scieee AI-readable full text Open interactive document viewer

Mutation of vsx genes in zebrafish highlights the robustness of the retinal specification network

Letelier, Joaquin,Buono, Lorena,Almuedo-Castillo, María,Zang, Jingjing,Mounieres, Constanza,González Díaz, Sergio,Polvillo Hernández, Rocío,Sanabria-Reinoso, Estefanía,Corbacho Sánchez, Jorge,Sousa Ortega, Ana,Diez del Corral, Ruth,Neuhauss, Stephan C. F

Abstract

Fondo Nacional de Desarrollo Científico y Tecnológico (11180727); Fondo Nacional de Desarrollo Científico y Tecnológico (1230903); JUNTA DE ANDALUCIA (PY20_00006); Consejo Superior de Investigaciones Científicas (2020AEP014); Spanish Ministry of Science, Innovation and Universities (BFU2017-86339P); Spanish Ministry of Science, Innovation and Universities (CEX2020-001088-M); Spanish Ministry of Science, Innovation and Universities (PID2020-112566GB-I00); Spanish Ministry of Science, Innovation and Universities (RED2018-102553-T)

Full text

Letelier, Buono etal. eLife 2023;12:e85594. DOI: https://doi.org/10.7554/eLife.85594 1 of 27 Mutation of vsx genes in zebrafish highlights the robustness of the retinal specificationnetwork Joaquín Letelier1,2*†, Lorena Buono1,3†, María AlmuedoCastillo1, Jingjing Zang4, Constanza Mounieres2, Sergio GonzálezDíaz1, Rocío Polvillo1, Estefanía SanabriaReinoso1, Jorge Corbacho1, Ana SousaOrtega1, Ruth Diez del Corral5, Stephan CF Neuhauss4, Juan R MartínezMorales1* 1Centro Andaluz de Biología del Desarrollo (CSIC/UPO/JA), Sevilla, Spain; 2Centre for Integrative Biology, Facultad de Ciencias, Universidad Mayor, Santiago, Chile; 3IRCCS SYNLAB SDN, Via E. Gianturco, Naples, Italy; 4Department of Molecular Life Sciences, University of Zürich, Zürich, Switzerland; 5Champalimaud Research, Champalimaud Centre for the Unknown, Lisbon, Portugal Abstract Genetic studies in human and mice have established a dual role for Vsx genes in retina development: an early function in progenitors’ specification, and a later requirement for bipolarcells fate determination. Despite their conserved expression patterns, it is currently unclear to which extent Vsx functions are also conserved across vertebrates, as mutant models are available only in mammals. To gain insight into vsx function in teleosts, we have generated vsx1 and vsx2 CRISPR/ Cas9 double knockouts (vsxKO) in zebrafish. Our electrophysiological and histological analyses indicate severe visual impairment and bipolar cells depletion in vsxKO larvae, with retinal precursors being rerouted toward photoreceptor or Müller glia fates. Surprisingly, neural retina is properly specified and maintained in mutant embryos, which do not display microphthalmia. We show that although important cisregulatory remodelling occurs in vsxKO retinas during early specification, this has little impact at a transcriptomic level. Our observations point to genetic redundancy as an important mechanism sustaining the integrity of the retinal specification network, and to Vsx genes regulatory weight varying substantially among vertebrate species. Editor's evaluation This study provides important insights into how tissue specification networks, while often employing conserved genes across species, can differ in their network architecture, resulting in differences in how they buffer perturbations. This is shown for the Visual System Homeobox genes (VSX) in the zebrafish retinal specification pathway, where yettobedefined compensatory mechanisms prevent microphthalmia in the absence of VSX function, something not observed in humans or mice. The evidence supporting the conclusions of the study is solid and provides a foundation for further molecular and genetic analysis of retinal specification. This work is relevant to developmental biologists with interests in tissue specification and gene regulatory networks. Introduction The organogenesis of the vertebrate eye is a complex multistep process entailing the sequential activation of genetic programs responsible for the initial specification of the eye field, the patterning of the eye primordium into subdomains, and the determination of the different neuronal types. RESEARCH ARTICLE *For correspondence: [email protected] (JL); [email protected] (JRMM) †These authors contributed equally to this work Competing interest: The authors declare that no competing interests exist. Funding: See page 21 Preprinted: 21 January 2022 Received: 15 December 2022 Accepted: 14 April 2023 Published: 25 May 2023 Reviewing Editor: Edward M Levine, Vanderbilt University, United States Copyright Letelier, Buono etal. This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited. Research article Developmental Biology | Evolutionary Biology Letelier, Buono etal. eLife 2023;12:e85594. DOI: https://doi.org/10.7554/eLife.85594 2 of 27 Although we are far from understanding the precise architecture of the gene regulatory networks (GRNs) controlling eye formation, many of their central nodes have been already identified (Buono and MartinezMorales, 2020; Fuhrmann, 2010; Heavner and Pevny, 2012; MartinezMorales, 2016). They comprise transcriptional regulators recruited repeatedly for key developmental decisions at different stages of eye formation, and which mutation in humans is often associated to severe ocular malformations: that is, microphthalmia, anophthalmia, and coloboma. This is the case for SIX3, PAX6, RAX, SOX2, VSX2, or OTX2 (GregoryEvans etal., 2004; GregoryEvans etal., 2013). Among the main regulators, the visual system homeobox transcription factors, Vsx1 and Vsx2, have been shown to control the development of visual circuits in vertebrate and invertebrate species (Burmeister etal., 1996; Erclik etal., 2008; Focareta etal., 2014). Vsx2, initially termed as Chx10, was the first gene of the family characterized in vertebrates (Liu etal., 1994). Vsx2/Chx10 shows a conserved expression pattern across vertebrate species, both in the retina (i.e. early in all optic cup precursors, and later in retinal bipolar cells), as well as in hindbrain and spinal cord interneurons (Ferda Percin etal., 2000; Kimura etal., 2013; Liu etal., 1994; Passini etal., 1997). A nonsense mutation in Vsx2 (Y176stop) turned to be the molecular cause of the phenotype exhibited by the classical mutant mice ocular retardation (or), which displays microphthalmia and optic nerve aplasia (Burmeister etal., 1996; Truslove, 1962). The phenotypic analysis of or mutants, as well as the examination of human patients with hereditary microphthalmia, revealed an essential role for Vsx2 in neuroepithelial proliferation and bipolar cells differentiation (BarYosef etal., 2004; Burmeister etal., 1996; Ferda Percin etal., 2000). Subsequent studies indicated that, during optic cup formation, Vsx2 is a key factor in the binary decision between neural retina and retinalpigmented epithelium (RPE) lineages. Genetic studies in mice and chick revealed that Vsx2 acts, downstream of the neural retina inducing ligands (i.e. FGFs), as a repressor of Mitf and Tfec genes and hence of the RPE identity (Horsford etal., 2005; Nguyen and Arnheiter, 2000; Rowan etal., 2004). A few years after Vsx2 identification, a closely related paralog, Vsx1, was reported in several vertebrate species (Chen and Cepko, 2000; Chow etal., 2001; Levine etal., 1994; Passini etal., 1997). The proteins encoded by these paralogous genes have similar domains’ architecture, including wellconserved pairedlike homeodomain and CVC (Chx10/Vsx1 and ceh10) regulatory modules, and share biochemical properties, binding with high affinity to the same DNA sequence motif ‘TAATTAGC’ (Capowski etal., 2016; Dorval etal., 2005; Ferda Percin etal., 2000; Heon, 2002). Although both genes display partially overlapping expression patterns in the retina, Vsx2 precedes Vsx1 expression in undifferentiated progenitors in all vertebrate models analysed. Furthermore, once retinal precursors exit the cell cycle, they are expressed in complementary sets of differentiated bipolar cells. Thus, Vsx1 is restricted to different types of ON and OFF cone bipolar cells in mice, and Vsx2 to S4 bipolar and Müller cells in zebrafish (Ohtoshi etal., 2004; Shi etal., 2011; Vitorino etal., 2009). In contrast to Vsx2, Vsx1 seems to have a minor contribution to retinal specification in mammals. A single case of sporadic microphthalmia has been associated to Vsx1 mutation in humans (MatíasPérez etal., 2018), and its mutation in mice does not affect early retinal development even in a Vsx2 mutant background (Chow etal., 2004; Clark etal., 2008). However, Vsx1 mutation has been linked to inherited corneal dystrophies in humans, and is associated to abnormal electroretinogram (ERGs) recordings either in mice or in patients (Chow etal., 2004; Heon, 2002; MintzHittner etal., 2004). Despite all these advances on the developmental role of Vsx genes, many questions remain open. A fundamental issue is to understand to which extent Vsx gene functions are conserved across vertebrates. Previous antisense oligonucleotides or morpholino studies in zebrafish have shown that vsx2 knockdown results in microphthalmia and optic cup folding defects (Barabino etal., 1997; Clark etal., 2008; GagoRodrigues et al., 2015; Vitorino etal., 2009). However, these findings have not been validated using knockout lines, neither the role of vsx1 and vsx2 in fate determination and bipolar cells differentiation has been sufficiently explored in teleost fish. To gain insight into the universality and diversity of Vsx functions, we have generated zebrafish mutants for vsx1 and vsx2 harboring deletions within the homeodomainencoding exons. Surprisingly, eye morphology and size appear normal either in the individual or in the double vsx1/vsx2 mutants, thus indicating that vsx genes are not essential to initiate retinal development in zebrafish. The absence of early retinal malformations facilitates the phenotypic analysis of the mutants at later embryonic and larval stages. Defects in the visual background adaptation (VBA) reflex are observed in vsx1 mutant, and appear enhanced in double mutant larvae, suggesting partial or complete blindness. Research article Developmental Biology | Evolutionary Biology Letelier, Buono etal. eLife 2023;12:e85594. DOI: https://doi.org/10.7554/eLife.85594 3 of 27 Analysis of ERG responses confirms vision loss, showing that the amplitude of the bwave recordings is reduced in vsx1 mutants, and absent in double mutants. Interestingly, a single wild type copy of vsx1 is sufficient to prevent VBA and ERG defects, indicating that vsx2 loss of function can be compensated by vsx1. The analysis of neuronalspecific markers confirmed that retinal progenitors fail to differentiate into bipolar cells in double mutant embryos. Instead, we show that precursors at the inner nuclear layer (INL) can remain proliferative, undergo apoptosis, or be rerouted toward other retinal lineages, particularly differentiating as Müller glial cells. Finally, we investigate whether transcriptional adaptation (ElBrolosy etal., 2019) may compensate for vsx1/vsx2 lossoffunction during retinal specification. The transcriptomic analysis of core components of the retinal specification GRN do not support a transcriptional adaptation mechanism in vsx1/vsx2 double mutants, rather suggesting that the network robustness is by itself sufficient to sustain early eye development even in the absence of vsx1 and vsx2 function. In summary, whereas our work shows a conserved role for Vsx genes during bipolar cell differentiation, also indicates that their hierarchic weight within the eye GRNs varies considerably across vertebrate species. Results Zebrafish vsx double mutants show normal eye size but affected lamination of the retina Despite the additional round of genome duplication occurring in the teleost lineage after the split with sarcopterygians (Meyer and Schartl, 1999), a single copy of both vsx1 and vsx2 was retained in zebrafish. In order to investigate the role of Vsx transcription factors during visual system formation in zebrafish, we generated mutants for both paralogs using CRISPR/Cas9. To optimize the generation of null animals, we targeted conserved regions encoding for the DNA binding domain of the proteins in their corresponding loci at chromosome 17 (Figure1a). We generated a 245bp deletion in vsx1 encompassing exon3, intron3, and exon4 of the gene (vsx1∆245). This mutation results in an inframe deletion of 53 amino acids by the removal of 159bp from exon3 (54bp) and exon4 (105bp; Figure1—figure supplement 1a). In the case of vsx2, a 73bp deletion was generated in exon 3 (vsx2∆73). This mutation deletes 24 amino acids of the core DBD of the protein and generates a premature stop codon in that domain (Figure1—figure supplement 1b). Both deletions can be easily screened by PCR with primers flanking the mutation sites. Using Vsx1and Vsx2specific antibodies, we found that no Vsx2 or Vsx1 proteins could be detected by western blot in 24hpf vsxKO samples (Figure1—figure supplement 1c, d). In addition, no maternal Vsx1 protein was detected in early 1.5hpf wildtype embryos (Figure1—figure supplement 1c). At 2week post fertilization, no obvious macroscopic defects were observed in the visual system of either homozygous single mutants (i.e. vsx1∆245 or vsx2∆73) or homozygous double mutants vsx1∆245; vsx2∆73 (here termed vsxKO), which appeared normal in shape and size (Figure 1— figure supplement 2; Figure1—figure supplement 3a–d). Homozygous single mutants, and even animals harboring a single wild type copy either of vsx1 (vsx1∆245+/-, vsx2∆73-/-) or vsx2 (vsx1∆245- /-; vsx2∆73+/-) reached adulthood and were fertile. However, double mutant larvae (vsx1∆245 -/-; vsx2∆73 -/-) died at around 3week post fertilization, with the exception of a single unfertile escaper reaching adulthood (1 out of 152 larvae raised). For further analyses, double mutant embryos and larvae were obtained each generation by incrossing of vsx1∆245+/-; vsx2∆73-/- or vsx1∆245-/-; vsx2∆73+/-animals. Once the proper recombinants were obtained, heterozygous lines maintenance was facilitated by the linkage between vsx1 and vsx2 mutant alleles, which tend to segregate together due to their proximity (10.6Mb) in chromosome 17. Histological sectioning of mutant retinas at 48hpf showed a small delay in the formation of the inner plexiform layer (IPL), but no obvious macroscopic optic cup malformations when compared to WT (Figure1b and f). At 72hpf, both the outer plexiform layer (OPL) and the IPL appeared less organized in the double mutant retinas, which showed discontinuities/fenestrae (Figure1c and g). At 6dpf, double mutant larvae showed all the layers of a normal retina, but the thickness of the outer (ONL) and inner (INL) nuclear layers was significantly increased and reduced respectively, when compared to siblings (Figure1d and h; Figure1—figure supplement 3e, h, i). In addition to retinal layer formation defects, vsxKO fish presented expanded pigmentation in skin melanocytes even when exposed to bright light for 20min (Figure1e and i; Figure1—figure supplement 3a, d). This phenomenon Research article Developmental Biology | Evolutionary Biology Letelier, Buono etal. eLife 2023;12:e85594. DOI: https://doi.org/10.7554/eLife.85594 4 of 27 Figure 1. DNAbinding domain deletion of vsx genes affect neural retina formation and disrupt VBA reflex. (a)CRISPR/Cas9 DNA editing tool was used to generate deletions (green box) in the highly conserved DBD from vsx1 (top) and vsx2 (bottom) TFs. Blue boxes represent gene exons, black boxes the location of sgRNAs used to guide Cas9 endonuclease and primers for screening are depicted as opposing arrowheads. bd and fh. Histological sections stained with nuclear marker DAPI and phalloidinAlexa488 for actin filaments from WT (bd, n≥8) and vsxKO central retinas (fh, n≥10) at 48hpf (b, f),72hpf (c, g)and 6dpf (d, h). (e, i). Head dorsal view from 6dpf WT (e)and vsxKO (i)larvae with insets showing their pigmentation pattern (white Figure 1 continued on next page Research article Developmental Biology | Evolutionary Biology Letelier, Buono etal. eLife 2023;12:e85594. DOI: https://doi.org/10.7554/eLife.85594 5 of 27 is indicative of an impaired visual background adaptation (VBA) reflex, and is often associated with blindness in zebrafish (Fleisch and Neuhauss, 2006). Visual function is impaired in single vsx1and vsxKO double mutants To test the visual performance of the vsx mutants; ERG recordings were obtained from WT and mutants at 5 dpf (Figure2). Zebrafish retina becomes fully functional at 5 dpf with the exception of late maturing rods (Bilotta etal., 2001) and thus, the recorded field potentials were mainly contributed by cones. Wild type larvae show a standard ERG response to light flash, characterized by a large positive bwave representing the depolarization of ON bipolar cells (Figure2a), which also masks the initial awave generated by photoreceptor (PR) hyperpolarization. Representative recordings Figure 2. ERG response is reduced in vsxKO larvae. (a)Representative ERG tracks at maximum light intensity from WT (blue), vsx1∆245 (red), vsx2∆73 (green) and vsxKO double mutants (grey and yellow) at 5dpf. For vsxKO larvae, two typical recordings are shown (grey and yellow tracks). (b). Averaged ERG bwave amplitudes from WT (blue), vsx1∆245 (red), vsx2∆73 (green) and vsxKO (yellow) larvae. No significant differences were observed between WT and vsx2∆73samples. vsx1∆245 and vsxKO mutants produce a significant reduction of the ERG bwave amplitude compared with both WT and vsx2∆73 larvae throughout all light intensities tested (***p<0.0001, ****p<0.00001). Data are shown as mean ± SEM. In (a) and (b), vsx1∆245 (red tracks) represents both vsx1∆245-/- and vsx1∆245-/-; vsx2∆73+/-genotypes, while vsx2∆73 (green tracks) represents both vsx2∆73-/- and vsx1∆245+/-; vsx2∆73- /- genotypes. Data were collected from five independent experiments. For statistical comparison, one way ANOVA test was used. ms: milliseconds, mV: millivolts. The online version of this article includes the following figure supplement(s) for figure 2: Figure supplement 1. OKR measurements indicate decreased eye movement velocity in vsx mutants. arrowhead). ONL: outer nuclear layer, INL: inner nuclear layer, GCL: ganglion cell layer, hpf: hours postfertilization, dpf: days postfertilization. Scale bar in (bd) and (fh): 50µm, scale bar in e and i: 500µm. The online version of this article includes the following source data and figure supplement(s) for figure 1: Figure supplement 1. Zebrafish Vsx1 and Vsx2 proteins are disrupted in vsxKO animals. Figure supplement 1—Source data 1. Raw unedited western blot gel for Vsx1. Figure supplement 1—Source data 2. Raw unedited western blot gel for Vsx2. Figure supplement 1—Source data 3. Uncropped Vsx1 blot with labelled bands. Figure supplement 1—Source data 4. Uncropped Vsx2 blot with labelled bands. Figure supplement 2. Eye size is normal in vsxKO juvenile fish. Figure supplement 3. VBA and nuclear layers width are affected in vsx mutants. Figure 1 continued Research article Developmental Biology | Evolutionary Biology Letelier, Buono etal. eLife 2023;12:e85594. DOI: https://doi.org/10.7554/eLife.85594 6 of 27 from larvae harboring different vsx genotypes are shown in Figure2a. We found that vsx2∆73ERG response (green curve) was similar to the WT recording (blue curve). However, recordings in vsx1∆245 larvae showed a reduced bwave compared to WT or vsx2∆73 larvae. From the 36 double mutant larvae recorded in total, 10 of them still showed a bwave, though reduced in comparison to vsx1∆245 mutants, and much smaller than WT recordings. Moreover, in the remaining 26 double mutants recorded only the negative awave but not the bwave (gray curve) was detected, suggesting that bipolar cells differentiation and/or function might be compromised. Statistical analysis of the average amplitude showed that the bwave is significantly decreased in both vsx1∆245 single and vsxKO double mutants in comparison to WT at all tested light intensities (Figure2b). In addition, the bwave response amplitude in the double mutant was significantly reduced compared to vsx1 single mutants (Figure2b). These measurements are in line with our previous observation indicating that double mutant retinas are more affected at the cellular level than single vsx1∆245 animals (Figure1—figure supplement 3). To quantitatively characterize eye performance, optokinetic response (OKR) recordings (Rinner etal., 2005) were obtained for WT and vsx mutant fish (Figure2—figure supplement 1). To investigate the role of Vsx transcription factors at the behavioral level, eye movement velocity was recorded at 5dpf in WT and vsxKO mutant fish. We measured eye velocity varying different parameters of the moving stimuli, such as contrast (contrast sensitivity; Figure2—figure supplement 1a), frequency (spatial resolution; Figure 2—figure supplement 1b) and angular velocity (temporal resolution; Figure2—figure supplement 1c). In all conditions tested, we observed a significant reduction in eye velocity for vsx1 single and vsxKO double mutants when compared with vsx2∆73 larvae and WT controls (repeated measurement, ANOVA p<0.001). Taken together these physiological recordings confirmed significant sight impairment in vsx1 mutants, a phenotype that is further aggravated by vsx2 loss in vsxKO double mutants. Extended proliferation wave and INL cell death in vsxKO double mutant retinas As vsxKO double mutants showed stronger retinal architecture and visual defects than other vsx mutant combinations, we decided to focus further phenotypic analyses on them. To assess whether our observations on the increased thickness of the ONL and the decreased width of the INL (Figure1— figure supplement 3) correlate with a proliferation and/or cell death unbalance, we examined both parameters in vsxKO fish. To investigate proliferation defects, we quantified the number of phosphohistone H3 positive (PH3+) cells in the retina of wild type and vsxKO animals throughout the lamination process: that is, at 24, 48, 60, and 72hpf (Figure3a–f and m; Figure3—figure supplement 1). At 24 and 48hpf, no difference in the number of PH3 + cells were observed between WT and vsxKO retinas (Figure3a, d and m; Figure3—figure supplement 1). However, at 60hpf, when the proliferation wave has largely finished in WT eyes, double mutant retinas continued to divide and showed a significant increase in PH3 + cells, particularly in the outer and peripheral regions (Figure3b, e and m). Later on, at 72hpf, PH3 + cells were only detected in the CMZ and no significant difference in the number of proliferative cells was detected between WT and vsxKO retinas (Figure3c, f and m). To test if cell death may account for the reduced INL width observed in double mutants (Figure1—figure supplement 3h, i), we stained retinal cryosections at different time points with anticleaved caspase3 (C3) antibodies to detect cells that undergo apoptosis (Figure3g–l and n). At 60hpf, C3positive cells (C3+) could be observed rarely in WT or vsxKO retinas (Figure3g, j and n). However, at both 72 and 96hpf, a significant increase in the number of apoptotic C3 + cells were detected in double mutants compared to WT (Figure3h, i, k and l). Apoptotic cells concentrated mainly in the INL layer of the retina (Figure3k, l and n), suggesting that cell death within this layer may contribute to the decreased thickness observed in vsxKO retinas. We also observed a few apoptotic C3 + cells in the ganglion cell layer (GCL) in vsxKO embryos (Figure3k and l) suggesting than the survival of these cells may be compromised. To investigate this point, we decided to analyze the integrity of the retinal ganglion cells’ (RGCs) projections to the optic tectum by injecting DiI and DiO tracers in WT and vsxKO double mutant eyes at 6dpf (Video 1). No obvious differences in retinotectal projections were detected between WT and double mutant larvae, indicating that the RGCs are not affected in vsxKO retinas compared to control animals. Research article Developmental Biology | Evolutionary Biology Letelier, Buono etal. eLife 2023;12:e85594. DOI: https://doi.org/10.7554/eLife.85594 7 of 27 60h72h 96h 60h72h 96h Wildtype vsxKO g j mn h k i l 60 h7 2h 72h60h48h 48h αPH3 αPH3 αC3 αC3 a def bc Wildtype vsxKO WT (n=8)vsxKO vsxKO vsxKO (n=9)WT (n=9)(n=9) WT (n=9)(n=10) 0 5 10 15 20 Number of PH3+ cells 48hpf 60hpf 72hpf *** WT 60hpf 72hpf 96hpf (n=8)vsxKO vsxKOvsxKO (n=8)WT (n=7)(n=12) WT (n=6)(n=9) 0 5 10 15 20 Number of C3+ cells INL *** *** GCL INL ONL GCL INL ONL GCL INL ONL GCL INL ONL GCL INL ONL GCL INL ONL GCL INL ONL GCL INL ONL GCL INL ONL GCL INL ONL GCL INL ONL GCL INL ONL Figure 3. Mitosis and apoptosis markers expression are increased in vsxKO retinas. (af). Phosphohistone H3 (PH3) antibody staining reveals cell divisions in central retina cryosections from WT (ac) and vsxKO (df) samples at three different developmental stages (48, 60, and 72hpf). Increased PH3 staining was observed in vsxKO retinas at 60hpf (white arrowheads in e) compared to WT samples (white arrowheads in b). (gl). Caspase3 (C3) antibody Figure 3 continued on next page Research article Developmental Biology | Evolutionary Biology Letelier, Buono etal. eLife 2023;12:e85594. DOI: https://doi.org/10.7554/eLife.85594 8 of 27 Abnormal cell fate specification in the retina in vsxKO Our results indicated that, in contrast to Vsx2 early requirement in the mouse (Burmeister etal., 1996), vsx genes are not essential for the early specification of the neural retina in zebrafish (Figure1; Figure1—figure supplement 2). This fact facilitated the analysis of cell fate choices in vsxKO embryos. Although all retinal layers are present in double mutant animals (Figure1—figure supplement 3), the identity of the cells within these layers required further investigation. To examine cell fate acquisition in the INL and ONL of mutant retinas, fluorescent antisense probes or antibodies for specific markers of PRs (prdm1a), bipolar (prox1, prkcbb), amacrine (ptf1a, pax6), and Müller glia cells (gfap) were examined at 4872hpf (Figure4; Figure4—figure supplement 2). ONL/photoreceptors specification Prdm1a (or Blimp1) is a transcription factor that has been shown to play an early role in the specification of PR identity, mainly by the suppression of bipolar cell fate genes, including vsx2 (Brzezinski etal., 2010; Katoh etal., 2010). Conversely, vsx2 acute knockdown by electroporation in the postnatal mouse retina triggers a bipolar to rod fate shift (Goodson etal., 2020; LivneBar etal., 2006). In this study, the comparative analysis of the transient marker prdm1a (Wilm and SolnicaKrezel, 2005) between wild type and vsxKO embryos revealed a mild downregulation in the mutants at 72 hpf (n=6) (Figure 4a and e), which is in agreement with the delayed differentiation of the photoreceptors we observed in vsxKO animals (Figure4—figure supplement 1). However, when we examined terminal differentiation markers for cones (Ab Zpr1) and rods (Ab Zpr3) at 72 and 96hpf, a delayed differentiation of both cell types was observed in double mutant embryos (Figure4—figure supplement 1). Whereas Zpr1 and Zpr3 staining could be detected in the entire ONL in wild type fish from 72hpf on (Figure4— figure supplement 1a–c, hj), in 72 hpf vsxKO embryos the staining was restricted to a few cells in the ventral retina (Figure 4—figure supplement 1d, k) and was only extended to the entire ONL at 96 hpf (Figure4—figure supplement 1e, l). At 6dpf, there is a significant increase of Zpr1 fluorescent intensity in vsxKO compared to WT retinas (Figure 4—figure supplement 1c, f, g), but no major differences were observed in rod stain intensity (Figure4—figure supplement 1j, m, n). This result suggests that PRs’ differentiation staining was used to evaluate cell death in central retina cryosections from WT (gi) and vsxKO (jl) samples at three different developmental stages (60, 72, and 96hpf). Aberrant C3 staining was observed in vsxKO retinas at 72 and 96hpf (white arrowheads in k and l) compared to WT samples (h and i). m. Quantification of PH3 positive cells in WT and vsxKO retinas at different stages. Using an unpaired ttest, a significant increase in PH3 positive cells was observed in vsxKO samples at 60hpf compared to WT (***p<0.0001) but no significant changes were observed at other stages analysed (48 and 72hpf). n. Quantification of C3 positive cells in WT and vsxKO retinas at different stages. Significant increase in C3positive cells was observed in vsxKO samples at 72 and 96hpf compared to WT (***p<0.0001), but no change was observed at 60hpf using an unpaired ttest. Data is shown as mean ± SD. ONL: outer nuclear layer, INL: inner nuclear layer, GCL: ganglion cell layer, hpf: hours postfertilization. Scale bar in (al): 50µm. The online version of this article includes the following figure supplement(s) for figure 3: Figure supplement 1. Delayed differentiation but normal RPE and proliferation in zebrafish vsxKO eyes at 24‐26hpf. Figure 3 continued Video 1. vsxKO larvae show normal GCL retinotectal projections. (a, b). 3D reconstructions of confocal stacks from zebrafish larval eyes injected with either DiO (green) or DiI (red) to label retinal ganglion cells and their projections to the optic tectum in wildtype (a, n=6) and vsxKO (b, n=8) at 6dpf. Note that vsxKO larvae show apparently normal retinotectal projections. https://elifesciences.org/articles/85594/figures#video1 Research article Developmental Biology | Evolutionary Biology Letelier, Buono etal. eLife 2023;12:e85594. DOI: https://doi.org/10.7554/eLife.85594 9 of 27 program is delayed in the absence of vsx function and that cone cells are overrepresented in the ONL of the double mutants. A prolonged period of precursors’ proliferation and/or competence could account for an increased number of PRs at larval stages, and thus for an expanded thickness of the ONL layer, as observed in double mutants at 6 dpf (Figure1; Figure1—figure supplement 3). INL/bipolar cells specification In the zebrafish retina, vsx1 and vsx2 expression has been reported in complementary subsets of bipolar cells, with vsx1 having a broader distribution and vsx2 being restricted to a few bipolar subtypes (Vitorino etal., 2009). To analyse bipolar cell integrity in vsxKO embryos, we first performed immunohistochemistry for the general INL marker prox1 (Figure4—figure supplement 2; Dyer, 2003) and then fluorescent in situ hybridizations for the bipolar cell marker protein kinase Cb1 (prkcbb) (Figure4). At 48hpf, no changes in the expression of prox1 was detected between WT and vsxKO retinas (Figure4—figure supplement 2a, e). However, at 72hpf the nuclear distribution of prox1 in the INL is affected in vsxKO samples compared to WT retinas (Figure4—figure supplement 2b, b’, f, f’) suggesting a lack of bipolar cells in vsxKO retinas. This observation was further confirmed by the fact that at 72hpf prkcbb expression is very reduced, if not absent, in the INL of double mutant retinas compared to WT (n=5) (Figure4b and f). These results are in agreement with our previous histological Bipolar Amacrine Müller glia Photoreceptor vsxKO Wildtype prdm1a prdm1a ptf1a ptf1a gfap gfap prkcbb prkcbb a ef gh bcd GCL INL ONL GCL INL ONL GCL INL ONL GCL INL ONL GCL INL ONL GCL INL ONL GCL INL ONL GCL INL ONL Figure 4. Altered expression of Bipolar and Müller glia cell markers in 3dpf vsx mutant fish. (ah). Confocal sections from in toto in situ hybridization experiments using specific fluorescent probes to label different cell types in wildtype and vsxKO retinas at 72hpf. No clear differences in the expression of the photoreceptor marker prdm1a were observed in ONL of wildtype (a) and mutant samples (e). Bipolar cell marker prkcbb expression (b, f) is considerably reduced in the INL of vsxKO mutant retinas (f, white arrowheads) compared to wildtype (b). Similar expression of the amacrine cell marker ptf1a is observed in the INL from wildtype (c) and vsxKO (g) retinas. Increased expression of the Müller glia cell marker gfap (d, h) is observed in the INL of vsxKO samples (h, white arrowheads) compared to wildtype (d) retinas. ONL: outer nuclear layer, INL: inner nuclear layer, GCL: ganglion cell layer. Scale bar in (ah): 50µm. The online version of this article includes the following figure supplement(s) for figure 4: Figure supplement 1. Delayed photoreceptor differentiation is observed in vsxKO retinas. Figure supplement 2. Analysis of INL markers prox1, ptf1a, and pax6 in WT and vsxKO retinas. Figure supplement 3. V2 spinal cord interneurons are not affected by the mutation of Vsx TFs. Research article Developmental Biology | Evolutionary Biology Letelier, Buono etal. eLife 2023;12:e85594. DOI: https://doi.org/10.7554/eLife.85594 16 of 27 Table 1. Nucleotide sequence of oligos used in this work. Organism, gene of interest, application and nucleotide sequence is described in each column. Note that the target site is bolded in CRISPR/Cas9 primers used for vsx disruption. Organism Gene Application Oligo sequence (5’–3’) Danio rerio vsx1 CRISPR/Cas9 TAATACGACTCACTATAGGGTTCCTCAAGTTGATGGGGTTTTAGAGCTAGAA Danio rerio vsx1 CRISPR/Cas9 TAATACGACTCACTATAGGTTTACGCGAGAGAAATGCGTTTTAGAGCTAGAA Danio rerio vsx2 CRISPR/Cas9 TAATACGACTCACTATAGGTGCCGGAGGACAGAATACGTTTTAGAGCTAGAA Danio rerio vsx2 CRISPR/Cas9 TAATACGACTCACTATAGGTGGAGAAAGCTTTTAACGGTTTTAGAGCTAGAA Danio rerio vsx1 Genotyping Fw ATGACTGCCTTTCCGGTGAT Danio rerio vsx1 Genotyping Rv CTGCTGGCTCACCTAGAAGC Danio rerio vsx2 Genotyping Fw TCGTAATCTTTCCACTGATTCTGAT Danio rerio vsx2 Genotyping Rv TGTTCTAGAGCATATTGTCTGTTCC Danio rerio vsx1 Cloning Fw CGGGAAGAGAAGAAGCTACAGAT Danio rerio vsx1 Cloning Rv GCCTTCTCTTTTTCCTCTTTTGA Danio rerio vsx2 Cloning Fw CTGTTTTGTCGGAAAGTTTGAA Danio rerio vsx2 Cloning Rv CCAGCTGGTAAGATGTAAATATTGTT Danio rerio ptf1a Cloning Fw GGCTTAGACTCTTTCTCCTCCTC Danio rerio ptf1a Cloning Rv CGTAGTCTGGGTCATTTGGAGAT Danio rerio gfap Cloning Fw GTTCCTTCTCATCCTACCGAAAG Danio rerio gfap Cloning Rv GATCAGCAAACTTTGAGCGATAC Danio rerio pkcb1 Cloning Fw GCGCAGTAAGCACAAGTTCAAGG Danio rerio pkcb1 Cloning Rv CCCAGCCAGCATCTCATATAGC Danio rerio prdm1a Cloning Fw TCAAAACGGCATGAACATCTATT Danio rerio prdm1a Cloning Rv AGGGGTTTGTCTTTCAGAGAAGT Table 1 continued on next page Research article Developmental Biology | Evolutionary Biology Letelier, Buono etal. eLife 2023;12:e85594. DOI: https://doi.org/10.7554/eLife.85594 17 of 27 Organism Gene Application Oligo sequence (5’–3’) Danio rerio tal1 Cloning Fw AGTATGATTTGCTCATCCTCCAA Danio rerio tal1 Cloning Rv TTTGTTTGTTTGCGCATTTAATA Danio rerio tfec Cloning Fw TATAAAGACCGGACGGGGACAAC Danio rerio tfec Cloning Rv CAGCTCCTGGATTCGTAGCTGGA Danio rerio bhlhe40 Cloning Fw TTGCAAATCGGCGAACAGGG Danio rerio bhlhe40 Cloning Rv GGAAACGTGCACGCAGTCG Danio rerio eef1a1l1 qPCR Fw TCCACCGGTCACCTGATCTAC Danio rerio eef1a1l1 qPCR Rv CAACACCCAGGCGTACTTGA Danio rerio vsx1 qPCR Fw TCTAGGTGAGCCAGCAGGAAT Danio rerio vsx1 qPCR Rv CCATGTCGTGTCGCTGTCTT Danio rerio vsx2 qPCR Fw GGGATTAATTGGGCCTGGAGG Danio rerio vsx2 qPCR Rv GCTGGCAGACTGGTTATGTTCC Danio rerio six3a qPCR Fw AAAAACAGGCTCCAGCATCAA Danio rerio six3a qPCR Rv AAGAATTGACGTGCCCGTGT Danio rerio six3b qPCR Fw TCCCCGTCGTTTTGTCTCTG Danio rerio six3b qPCR Rv AGAAGTTTAGGGTGGGCAGC Danio rerio lhx2b qPCR Fw AGGCAAGATTTCGGATCGCT Danio rerio lhx2b qPCR Rv TCTCTGCACCGAAAACCTGTA Danio rerio mitfa qPCR Fw CTGATGGCTTTCCAGTAGCAGA Danio rerio mitfa qPCR Rv GCTTTCAGGATGGTGCCTTT Danio rerio nr2e1 qPCR Fw CAAATCTGGCACACAGGGCG Danio rerio nr2e1 qPCR Rv CGACGAACCGTTCACCTCTT Table 1 continued Table 1 continued on next page Research article Developmental Biology | Evolutionary Biology Letelier, Buono etal. eLife 2023;12:e85594. DOI: https://doi.org/10.7554/eLife.85594 18 of 27 Organism Gene Application Oligo sequence (5’–3’) Danio rerio prrx1a qPCR Fw CTCACCGTCATACAGTGCCA Danio rerio prrx1a qPCR Rv AGAGTCTTTGACAGCCCAGC Danio rerio rorab qPCR Fw ACAAACCAGCACCAGTTCGG Danio rerio rorab qPCR Rv CCTCCTGAAGAAACCCTTGCAT Danio rerio rx1 qPCR Fw AAGAACTTGCATCGGACGGT Danio rerio rx1 qPCR Rv TCGGAAGCTTGCATCCAGTT Danio rerio rx2 qPCR Fw TCGGGACGCATAAAGTGGAC Danio rerio rx2 qPCR Rv CGGGTCTCCCAAATCTGCAT Danio rerio rx3 qPCR Fw CCGAGTACAGGTGTGGTTCC Danio rerio rx3 qPCR Rv GTCAACCAGGGCTCTAACGG Danio rerio hmx4 qPCR Fw TGTCGACCCGCTTCTTTGAA Danio rerio hmx4 qPCR Rv TGATGAAGACAGCCATCCCG Oryzias latipes vsx1 CRISPR/Cas9 TAATACGACTCACTATAGGCAGAGTGAGGTTCAGTGGGTTTTAGAGCTAGAA Oryzias latipes vsx1 CRISPR/Cas9 TAATACGACTCACTATAGGTAGGGCCTGACCTGGATTGTTTTAGAGCTAGAA Oryzias latipes vsx2.1 CRISPR/Cas9 TAATACGACTCACTATAGGGGATGATGAGAGTCAAGGGTTTTAGAGCTAGAA Oryzias latipes vsx2.1 CRISPR/Cas9 TAATACGACTCACTATAGGAAAAAATAACAGAATTGAGTTTTAGAGCTAGAA Oryzias latipes vsx1 Genotyping Fw AACAATAATTTAAAATGCGGAAAAA Oryzias latipes vsx1 Genotyping Rv GAAACTAAAATCCCATTCAGTGCT Oryzias latipes vsx2.1 Genotyping Fw ATATCACGGGAAATTAAAATGCTC Oryzias latipes vsx2.1 Genotyping Rv AAGTCAAATGTGCCATTGTTAGTC Table 1 continued Research article Developmental Biology | Evolutionary Biology Letelier, Buono etal. eLife 2023;12:e85594. DOI: https://doi.org/10.7554/eLife.85594 19 of 27 Electroretinography (ERG) ERG was recorded on 5 dpf larvae as previously described (Zang etal., 2015). 100ms light stimuli delivered by HPX2000 (Ocean Optics) were attenuated (log4 to log0) by neutral density filters and given with an interval of 15s. Full light intensity was measured by spectrometer (Ocean Optics, USB2000+) with spectrum shown in S1 (SpectraSuite, Ocean Optics). Electronic signals were amplified 1000 times by a preamplifier (P55 A.C. Preamplifier, AstroMed. Inc, Grass Technology), digitized by DAQ Board (SCC68, National Instruments) and recorded by selfwritten Labview program (National Instruments). Figures were prepared using Microsoft Excel 2016. Optokinetic response (OKR) The OKR was recorded by the experiment setup as previously described (Mueller and Neuhauss, 2010). Briefly, 5dpf larvae were stimulated binocularly with sinusoidal gratings. To determine the contrast sensitivity, a spatial frequency of 20 cycles/360° and an angular velocity of 7.5deg/s were used with varying contrast (5, 10, 20, 40, 70, and 100%). To study the spatial sensitivity, an angular velocity of 7.5/s and 70% of the maximum contrast was used with different spatial frequency (7, 14, 21, 28, 42, 56 cycles/360°). To analyse the temporal sensitivity, maximum contrast and a spatial frequency of 20 cycles/360° were applied with increasing temporal frequency (5, 10, 15, 20, 25, 30deg/s). Figures were presented by SPSS (Version 23.0. Armonk, NY: IBM Corp). Immunohistochemistry in sections Zebrafish wildtype and vsxKO retina sections from different developmental stages were analysed for the detection of apoptotic and mitotic cells using rabbit antiactive caspase3 antibodies (BD Biosciences, 559565) and rabbit antiphosphohistone H3 antibodies (Merck Millipore, 06–570), respectively. For the detection of cone and rod photoreceptors, zpr1 (ZIRC) and zpr3 (ZIRC) antibodies were used, respectively. Briefly, eye transverse cryosections were dried at room temperature for≥3hr, washed five times for 5min each with PBST, blocked for≥1hr with 10% fetal bovine serum in PBST and incubated overnight in a humid chamber at 4°C with the corresponding primary antibody. All primary antibodies were diluted 1:500 in blocking solution. After several washes with PBST, a 1:500 dilution of the secondary antibody (Alexa Fluor 555 goat antirabbit or goat antimouse antibodies, Thermo Fisher, #A21429 and #A21422, respectively) was added for 2hr at room temperature. Following extensive washes with PBST, slides were mounted in 15% glycerol/PBS solution and sealed with 22x60mm coverslips. Immunofluorescence confocal images were taken using a Leica SPE confocal microscope. Whole-mount embryo immunofluorescence Embryos collected from incrossed vsx1+/-; vsx2-/- adult fish were dechorionated and fixed at 72 hpf with 4% Formaldehyde in PBS (FA). Fixed embryos were washed with PBSTween 0.5%-Triton 0.5% (PBST), treated with Proteinase K (10µg/mL in PBST) for 30min at 37°C followed by PBST washes and a postfixation step in FA for 30min at room temperature (RT). After PBST washes, embryos were treated with cold acetone at –20°C for 20min, then washed again with PBST and incubated with freshly prepared blocking solution (5% normal goat serum, 1% BSA, 1% DMSO in PBST) at RT for 2hr. Primary antibody specific for zebrafish Prox1 (GeneTex, GTX128354) and Pax6 (GeneTex, GTX128843) were diluted 1:100 in blocking solution and embryos were incubated overnight (ON) at 4°C. Embryos were subsequently washed with PBST and incubated ON at 4°C in the dark with the Alexa FluorTM 488 Goat antirabbit antibody (Invitrogen), diluted 1:500. Finally, embryos were washed with PBST and incubated ON at 4°C with DAPI (Sigma) diluted 1:5000 in PBST. For imaging, embryos were embedded in 1% lowmelting point agarose, transferred to glassbottom culture dishes (MatTek corporation) and manually oriented. Confocal laser scanning microscopy was performed using an LSM 880 microscope (Zeiss). Images were processed using Fiji. After imaging, embryos were genotyped by PCR to identify vsx1-/-; vsx2-/- double mutant embryos. RNA in situ hybridization Fluorescence in situ hybridization experiments were performed as previously described (Bogdanović etal., 2012). Fragments of the vsx1, vsx2, ptf1a, prdm1a, gfap, prkcbb, tfec, bhlhe40 and tal1 genes were PCR amplified from zebrafish cDNA (SuperScript IV VILO Master Mix ThermoFisher Scientific, #11756050) using specific primers (Table1). For vsx1 and vsx2 genes, the deleted region of Research article Developmental Biology | Evolutionary Biology Letelier, Buono etal. eLife 2023;12:e85594. DOI: https://doi.org/10.7554/eLife.85594 20 of 27 the coding sequence in vsxKO mutants was excluded from the amplified fragment. PCR products were cloned into StrataClone PCR Cloning vector (Agilent, #240205), linearized with XbaI restriction enzyme (Takara, #1093B) and transcribed with a DIGlabeling Kit (Roche, #11277073910) using T3 polymerase (Roche, #11031163001) to obtain digoxigeninlabeled antisense probes. Probes were used at a final concentration of 2ng/µl diluted in hybridization buffer (Thisse and Thisse, 2008). For atoh7, a colorimetric antisense digoxigeninlabeled RNA probe was prepared as reported elsewhere (Masai etal., 2000). Morpholino injections The vsx2E2I2 splicing morpholino was obtained from Gene Tools and injected as reported before (GagoRodrigues etal., 2015). For RNAseq experiments, vsx2 morphants where coinjected with lynTdtomato mRNA at a concentration of 50ng/µL. At 16 hpf, red fluorescent embryos were pooled under the stereoscope and heads were dissected at 18 hpf for total RNA extraction. RNA-seq Total RNA was extracted from 18 hpf zebrafish embryos’ heads using 1 ml TRIzol (Invitrogen, #15596026) following the manufacturer’s protocol. The trunk and tail of the embryos was used to extract genomic DNA using Chelex resin (C7901, Sigma) for PCR screening. Potential DNA contamination was eliminated by treating RNA samples with TURBO DNAsefree kit (Ambion, #AM1907). The concentration of the RNA samples was evaluated by Qubit spectrophotometer (Thermo Fisher). Libraries were prepared with TruSeq stranded mRNA kit (Illumina) and sequenced 2x125bp on an Illumina Nextseq platform. We obtain at least 33million reads per sample. Three biological replicates were used for each analysed condition. Reads were aligned to the danRer10 zebrafish genome assembly using hisat2 (Kim etal., 2015). Transcript abundance was estimated with Cufflinks v2.2.1. Differential gene expression analysis was performed using Cuffdiff v2.2.1, setting an adjusted <i>Pvalue <0.05. PCA analysis were done using CummeRbund, R package version 2.40.0 (Goff and Trapnell, 2022). Heatmap visualization was obtained with Clustvis (Metsalu and Vilo, 2015) using the FPKMs normalized by row as input. qPCR cDNA retrotranscription and qPCR were performed as previously described (VázquezMarín etal., 2019). eef1a1l1 gene was used as housekeeping normalization control. Primer sequences for amplified genes are detailed in Table1. ATAC-seq Each ATACseq sample was obtained starting from a single 18 hpf zebrafish embryo’s head manually dissected, while the trunk and tail was kept for conventional PCR genotyping. Tagmentation and library amplification were performed using the FASTATAC protocol previously described (Corces etal., 2016). We obtained at least 70 M reads from the sequencing of each library. For data comparison, we used two biological replicates for each condition. Reads were aligned to the danRer10 zebrafish genome using Bowtie2 (Langmead and Salzberg, 2012) with -X 2000—nomixed—nounal parameters. PCR artifacts and duplicates were removed with the tool rmdup, available in the Samtools toolkit (Li etal., 2009). In order to detect the exact position where the transposase binds to the DNA, read start sites were offset by+4/–5bp in the plus and minus strands. Read pairs that have an insert < 130 bp were selected as nucleosomefree reads. Differential chromatin accessibility was calculated as reported (Magri etal., 2019). All chromatin regions reporting differential accessibility with an adjusted pvalue < 0.05 were considered as DOCRs. All the DOCRS have been associated with genes using the online tool GREAT (McLean etal., 2010) with the option ‘basal plus extension’. Gene ontology enrichment analysis of the genes associated with DOCRs was performed with PANTHER (Mi etal., 2021). Labeling of retinotectal projections (DiI/DiO injections) Following PCR genotyping, 6 dpf wildtype and vsx mutant larvae were fixed in 4% PFA overnight, washed in PBS and embedded in 1% low melting agarose (Sigma, #A9414) in PBS on an agarose filled Petri dish for injection. Each eye (between the lens and the retina) of the fish was injected either with Research article Developmental Biology | Evolutionary Biology Letelier, Buono etal. eLife 2023;12:e85594. DOI: https://doi.org/10.7554/eLife.85594 21 of 27 1% DiI (Invitrogen, #D275) or 1% DiO (Invitrogen, #D282) solutions in Chloroform (or dimethylformamide) with a pulled capillary glass mounted on a micromanipulator and under a stereomicroscope. A PV820 Pneumatic PicoPump (WPI) with the appropriate setting to deliver pressure to label the whole retina was used. Injected simples were washed in PBS, maintained overnight at 4°C and mounted on low melting agarose to image on a Zeiss LSM 710 confocal microscope. Zstacks (0.5 µm x 0.5µm x 1µm) were collected to visualize the optic nerve reaching the tectum and 3D reconstructions were generated using Zen blue edition software (Zeiss). Total protein extraction and western blotting analysis Vsx1 and Vsx2 protein presence was analysed by Western blotting. To accomplish this, three different samples were prepared: the first two contained 20 heads of wildtype or vsxKO embryos at 24 hpf stage and the third sample comprised 20 wildtype embryos at 1.5 hpf. Each set of embryos were shaken for 5min at 1100rpm in deyolking buffer (55mM NaCl, 1.8mM KCl and 1.25mM NaHCO3). Tubes were then centrifuged at 300g for 30s, and subsequently the pellets were rinsed with wash buffer (10mM TrisHCl pH8.0, 110mM NaCl, 3.5mM KCl and 2.7mM CaCl2). Then, each pellet was resuspended in 25µL SDS buffer (100mM TrisHCl pH 6.8, 4% SDS, 20% glycerol and 200mM DTT) and heated at 95°C for 5min. After that, samples were centrifuged at 16,000g for 20min at 4°C and supernatants were collected. Protein extracts were loaded in 10% TGX StainFreeTM FastCastTM Acrylamide (BioRad) and blotted onto nitrocellulose membranes. Western blot normalization was performed using total protein load following manufacturer protocol for Stain Free gels (Bio Rad). Vsx1 (A10801, https://www.antibodies.com/) and Vsx2 (X1180P, Abintek) antibodies were used at a 1:500 dilution, followed by incubation with antiRabbit IgGHRP secondary antibody (AP160P, Chemicon), diluted to 1:10000 for Vsx1 detection and Rabbit antiSheep IgGHRP secondary antibody (402100, Calbiochem) diluted to 1:2000 for Vsx2. Chemiluminescent signals were detected with SuperSignal West Femto Substrate (Thermo Scientific) in a ChemiDoc MP Imaging System (BioRad). Statistical analysis Quantitative data were evaluated using Prism 9.0 GraphPad software. Twoway ANOVA and a Tukey post hoc test was used to analyse ERG data, oneway ANOVA for OKR recordings and qPCR. Unpaired t test were used for PH3+ cell counts, C3+ cell counts, total eye area, retina layers’ width, trunk V2 neuron comparisons and Zpr1/3 fluorescent intensity labeling. n values and significance levels are indicated in figure legends. Acknowledgements We thank Marta Magri for their scientific advice and the CABD Proteomics, Aquatic Vertebrates and Functional Genomics facilities for their excellent technical assistance. This work was supported by grants awarded to JL from ANID (FONDECYT Iniciación #11180727, FONDECYT Regular #1230903) and JRMM from Junta de Andalucía (Reference PY20_00006), CSIC (Reference 2020AEP014), and Spanish Ministry of Science, Innovation and Universities: (References BFU201786339P, RED2018102553T, PID2020112566GBI00, and CEX2020001088M). Additional information Funding Funder Grant reference number Author Fondo Nacional de Desarrollo Científico y Tecnológico 11180727 Joaquín Letelier Fondo Nacional de Desarrollo Científico y Tecnológico 1230903 Joaquín Letelier JUNTA DE ANDALUCIA PY20_00006 Juan R Martínez-Morales Research article Developmental Biology | Evolutionary Biology Letelier, Buono etal. eLife 2023;12:e85594. DOI: https://doi.org/10.7554/eLife.85594 22 of 27 Funder Grant reference number Author Consejo Superior de Investigaciones Científicas 2020AEP014 Juan R Martínez-Morales Spanish Ministry of Science, Innovation and Universities BFU2017-86339P Juan R Martínez-Morales Spanish Ministry of Science, Innovation and Universities CEX2020-001088-M Juan R Martínez-Morales Spanish Ministry of Science, Innovation and Universities PID2020-112566GB-I00 Juan R Martínez-Morales Spanish Ministry of Science, Innovation and Universities RED2018-102553-T Juan R Martínez-Morales The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication. Author contributions Joaquín Letelier, Conceptualization, Data curation, Formal analysis, Supervision, Funding acquisition, Investigation, Methodology, Writing – original draft, Project administration, Writing – review and editing; Lorena Buono, Jorge Corbacho, Data curation, Formal analysis, Investigation, Methodology; María AlmuedoCastillo, Data curation, Formal analysis, Investigation; Jingjing Zang, Data curation, Investigation; Constanza Mounieres, Sergio GonzálezDíaz, Ana SousaOrtega, Ruth Diez del Corral, Investigation; Rocío Polvillo, Stephan CF Neuhauss, Funding acquisition, Investigation; Estefanía SanabriaReinoso, Juan R MartínezMorales, Conceptualization, Resources, Formal analysis, Supervision, Funding acquisition, Investigation, Writing – original draft, Project administration, Writing – review and editing Author ORCIDs Joaquín Letelier http://orcid.org/0000-0002-2406-0337 Lorena Buono http://orcid.org/0000-0002-5457-4515 Ruth Diez del Corral http://orcid.org/0000-0003-2649-7214 Stephan CF Neuhauss http://orcid.org/0000-0002-9615-480X Juan R MartínezMorales http://orcid.org/0000-0002-4650-4293 Ethics All experiments performed in this work comply European Community standards for the use of animals in experimentation and were approved by ethical committees from Universidad Pablo de Olavide (#02/04/2018/041), Consejo Superior de Investigaciones Científicas (CSIC), the Andalusian government and Universidad Mayor (#25/2018). Zebrafish AB/Tübingen (AB/TU) and medaka iCab wildtype strains were staged, maintained and bred under standard conditions. Decision letter and Author response Decision letter https://doi.org/10.7554/eLife.85594.sa1 Author response https://doi.org/10.7554/eLife.85594.sa2 Additional files Supplementary files • MDAR checklist Data availability Sequencing data have been deposited in GEO under accession code GSE189739. Research article Developmental Biology | Evolutionary Biology Letelier, Buono etal. eLife 2023;12:e85594. DOI: https://doi.org/10.7554/eLife.85594 23 of 27 The following dataset was generated: Author(s) Year Dataset title Dataset URL Database and Identifier Letelier J, Buono L 2022 Mutation of Vsx genes in zebrafish highlights the robustness of the retinal specification network https://www. ncbi. nlm. nih. gov/ geo/ query/ acc. cgi? acc= GSE189739 NCBI Gene Expression Omnibus, GSE189739 References Barabino SM, Spada F, Cotelli F, Boncinelli E. 1997. Inactivation of the zebrafish homologue of CHX10 by antisense oligonucleotides causes eye malformations similar to the ocular retardation phenotype. Mechanisms of Development 63:133–143. DOI: https://doi.org/10.1016/s0925-4773(97)00036-1, PMID: 9203137 BarYosef U, Abuelaish I, Harel T, Hendler N, Ofir R, Birk OS. 2004. Chx10 mutations cause nonsyndromic microphthalmia/ anophthalmia in Arab and Jewish kindreds. Human Genetics 115:302–309. DOI: https://doi. org/10.1007/s00439-004-1154-2, PMID: 15257456 Bassett EA, Wallace VA. 2012. Cell fate determination in the vertebrate retina. Trends in Neurosciences 35:565–573. DOI: https://doi.org/10.1016/j.tins.2012.05.004, PMID: 22704732 Bernardos RL, Raymond PA. 2006. Gfap transgenic zebrafish. Gene Expression Patterns 6:1007–1013. DOI: https://doi.org/10.1016/j.modgep.2006.04.006, PMID: 16765104 Bilotta J, Saszik S, Sutherland SE. 2001. Rod contributions to the electroretinogram of the darkadapted developing zebrafish. Developmental Dynamics 222:564–570. DOI: https://doi.org/10.1002/dvdy.1188, PMID: 11748826 Bogdanović O, DelfinoMachín M, NicolásPérez M, Gavilán MP, GagoRodrigues I, FernándezMiñán A, Lillo C, Ríos RM, Wittbrodt J, MartínezMorales JR. 2012. Numb/numblopo antagonism controls retinal epithelium morphogenesis by regulating integrin endocytosis. Developmental Cell 23:782–795. DOI: https://doi.org/10. 1016/j.devcel.2012.09.004, PMID: 23041384 Brzezinski JA, Lamba DA, Reh TA. 2010. Blimp1 controls photoreceptor versus bipolar cell fate choice during retinal development. Development 137:619–629. DOI: https://doi.org/10.1242/dev.043968, PMID: 20110327 Buono L, MartinezMorales JR. 2020. Retina development in vertebrates: systems biology approaches to understanding genetic programs: on the contribution of nextgeneration sequencing methods to the characterization of the regulatory networks controlling vertebrate eye development. BioEssays 42:e1900187. DOI: https://doi.org/10.1002/bies.201900187, PMID: 31997389 Buono L, Corbacho J, Naranjo S, AlmuedoCastillo M, MorenoMarmol T, de la Cerda B, SanabriaReinoso E, Polvillo R, DíazCorrales FJ, Bogdanovic O, Bovolenta P, MartínezMorales JR. 2021. Author correction: analysis of gene network bifurcation during optic cup morphogenesis in zebrafish. Nature Communications 12:4665. DOI: https://doi.org/10.1038/s41467-021-24834-x, PMID: 34315888 Burmeister M, Novak J, Liang MY, Basu S, Ploder L, Hawes NL, Vidgen D, Hoover F, Goldman D, Kalnins VI, Roderick TH, Taylor BA, Hankin MH, McInnes RR. 1996. Ocular retardation mouse caused by CHX10 homeobox null allele: impaired retinal progenitor proliferation and bipolar cell differentiation. Nature Genetics 12:376– 384. DOI: https://doi.org/10.1038/ng0496-376, PMID: 8630490 Capowski EE, Wright LS, Liang K, Phillips MJ, Wallace K, Petelinsek A, Hagstrom A, Pinilla I, Borys K, Lien J, Min JH, Keles S, Thomson JA, Gamm DM. 2016. Regulation of Wnt signaling by Vsx2 during optic vesicle patterning in human induced pluripotent stem cells. Stem Cells 34:2625–2634. DOI: https://doi.org/10.1002/ stem.2414, PMID: 27301076 Chen CM, Cepko CL. 2000. Expression of CHX10 and CHX101 in the developing chicken retina. Mechanisms of Development 90:293–297. DOI: https://doi.org/10.1016/s0925-4773(99)00251-8, PMID: 10640715 Chow RL, Snow B, Novak J, Looser J, Freund C, Vidgen D, Ploder L, McInnes RR. 2001. Vsx1, a rapidly evolving pairedlike homeobox gene expressed in cone bipolar cells. Mechanisms of Development 109:315–322. DOI: https://doi.org/10.1016/s0925-4773(01)00585-8, PMID: 11731243 Chow RL, Volgyi B, Szilard RK, Ng D, McKerlie C, Bloomfield SA, Birch DG, McInnes RR. 2004. Control of late offcenter cone bipolar cell differentiation and visual signaling by the homeobox gene Vsx1. PNAS 101:1754– 1759. DOI: https://doi.org/10.1073/pnas.0306520101, PMID: 14745032 Clark AM, Yun S, Veien ES, Wu YY, Chow RL, Dorsky RI, Levine EM. 2008. Negative regulation of Vsx1 by its paralog chx10/vsx2 is conserved in the vertebrate retina. Brain Research 1192:99–113. DOI: https://doi.org/10. 1016/j.brainres.2007.06.007, PMID: 17919464 Corces MR, Buenrostro JD, Wu B, Greenside PG, Chan SM, Koenig JL, Snyder MP, Pritchard JK, Kundaje A, Greenleaf WJ, Majeti R, Chang HY. 2016. LineageSpecific and singlecell chromatin accessibility charts human hematopoiesis and leukemia evolution. Nature Genetics 48:1193–1203. DOI: https://doi.org/10.1038/ng.3646, PMID: 27526324 Crone SA, Quinlan KA, Zagoraiou L, Droho S, Restrepo CE, Lundfald L, Endo T, Setlak J, Jessell TM, Kiehn O, Sharma K. 2008. Genetic ablation of v2a ipsilateral interneurons disrupts leftright locomotor coordination in mammalian spinal cord. Neuron 60:70–83. DOI: https://doi.org/10.1016/j.neuron.2008.08.009, PMID: 18940589 Research article Developmental Biology | Evolutionary Biology Letelier, Buono etal. eLife 2023;12:e85594. DOI: https://doi.org/10.7554/eLife.85594 24 of 27 Dorval KM, Bobechko BP, Ahmad KF, Bremner R. 2005. Transcriptional activity of the pairedlike homeodomain proteins CHX10 and VSX1. Journal of Biological Chemistry 280:10100–10108. DOI: https://doi.org/10.1074/ jbc.M412676200 Dyer MA. 2003. The homeodomain proteins Prox1, SIX3 and CHX10 regulate proliferation, cell fate specification and differentiation in the developing retina. Cell Cycle 2:347–354. DOI: https://doi.org/10.4161/cc.2.4.429 ElBrolosy MA, Kontarakis Z, Rossi A, Kuenne C, Günther S, Fukuda N, Kikhi K, Boezio GLM, Takacs CM, Lai SL, Fukuda R, Gerri C, Giraldez AJ, Stainier DYR. 2019. Genetic compensation triggered by mutant mRNA degradation. Nature 568:193–197. DOI: https://doi.org/10.1038/s41586-019-1064-z, PMID: 30944477 Erclik T, Hartenstein V, Lipshitz HD, McInnes RR. 2008. Conserved role of the vsx genes supports a monophyletic origin for bilaterian visual systems. Current Biology 18:1278–1287. DOI: https://doi.org/10.1016/j.cub.2008.07. 076, PMID: 18723351 Ferda Percin E, Ploder LA, Yu JJ, Arici K, Horsford DJ, Rutherford A, Bapat B, Cox DW, Duncan AM, Kalnins VI, KocakAltintas A, Sowden JC, Traboulsi E, Sarfarazi M, McInnes RR. 2000. Human microphthalmia associated with mutations in the retinal homeobox gene CHX10. Nature Genetics 25:397–401. DOI: https://doi.org/10. 1038/78071, PMID: 10932181 Fleisch VC, Neuhauss SCF. 2006. Visual behavior in zebrafish. Zebrafish 3:191–201. DOI: https://doi.org/10.1089/ zeb.2006.3.191, PMID: 18248260 Focareta L, Sesso S, Cole AG. 2014. Characterization of homeobox genes reveals sophisticated regionalization of the central nervous system in the European cuttlefish Sepia officinalis. PLOS ONE 9:e109627. DOI: https:// doi.org/10.1371/journal.pone.0109627, PMID: 25286399 Fuhrmann S. 2010. Eye morphogenesis and patterning of the optic vesicle. Current Topics in Developmental Biology 93:61–84. DOI: https://doi.org/10.1016/B978-0-12-385044-7.00003-5 Fujitani Y, Fujitani S, Luo H, Qiu F, Burlison J, Long Q, Kawaguchi Y, Edlund H, MacDonald RJ, Furukawa T, Fujikado T, Magnuson MA, Xiang M, Wright CVE. 2006. Ptf1A determines horizontal and amacrine cell fates during mouse retinal development. Development 133:4439–4450. DOI: https://doi.org/10.1242/dev.02598, PMID: 17075007 Gagnon JA, Valen E, Thyme SB, Huang P, Akhmetova L, Pauli A, Montague TG, Zimmerman S, Richter C, Schier AF. 2014. Efficient mutagenesis by Cas9 proteinmediated oligonucleotide insertion and largescale assessment of singleguide RNAs. PLOS ONE 9:e98186. DOI: https://doi.org/10.1371/journal.pone.0098186, PMID: 24873830 GagoRodrigues I, FernándezMiñán A, Letelier J, Naranjo S, Tena JJ, GómezSkarmeta JL, MartinezMorales JR. 2015. Analysis of opo cisregulatory landscape uncovers Vsx2 requirement in early eye morphogenesis. Nature Communications 6:7054. DOI: https://doi.org/10.1038/ncomms8054, PMID: 25963169 Goff L, Trapnell CK. 2022. CummeRbund: analysis, exploration, manipulation, and visualization of cufflinks highthroughput sequencing data. 3.16. Bioconductor. https://doi.org/10.18129/B9.bioc.cummeRbund DOI: https://doi.org/10.18129/B9.bioc.cummeRbund Goldman D. 2014. Müller glial cell reprogramming and retina regeneration. Nature Reviews. Neuroscience 15:431–442. DOI: https://doi.org/10.1038/nrn3723, PMID: 24894585 Goodson NB, Kaufman MA, Park KU, Brzezinski JA. 2020. Simultaneous deletion of PRDM1 and Vsx2 enhancers in the retina alters photoreceptor and bipolar cell fate specification, yet differs from deleting both genes. Development 147:dev190272. DOI: https://doi.org/10.1242/dev.190272, PMID: 32541005 Green ES, Stubbs JL, Levine EM. 2003. Genetic rescue of cell number in a mouse model of microphthalmia: interactions between CHX10 and G1phase cell cycle regulators. Development130:539–552. DOI: https://doi. org/10.1242/dev.00275, PMID: 12490560 GregoryEvans CY, Williams MJ, Halford S, GregoryEvans K. 2004. Ocular coloboma: a reassessment in the age of molecular neuroscience. Journal of Medical Genetics 41:881–891. DOI: https://doi.org/10.1136/jmg.2004. 025494, PMID: 15591273 GregoryEvans CY, Wallace VA, GregoryEvans K. 2013. Gene networks: dissecting pathways in retinal development and disease. Progress in Retinal and Eye Research 33:40–66. DOI: https://doi.org/10.1016/j. preteyeres.2012.10.003, PMID: 23128416 Hatakeyama J, Tomita K, Inoue T, Kageyama R. 2001. Roles of homeobox and bHLH genes in specification of a retinal cell type. Development 128:1313–1322. DOI: https://doi.org/10.1242/dev.128.8.1313, PMID: 11262232 Heavner W, Pevny L. 2012. Eye development and retinogenesis. Cold Spring Harbor Perspectives in Biology 4:a008391. DOI: https://doi.org/10.1101/cshperspect.a008391, PMID: 23071378 Heon E. 2002. Vsx1: a gene for posterior polymorphous dystrophy and keratoconus. Human Molecular Genetics 11:1029–1036. DOI: https://doi.org/10.1093/hmg/11.9.1029 Hitchcock PF, Macdonald RE, VanDeRyt JT, Wilson SW. 1996. Antibodies against Pax6 immunostain amacrine and ganglion cells and neuronal progenitors, but not rod precursors, in the normal and regenerating retina of the goldfish. Journal of Neurobiology 29:399–413. DOI: https://doi.org/10.1002/(SICI)1097-4695(199603) 29:3<399::AID-NEU10>3.0.CO;2-4, PMID: 8907167 Horsford DJ, Nguyen MTT, Sellar GC, Kothary R, Arnheiter H, McInnes RR. 2005. Chx10 repression of MITF is required for the maintenance of mammalian neuroretinal identity. Development 132:177–187. DOI: https://doi. org/10.1242/dev.01571, PMID: 15576400 Iwamatsu T. 2004. Stages of normal development in the medaka Oryzias latipes. Mechanisms of Development 121:605–618. DOI: https://doi.org/10.1016/j.mod.2004.03.012, PMID: 15210170 Jusuf PR, Harris WA. 2009. Ptf1A is expressed transiently in all types of amacrine cells in the embryonic zebrafish retina. Neural Development 4:34. DOI: https://doi.org/10.1186/1749-8104-4-34 Research article Developmental Biology | Evolutionary Biology Letelier, Buono etal. eLife 2023;12:e85594. DOI: https://doi.org/10.7554/eLife.85594 25 of 27 Katoh K, Omori Y, Onishi A, Sato S, Kondo M, Furukawa T. 2010. Blimp1 suppresses CHX10 expression in differentiating retinal photoreceptor precursors to ensure proper photoreceptor development. The Journal of Neuroscience 30:6515–6526. DOI: https://doi.org/10.1523/JNEUROSCI.0771-10.2010, PMID: 20463215 Kim DS, Matsuda T, Cepko CL. 2008. A core pairedtype and POU homeodomaincontaining transcription factor program drives retinal bipolar cell gene expression. The Journal of Neuroscience 28:7748–7764. DOI: https:// doi.org/10.1523/JNEUROSCI.0397-08.2008 Kim D, Langmead B, Salzberg SL. 2015. HISAT: a fast spliced aligner with low memory requirements. Nature Methods 12:357–360. DOI: https://doi.org/10.1038/nmeth.3317 Kimmel CB, Ballard WW, Kimmel SR, Ullmann B, Schilling TF. 1995. Stages of embryonic development of the zebrafish. Developmental Dynamics 203:253–310. DOI: https://doi.org/10.1002/aja.1002030302, PMID: 8589427 Kimura Y., Satou C, Higashijima SI. 2008. V2a and v2b neurons are generated by the final divisions of pairproducing progenitors in the zebrafish spinal cord. Development 135:3001–3005. DOI: https://doi.org/10. 1242/dev.024802, PMID: 18684740 Kimura Y, Satou C, Fujioka S, Shoji W, Umeda K, Ishizuka T, Yawo H, Higashijima S. 2013. Hindbrain v2a neurons in the excitation of spinal locomotor circuits during zebrafish swimming. Current Biology 23:843–849. DOI: https://doi.org/10.1016/j.cub.2013.03.066, PMID: 23623549 Kok FO, Shin M, Ni CW, Gupta A, Grosse AS, van Impel A, Kirchmaier BC, PetersonMaduro J, Kourkoulis G, Male I, DeSantis DF, SheppardTindell S, Ebarasi L, Betsholtz C, SchulteMerker S, Wolfe SA, Lawson ND. 2015. Reverse genetic screening reveals poor correlation between morpholinoinduced and mutant phenotypes in zebrafish. Developmental Cell 32:97–108. DOI: https://doi.org/10.1016/j.devcel.2014.11.018, PMID: 25533206 Langmead B, Salzberg SL. 2012. Fast gappedread alignment with bowtie 2. Nature Methods 9:357–359. DOI: https://doi.org/10.1038/nmeth.1923, PMID: 22388286 Levine EM, Hitchcock PF, Glasgow E, Schechter N. 1994. Restricted expression of a new pairedclass homeobox gene in normal and regenerating adult goldfish retina. The Journal of Comparative Neurology 348:596–606. DOI: https://doi.org/10.1002/cne.903480409, PMID: 7836564 Li H, Handsaker B, Wysoker A, Fennell T, Ruan J, Homer N, Marth G, Abecasis G, Durbin R, 1000 Genome Project Data Processing Subgroup. 2009. The sequence alignment/map format and samtools. Bioinformatics 25:2078–2079. DOI: https://doi.org/10.1093/bioinformatics/btp352, PMID: 19505943 Liu IS, Chen JD, Ploder L, Vidgen D, van der Kooy D, Kalnins VI, McInnes RR. 1994. Developmental expression of a novel murine homeobox gene (CHX10): evidence for roles in determination of the neuroretina and inner nuclear layer. Neuron 13:377–393. DOI: https://doi.org/10.1016/0896-6273(94)90354-9, PMID: 7914735 LivneBar I, Pacal M, Cheung MC, Hankin M, Trogadis J, Chen D, Dorval KM, Bremner R. 2006. Chx10 is required to block photoreceptor differentiation but is dispensable for progenitor proliferation in the postnatal retina. PNAS 103:4988–4993. DOI: https://doi.org/10.1073/pnas.0600083103, PMID: 16547132 Magri MS, JiménezGancedo S, Bertrand S, Madgwick A, Escrivà H, Lemaire P, GómezSkarmeta JL. 2019. Assaying chromatin accessibility using ATACseq in invertebrate chordate embryos. Frontiers in Cell and Developmental Biology 7:372. DOI: https://doi.org/10.3389/fcell.2019.00372, PMID: 32039199 MartinezMorales JR. 2016. Vertebrate eye gene regulatory networks. Organogenetic Gene Networks: Genetic Control of Organ Formation 1:259–274. DOI: https://doi.org/10.1007/978-3-319-42767-6 Masai I, Stemple DL, Okamoto H, Wilson SW. 2000. Midline signals regulate retinal neurogenesis in zebrafish. Neuron 27:251–263. DOI: https://doi.org/10.1016/s0896-6273(00)00034-9, PMID: 10985346 MatíasPérez D, GarcíaMontaño LA, CruzAguilar M, GarcíaMontalvo IA, NavaValdéz J, BarragánArevalo T, VillanuevaMendoza C, Villarroel CE, GuadarramaVallejo C, la Cruz RV, ChacónCamacho O, Zenteno JC. 2018. Identification of novel pathogenic variants and novel genephenotype correlations in Mexican subjects with microphthalmia and/or anophthalmia by nextgeneration sequencing. Journal of Human Genetics 63:1169– 1180. DOI: https://doi.org/10.1038/s10038-018-0504-1, PMID: 30181649 McLean CY, Bristor D, Hiller M, Clarke SL, Schaar BT, Lowe CB, Wenger AM, Bejerano G. 2010. Great improves functional interpretation of cisregulatory regions. Nature Biotechnology 28:495–501. DOI: https://doi.org/10. 1038/nbt.1630, PMID: 20436461 Metsalu T, Vilo J. 2015. ClustVis: a web tool for visualizing clustering of multivariate data using principal component analysis and heatmap. Nucleic Acids Research 43:W566–W570. DOI: https://doi.org/10.1093/nar/ gkv468, PMID: 25969447 Meyer A, Schartl M. 1999. Gene and genome duplications in vertebrates: the onetofour (- toeight in fish) rule and the evolution of novel gene functions. Current Opinion in Cell Biology 11:699–704. DOI: https://doi.org/ 10.1016/s0955-0674(99)00039-3, PMID: 10600714 Mi H, Ebert D, Muruganujan A, Mills C, Albou LP, Mushayamaha T, Thomas PD. 2021. Panther version 16: a revised family classification, treebased classification tool, enhancer regions and extensive API. Nucleic Acids Research 49:D394–D403. DOI: https://doi.org/10.1093/nar/gkaa1106, PMID: 33290554 MintzHittner HA, Semina EV, Frishman LJ, Prager TC, Murray JC. 2004. Vsx1 (RINX) mutation with craniofacial anomalies, empty sella, corneal endothelial changes, and abnormal retinal and auditory bipolar cells. Ophthalmology 111:828–836. DOI: https://doi.org/10.1016/j.ophtha.2003.07.006, PMID: 15051220 MorenoMateos MA, Vejnar CE, Beaudoin JD, Fernandez JP, Mis EK, Khokha MK, Giraldez AJ. 2015. CRISPRscan: designing highly efficient sgRNAs for CRISPRCas9 targeting in vivo. Nature Methods 12:982–988. DOI: https://doi.org/10.1038/nmeth.3543, PMID: 26322839 Mueller KP, Neuhauss SCF. 2010. Quantitative measurements of the optokinetic response in adult fish. Journal of Neuroscience Methods 186:29–34. DOI: https://doi.org/10.1016/j.jneumeth.2009.10.020, PMID: 19900474