson, M., Zaretskaya, I., Raytselis, Y., Merezhuk, Y., McGinnis, S., and Madden, T. L. (2008). NCBI BLAST: A Better Web Interface. Nucleic Acids Res. 36, W5–W9. doi: 10.1093/nar/gkn201 Jolley, K. A., Bray, J. E., and Maiden, M. C. J. (2018). Open-Access Bacterial Population Genomics: BIGSdb Software, the PubMLST.org Website and Their Applications. Wellcome Open Res. 3, 124. doi: 10.12688/ wellcomeopenres.14826.1 Kenny, E., Atkinson, T., and Hartley, B. S. (1985). Nucleotide Sequence of the Thymidylate Synthetase Gene (Thyp3) From the Bacillus Subtilis Phage j3T. Gene 34, 335–342. doi: 10.1016/0378-1119(85)90142-8 Khan, A., Burmeister, A. R., and Wahl, L. M. (2020). Evolution Along the Parasitism-Mutualism Continuum Determines the Genetic Repertoire of Prophages. PLoS Comput. Biol. 16, e1008482. doi: 10.1371/ journal.pcbi.1008482 Kilian, M., Riley, D. R., Jensen, A., Brüggemann, H., and Tettelin, H. (2014). Parallel Evolution of Streptococcus Pneumoniae and Streptococcus Mitis to Pathogenic and Mutualistic Lifestyles. mBio 5, e01490–14. doi: 10.1128/ mBio.01490-14 Koonin, E. V., Makarova, K. S., and Wolf, Y. I. (2017). Evolutionary Genomics of Defense Systems in Archaea and Bacteria. Annu. Rev. Microbiol. 71, 233–261. doi: 10.1146/annurev-micro-090816-093830 Kot, W., Sabri, M., Gingras, H., Ouellette, M., Tremblay, D. M., and Moineau, S. (2017). Complete Genome Sequence of Streptococcus Pneumoniae Virulent Phage MS1. Genome Announc. 5, e00333–17. doi: 10.1128/genomeA.00333-17 Labrie, S. J., Samson, J. E., and Moineau, S. (2010). Bacteriophage Resistance Mechanisms. Nat. Rev. Microbiol. 8, 317–327. doi: 10.1038/nrmicro2315 Larsen, M. V., Cosentino, S., Rasmussen, S., Friis, C., Hasman, H., Marvig, R. L., et al (2012). Multilocus Sequence Typing of Total-Genome-Sequenced Bacteria. J. Clin. Microbiol. 50, 1355–1361. doi: 10.1128/JCM.06094-11 Laslett, D., and Canback, B. (2004). ARAGORN, a Program to Detect tRNA Genes and tmRNA Genes in Nucleotide Sequences. Nucleic Acids Res. 32, 11–16. doi: 10.1093/nar/gkh152 Laurenceau, R., Krasteva, P. V., Diallo, A., Ouarti, S., Duchateau, M., Malosse, C., et al (2015). Conserved Streptococcus Pneumoniae Spirosomes Suggest a Single Type of Transformation Pilus in Competence. PLoS Pathog. 11, e1004835. doi: 10.1371/journal.ppat.1004835 Lees, J. A., Croucher, N. J., Goldblatt, D., Nosten, F., Parkhill, J., Turner, C., et al (2017). Genome-Wide Identification of Lineage and Locus Specific Variation Associated With Pneumococcal Carriage Duration. eLife 6, e26255. doi: 10.7554/eLife.26255 Leprohon, P., Gingras, H., Ouennane, S., Moineau, S., and Ouellette, M. (2015). A Genomic Approach to Understand Interactions Between Streptococcus Pneumoniae and its Bacteriophages. BMC Genomics 16, 972. doi: 10.1186/ s12864-015-2134-8 Li, Q., Cheng, W., Morlot, C., Bai, X.-H., Jiang, Y.-L., Wang, W., et al (2015). FullLength Structure of the Major Autolysin LytA. Acta Crystallogr. D Biol. Crystallogr. 71, 1373–1381. doi: 10.1107/S1399004715007403 Lindsay, J. A., Ruzin, A., Ross, H. F., Kurepina, N., and Novick, R. P. (1998). The Gene for Toxic Shock Toxin is Carried by a Family of Mobile Pathogenicity Islands in Staphylococcus Aureus.Mol. Microbiol. 29, 527–543. doi: 10.1046/ j.1365-2958.1998.00947.x Li, J., and Zhang, J. R. (2019). Phase Variation of Streptococcus Pneumoniae. Microbiol. Spectr. 7. doi: 10.1128/microbiolspec.GPP3-0005-2018 Llull, D., Lopez, R., and Garcıa, E. (2006). Skl, a Novel Choline-Binding NAcetylmuramoyl-L-Alanine Amidase of Streptococcus Mitis SK137 Containing aCHAPDomain.FEBS Lett. 580, 1959–1964. doi: 10.1016/ j.febslet.2006.02.060 Loeffler, J. M., and Fischetti, V. A. (2006). Lysogeny of Streptococcus Pneumoniae With MM1 Phage: Improved Adherence and Other Phenotypic Changes. Infect. Immun. 74, 4486–4495. doi: 10.1128/IAI.00020-06 Loenen, W. A. M., and Raleigh, E. A. (2014). The Other Face of Restriction: Modification-Dependent Enzymes. Nucleic Acids Res. 42, 56–69. doi: 10.1093/ nar/gkt747 Lopes de Sousa, A., Maues, D., Lobato, A., Franco, E. F., Pinheiro, K., Araujo, F., et al (2018). PhageWeb –Web Interface for Rapid Identification and Characterization of Prophages in Bacterial Genomes. Front. Genet. 9, 644. doi: 10.3389/fgene.2018.00644 Lopez, E., Domenech, A., Ferrandiz, M.-J., Frias, M. J., Ardanuy, C., Ramirez, M., et al (2014). Induction of Prophages by Fluoroquinolones in Streptococcus Pneumoniae: Implications for Emergence of Resistance in Genetically-Related Clones. PLoS One 9, e94358. doi: 10.1371/journal.pone.0094358 Lopez, R., and Garcıa, E. (2004). Recent Trends on the Molecular Biology of Pneumococcal Capsules, Lytic Enzymes, and Bacteriophage. FEMS Microbiol. Rev. 28, 553–580. doi: 10.1016/j.femsre.2004.05.002 Lund, E., and Henrichsen, J. (1978). Laboratory Diagnosis, Serology and Epidemiology of Streptococcus Pneumoniae.Methods Microbiol. 12, 241–262. doi: 10.1016/S0580-9517(08)70365-9 Lu, S., Wang, J., Chitsaz, F., Derbyshire, M. K., Geer, R. C., Gonzales, N. R., et al (2020). CDD/SPARCLE: The Conserved Domain Database in 2020. Nucleic Acids Res. 48, D265–D268. doi: 10.1093/nar/gkz991 Lwoff, A. (1953). Lysogeny. Bacteriol. Rev. 17, 269–337. doi: 10.1128/br.17.4.269337.1953 Maestro, B., and Sanz, J. M. (2016). Choline Binding Proteins From Streptococcus Pneumoniae: A Dual Role as Enzybiotics and Targets for the Design of New Antimicrobials. Antibiotics (Basel) 5, 21. doi: 10.3390/antibiotics5020021 Martın, A. C., Lopez, R., and Garcıa, P. (1996). Analysis of the Complete Nucleotide Sequence and Functional Organization of the Genome of Streptococcus Pneumoniae Bacteriophage Cp-1. J. Virol. 70, 3678–3687. doi: 10.1128/JVI.70.6.3678-3687.1996 Masomian, M., Ahmad, Z., Gew, L. T., and Poh, C. L. (2020). Development of Next Generation Streptococcus Pneumoniae Vaccines Conferring Broad Protection. Vaccines 8, 132. doi: 10.3390/vaccines8010132 McGee, L., McDougal, L., Zhou, J., Spratt, B. G., Tenover, F. C., George, R., et al (2001). Nomenclature of Major Antimicrobial-Resistant Clones of Streptococcus Pneumoniae Defined by the Pneumococcal Molecular Epidemiology Network. J. Clin. Microbiol. 39, 2565–2571. doi: 10.1128/ JCM.39.7.2565-2571.2001 Mellroth, P., Sandalova, T., Kikhney, A., Vilaplana, F., Hesek, D., Lee, M., et al (2014). Structural and Functional Insights Into Peptidoglycan Access for the Lytic Amidase LytA of Streptococcus Pneumoniae.mBio 5, e01120–e01113. doi: 10.1128/mBio.01120-13 Mirdita, M., Steinegger, M., and Söding, J. (2019). MMseqs2 Desktop and Local Web Server App for Fast, Interactive Sequence Searches. Bioinformatics 35, 2856–2858. doi: 10.1093/bioinformatics/bty1057 Morales, M., Garcıa, P., de la Campa, A. G., Liñares, J., Ardanuy, C., and Garcıa, E. (2010). Evidence of Localized Prophage-Host Recombination in the lytA Gene Encoding the Major Pneumococcal Autolysin. J. Bacteriol. 192, 2624–2632. doi: 10.1128/JB.01501-09 Morales, M., Martın-Galiano, A. J., Domenech, M., and Garcıa, E. (2015). Insights Into the Evolutionary Relationships of LytA Autolysin and Ply PneumolysinLike Genes in Streptococcus Pneumoniae and Related Streptococci. Genome Biol. Evol. 7, 2747–2761. doi: 10.1093/gbe/evv178 Morgado, S., and Vicente, A. C. (2019). Global in-Silico Scenario of tRNA Genes and Their Organization in Virus Genomes. Viruses 11, 180. doi: 10.3390/ v11020180 Murphy, J., Mahony, J., Ainsworth, S., Nauta, A., and van Sinderen, D. (2013). Bacteriophage Orphan DNA Methyltransferases: Insights From Their Bacterial Origin, Function, and Occurrence. Appl. Environ. Microbiol. 79, 7547–7555. doi: 10.1128/aem.02229-13 Murray, E., Draper, L. A., Ross, R. P., and Hill, C. (2021). The Advantages and Challenges of Using Endolysins in a Clinical Setting. Viruses 13, 680. doi: 10.3390/v13040680 Mushegian, A. R. (2020). Are There 10 31 Virus Particles on Earth, or More, or Fewer? J. Bacteriol. 202, e00052–20. doi: 10.1128/jb.00052-20 Nakamura, Y., Gojobori, T., and Ikemura, T. (2000). Codon Usage Tabulated From International DNA Sequence Databases: Status for the Year 2000. Nucleic Acids Res. 28, 292. doi: 10.1093/nar/28.1.292 Nakamura, K., Ogura, Y., Gotoh, Y., and Hayashi, T. (2021). Prophages Integrating Into Prophages: A Mechanism to Accumulate Type III Secretion Effector Genes and Duplicate Shiga Toxin-Encoding Prophages in Escherichia Coli.PLoS Pathog. 17, e1009073. doi: 10.1371/journal.ppat.1009073 Martı ´n-Galiano and Garcı ´a Pneumococcal Prophages and Chromosomal Reorganization Frontiers in Cellular and Infection Microbiology | www.frontiersin.org November 2021 | Volume 11 | Article 77540219 Nieto, C., Espinosa, M., and Puyet, A. (1997). The Maltose/Maltodextrin Regulon of Streptococcus Pneumoniae. Differential Promoter Regulation by the Transcriptional Repressor MalR. J. Biol. Chem. 272, 30860–30865. doi: 10.1074/jbc.272.49.30860 O'Leary, N. A., Wright, M. W., Brister, J. R., Ciufo, S., Haddad, D., McVeigh, R., et al (2016). Reference Sequence (RefSeq) Database at NCBI: Current Status, Taxonomic Expansion, and Functional Annotation. Nucleic Acids Res. 44, D733–D745. doi: 10.1093/nar/gkv1189 Obregon, V., Garcıa, J. L., Garcıa, E., Lopez, R., and Garcıa, P. (2003a). Genome Organization and Molecular Analysis of the Temperate Bacteriophage MM1 of Streptococcus Pneumoniae.J. Bacteriol. 185, 2362–2368. doi: 10.1128/ jb.185.7.2362-2368.2003 Obregon, V., Garcıa, P., Lopez, R., and Garcıa, J. L. (2003b). VO1, a Temperate Bacteriophage of the Type 19A Multiresistant Epidemic 8249 Strain of Streptococcus Pneumoniae: Analysis of Variability of Lytic and Putative C5 Methyltransferase Genes. Microb. Drug Resist. 9, 7–15. doi: 10.1089/ 107662903764736292 Ouennane, S., Leprohon, P., and Moineau, S. (2015). Diverse Virulent Pneumophages Infect Streptococcus Mitis.PLoS One 10, e0118807. doi: 10.1371/journal.pone.0118807 Pei, J., Mitchell, D. A., Dixon, J. E., and Grishin, N. V. (2011). Expansion of Type II CAAX Proteases Reveals Evolutionary Origin of g-Secretase Subunit APH-1. J. Mol. Biol. 410, 18–26. doi: 10.1016/j.jmb.2011.04.066 Peng, S.-Y., Chen, L.-K., Wu, W.-J., Paramita, P., Yang, P.-W., Li, Y.-Z., et al (2020). Isolation and Characterization of a New Phage Infecting Elizabethkingia Anophelis and Evaluation of its Therapeutic Efficacy In Vitro and In Vivo.Front. Microbiol. 11, 728. doi: 10.3389/fmicb.2020.00728 Pfeifer, E., Moura de Sousa, J. A., Touchon, M., and Rocha, E. P. C. (2021). Bacteria Have Numerous Distinctive Groups of Phage-Plasmids With Conserved Phage and Variable Plasmid Gene Repertoires. Nucleic Acids Res. 49, 2655–2673. doi: 10.1093/nar/gkab064 Podlacha, M., Grabowski, Ł., Kosznik-Kawsnicka, K., Zdrojewska, K., Stasiłojc, M., Węgrzyn, G., et al (2021). Interactions of Bacteriophages With Animal and Human Organisms—Safety Issues in the Light of Phage Therapy. Int. J. Mol. Sci. 22, 8937. doi: 10.3390/ijms22168937 Popescu, M., Van Belleghem, J. D., Khosravi, A., and Bollyky, P. L. (2021). Bacteriophages and the Immune System. Annu.Rev.Virol.8, 67–87. doi: 10.1146/annurev-virology-091919-074551 Ramirez, M., Severina, E., and Tomasz, A. (1999). A High Incidence of Prophage Carriage Among Natural Isolates of Streptococcus Pneumoniae.J. Bacteriol. 181, 3618–3625. doi: 10.1128/JB.181.12.3618-3625.1999 Ramos-Sevillano, E., Urzainqui, A., Campuzano, S., Moscoso, M., GonzalezCamacho, F., Domenech, M., et al (2015). Pleiotropic Effects of the Cell Wall Amidase LytA on Streptococcus Pneumoniae Sensitivity to the Host Immune Response. Infect. Immun. 83, 591–603. doi: 10.1128/iai.02811-14 Ramos-Sevillano, E., Urzainqui, A., de Andres, B., Gonzalez-Tajuelo, R., Domenech, M., Gonzalez-Camacho, F., et al (2016). PSGL-1 on Leukocytes is a Critical Component of the Host Immune Response Against Invasive Pneumococcal Disease. PLoS Pathog. 12, e1005500. doi: 10.1371/ journal.ppat.1005500 Reis-Cunha, J. L., Bartholomeu, D. C., Manson, A. L., Earl, A. M., and Cerqueira, G. C. (2019). ProphET, Prophage Estimation Tool: A Stand-Alone Prophage Sequence Prediction Tool With Self-Updating Reference Database. PLoS One 14, e0223364. doi: 10.1371/journal.pone.0223364 Rezaei Javan, R., Ramos-Sevillano, E., Akter, A., Brown, J., and Brueggemann, A. B. (2019). Prophages and Satellite Prophages are Widespread in Streptococcus and may Play a Role in Pneumococcal Pathogenesis. Nat. Commun. 10, 4852. doi: 10.1038/s41467-019-12825-y Roach, D. J., Burton, J. N., Lee, C., Stackhouse, B., Butler-Wu, S. M., Cookson, B. T., et al (2015). A Year of Infection in the Intensive Care Unit: Prospective Whole Genome Sequencing of Bacterial Clinical Isolates Reveals Cryptic Transmissions and Novel Microbiota. PLoS Genet. 11, e1005413. doi: 10.1371/journal.pgen.1005413 Romero, P., Croucher, N. J., Hiller, N. L., Hu, F. Z., Ehrlich, G. D., Bentley, S. D., et al (2009a). Comparative Genomic Analysis of Ten Streptococcus Pneumoniae Temperate Bacteriophages. J. Bacteriol. 191, 4854–4862. doi: 10.1128/jb.01272-08 Romero, P., Garcıa, E., and Mitchell, T. J. (2009b). Development of a Prophage Typing System and Analysis of Prophage Carriage in Streptococcus Pneumoniae.Appl. Environ. Microbiol. 75, 1642–1649. doi: 10.1128/ AEM.02155-08 Romero, A., Lopez, R., and Garcia, P. (1990). Sequence of the Streptococcus Pneumoniae Bacteriophage HB-3 Amidase Reveals High Homology With the Major Host Autolysin. J. Bacteriol. 172, 5064–5070. doi: 10.1128/jb.172.9.50645070.1990 Rostøl, J. T., and Marraffini, L. (2019). (Ph)ighting Phages: How Bacteria Resist Their Parasites. Cell Host Microbe 25, 184–194. doi: 10.1016/ j.chom.2019.01.009 Sanchez-Beato, A. R., Lopez, R., and Garcıa, J. L. (1998). Molecular Characterization of PcpA: A Novel Choline-Binding Protein of Streptococcus Pneumoniae.FEMS Microbiol. Lett. 164, 207–214. doi: 10.1016/s0378-1097(98) 00206-7 Schattner, P., Brooks, A. N., and Lowe, T. M. (2005). The tRNAscan-SE, Snoscan and snoGPS Web Servers for the Detection of tRNAs and snoRNAs. Nucleic Acids Res. 33, W686–W689. doi: 10.1093/nar/gki366 Schroven, K., Aertsen, A., and Lavigne, R. (2021). Bacteriophages as Drivers of Bacterial Virulence and Their Potential for Biotechnological Exploitation. FEMS Microbiol. Rev. 45, fuaa041. doi: 10.1093/femsre/fuaa041 Seguritan, V., Feng, I. W., Rohwer, F., Swift, M., and Segall, A. M. (2003). Genome Sequences of Two Closely Related Vibrio Parahaemolyticus Phages, VP16T and VP16C. J. Bacteriol. 185, 6434–6447. doi: 10.1128/JB.185.21.64346447.2003 Sempere, J., de Miguel, S., Gonzalez-Camacho, F., Yuste, J., and Domenech, M. (2020). Clinical Relevance and Molecular Pathogenesis of the Emerging Serotypes 22F and 33F of Streptococcus Pneumoniae in Spain. Front. Microbiol. 11, 309. doi: 10.3389/fmicb.2020.00309 Shimada, K., Weisberg, R. A., and Gottesman, M. E. (1975). Prophage Lambda at Unusual Chromosomal Locations. III. The Components of the Secondary Attachment Sites. J. Mol. Biol. 93, 415–429. doi: 10.1016/0022-2836(75) 90237-5 Sievers, F., and Higgins, D. G. (2021). The Clustal Omega Multiple Alignment Package. Methods Mol. Biol. 2231, 3–16. doi: 10.1007/978-1-0716-1036-7_1 Silva, M. D., Oliveira, H., Faustino, A., and Sillankorva, S. (2020). Characterization of MSlys, the Endolysin of Streptococcus Pneumoniae Phage MS1. Biotechnol. Rep. (Amst.) 28, e00547. doi: 10.1016/j.btre.2020.e00547 Sinha, D., Zimmer, K., Cameron, T. A., Rusch, D. B., Winkler, M. E., and De Lay, N. R. (2019). Redefining the Small Regulatory RNA Transcriptome in Streptococcus Pneumoniae Serotype 2 Strain D39. J. Bacteriol. 201, e00764– 18. doi: 10.1128/JB.00764-18 Slager, J., Aprianto, R., and Veening, J.-W. (2018). Deep Genome Annotation of the Opportunistic Human Pathogen Streptococcus Pneumoniae D39. Nucleic Acids Res. 46, 9971–9989. doi: 10.1093/nar/gky725 Steinberg, R., Knüpffer, L., Origi, A., Asti, R., and Koch, H.-G. (2018). CoTranslational Protein Targeting in Bacteria. FEMS Microbiol. Lett. 365, fny095. doi: 10.1093/femsle/fny095 Stout, T. J., Schellenberger, U., Santi, D. V., and Stroud, R. M. (1998). Crystal Structures of a Unique Thermal-Stable Thymidylate Synthase From Bacillus Subtilis.Biochemistry 37, 14736–14747. doi: 10.1021/bi981270l Stroynowski, I. T. (1981). Integration of the Bacteriophage Ф3T-Coded Thymidylate Synthetase Gene Into the Bacillus Subtilis Chromosome. J. Bacteriol. 148, 101–108. doi: 10.1128/jb.148.1.101-108.1981 Tam, N. H., and Borriss, R. (1995). The thyA Gene From Bacillus Subtilis Exhibits Similarity With the Phage Ф3T Thymidylate Synthase Gene. Microbiology 141, 291–297. doi: 10.1099/13500872-141-2-291 Tin Tin Htar, M., Morato Martınez, J., Theilacker, C., Schmitt, H.-J., and Swerdlow, D. (2019). Serotype Evolution in Western Europe: Perspectives on Invasive Pneumococcal Diseases (IPD). Expert Rev. Vaccines 18, 1145–1155. doi: 10.1080/14760584.2019.1688149 Touchon, M., Bernheim, A., and Rocha, E. P. (2016). Genetic and Life-History Traits Associated With the Distribution of Prophages in Bacteria. ISME J. 10, 2744–2754. doi: 10.1038/ismej.2016.47 Tucker, R. G. (1969). Acquisition of Thymidylate Synthetase Activity by a Thymine-Requiring Mutant of Bacillus Subtilis Following Infection by the Temperate Phage j3. J. Gen. Virol. 4, 489–504. doi: 10.1099/0022-1317-4-4-489 Martı ´n-Galiano and Garcı ´a Pneumococcal Prophages and Chromosomal Reorganization Frontiers in Cellular and Infection Microbiology | www.frontiersin.org November 2021 | Volume 11 | Article 77540220 Tunjungputri, R. N., Mobegi, F. M., Cremers, A. J., van der Gaast-de Jongh, C. E., Ferwerda, G., Meis, J. F., et al (2017). Phage-Derived Protein Induces Increased Platelet Activation and is Associated With Mortality in Patients With Invasive Pneumococcal Disease. mBio 8, e01984–16. doi: 10.1128/mBio.01984-16 vanderKamp,I.,Draper,L.A.,Smith,M.K.,Buttimer,C.,Ross,R.P.,andHill,C.(2020). ANewPhageLysinIsolatedFromtheOralMicrobiomeTargetingStreptococcus Pneumoniae.Pharmaceuticals (Basel) 13, 478. doi: 10.3390/ph13120478 Van Duyne, G. D., and Rutherford, K. (2013). Large Serine Recombinase Domain Structure and Attachment Site Binding. Crit. Rev. Biochem. Mol. Biol. 48, 476– 491. doi: 10.3109/10409238.2013.831807 van Tonder, A. J., Bray, J. E., Jolley, K. A., Jansen van Rensburg, M., Quirk, S. J., Haraldsson, G., et al (2019). Genomic Analyses of >3,100 Nasopharyngeal Pneumococci Revealed Significant Differences Between Pneumococci Recovered in Four Different Geographical Regions. Front. Microbiol. 10, 317. doi: 10.3389/fmicb.2019.00317 Vasu, K., and Nagaraja, V. (2013). Diverse Functions of Restriction-Modification Systems in Addition to Cellular Defense. Microbiol. Mol. Biol. Rev. 77, 53–72. doi: 10.1128/MMBR.00044-12 Vazquez, R., Garcıa, E., and Garcıa, P. (2018). Phage Lysins for Fighting Bacterial Respiratory Infections: A New Generation of Antimicrobials. Front. Immunol. 9, 2252. doi: 10.3389/fimmu.2018.02252 Wang, X., and Wood, T. K. (2016). Cryptic Prophages as Targets for Drug Development. Drug Resist. Updat. 27, 30–38. doi: 10.1016/j.drup.2016.06.001 Weiss, S. B., Hsu, W.-T., Foft, J. W., and Scherberg, N. H. (1968). Transfer RNA Coded by the T4 Bacteriophage Genome. Proc. Natl. Acad. Sci. U.S.A. 61, 114– 121. doi: 10.1073/pnas.61.1.114 Whatmore, A. M., and Dowson, C. G. (1999). The Autolysin-Encoding Gene (Lyta)ofStreptococcus Pneumoniae Displays Restricted Allelic Variation Despite Localized Recombination Events With Genes of Pneumococcal Bacteriophage Encoding Cell Wall Lytic Enzymes. Infect. Immun. 67, 4551– 4556. doi: 10.1128/iai.67.9.4551-4556.1999 Williams, K. P. (2002). Integration Sites for Genetic Elements in Prokaryotic tRNA and tmRNA Genes: Sublocation Preference of Integrase Subfamilies. Nucleic Acids Res. 30, 866–875. doi: 10.1093/nar/30.4.866 Willner, D., Furlan, M., Schmieder, R., Grasis, J. A., Pride, D. T., Relman, D. A., et al (2011). Metagenomic Detection of Phage-Encoded Platelet-Binding Factors in the Human Oral Cavity. Proc. Natl. Acad. Sci. U.S.A. 108 Suppl 1, 4547–4553. doi: 10.1073/pnas.1000089107 Yang, H., Luo, D., Etobayeva, I., Li, X., Gong, Y., Wang, S., et al (2020). Linker Editing of Pneumococcal Lysin ClyJ Conveys Improved Bactericidal Activity. Antimicrob. Agents Chemother. 64, e01610–19. doi: 10.1128/aac.01610-19 Yuan, P., Gupta, K., and Van Duyne, G. D. (2008). Tetrameric Structure of a Serine Integrase Catalytic Domain. Structure 16, 1275–1286. doi: 10.1016/ j.str.2008.04.018 Conflict of Interest: The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. Publisher’s Note: All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher. Copyright © 2021 Martı  n-Galiano and Garcı  a. This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms. Martı ´n-Galiano and Garcı ´a Pneumococcal Prophages and Chromosomal Reorganization Frontiers in Cellular and Infection Microbiology | www.frontiersin.org November 2021 | Volume 11 | Article 77540221