Expression of the Alternative Oxidase Influences JNK Signaling and Cell Migration

Expression of the Alternative Oxidase Influences Jun N-Terminal Kinase Signaling and Cell Migration Ana Andjelkovic´, a,b Amelia Mordas, a,b *Lyon Bruinsma, a,b *Annika Ketola, a,b *Giuseppe Cannino, a,b *Luca Giordano, a,b * Praveen K. Dhandapani, a,b,c Marten Szibor, a,b,c Eric Dufour, a,b Howard T. Jacobs a,b,c a Faculty of Medicine and Life Sciences, University of Tampere, Tampere, Finland b BioMediTech Institute, University of Tampere, Tampere, Finland c Institute of Biotechnology, University of Helsinki, Helsinki, Finland ABSTRACT Downregulation of Jun N-terminal kinase (JNK) signaling inhibits cell migration in diverse model systems. In Drosophila pupal development, attenuated JNK signaling in the thoracic dorsal epithelium leads to defective midline closure, resulting in cleft thorax. Here we report that concomitant expression of the Ciona intestinalis alternative oxidase (AOX) was able to compensate for JNK pathway downregulation, substantially correcting the cleft thorax phenotype. AOX expression also promoted wound-healing behavior and single-cell migration in immortalized mouse embryonic fibroblasts (iMEFs), counteracting the effect of JNK pathway inhibition. However, AOX was not able to rescue developmental phenotypes resulting from knockdown of the AP-1 transcription factor, the canonical target of JNK, nor its targets and had no effect on AP-1-dependent transcription. The migration of AOXexpressing iMEFs in the wound-healing assay was differentially stimulated by antimycin A, which redirects respiratory electron flow through AOX, altering the balance between mitochondrial ATP and heat production. Since other treatments affecting mitochondrial ATP did not stimulate wound healing, we propose increased mitochondrial heat production as the most likely primary mechanism of action of AOX in promoting cell migration in these various contexts. KEYWORDS AP-1, Jun N-terminal kinase, alternative oxidase, transcription, wound healing Cell migration is an essential process in animal development, as well as in tissue repair. It has been widely studied in model systems, where the focus has been largely on mechanosensation and mechanotransduction (1, 2). The transcriptional and cytoskeletal regulation of cell migration ensures coordination and an ability to respond to extrinsic and intrinsic cues (2). At the cellular level, the most studied mammalian model is the scratch or wound-healing assay, in which a linear scratch is made in a confluent monolayer of cells, which then migrate to close the gap at a measurable rate (3). In Drosophila development, cell migration has been studied in embryogenesis, in the process of dorsal closure (4, 5), and later on during metamorphosis, when many of the same genes are involved in thoracic closure (6). This process involves cells everting from the wing imaginal discs, which spread over the preexisting larval epidermis (7). These migrating cell sheets eventually fuse at the midline to create a closed epithelial layer that gives rise to the cuticular structures of the dorsal thorax. In an earlier study (8), we reported that the process of dorsal thoracic closure is disrupted by the expression of a commonly used, inducible driver of transgene expression, GeneSwitch, in the presence of the inducing steroid RU486. GeneSwitch is a modified version of the Saccharomyces cerevisiae transcription factor GAL4 incorporating the ligand-binding domain of the progesterone receptor so as to place it under Received 5 March 2018 Returned for modification 11 April 2018 Accepted 11 September 2018 Accepted manuscript posted online 17 September 2018 Citation Andjelkovic´ A, Mordas A, Bruinsma L, Ketola A, Cannino G, Giordano L, Dhandapani PK, Szibor M, Dufour E, Jacobs HT. 2018. Expression of the alternative oxidase influences Jun N-terminal kinase signaling and cell migration. Mol Cell Biol 38:e00110-18. https:// doi.org/10.1128/MCB.00110-18. Copyright © 2018 Andjelkovic´ et al. This is an open-access article distributed under the terms of the Creative Commons Attribution 4.0 International license. Address correspondence to Howard T. Jacobs, howard.t.jacobs@uta.fi. *Present address: Amelia Mordas, Institute of Molecular, Cell and Systems Biology, University of Glasgow, Glasgow, Scotland, United Kingdom; Lyon Bruinsma, Laboratory of Systems and Synthetic Biology, Wageningen University & Research, Wageningen, The Netherlands; Annika Ketola, VTT Technical Research Center of Finland Ltd., Espoo, Finland; Giuseppe Cannino, CNR Institute of Neuroscience and Department of Biomedical Sciences, University of Padova, Padua, Italy; Luca Giordano, University of Pittsburgh School of Medicine, Division of Cardiology, Pittsburgh, Pennsylvania, USA. E.D. and H.T.J. contributed equally to this article. RESEARCH ARTICLE crossm December 2018 Volume 38 Issue 24 e00110-18 mcb.asm.org 1Molecular and Cellular Biology on January 3, 2019 by guesthttp://mcb.asm.org/Downloaded from steroid control (9, 10). Since progesterone or its analogues are not found in Drosophila, it had been assumed that GeneSwitch plus RU486 would be phenotypically inert in otherwise wild-type flies, which is indeed the case in adults. Although cleft thorax was the most dramatic and frequent phenotype observed in GeneSwitch-expressing flies reared throughout development on RU486-containing medium, other developmental dysmorphologies were also observed, including wings with apoptotic regions, abnormal or missing bristles, and cleft abdomen. In the course of these studies, we observed that coexpression of the mitochondrial alternative oxidase (AOX) from Ciona intestinalis was able to revert the cleft thorax and other dysmorphological phenotypes brought about by GeneSwitch plus RU486 (8). Expression of an otherwise inert transgene, such as green fluorescent protein (GFP), the alternative NADH dehydrogenase Ndi1 from yeast, or even a catalytically inactive variant of AOX, was unable to correct GeneSwitch-plus-RU486induced cleft thorax (8). AOX represents an accessory component of the mitochondrial respiratory chain (RC), which is found in microbes, plants, and some metazoan phyla but not insects or vertebrates (11). AOX provides a non-proton-motive bypass for complexes III (cIII) and IV (cIV) of the standard RC. In various contexts, it is able to relieve metabolically deleterious stresses arising from damage, toxic inhibition, or overload of the RC (11, 12). Furthermore, when expressed in human cells, flies, or mice, Ciona AOX can alleviate the damaging phenotypes associated with RC inhibition (13–19). However, the link between respiratory homeostasis and dysmorphologies resulting from GeneSwitch plus RU486 is unknown. These findings prompted us to test whether AOX could revert the cleft thorax phenotype brought about by genetic manipulations in the signaling network that maintains the migratory behavior of the cell sheets everting from the wing discs. Three such classes of mutants have been studied. First, cleft thorax is manifested by specific, recessive alleles of the gene encoding the Drosophila RXR homologue, ultraspiracle (usp), which acts as a dimerization partner for the ecdysone receptor (20). Second, compound heterozygotes for another essential transcription factor, the GATA factor pannier (pnr), also give rise to this phenotype (21). One pnr allele used in these studies is pnr MD237 , a hypomorph created by insertion of GAL4 into the promoter region for one of the two antagonistic pnr isoforms. This allele was originally isolated in an enhancer-trap screen and has proven useful as a driver of transgene expression in the specific domain of pnr expression in the dorsal epithelium; thus, it is often referred to as pnr-GAL4. Third, cleft thorax results from mutations in the Jun N-terminal kinase (JNK) signaling pathway (4)(Fig. 1A). JNK (22) is a member of the mitogen-activated protein (MAP) kinase family that activates the AP-1 transcription factor by phosphorylating its c-Jun subunit (23). AP-1 has a plethora of cellular roles, which include the regulation of cell migration both in development (24) and in pathology, e.g., tumor invasion (25). It is also subject to many types of regulation (26). JNK is itself activated by a variety of stresses through a classic kinase cascade (27,28). In the context of thoracic closure, the initiating stimulus appears to be the engagement of receptor tyrosine kinase pvr (29) (PDGF [platelet-derived growth factor] and VEGF [vascular endothelial growth factor receptor] receptor related). Cleft thorax is produced by mutant alleles of the JNK kinase (JNKK) hemipterous (hep)( 30)orofthe AP-1 subunit kayak (kay; the Drosophila ortholog of mammalian c-Fos)( 31). The use of pnr-GAL4 or other drivers to bring about the local downregulation of JNK targets, such as scarface (serine protease) (32), or overexpression of the AP-1 target puckered (puc;a phosphatase regulator of JNK via a negative feedback loop) (33)orthetissue inhibitor of metalloproteases (Timp)( 34) can also produce cleft thorax, while downregulation of puc can rescue cleft thorax caused by mutations of hep (30). One key target of JNK in dorsal closure (35,36) is the transforming growth factor ␤ family member decapentaplegic (dpp). In thoracic closure, dpp promotes the migration of cells at the imaginal leading edge (7), but it acts in a parallel pathway rather than Andjelkovic´ et al. Molecular and Cellular Biology December 2018 Volume 38 Issue 24 e00110-18 mcb.asm.org 2 on January 3, 2019 by guesthttp://mcb.asm.org/Downloaded from downstream of JNK (30). One key target of dpp in thoracic closure is pnr (37). A dpp homologue in mammals is similarly involved in palatal closure (38). We therefore set out to test whether AOX could rescue cleft thorax when induced by manipulations of the JNK pathway and the associated gene network described above. RESULTS AOX expression mitigates cleft thorax due to downregulation of JNK signaling. We first confirmed, using RNA interference (RNAi) and the pnr-GAL4 (pnr MD237 ) driver, that the downregulation of key components of the JNK signaling cascade (Fig. 1A)(22)in the mediodorsal region during Drosophila development resulted in a phenotype of cleft thorax. After verifying the expression pattern conferred by pnr-GAL4, using the GFP reporter already present in the pnr MD237 stock (Fig. 1B; see Table S1 in the supplemental material), we combined it with RNAi insertions targeted against basket (bsk; encoding JNK), hemipterous (hep; encoding JNKK), misshapen (msn; JNKKKK), and PDGFand VEGF-receptor related (pvr; encoding the receptor tyrosine kinase at the top of the cascade [Table S2]). These all produced a cleft thorax phenotype of various severities (see Fig. 1C for examples), according to the tested construct/insertion and temperature. The two isolates of the pnr-GAL4 driver gave indistinguishable morphological phenotypes and were therefore used interchangeably in the remainder of the study. Under conditions producing the clearest phenotypes, but avoiding substantial lethality (except in the case of pvr, where it was unavoidable), we then combined these with expression constructs for AOX or for a control transgene, the GFP gene (Fig. 2 and 3). For bsk and hep we tested multiple RNAi lines (Table S1), each producing cleft thorax when combined with the pnr-GAL4 driver. Although the severity of cleft thorax varied FIG 1 Cleft thorax produced by downregulation of JNK signaling. (A) Summary of the main steps in the JNK signaling cascade in Drosophila thoracic development indicating Drosophila genes by their standard symbols and their functional assignments in red text. The dotted line to dpp represents its activation by AP-1 in embryonic dorsal closure but not in pupal thoracic closure. pnr is activated by dpp to regulate the dorsal phenotype. The steps indicated with a green background are the ones that were clearly influenced by AOX, based on the data presented later in the paper. TGF- ␤ , transforming growth factor ␤ . (B) Live-cell imaging of a 13to 15-h-old embryo (i), an L3-stage larva (ii), and a pupa (iii) of flies expressing GFP under the control of the pnr-GAL4 driver (original pnr MD237 strain). (C) Examples of thoracic phenotypes scored as normal, mild, or severe, with arrows indicating the trend within each class toward more severe cleft thorax phenotypes. AOX and Cell Migration Molecular and Cellular Biology December 2018 Volume 38 Issue 24 e00110-18 mcb.asm.org 3 on January 3, 2019 by guesthttp://mcb.asm.org/Downloaded from slightly between experiments, expression of AOX (Fig. 2A and 3A and B) but not that of GFP (Fig. 2B) led to a significant and substantial shift toward a wild-type phenotype in the progeny of bsk or hep knockdown flies. Two different RNAi lines for each gene showed the same effect (Fig. 3E to G). Any contribution to the alleviation of the phenotype from promoter dilution was excluded by measuring the amount of AOX RNA driven by pnr-GAL4 in pupae with and without one of the double-stranded RNA (dsRNA) constructs for hep, which showed no significant difference (Fig. 2D). FIG 2 AOX rescues cleft thorax produced by downregulation of JNK signaling. (A, B) Effects of coexpressing AOX (A) or GFP (B) on the proportion of different phenotypic classes resulting from knockdown of bsk and hep, using the pnr-GAL4 driver and RNAi lines KK 104569 (bsk) and GD 47507 (hep). For details of the crosses, see Table S2 in the supplemental material. The data represent the means ⫾SEM for nine replicate vials in each experiment, with nindicating the total number of flies analyzed in each case. Statistically significant differences between the proportions of AOXor GFP-expressing and -nonexpressing flies of different phenotypic classes are shown. Pvalues, as indicated, were determined by paired, two-tailed Student’s ttest with Bonferroni correction. (C) Effect of coexpressing AOX or GFP on pupal semilethality caused by knockdown of pvr (RNAi line KK 105353) using the pnr-GAL4 driver. For details of the crosses, see Table S2 in the supplemental material. The data represent the means ⫾SEM for nine replicate vials in each experiment, with nindicating the total number of flies analyzed in each case. Statistically significant differences between classes are indicated, with Pvalues being determined by analysis of variance with the Tukey post hoc honestly significant difference (HSD) test. Note that conversion to percentages for each vial corrects for differential lethality and for other vial-specific anomalies. (D) qRT-PCR analysis of AOX RNA (means ⫾SD; n⫽3) in hemizygous UAS-AOX F6 transgenic flies that were also hemizygous for pnr MD237 (pnr-GAL4), with or without the hep RNAi construct of line GD 47509. Values were normalized against those for RpL32 and then against the mean value for flies expressing AOX only, to generate the relative values shown. KD, knockdown. Andjelkovic´ et al. Molecular and Cellular Biology December 2018 Volume 38 Issue 24 e00110-18 mcb.asm.org 4 on January 3, 2019 by guesthttp://mcb.asm.org/Downloaded from For msn knockdown, very few flies eclosed using the available RNAi line, and AOX or GFP expression produced no significant change in phenotype, despite a trend toward the wild type for AOX (Fig. 3C) and increased severity in the case of GFP (Fig. 3F). A pvr knockdown line was pupal semilethal when combined with the pnr-GAL4 driver, even at 18°C. As a result, the number of eclosing progeny was insufficient to enable a statistically meaningful analysis of the thoracic phenotype according to severity, but the mean proportion of progeny with cleft thorax was about 80% in this and parallel pvr knockdown experiments. Coexpression of AOX, but not GFP, gave substantial rescue of semilethality (Fig. 2C), with 71% (75/105) of the eclosing flies having a normal thorax. AOX expression can influence mammalian cell migration. The failure of thoracic dorsal closure during Drosophila development indicates a defect in cell migration, which AOX expression was able to correct. To test the generality of this finding, we conducted cell migration assays in mammalian cells. Mouse embryonic fibroblasts (MEFs) were isolated from AOX hemizygous mice and wild-type littermates and immortalized using a standard retroviral transduction procedure with viruses encoding human papillomavirus 16 (HPV16) oncoproteins E6 and E7 (39). AOX-endowed immortalized MEFs (iMEFs) showed an increased speed of wound closure in the standard FIG 3 Confirmation of AOX rescue of cleft thorax caused by JNK knockdown. Effects of coexpressing AOX or GFP on the proportion of different phenotypic classes resulting from knockdown of bsk,hep, and msn, using the pnr-GAL4 driver. (A, B) Repeats of experiments whose results are shown in Fig. 2A. (C) Results of assays with RNAi line KK 101517 (msn) with coexpression of AOX. (D, E, G) Repeats of the experiments whose results are shown in Fig. 2A, using alternate RNAi lines, GD 38138 (bsk) and GD 47509 (hep). (F) Results of assays with RNAi line KK 101517 (msn) with coexpression of GFP. For details of the crosses, see Table S2 in the supplemental material. The data represent the means ⫾SEM for nine replicate vials in each experiment, with nindicating the total number of flies analyzed in each case. Statistically significant differences between the proportions of AOXor GFP-expressing and -nonexpressing flies of different phenotypic classes are shown. Pvalues, as indicated, were determined by paired, two-tailed Student’s t test with Bonferroni correction. Note that conversion to percentages for each vial corrects for differential lethality and for other vial-specific anomalies. AOX and Cell Migration Molecular and Cellular Biology December 2018 Volume 38 Issue 24 e00110-18 mcb.asm.org 5 on January 3, 2019 by guesthttp://mcb.asm.org/Downloaded from scratch assay (Fig. 4A), which was maintained in the presence of various drugs, notably, phorbol myristate acetate (PMA), an indirect activator of AP-1-dependent transcription (acting via protein kinase C), and the JNK inhibitor SP600125. However, JNK inhibitor V decreased the rate of wound closure of AOX-endowed iMEFs to the same level as wild-type iMEFs. The scratch assay conducted on primary MEFs (at passage 6) revealed no difference in migration rate between AOX-endowed and control MEFs (Fig. 4B). All primary lines migrated much more slowly than iMEFs, with inhibitor V also producing substantial cell death. The rate of single-cell migration of AOX-endowed iMEFs was also significantly greater than that of control iMEFs (Fig. 4C). AOX expression has no systematic effect on c-Jun phosphorylation. We next tested the same set of JNK modulators for their effects on c-Jun phosphorylation at JNK target sites (40) Ser63 and Ser73, which has been shown to promote wound healing in the scratch assay (41). This was done in iMEFs (Fig. 5A), as well as in two other cell lines, the HEK293-derived AP-1 transcriptional reporter line used later in the study (HEK-AP1) (Fig. 5B) and human fibroblast line BJ-5ta (Fig. 5C). Only SP600125 decreased the amount of phosphorylated c-Jun, whereas JNK inhibitor V instead increased it, as did PMA. The presence of AOX did not influence c-Jun phosphorylation at these sites in iMEFs (Fig. 5A), although it did appear to potentiate the effect of inhibitor V in an AOX-expressing BJ-5ta cell clone (Fig. 5C). AOX does not rescue cleft thorax caused by manipulation of AP-1 expression or other targets. We reasoned that directly downregulating c-Jun or its dimerization partner, c-Fos, encoded in Drosophila by Jun-related antigen (Jra) and kayak (kay), respectively, should produce effects that largely override its regulation by JNK and the beneficial effects of AOX. Accordingly, coexpression of AOX had only a slight effect on the severity of cleft thorax induced by knockdown of kay or Jra using the pnr-GAL4 FIG 4 Effects of AOX on mammalian cell migration. (A, B) Rate of wound closure in scratch assay of cultured wild-type iMEFs (control) and AOX hemizygous iMEFs (A) and primary MEFs (B) at passage 6, as indicated, either untreated (untr), treated with only 0.2% DMSO, with PMA (20 mM), with SP600125 (20 ␮ M in 0.2% DMSO), or with JNK inhibitor V (inh V; 20 ␮ M), as shown. Asterisks above the bars indicate a statistically significant difference (determined by one-way analysis of variance with the Tukey post hoc HSD test) from untreated cells of the given genotype. Asterisks joining the bars indicate statistically significant differences between the genotypes for a given treatment, based on the same statistical analysis. For clarity, other significant differences are not shown. All data points are based on three biological replicates, each analyzed in triplicate, except for DMSO only, which used only two biological replicates. For the primary MEFs in panel B, the means ⫾SD are for pooled data from two cell lines of each genotype analyzed in triplicate at passage 6. (C) Rate of migration of single iMEFs of the indicated genotypes. Asterisks denote statistical significance, as shown (Student’s ttest, unpaired; n⫽31 for control iMEFs; n⫽21 for AOX-endowed iMEFs). Andjelkovic´ et al. Molecular and Cellular Biology December 2018 Volume 38 Issue 24 e00110-18 mcb.asm.org 6 on January 3, 2019 by guesthttp://mcb.asm.org/Downloaded from driver (Fig. 6A and B). Similarly, AOX was unable to rescue the lethality caused by overexpression of the AP-1 target, puc, which also antagonizes the action of bsk (Fig. 6C). Note, however, that this result may be trivial, since puc overexpression generates a severe embryonic phenotype, due to the inhibition of dorsal closure. As discussed earlier, pnr is considered to act in thoracic closure via a pathway parallel to the JNK pathway. Since the pnr-GAL4 line pnr MD237 is also a pnr hypomorph, we combined it with the pnr D1 mutant as a compound heterozygote, producing, as expected, a phenotype of severe cleft thorax (Fig. 6D). This was not alleviated by AOX, whether it was supplied using a constitutive or a GAL4-dependent transgene (Fig. 6D). Our findings are consistent with the inference that AOX acts on JNK signaling upstream of AP-1 but cannot compensate for a deficiency of AP-1 itself nor of a parallel pathway also required for thoracic closure. FIG 5 Phosphorylation status of JNK target residues in c-Jun. Western blots of whole-cell protein extracts from control and AOX-expressing iMEFs (A), HEK-AP1 cells (B), and AOX-expressing or control human BJ-5ta fibroblasts (C) untreated (untr) or treated with JNK modulators, as shown: 0.2% DMSO, 20 ␮ M SP600125 (SP) in 0.2% DMSO, 20 ␮ M JNK inhibitor V (V or inh V), or 8 nM PMA. The molecular weights of the major bands detected by each antibody, inferred from size markers run on all gels, were as expected (100 kDa for ␣ -actinin [ ␣ -act], 47 kDa for c-Jun phosphorylated at residue Ser73 [pSer73] or Ser63 [pSer63]). Separate blots were initially probed for pSer73 or pSer63, and then in both cases the blots were reprobed for ␣ -actinin as a loading control. Drug concentrations were based either on dose-response curves obtained using the HEK-AP1 cell transcriptional reporter system (for PMA and JNK inhibitor V; see Table S3 in the supplemental material) or on trials to determine the highest concentration at which there was no evidence of substantial cell death (for SP600125). Blot images were optimized for brightness and contrast, rotated, and cropped with the addition of white frames or dividers for clarity, but with no other manipulations. AOX and Cell Migration Molecular and Cellular Biology December 2018 Volume 38 Issue 24 e00110-18 mcb.asm.org 7 on January 3, 2019 by guesthttp://mcb.asm.org/Downloaded from AOX does not influence AP1-dependent transcription in cultured cells. To investigate the mechanism by which AOX impacts the outcome of JNK signaling, we tested whether it influences transcription directed by AP-1. Using a well-established luciferase-based AP-1 reporter system (42) and a variety of different expression conFIG 6 AOX does not rescue cleft thorax produced by altered expression of AP-1 or other targets. (A, B) Effects of coexpressing AOX on the proportion of different phenotypic classes resulting from knockdown of kay (at 25°C) and Jra (at 18°C), using the pnr-GAL4 driver and RNAi lines GD 6212 (kay) and KK 107997 (Jra) (A) and alternate RNAi lines GD 19512 (kay) and GD 10835 (Jra) (B). For details of the crosses, see Table S2 in the supplemental material. Because the GD 10835 (Jra) construct is carried on chromosome X, two parallel crosses were required to test the effects of AOX expression in each sex, and statistical analysis was not meaningful in this case. The data represent the means ⫾SEM for nine replicate vials in each experiment, with nindicating the total number of flies analyzed in each case. Statistically significant differences between the proportions of AOX-expressing and -nonexpressing flies of different phenotypic classes are shown. Pvalues, as indicated, were determined by paired, two-tailed Student’s ttest with Bonferroni correction. Note that Jra knockdown using RNAi line KK 107997 (Jra) was lethal at 25°C and that AOX did not rescue this lethality. (C) Effect of coexpressing AOX or GFP on pupal lethality caused by overexpression of puc under the control of the pnr-GAL4 driver. Progeny classes are as indicated, and all contained, in addition, the UAS-puc overexpression construct. For details of the crosses, see Table S2 in the supplemental material. The data represent the means ⫾SEM for nine replicate vials in each experiment, with nindicating the total number of flies analyzed in each case. Note that conversion to percentages for each vial corrects for differential lethality and other vial-specific anomalies. (D) Phenotypes of pnr MD237 /pnr D1 compound heterozygotes with and without the presence of AOX transgenes, as indicated. Neither the GAL4-driven UAS-AOX F6 transgene nor homozygosity for the tub-AOX transgenes on chromosomes 2 and X produced the rescue of the strong cleft thorax phenotype. Note that because progeny phenotypes were essentially uniform for a given genotype, no meaningful variances could be calculated. Andjelkovic´ et al. Molecular and Cellular Biology December 2018 Volume 38 Issue 24 e00110-18 mcb.asm.org 8 on January 3, 2019 by guesthttp://mcb.asm.org/Downloaded from structs for AOX, we tested whether AOX expression in Drosophila S2 cells was able to alter AP-1-dependent transcription under different conditions of JNK pathway activation. First, we compared the transcriptional readout in cells cotransfected with the reporter plasmids and with AOX cloned into the copper-inducible expression vector pMT/V5-His B, with its natural stop codon, with that in cells transfected with the empty vector. JNK pathway activation was achieved using the pUAST-Hep act plasmid, included in all transfections in combination with pAct-Gal4, which promotes pUAST-Hep act transcription by constitutive expression of Gal4. Transfection efficiency was controlled by the inclusion of a constitutively expressed plasmid encoding renilla luciferase, which can be experimentally distinguished from the firefly luciferase of the reporter construct. Finally, to measure background transcription independently of AP-1, the system includes a mutated version of the reporter (which was used as an alternative in transfections), to which AP-1 does not bind. Despite the complexity of this system, it gave clear-cut results. AOX produced no significant change in AP-1-dependent luciferase expression under both basal and JNK-activated conditions (Fig. 7A; Table S4). Next, we tested reporter cells cotransfected with a plasmid (pAC/AOX) (43) directing constitutive AOX expression under the control of a ␤ -actin promoter versus cells cotransfected with the empty vector. Again, AOX expression had no effect on the transcriptional readout (Fig. 7B; Table S4). Using a system in which JNK pathway activation and AOX induction were brought about simultaneously by expression of the exogenous transcription factor Gal4, but this time using a control plasmid harboring a catalytically inactive, mutated AOX, we again found no effect of AOX (Fig. 7C: see also the results of a parallel experiment in Table S4). AOX also produced no significant difference in AP-1-dependent transcription in cells where hep had been knocked down (Fig. 7D; Table S4). We conducted a similar exercise in mammalian cells, using an HEK293 cell-derived reporter cell line (here designated HEK-AP1), stably transduced with lentiviral constructs expressing AOX or, as a control, the mutated, catalytically inactive variant (mutAOX). Successful transduction and cell cloning at limiting dilution were verified via the fluorescence conferred by the cotransduced marker GFP, and AOX functionality was verified by respirometry (Table S5). Although individual HEK-AP1 cell-derived clones showed a variable degree of AP-1-dependent transcriptional activity, AOX-expressing and control cell clones showed a similar susceptibility to the effects of the JNK antagonists SP600125 and inhibitor V (Fig. 7E). Surprisingly, SP600125 increased rather than decreased the transcriptional readout, despite the fact that it inhibited c-Jun phosphorylation (Fig. 5B), although it did modestly suppress PMA-activated transcription in the reporter line (Fig. 7E). Antimycin A differentially stimulates the migration of AOX-expressing cells. To gain insight into the intracellular process(es) underlying the enhanced migratory behavior of AOX-expressing cells, we tested the effects of sublethal doses of various metabolic effectors on the relative rates of migration of AOX-expressing versus control iMEFs. In an initial experiment (Fig. 8A), we tested various oxidative phosphorylation inhibitors, antioxidants, and protease inhibitors in the wound-healing assay for a differential effect on AOX-expressing cells. For further study, we selected three treatments that appeared to give a differential effect (antimycin A, oligomycin, and mitoquinone mesylate [MitoQ]), together with two that did not (rotenone and carbonyl cyanide p-trifluoromethoxyphenylhydrazone [FCCP]), and measured wound closure in four independent experiments. Antimycin A had a significantly different effect on the migration of AOX-expressing MEFs versus wild-type MEFs (Fig. 8B), stimulating the migration of the former but suppressing that of the latter, whereas MitoQ, rotenone, oligomycin, and FCCP had no significant effects. To understand the implications of these findings for the mechanism by which AOX promotes cell migration, we checked the effects of AOX expression on respiration in the cell lines tested (Fig. 8C). AOX had no significant effect on whole-cell respiration or on permeabilized cell respiration on cI-, cII-, and cIV-linked substrates. However, in the presence of antimycin A, it enabled AOX and Cell Migration Molecular and Cellular Biology December 2018 Volume 38 Issue 24 e00110-18 mcb.asm.org 9 on January 3, 2019 by guesthttp://mcb.asm.org/Downloaded from two-round PCR-based procedure essentially as described previously (112), but using hep-specific primers (shown 5=to 3=) TGGAGGCAAAGCTCCAGGC and CGCGAACGAAGCAGCCAAGG for the first round and GAATTAATACGACTCACTATAGGGGAGACATCCGCCACCCACGCACCTTC and GAATTAATACGACTCACTATA GGGGAGATCCCATTGCCCAGGTCGCCCAG for the second round, followed by transcription using a MEGAscript T7 transcription kit (Life Technologies). Knockdown at the RNA level (to ⬃85%) was verified in transfected cells (112) by qRT-PCR. For combined dsRNA/reporter plasmid transfections, 1 ⫻ 10 5 cells were plated per well in 24-well plates. After 30 min, cells were transfected with 300 ng of each relevant plasmid and 4 ␮ gofhep-specific dsRNA per well in a total volume of 100 ␮ l. A further 4 ␮ gof the dsRNA was added 72 h later, and luciferase assays were conducted 110 h after the initial transfection. For luciferase assays, 75 ␮ l of suspended cells from each well was transferred in triplicate to the wells of a 96-well microplate (Lab Systems) and analyzed using a Dual-Glo luciferase assay system (Promega), according to the manufacturer’s protocol. Luminescence was measured using a Thermo Labsystems Luminoskan Ascent plate reader. Luciferase reporter assays in mammalian cells. Firefly luciferase reporter assays were carried out in HEK-AP1 cells and in AOX/mutAOX-expressing clones derived from them, as follows: 30,000 cells were plated in technical duplicate (2 wells per sample) in luminometer-compatible Nunc MicroWell 96-well plates with lids (Thermo Fisher Scientific). After 24 h, the medium was replaced with medium containing either 0.2% DMSO, 20 ␮ M SP600125 in 0.2% DMSO, 20 ␮ M JNK inhibitor V, or no added drug. Cells were incubated for2hat37°C. For PMA treatment, a second replacement medium contained 8 nM PMA plus 20 ␮ M SP600125 in 0.2% DMSO, 20 ␮ M JNK inhibitor V, or no other added drug, as appropriate, and the cells were incubated for a further 6 h. Luciferase assays were carried out using the Dual-Glo luciferase assay system (Promega), according to the manufacturer’s protocol, and luminescence was measured using a PerkinElmer UV/visible plate reader. Protein analysis by Western blotting. Batches of 300,000 MEFs or HEK-AP1 cells or 250,000 BJ-5ta cells were plated on 6-well plates (CellStar; Greiner Bio-One). After 24 h, the medium was replaced with medium containing either 0.2% DMSO, 20 ␮ M SP600125 in 0.2% DMSO, 20 ␮ M JNK inhibitor V, 8 nM PMA, or no added drug and the plate was incubated for 2 h (or 40 min, in the case of PMA). Cells were carefully rinsed in ice-cold phosphate-buffered saline (PBS) and then scraped free on ice using a CytOne cell scraper (220 mm long, 11-mm blade) in 75 ␮ l of resuspension buffer containing 100 mM NaCl, 10 mM Tris-HCl, and 1 mM EDTA, pH 7.8, supplemented with cOmplete, Mini, EDTA-free protease inhibitor and phosphatase inhibitor cocktails (at the manufacturer’s recommended amount; Roche) and 1 mM phenylmethylsulfonyl fluoride. Protein concentrations were determined using the Bradford assay. After lysis by the addition of an equal volume of SDS sample buffer (Laemmli 2⫻concentrate; Sigma-Aldrich), samples were heated for 5 min at 100°C and briefly centrifuged to remove particulates, and 20 ␮ g of each extract was loaded onto 18-well precast Any kD Criterion TGX Stain-Free protein gels (Bio-Rad), which were run and blotted as described previously (43). Blots were processed as described previously (15), but with blocking in 5% bovine serum albumin (BSA) in PBS-Tween for1honashaker and using the primary antibody phospho-c-Jun (Ser 73) rabbit monoclonal no. 3270 (1:1,000; Cell Signaling Technology) or phospho-c-Jun (Ser63) II rabbit polyclonal 9261 (1:1,000; Cell Signaling Technology), with reprobing using anti- ␣ -actinin rabbit polyclonal C-20 (1:7,000; sc-7454-R; Santa Cruz Biotechnology). Secondary antibody was peroxidase-labeled goat anti-rabbit IgG (1:10,000; PI-1000; Vector Laboratories). The chemiluminescence of all blots was documented both with film and by using a Bio-Rad ChemiDoc imager. Respirometry. Whole-cell and permeabilized cell respiration was measured essentially as described previously (118). iMEFs were seeded 24 h before the experiment and grown in DMEM containing 4.5 g/liter glucose, 10% fetal bovine serum (Thermo Fisher Scientific), 2 mM GlutaMAX (Gibco), and 100 U/ml penicillin plus 100 ␮ g/ml streptomycin (Lonza). To activate cell respiration, the growth medium was replaced 1 h before the assay. Cells were detached with 0.05% trypsin and counted by trypan blue exclusion. Mitochondrial respiration in permeabilized cells was assayed using an Oroboros oxygraph-2K oxygraph (Oroboros, Innsbruck, Austria), with 2 ⫻10 6 iMEFs being directly suspended in the oxygraph chamber containing 2 ml of respiration buffer B (10 mM KH 2 PO 4 , 20 mM HEPES-KOH, 20 mM taurine, 0.5 mM EGTA, 3 mM MgCl 2 , 1 mg/ml essentially fatty acid-free BSA, 60 mM potassium-lactobionate, 110 mM mannitol, 0.3 mM dithiothreitol, pH 7.1). After measuring endogenous whole-cell respiration, substrates and inhibitors were added in the following order: (i) digitonin (30 ␮ g), to permeabilize the cells; (ii) sodium pyruvate (to 5 mM), sodium glutamate (to 5 mM), and sodium malate (to 2 mM) as a cI-linked substrate mix, followed by ADP (to 2 mM); (iii) rotenone (to 150 nM) followed by succinate (to 10 mM) as a cII-linked substrate mix; (iv) antimycin A (to 30 ng/ml), to reveal AOX-mediated respiration; (v) n-propyl gallate (nPG; to 200 ␮ M), to reveal any residual non-AOX-mediated oxygen consumption to be subtracted; (vi) N,N,N=,N=-tetramethyl-p-phenylenediamine (TMPD; to 1 mM) plus sodium L-ascorbate (to 2 mM) as a cIV-linked substrate mix; and (vii) sodium azide (to 40 mM), to reveal any non-cIV-mediated oxygen consumption to be subtracted. O 2 consumption (in picomoles · second ⫺1 · milliliter ⫺1 ) was normalized to the amount of total proteins extracted from 1 ⫻10 6 cells and assayed by the Bradford method (119). All chemicals were purchased from Sigma-Aldrich. SUPPLEMENTAL MATERIAL Supplemental material for this article may be found at https://doi.org/10.1128/MCB .00110-18. SUPPLEMENTAL FILE 1, XLS file, 0.1 MB. SUPPLEMENTAL FILE 2, XLS file, 0.1 MB. Andjelkovic´ et al. Molecular and Cellular Biology December 2018 Volume 38 Issue 24 e00110-18 mcb.asm.org 16 on January 3, 2019 by guesthttp://mcb.asm.org/Downloaded from SUPPLEMENTAL FILE 3, XLS file, 0.1 MB. SUPPLEMENTAL FILE 4, XLS file, 0.1 MB. SUPPLEMENTAL FILE 5, XLS file, 0.1 MB. ACKNOWLEDGMENTS This work was supported by the European Research Council (advanced grant 232738 to H.T.J.), the Academy of Finland (Center of Excellence grant 272376 and Academy Professorship grant 283157 to H.T.J.), the Finnish Cultural Foundation (a grant from the Vilho Rossin Fund to A.A.), the University of Tampere, the Tampere University Hospital Medical Research Fund, and the Sigrid Juselius Foundation. We thank Tea Tuomela, Outi Kurronen, Merja Jokela, Sina Saari, and Samuli Hartikainen for technical assistance; Marcos Oliveira for useful discussions; Dirk Bohmann for the supply of reporter plasmids; Filippo Scialó for providing cells and plasmids; Troy Faithfull for critical reading of the manuscript; Maria Aatonen and Tiina Pessa-Morikawa and the Flow Cytometry Core Facility in the Department of Biosciences, University of Helsinki, for assistance with flow cytometry; and Outi Paloheomo and Teemu Ihalainen (Tampere Imaging Facility, University of Tampere) and Mika Molin (Light Microscopy Unit, Institute of Biotechnology, University of Helsinki) for help with microscopy. REFERENCES 1. Pandya P, Orgaz JL, Sanz-Moreno V. 2017. Actomyosin contractility and collective migration: may the force be with you. Curr Opin Cell Biol 48:87–96. https://doi.org/10.1016/j.ceb.2017.06.006. 2. Hunter MV, Fernandez-Gonzalez R. 2017. Coordinating cell movements in vivo: junctional and cytoskeletal dynamics lead the way. Curr Opin Cell Biol 48:54–62. https://doi.org/10.1016/j.ceb.2017.05.005. 3. Yarrow JC, Perlman ZE, Westwood NJ, Mitchison TJ. 2004. A highthroughput cell migration assay using scratch wound healing, a comparison of image-based readout methods. BMC Biotech 4:21. https:// doi.org/10.1186/1472-6750-4-21. 4. Hayes P, Solon J. 2017. Drosophila dorsal closure: an orchestra of forces to zip shut the embryo. Mech Dev 144:2–10. https://doi.org/10.1016/j .mod.2016.12.005. 5. Gorfinkiel N, Schamberg S, Blanchard GB. 2011. Integrative approaches to morphogenesis: lessons from dorsal closure. Genesis 49:522–533. https://doi.org/10.1002/dvg.20704. 6. Kockel L, Homsy JG, Bohmann D. 2001. Drosophila AP-1: lessons from an invertebrate. Oncogene 20:2347–2364. https://doi.org/10.1038/sj .onc.1204300. 7. Martín-Blanco E, Pastor-Pareja JC, García-Bellido A. 2000. JNK and decapentaplegic signaling control adhesiveness and cytoskeleton dynamics during thorax closure in Drosophila. Proc Natl Acad SciUSA 97:7888–7893. https://doi.org/10.1073/pnas.97.14.7888. 8. Andjelkovic´ A, Kemppainen KK, Jacobs HT. 2016. Ligand-bound GeneSwitch causes developmental aberrations in Drosophila that are alleviated by the alternative oxidase. G3 (Bethesda) 6:2839–2846. https://doi.org/10.1534/g3.116.030882. 9. Abruzzese RV, Godin D, Burcin M, Mehta V, French M, Li Y, O’Malley BW, Nordstrom JL. 1999. Ligand-dependent regulation of plasmid-based transgene expression in vivo. Hum Gene Ther 10:1499–1507. https:// doi.org/10.1089/10430349950017833. 10. McGuire SE, Roman G, Davis RL. 2004. Gene expression systems in Drosophila: a synthesis of time and space. Trends Genet 20:384–391. https://doi.org/10.1016/j.tig.2004.06.012. 11. Rogov AG, Sukhanova EI, Uralskaya LA, Aliverdieva DA, Zvyagilskaya RA. 2014. Alternative oxidase: distribution, induction, properties, structure, regulation, and functions. Biochemistry (Mosc) 79:1615–1634. https:// doi.org/10.1134/S0006297914130112. 12. Saha B, Borovskii G, Panda SK. 2016. Alternative oxidase and plant stress tolerance. Plant Signal Behav 11:e1256530. https://doi.org/10 .1080/15592324.2016.1256530. 13. Hakkaart GA, Dassa EP, Jacobs HT, Rustin P. 2006. Allotopic expression of a mitochondrial alternative oxidase confers cyanide resistance to human cell respiration. EMBO Rep 7:341–345. https://doi.org/10.1038/ sj.embor.7400601. 14. Dassa EP, Dufour E, Gonçalves S, Paupe V, Hakkaart GA, Jacobs HT, Rustin P. 2009. Expression of the alternative oxidase complements cytochrome c oxidase deficiency in human cells. EMBO Mol Med 1:30–36. https://doi.org/10.1002/emmm.200900001. 15. Fernandez-Ayala DJ, Sanz Vartiainen AS, Kemppainen KK, Babusiak M, Mustalahti E, Costa R, Tuomela T, Zeviani M, Chung J, O’Dell KMO, Rustin P, Jacobs HT. 2009. Expression of the Ciona intestinalis alternative oxidase (AOX) in Drosophila complements defects in mitochondrial oxidative phosphorylation. Cell Metab 9:449–460. https://doi.org/10 .1016/j.cmet.2009.03.004. 16. Kemppainen KK, Rinne J, Sriram A, Lakanmaa M, Zeb A, Tuomela T, Popplestone A, Singh S, Sanz A, Rustin P, Jacobs HT. 2014. Expression of alternative oxidase in Drosophila ameliorates diverse phenotypes due to cytochrome oxidase deficiency. Hum Mol Genet 23:2078–2093. https://doi.org/10.1093/hmg/ddt601. 17. El-Khoury R, Dufour E, Rak M, Ramanantsoa N, Grandchamp N, Csaba Z, Duvillié B, Bénit P, Gallego J, Gressens P, Sarkis C, Jacobs HT, Rustin P. 2013. Alternative oxidase expression in the mouse enables bypassing cytochrome c oxidase blockade and limits mitochondrial ROS overproduction. PLoS Genet 9:e1003182. https://doi.org/10.1371/journal.pgen .1003182. 18. Szibor M, Dhandapani PK, Dufour E, Holmström KM, Zhuang Y, Salwig I, Wittig I, Heidler J, Gizatullina Z, Gainutdinov T, German Mouse Clinic Consortium, Fuchs H, Gailus-Durner V, de Angelis MH, Nandania J, Velagapudi V, Wietelmann A, Rustin P, Gellerich FN, Jacobs HT, Braun T. 2017. Broad AOX expression in a genetically tractable mouse model does not disturb normal physiology. Dis Model Mech 10:163–171. https://doi.org/10.1242/dmm.027839. 19. El-Khoury R, Kaulio E, Lassila KA, Crowther DC, Jacobs HT, Rustin P. 2016. Expression of the alternative oxidase mitigates beta-amyloid production and toxicity in model systems. Free Radic Biol Med 96: 57–66. https://doi.org/10.1016/j.freeradbiomed.2016.04.006. 20. Henrich VC, Szekely AA, Kim SJ, Brown NE, Antoniewski C, Hayden MA, Lepesant JA, Gilbert LI. 1994. Expression and function of the ultraspiracle (usp) gene during development of Drosophila melanogaster. Dev Biol 165:38–52. https://doi.org/10.1006/dbio.1994.1232. 21. Heitzler P, Haenlin M, Ramain P, Calleja M, Simpson P. 1996. A genetic analysis of pannier, a gene necessary for viability of dorsal tissues and bristle positioning in Drosophila. Genetics 143:1271–1286. 22. Weston CR, Davis RJ. 2002. The JNK signal transduction pathway. Curr Opin Genet Dev 12:14–21. https://doi.org/10.1016/S0959-437X(01)00 258-1. 23. Karin M, Gallagher E. 2005. From JNK to pay dirt: Jun kinases, their biochemistry, physiology and clinical importance. IUBMB Life 57: 283–295. https://doi.org/10.1080/15216540500097111. 24. Grose R. 2003. Epithelial migration: open your eyes to c-Jun. Curr Biol 13:R678–R680. https://doi.org/10.1016/S0960-9822(03)00607-9. AOX and Cell Migration Molecular and Cellular Biology December 2018 Volume 38 Issue 24 e00110-18 mcb.asm.org 17 on January 3, 2019 by guesthttp://mcb.asm.org/Downloaded from 25. Ozanne BW, Spence HJ, McGarry LC, Hennigan RF. 2007. Transcription factors control invasion: AP-1 the first among equals. Oncogene 26: 1–10. https://doi.org/10.1038/sj.onc.1209759. 26. Eferl R, Wagner EF. 2003. AP-1: a double-edged sword in tumorigenesis. Nat Rev Cancer 3:859–868. https://doi.org/10.1038/nrc1209. 27. Dhillon AS, Hagan S, Rath O. 2007. MAP kinase signaling pathways in cancer. Oncogene 26:3279–3290. https://doi.org/10.1038/sj.onc .1210421. 28. Ríos-Barrera LD, Riesgo-Escovar JR. 2013. Regulating cell morphogenesis: the Drosophila Jun N-terminal kinase pathway. Genesis 51:147–162. https://doi.org/10.1002/dvg.22354. 29. Ishimaru S, Ueda R, Hinohara Y, Ohtani M, Hanafusa H. 2004. PVR plays a critical role via JNK activation in thorax closure during Drosophila metamorphosis. EMBO J 23:3984–3994. https://doi.org/ 10.1038/sj.emboj.7600417. 30. Agnes F, Suzanne M, Noselli S. 1999. The Drosophila JNK pathway controls the morphogenesis of imaginal discs during metamorphosis. Development 126:5453–5462. 31. Zeitlinger J, Bohmann D. 1999. Thorax closure in Drosophila: involvement of Fos and the JNK pathway. Development 126:3947–3956. 32. Srivastava A, Dong Q. 2015. Regulation of a serine protease homolog by the JNK pathway during thoracic development of Drosophila melanogaster. FEBS Open Bio 5:117–123. https://doi.org/10.1016/j.fob.2015 .01.008. 33. Pastor-Pareja JC, Grawe F, Martin-Blanco E, Garcia-Bellido A. 2004. Invasive cell behavior during Drosophila imaginal disc eversion is mediated by the JNK signaling cascade. Dev Cell 7:387–399. https://doi .org/10.1016/j.devcel.2004.07.022. 34. Srivastava A, Pastor-Pareja JC, Igaki T, Pagliarini R, Xu T. 2007. Basement membrane remodeling is essential for Drosophila disc eversion and tumor invasion. Proc Natl Acad SciUSA104:2721–2726. https://doi .org/10.1073/pnas.0611666104. 35. Glise B, Noselli S. 1997. Coupling of Jun amino-terminal kinase and Decapentaplegic signaling pathways in Drosophila morphogenesis. Genes Dev 11:1738–1747. https://doi.org/10.1101/gad.11.13.1738. 36. Hou XS, Goldstein ES, Perrimon N. 1997. Drosophila Jun relays the Jun amino-terminal kinase signal transduction pathway to the decapentaplegic signal transduction pathway in regulating epithelial cell sheet movement. Genes Dev 11:1728–1737. https://doi.org/10.1101/gad.11 .13.1728. 37. Sato M, Saigo K. 2000. Involvement of pannier and u-shaped in regulation of decapentaplegic-dependent wingless expression in developing Drosophila notum. Mech Dev 93:127–138. https://doi.org/10.1016/ S0925-4773(00)00282-3. 38. Taya Y, O’Kane S, Ferguson MW. 1999. Pathogenesis of cleft palate in TGF-beta3 knockout mice. Development 126:3869–3879. 39. Lochmüller H, Johns T, Shoubridge EA. 1999. Expression of the E6 and E7 genes of human papillomavirus (HPV16) extends the life span of human myoblasts. Exp Cell Res 248:186–193. https://doi.org/10.1006/ excr.1999.4407. 40. Morton S, Davis RJ, McLaren A, Cohen P. 2003. A reinvestigation of the multisite phosphorylation of the transcription factor c-Jun. EMBO J 22:3876–3886. https://doi.org/10.1093/emboj/cdg388. 41. Javelaud D, Laboureau J, Gabison E, Verrecchia F, Mauviel A. 2003. Disruption of basal JNK activity differentially affects key fibroblast functions important for wound healing. J Biol Chem 278:24624–24628. https://doi.org/10.1074/jbc.M301942200. 42. Chatterjee N, Bohmann D. 2012. A versatile ⌽C31 based reporter system for measuring AP-1 and Nrf2 signaling in Drosophila and in tissue culture. PLoS One 7:e34063. https://doi.org/10.1371/journal .pone.0034063. 43. Andjelkovic´ A, Oliveira MT, Cannino G, Yalgin C, Dhandapani PK, Dufour E, Rustin P, Szibor M, Jacobs HT. 2015. Diiron centre mutations in Ciona intestinalis alternative oxidase abolish enzymatic activity and prevent rescue of cytochrome oxidase deficiency in flies. Sci Rep 5:18295. https://doi.org/10.1038/srep18295. 44. Hoefnagel MHN, Wiskich JT. 1998. Activation of the plant alternative oxidase by high reduction levels of the Q-Pool and pyruvate. Arch Biochem Biophys 355:262–270. https://doi.org/10.1006/abbi.1998 .0737. 45. Castro-Guerrero NA, Krab K, Moreno-Sanchez R. 2004. The alternative respiratory pathway of Euglena mitochondria. J Bioenerg Biomembr 36:459–469. https://doi.org/10.1023/B:JOBB.0000047328.82733.ef. 46. Umbach AL, Ng VS, Siedow JN. 2006. Regulation of plant alternative oxidase activity: a tale of two cysteines. Biochim Biophys Acta 1757: 135–142. https://doi.org/10.1016/j.bbabio.2005.12.005. 47. May B, Young L, Moore AL. 2017. Structural insights into the alternative oxidases: are all oxidases made equal? Biochem Soc Trans 45:731–740. https://doi.org/10.1042/BST20160178. 48. Hardie DG. 2011. AMP-activated protein kinase: an energy sensor that regulates all aspects of cell function. Genes Dev 25:1895–1908. https:// doi.org/10.1101/gad.17420111. 49. Cunniff B, McKenzie AJ, Heintz NH, Howe AK. 2016. AMPK activity regulates trafficking of mitochondria to the leading edge during cell migration and matrix invasion. Mol Biol Cell 27:2662–2674. https://doi .org/10.1091/mbc.e16-05-0286. 50. Pellegrino MW, Nargund AM, Haynes CM. 2013. Signaling the mitochondrial unfolded protein response. Biochim Biophys Acta 1833: 410–416. https://doi.org/10.1016/j.bbamcr.2012.02.019. 51. McLaughlin-Drubin ME, Münger K. 2009. The human papillomavirus E7 oncoprotein. Virology 384:335–344. https://doi.org/10.1016/j.virol.2008 .10.006. 52. Mazurek S, Zwerschke W, Jansen-Durr P, Eigenbrodt E. 2001. Effects of the human papilloma virus HPV-16 E7 oncoprotein on glycolysis and glutaminolysis: role of pyruvate kinase type M2 and the glycolyticenzyme complex. Biochem J 356:247–256. 53. Yizhak K, Le Dévédec SE, Rogkoti VM, Baenke F, de Boer VC, Frezza C, Schulze A, van de Water B, Ruppin E. 2014. A computational study of the Warburg effect identifies metabolic targets inhibiting cancer migration. Mol Syst Biol 10:744. https://doi.org/10.15252/msb.20134993. 54. Gaude E, Schmidt C, Gammage PA, Dugourd A, Blacker T, Chew SP, Saez-Rodriguez J, O’Neill JS, Szabadkai G, Minczuk M, Frezza C. 2018. NADH shuttling couples cytosolic reductive carboxylation of glutamine with glycolysis in cells with mitochondrial dysfunction. Mol Cell 69: 581–593. https://doi.org/10.1016/j.molcel.2018.01.034. 55. Vousden KH, Ryan KM. 2009. p53 and metabolism. Nat Rev Cancer 9:691–700. https://doi.org/10.1038/nrc2715. 56. Matoba S, Kang JG, Patino WD, Wragg A, Boehm M, Gavrilova O, Hurley PJ, Bunz F, Hwang PM. 2006. p53 regulates mitochondrial respiration. Science 312:1650–1653. https://doi.org/10.1126/science.1126863. 57. Schwartzenberg-Bar-Yoseph F, Armoni M, Karnieli E. 2004. The tumor suppressor p53 down-regulates glucose transporters GLUT1 and GLUT4 gene expression. Cancer Res 64:2627–2633. https://doi.org/10 .1158/0008-5472.CAN-03-0846. 58. Scheffner M, Werness BA, Huibregtse JM, Levine AJ, Howley PM. 1990. The E6 oncoprotein encoded by human papillomavirus types 16 and 18 promotes the degradation of p53. Cell 63:1129–1136. https://doi.org/ 10.1016/0092-8674(90)90409-8. 59. Schreiber M, Kolbus A, Piu F, Szabowski A, Möhle-Steinlein U, Tian J, Karin M, Angel P, Wagner EF. 1999. Control of cell cycle progression by c-Jun is p53 dependent. Genes Dev 13:607–619. https://doi.org/10 .1101/gad.13.5.607. 60. Scherer SJ, Maier SM, Seifert M, Hanselmann RG, Zang KD, MullerHermelink HK, Angel P, Welter C, Schartl M. 2000. p53 and c-Jun functionally synergize in the regulation of the DNA repair gene hMSH2 in response to UV. J Biol Chem 275:37469–37473. https://doi.org/10 .1074/jbc.M006990200. 61. Saha MN, Jiang H, Yang Y, Zhu X, Wang X, Schimmer AD, Qiu L, Chang H. 2012. Targeting p53 via JNK pathway: a novel role of RITA for apoptotic signaling in multiple myeloma. PLoS One 7:e30215. https:// doi.org/10.1371/journal.pone.0030215. 62. Tu SP, Chi AL, Ai W, Takaishi S, Dubeykovskaya Z, Quante M, Fox JG, Wang TC. 2009. p53 inhibition of AP1-dependent TFF2 expression induces apoptosis and inhibits cell migration in gastric cancer cells. Am J Physiol 297:G385–G396. https://doi.org/10.1152/ajpgi.90620.2008. 63. Guo Y, Meng X, Ma J, Zheng Y, Wang Q, Wang Y, Shang H. 2014. Human papillomavirus 16 E6 contributes HIF-1 ␣ induced Warburg effect by attenuating the VHL-HIF-1 ␣ interaction. Int J Mol Sci 15:7974–7986. https://doi.org/10.3390/ijms15057974. 64. Spangle JM, Münger K. 2010. The human papillomavirus type 16 E6 oncoprotein activates mTORC1 signaling and increases protein synthesis. J Virol 84:9398–9407. https://doi.org/10.1128/JVI.00974-10. 65. Jochum W, Passegué E, Wagner EF. 2001. AP-1 in mouse development and tumorigenesis. Oncogene 20:2401–2412. https://doi.org/10.1038/ sj.onc.1204389. 66. Angel P, Karin M. 1991. The role of Jun, Fos and the AP-1 complex in cell-proliferation and transformation. Biochim Biophys Acta 1072: 129–157. Andjelkovic´ et al. Molecular and Cellular Biology December 2018 Volume 38 Issue 24 e00110-18 mcb.asm.org 18 on January 3, 2019 by guesthttp://mcb.asm.org/Downloaded from 67. Vesely PW, Staber PB, Hoefler G, Kenner L. 2009. Translational regulation mechanisms of AP-1 proteins. Mutat Res 682:7–12. https://doi.org/ 10.1016/j.mrrev.2009.01.001. 68. Sheerin A, Thompson KS, Goyns MH. 2002. Altered composition of the AP-1 transcription factor in immortalized compared to normal proliferating cells. Cancer Lett 177:83–87. https://doi.org/10.1016/S0304 -3835(01)00751-0. 69. Karin M, Liu Z-G, Zandi E. 1997. AP-1 function and regulation. Curr Opin Cell Biol 9:240–246. https://doi.org/10.1016/S0955-0674(97)80068-3. 70. Li CH, Cheng YW, Liao PL, Yang YT, Kang JJ. 2010. Chloramphenicol causes mitochondrial stress, decreases ATP biosynthesis, induces matrix metalloproteinase-13 expression, and solid-tumor cell invasion. Toxicol Sci 116:140–150. https://doi.org/10.1093/toxsci/kfq085. 71. Carboni S, Hiver A, Szyndralewiez C, Gaillard P, Gotteland JP, Vitte PA. 2004. AS601245 (1,3-benzothiazol-2-yl (2-{[2-(3-pyridinyl) ethyl] amino}-4 pyrimidinyl) acetonitrile): a c-Jun NH 2 -terminal protein kinase inhibitor with neuroprotective properties. J Pharmacol Exp Ther 310: 25–32. https://doi.org/10.1124/jpet.103.064246. 72. Bain J, McLauchlan H, Elliott M, Cohen P. 2003. The specificities of protein kinase inhibitors: an update. Biochem J 371:199–204. https:// doi.org/10.1042/bj20021535. 73. Tanemura S, Momose H, Shimizu N, Kitagawa D, Seo J, Yamasaki T, Nakagawa K, Kajiho H, Penninger Katada T, Nishina H. 2009. Blockage by SP600125 of Fc␧receptor-induced degranulation and cytokine gene expression in mast cells is mediated through inhibition of phosphatidylinositol 3-kinase signaling pathway. J Biochem 145:345–354. https:// doi.org/10.1093/jb/mvn172. 74. Gupta S, Barrett T, Whitmarsh AJ, Cavanagh J, Sluss HK, Dérijard B, Davis RJ. 1996. Selective interaction of JNK protein kinase isoforms with transcription factors. EMBO J 15:2760–2770. https://doi.org/10.1002/j .1460-2075.1996.tb00636.x. 75. Abate C, Patel L, Rauscher FJ, Curran T. 1990. Redox regulation of Fos and Jun DNA-binding activity in vitro. Science 249:1157–1161. https:// doi.org/10.1126/science.2118682. 76. Jindra M, Gaziova I, Uhlirova M, Okabe M, Hiromi Y, Hirose S. 2004. Coactivator MBF1 preserves the redox-dependent AP-1 activity during oxidative stress in Drosophila. EMBO J 23:3538–3547. https://doi.org/ 10.1038/sj.emboj.7600356. 77. Sanz A, Fernández-Ayala DJ, Stefanatos RK, Jacobs HT. 2010. Mitochondrial ROS production correlates with, but does not directly regulate lifespan in Drosophila. Aging (Albany NY) 2:200–223. https://doi.org/ 10.18632/aging.100137. 78. Poulios E, Trougakos IP, Gonos ES. 2006. Comparative effects of hypoxia on normal and immortalized human diploid fibroblasts. Anticancer Res 26:2165–2168. 79. Martínez-Reyes I, Diebold LP, Kong H, Schieber M, Huang H, Hensley CT, Mehta MM, Wang T, Santos JH, Woychik R, Dufour E, Spelbrink JN, Weinberg SE, Zhao Y, DeBerardinis R, Chandel NS. 2016. TCA cycle and mitochondrial membrane potential are necessary for diverse biological functions. Mol Cell 61:199–209. https://doi.org/10.1016/j.molcel.2015 .12.002. 80. Verschoor ML, Wilson LA, Singh G. 2010. Mechanisms associated with mitochondrial-generated reactive oxygen species in cancer. Can J Physiol Pharmacol 88:204–219. https://doi.org/10.1139/Y09-135. 81. Voelkl J, Alesutan I, Primessnig U, Feger M, Mia S, Jungmann A, Castor T, Viereck R, Stöckigt F, Borst O, Gawaz M, Schrickel JW, Metzler B, Katus HA, Müller OJ, Pieske B, Heinzel FR, Lang F. 2016. AMP-activated protein kinase ␣ 1-sensitive activation of AP-1 in cardiomyocytes. J Mol Cell Cardiol 97:36–43. https://doi.org/10.1016/j.yjmcc.2016.04.009. 82. Jhun BS, Lee JY, Oh YT, Lee JH, Choe W, Baik HH, Kim SS, Yoon KS, Ha J, Kang I. 2006. Inhibition of AMP-activated protein kinase suppresses IL-2 expression through down-regulation of NF-AT and AP-1 activation in Jurkat T cells. Biochem Biophys Res Commun 351:986–992. https:// doi.org/10.1016/j.bbrc.2006.10.138. 83. Paupe V, Prudent J. 2018. New insights into the role of mitochondrial calcium homeostasis in cell migration. Biochem Biophys Res Commun 500:75–86. https://doi.org/10.1016/j.bbrc.2017.05.039. 84. Hayes JD, Dinkova-Kostova AT. 2014. The Nrf2 regulatory network provides an interface between redox and intermediary metabolism. Trends Biochem Sci 39:199–218. https://doi.org/10.1016/j.tibs.2014.02 .002. 85. Ameri K, Harris AL. 2008. Activating transcription factor 4. Int J Biochem Cell Biol 40:14–21. https://doi.org/10.1016/j.biocel.2007.01.020. 86. Rössler OG, Thiel G. 2017. Specificity of stress-responsive transcription factors Nrf2, ATF4, and AP-1. J Cell Biochem 118:127–140. https://doi .org/10.1002/jcb.25619. 87. Dougherty CJ, Kubasiak LA, Frazier DP, Li H, Xiong WC, Bishopric NH, Webster KA. 2004. Mitochondrial signals initiate the activation of c-Jun N-terminal kinase (JNK) by hypoxia-reoxygenation. FASEB J 18: 1060–1070. https://doi.org/10.1096/fj.04-1505com. 88. Xu J, Qin X, Cai X, Yang L, Xing Y, Li J, Zhang L, Tang Y, Liu J, Zhang X, Gao F. 2015. Mitochondrial JNK activation triggers autophagy and apoptosis and aggravates myocardial injury following ischemia/ reperfusion. Biochim Biophys Acta 1852:262–270. https://doi.org/10 .1016/j.bbadis.2014.05.012. 89. Rottenberg H, Wu SL. 1998. Quantitative assay by flow cytometry of the mitochondrial membrane potential in intact cells. Biochim Biophys Acta 1404:393–404. https://doi.org/10.1016/S0167-4889(98)00088-3. 90. Heytler PG. 1979. Uncouplers of oxidative phosphorylation. Methods Enzymol 55:462–472. https://doi.org/10.1016/0076-6879(79)55060-5. 91. Barrientos A, Moraes CT. 1999. Titrating the effects of mitochondrial complex I impairment in the cell physiology. J Biol Chem 274: 16188–16197. https://doi.org/10.1074/jbc.274.23.16188. 92. Liu Y, Schubert DR. 2009. The specificity of neuroprotection by antioxidants. J Biomed Sci 16:98. https://doi.org/10.1186/1423-0127-16-98. 93. Yuyun X, Jinjun Q, Minfang X, Jing Q, Juan X, Rui M, Li Z, Jing G. 2012. Effects of low concentrations of rotenone upon mitohormesis in SHSY5Y cells. Dose Response 11:270–280. https://doi.org/10.2203/dose -response.12-005.Gao. 94. Rushworth GF, Megson IL. 2014. Existing and potential therapeutic uses for N-acetylcysteine: the need for conversion to intracellular glutathione for antioxidant benefits. Pharmacol Ther 141:150–159. https://doi .org/10.1016/j.pharmthera.2013.09.006. 95. Kelso GF, Porteous CM, Coulter CV, Hughes G, Porteous WK, Ledgerwood EC, Smith RA, Murphy MP. 2001. Selective targeting of a redoxactive ubiquinone to mitochondria within cells: antioxidant and antiapoptotic properties. J Biol Chem 276:4588–4596. https://doi.org/10 .1074/jbc.M009093200. 96. Boveris A, Chance B. 1973. The mitochondrial generation of hydrogen peroxide. General properties and effect of hyperbaric oxygen. Biochem J 134:707–716. 97. Brennan JP, Southworth R, Medina RA, Davidson SM, Duchen MR, Shattock MJ. 2006. Mitochondrial uncoupling, with low concentration FCCP, induces ROS-dependent cardioprotection independent of KATP channel activation. Cardiovasc Res 72:313–321. https://doi .org/10.1016/j.cardiores.2006.07.019. 98. Aon MA, Cortassa S, O’Rourke B. 2010. Redox-optimized ROS balance: a unifying hypothesis. Biochim Biophys Acta 1797:865–877. https://doi .org/10.1016/j.bbabio.2010.02.016. 99. Seglen PO, Grinde BS, Solheim AE. 1979. Inhibition of the lysosomal pathway of protein degradation in isolated rat hepatocytes by ammonia, methylamine, chloroquine and leupeptin. Eur J Biochem 95: 215–225. https://doi.org/10.1111/j.1432-1033.1979.tb12956.x. 100. Murray EJ, Grisanti MS, Bentley GV, Murray SS. 1997. E64d, a membrane-permeable cysteine protease inhibitor, attenuates the effects of parathyroid hormone on osteoblasts in vitro. Metabolism 46: 1090–1094. https://doi.org/10.1016/S0026-0495(97)90284-5. 101. Slee EA, Zhu H, Chow SC, MacFarlane M, Nicholson DW, Cohen GM. 1996. Benzyloxycarbonyl-Val-Ala-Asp (OMe) fluoromethylketone (ZVAD.FMK) inhibits apoptosis by blocking the processing of CPP32. Biochem J 315:21–24. https://doi.org/10.1042/bj3150021. 102. Chrétien D, Bénit P, Ha HH, Keipert S, El-Khoury R, Chang YT, Jastroch M, Jacobs HT, Rustin P, Rak M. 2018. Mitochondria are physiologically maintained at close to 50 °C. PLoS Biol 16:e2003992. https://doi.org/ 10.1371/journal.pbio.2003992. 103. Parkinson WC. 1983. Motility of mouse fibroblasts in tissue culture. Biophys J 42:17–23. https://doi.org/10.1016/S0006-3495(83)84364-1. 104. Zimmerle CT, Frieden C. 1986. Effect of temperature on the mechanism of actin polymerization. Biochemistry 25:6432–6438. https://doi.org/10 .1021/bi00369a014. 105. Gao F, Hu X, Xie X, Liu X, Wang J. 2015. Heat shock protein 90 stimulates rat mesenchymal stem cell migration via PI3K/Akt and ERK1/2 pathways. J Cell Biochem Biophys 71:481–489. https://doi.org/ 10.1007/s12013-014-0228-6. 106. Boroughs LK, Antonyak MA, Johnson JL, Cerione R. 2011. A unique role for heat shock protein 70 and its binding partner tissue transglutaminase in cancer cell migration. J Biol Chem 286:37094–37107. https:// doi.org/10.1074/jbc.M111.242438. AOX and Cell Migration Molecular and Cellular Biology December 2018 Volume 38 Issue 24 e00110-18 mcb.asm.org 19 on January 3, 2019 by guesthttp://mcb.asm.org/Downloaded from 107. Lang BJ, Nguyen L, Nguyen HC, Vieusseux JL, Chai RCC, Christophi C, Fifis T, Kouspou MM, Price JT. 2012. Heat stress induces epithelial plasticity and cell migration independent of heat shock factor 1. Cell Stress Chaperones 17:765–778. https://doi.org/10.1007/s12192-012 -0349-z. 108. O’Callaghan-Sunol C, Sherman MY. 2006. Heat shock transcription factor (HSF1) plays a critical role in cell migration via maintaining MAP kinase signaling. Cell Cycle 5:1431–1437. https://doi.org/10.4161/cc.5 .13.2915. 109. Emara S, Amer S, Ali A, Abouleila Y, Oga A, Masujima T. 2017. Single-cell metabolomics, p 323–344. In Sussulini A (ed), Metabolomics: from fundamentals to clinical applications. Springer, Cham, Switzerland. 110. Merkey AB, Wong CK, Hoshizaki DK, Gibbs AG. 2011. Energetics of metamorphosis in Drosophila melanogaster. J Insect Physiol 57: 1437–1445. https://doi.org/10.1016/j.jinsphys.2011.07.013. 111. van Horssen R, Janssen E, Peters W, van de Pasch L, Lindert MM, van Dommelen MM, Linssen PC, Hagen TL, Fransen JA, Wieringa B. 2009. Modulation of cell motility by spatial repositioning of enzymatic ATP/ ADP exchange capacity. J Biol Chem 284:1620–1627. https://doi.org/ 10.1074/jbc.M806974200. 112. Fukuoh A, Cannino G, Gerards M, Buckley S, Kazanciouglu S, Scialo F, Lihavainen E, Ribeiro A, Dufour E, Jacobs HT. 2014. Screen for mitochondrial DNA copy number maintenance genes reveals essential role for ATP synthase. Mol Syst Biol 10:734. https://doi.org/10.15252/msb .20145117. 113. Abbondanzo SJ, Gadi I, Stewart CL. 1993. Derivation of embryonic stem cell lines. Methods Enzymol 225:803–823. https://doi.org/10.1016/0076 -6879(93)25052-4. 114. Cannino G, El-Khoury R, Pirinen M, Hutz B, Rustin P, Jacobs HT, Dufour E. 2012. Glucose modulates respiratory complex I activity in response to acute mitochondrial dysfunction. J Biol Chem 287: 38729–38740. https://doi.org/10.1074/jbc.M112.386060. 115. Reed BH, McMillan SC, Chaudhary R. 2009. The preparation of Drosophila embryos for live-imaging using the hanging drop protocol. J Vis Exp 25:1206. https://doi.org/10.3791/1206. 116. Piccinini F, Kiss A, Horvath P. 2016. CellTracker (not only) for dummies. Bioinformatics 32:955–957. https://doi.org/10.1093/bioinfor matics/btv686. 117. Jõers P, Lewis SC, Fukuoh A, Parhiala M, Ellilä S, Holt IJ, Jacobs HT. 2013. Mitochondrial transcription terminator family members mTTF and mTerf5 have opposing roles in coordination of mtDNA synthesis. PLoS Genet 9:e1003800. https://doi.org/10.1371/journal.pgen.1003800. 118. Kuznetsov AV, Veksler V, Gellerich FN, Saks V, Margreiter R, Kunz WS. 2008. Analysis of mitochondrial function in situ in permeabilized muscle fibers, tissues and cells. Nat Protoc 3:965–976. https://doi.org/10 .1038/nprot.2008.61. 119. Bradford MM. 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72:248–254. https://doi.org/10 .1016/0003-2697(76)90527-3. Andjelkovic´ et al. Molecular and Cellular Biology December 2018 Volume 38 Issue 24 e00110-18 mcb.asm.org 20 on January 3, 2019 by guesthttp://mcb.asm.org/Downloaded from