scieee AI-readable full text Open interactive document viewer

Beneficial effects of lingonberry (Vaccinium vitis-idaea L.) supplementation on metabolic and inflammatory adverse effects induced by high-fat diet in a mouse model of obesity

Ryyti, Riitta,Hämäläinen, Mari,Peltola, Rainer,Moilanen, Eeva

Full text

RESEARCH ARTICLE Beneficial effects of lingonberry (Vaccinium vitis-idaea L.) supplementation on metabolic and inflammatory adverse effects induced by high-fat diet in a mouse model of obesity Riitta RyytiID 1 , Mari Ha ¨ma ¨la ¨inen 1 , Rainer Peltola 2 , Eeva MoilanenID 1 * 1The Immunopharmacology Research Group, Faculty of Medicine and Health Technology, Tampere University and Tampere University Hospital, Tampere, Finland, 2Natural Resources Institute Finland, Bioeconomy and environment, Rovaniemi, Finland *[email protected] Abstract Obesity is a constantly increasing health problem worldwide. It is associated with a systemic low-grade inflammation, which contributes to the development of metabolic disorders and comorbidities such as type 2 diabetes. Diet has an important role in the prevention of obesity and its adverse health effects; as a part of healthy diet, polyphenolrich berries, such as lingonberry (Vaccinium vitis-idaea L.) have been proposed to have health-promoting effects. In the present study, we investigated the effects of lingonberry supplementation on high-fat diet induced metabolic and inflammatory changes in a mouse model of obesity. Thirty male C57BL/6N mice were divided into three groups (n = 10/ group) to receive low-fat (LF), high-fat (HF) and lingonberry-supplemented high-fat (HF +LGB) diet for six weeks. Low-fat and high-fat diet contained 10% and 46% of energy from fat, respectively. Lingonberry supplementation prevented the high-fat diet induced adverse changes in blood cholesterol and glucose levels and had a moderate effect on the weight and visceral fat gain, which were 26% and 25% lower, respectively, in the lingonberry group than in the high-fat diet control group. Interestingly, lingonberry supplementation also restrained the high-fat diet induced increases in the circulating levels of the proinflammatory adipocytokine leptin (by 36%) and the inflammatory acute phase reactant serum amyloid A (SAA; by 85%). Similar beneficial effects were discovered in the hepatic expression of the inflammatory factors CXCL-14, S100A10 and SAA by lingonberry supplementation. In conclusion, the present results indicate that lingonberry supplementation significantly prevents high-fat diet induced metabolic and inflammatory changes in a murine model of obesity. The results encourage evaluation of lingonberries as a part of healthy diet against obesity and its comorbidities. PLOS ONE PLOS ONE | https://doi.org/10.1371/journal.pone.0232605 May 7, 2020 1 / 17 a1111111111 a1111111111 a1111111111 a1111111111 a1111111111 OPEN ACCESS Citation: Ryyti R, Ha¨ma¨la¨inen M, Peltola R, Moilanen E (2020) Beneficial effects of lingonberry (Vaccinium vitis-idaea L.) supplementation on metabolic and inflammatory adverse effects induced by high-fat diet in a mouse model of obesity. PLoS ONE 15(5): e0232605. https://doi. org/10.1371/journal.pone.0232605 Editor: Michele Vacca, University of Cambridge, UNITED KINGDOM Received: October 4, 2019 Accepted: April 18, 2020 Published: May 7, 2020 Copyright: ©2020 Ryyti et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Data Availability Statement: All relevant data are within the paper. Funding: The study was financially supported by a grant from the European Regional Development Fund (ERDF). Kiantama Ltd, Suomussalmi, Finland provided the lingonberry powder. The funders had no role in the study design, data collection and analysis, decision to publish or preparation of the manuscript. 1. Introduction The prevalence of obesity, metabolic syndrome and type 2 diabetes has increased rapidly worldwide during the last decades. Reasons can be found in changing lifestyles, which lead to reduced physical activity and obesogenic diet. It seems that obesity is continuing to be an increasing global health burden; according to the WHO statistics, 13% of adults aged 18 and over (corresponding to over 650 million people) were obese (body mass index BMI >30 kg/ m 2 ) and 39% overweight in 2016 [1]. Obesity is a complex chronic disorder with a multifactorial etiology, involving genetics, hormones, diet and environment [2], and it has a major impact on various metabolic and (patho)physiological functions in the human body. Obesity is a major risk factor and underlying condition in the progression of many metabolic disorders, particularly type 2 diabetes, cardiovascular diseases and cancer, through its effects on the development of, for instance hypertension, insulin resistance, nonalcoholic fatty liver disease and inflammation [3,4]. Adipose tissue is an active tissue regulating various physiological and pathological processes, including immunity and inflammation. It is therefore no longer considered only as a passive energy storage. Adipose tissue produces and releases several hormone-like factors called adipokines, and many of them have proor anti-inflammatory properties [2,5]. In obese adipose tissue, immune cells secreting pro-inflammatory substances increase in number while those producing anti-inflammatory substances have been shown to decrease. This imbalance is responsible for the obesity induced low-grade inflammation and insulin resistance in the body [3]. Diet has an important role in the prevention and treatment of obesity, type 2 diabetes and other obesity-related diseases. Diets containing plenty of polyphenol-rich vegetables have been shown to lower the risk of obesity-related comorbidities [6–8]. Berries are specifically rich in various polyphenols [9,10]. Diets containing berries are associated with lowered risk of type 2 diabetes, probably due to the flavonoids [11], anthocyanidins [8,12,13] or other polyphenols [14] present in berries. Several intervention studies have shown beneficial effects of berries also on inflammation and cardiovascular diseases [15]. Lingonberry (Vaccinium vitis-idaea L.) has been reported to have promising health-beneficial effects and anti-inflammatory properties in experimental models [16–19]. Lingonberries / lingonberry extracts were found to exhibit antidiabetic potential in various in vitro tests [20] and beneficial metabolic effects in mice exposed to high-fat diet [21–25]. Lingonberries are rich in dietary polyphenols with high antioxidant activities [16,26–28] and contain also essential omega-3 fatty acids [29] and plant sterols [30,31], which may contribute to their healthpromoting effects. Lingonberries are commonly consumed in the Nordic countries and commercially available in many different forms. They are also the most generally collected and commercially utilized wild berries in Finland [32]. In the present study, we aimed to investigate the effects of lingonberry supplementation on metabolic and inflammatory changes in high-fat diet induced experimental obesity in mice to extend the current understanding on the health benefits of lingonberries. As the test material, we used commercially available air-dried lingonberry powder made from Finnish lingonberries. 2. Materials and methods Animals and study design Male C57BL/6N mice (Scanbur Research A/S, Karlslunde, Denmark), 8 weeks of age and 24.3 ±0.2g of weight at the beginning of the experiment, were divided into three groups of 10 mice, PLOS ONE Beneficial effects of lingonberry (Vaccinium vitis-idaea L.) supplementation in a mouse model of obesity PLOS ONE | https://doi.org/10.1371/journal.pone.0232605 May 7, 2020 2 / 17 Competing interests: RR is an employee of Kiantama Ltd; she confirms, that her position has not altered her adherence to the PLOS ONE policies. She and the other authors declare no other competing interests. This does not alter our adherence to PLOS ONE policies on sharing data and materials. and housed two mice per cage in the animal facility of the Tampere University under standard conditions (12/12h light/dark cycle, 22±1 ˚C temperature, and 50–60% humidity) with food and water provided ad libitum. The mice were fed with normal low-fat diet (LF, 10 kcal% fat), with high-fat diet (HF, 46 kcal% fat) or with high-fat diet supplemented with air-dried lingonberry (Vaccinium vitisidaea L.) powder (HF + LGB, 20% w/w) for 6 weeks. Both high-fat diets contained 46% of energy from fat and 36% from carbohydrate, while the low-fat diet had 10% of energy from fat and 72% from carbohydrate (Table 1). Otherwise the custom-made pelleted diets (Research Diets, Inc, New Brunswick, NJ, USA) were matched for protein (18% of energy from protein), fiber, vitamin and trace element contents considering the composition of the lingonberry powder. Air-dried lingonberry powder (100 g powder corresponds to ca 900 g fresh berries) was produced from Finnish lingonberries by Kiantama Ltd (Suomussalmi, Finland). Table 1. Composition of the experimental diets. LF HF HF+LGB Calculated energy (kcal) Protein 716 716 716 Carbohydrate 2840 1422 1422 Starch 2110 691 691 Sugar 730 731 731 Fat 405 1823 1823 Total energy 3961 3961 3961 Calculated energy per gram diet (kcal/g) 3.60 4.39 4.30 Calculated Energy (kcal%) Protein 18 18 18 Carbohydrate 72 36 36 Fat 10 46 46 Fiber (g%) 9 10 10 Lingonberry powder (g) 0 0 184� Ingredients (g) (+ from LGB powder) Casein 200 200 194 (+ 6) total: 200 L-Cystine 3 3 3 Corn Starch 452 73 31 (+ 42) total: 73 Maltodextrin 10 75 100 100 Sucrose 173 173 103 (+ 70) total: 173 Cellulose 94 94 50 (+ 44) total: 94 Soybean Oil 25 25 24 (+ 1) total: 25 Lard 20 178 178 Mineral Mix S10026 10 10 10 DiCalcium Phosphate 13 13 13 Calcium Carbonate 6 6 6 Potassium Citrate 17 17 17 Vitamin Mix V10001 10 10 10 Choline Bitartrate 2 2 2 LF = low-fat diet, HF = high-fat diet, HF+LGB = lingonberry-supplemented high-fat diet �Nutrient content/100 g lingonberry powder: fat 0.8 g, carbohydrates 61 g (of which sugars 38 g), fiber 24 g, protein 3 g https://doi.org/10.1371/journal.pone.0232605.t001 PLOS ONE Beneficial effects of lingonberry (Vaccinium vitis-idaea L.) supplementation in a mouse model of obesity PLOS ONE | https://doi.org/10.1371/journal.pone.0232605 May 7, 2020 3 / 17 Body weight of the mice and food consumption was monitored weekly. At the end of the study, 6h-fasted mice were anesthetized with isoflurane (Oriola Corp., Espoo, Finland), blood glucose was measured and blood was collected by cardiac puncture. Tissue samples were collected for further analyses. The study was approved by the National Animal Experimental Board (permission number ESAVI984/04.10.07/2018) and the experiments were carried out in accordance with the EU legislation for the protection of animals used for scientific purposes (Directive 2010/63/EU). Blood samples and analyses Six-hour fasting (morning fast) blood glucose levels in mice were measured from the tip of the tail with Contour Next One (Oy Diabet Ab, Lemu, Finland). Blood collected by cardiac puncture was centrifuged for 15 minutes at 1500 x g after 30 minutes incubation at room temperature, and obtained serum was immediately storaged at -80 ˚C. Serum triglyceride and total cholesterol levels, and alanine aminotransferase (ALT) activity were measured by fluorometric assays (Abcam, Cambridge, UK). Enzyme-linked immunoassays were used to measure the concentrations of leptin, resistin and adiponectin (R&D Systems Europe Ltd., Abingdon, UK), insulin (Mercodia Ltd., Uppsala, Sweden) and serum amyloid A (Tridelta Development Ltd., Maynooth, Ireland) in serum samples. Detection limits were 7.8 pg/mL for leptin and resistin, 15.6 pg/mL for adiponectin, 33 pmol/L for insulin and 16 ng/mL for SAA. RNA extraction and qRT-PCR Total RNA was extracted from liver using RNeasy Mini Kit (Qiagen Inc., Hilden, Germany). Briefly, samples stored immediately after collection in RNA Later 1 (Ambion, Thermo Fisher Scientific, Waltham, MA, USA) were weighed and maximum of 30 mg of tissue was cut into smaller pieces and homogenized with Qiashredder (Qiagen). RNA was extracted with RNeasy Mini Kit with on-column DNase digestion. RNA was transcribed to cDNA by using Maxima First Strand cDNA Synthesis Kit (Thermo Fisher Scientific) in 10 ul reaction volume and diluted 1:5 with RNase-free water. Quantitative PCR was performed using TaqMan Universal Master Mix and ABI Prism 7500 sequence detection system (Applied Biosystems, Foster City, CA, USA). The PCR cycling parameters were incubation at 50 ˚C for 2 minutes, incubation at 95 ˚C for 10 minutes, and thereafter 40 cycles of denaturation at 95 ˚C for 15 s and annealing and extension at 60 ˚C for 1 minute. Primers and probe for the housekeeping gene glyceraldehyde 3-phosphate dehydrogenase GAPDH) were GCATGGCCTTCCGTGTTC (forward, 300 nM), GATGTCATCATACTTGGCAGGTTT (reverse, 300nM) and TCGTGGATCTGACGTG CCGCC (probe, 150 nM); and TCGGAGGCTTAATTACACATGTTC (forward, 900 nM), CAAGTGCATCATCGTTGTTCATAC (reverse, 300 nM) and CAGAATTGCCATTGCACAACT CTTTTCTCA (probe, 200 nM) for interleukin 6 (IL-6). The sequences and concentrations were optimized according to the manufacturer’s guidelines in TaqMan Universal PCR Master Mix Protocol part number 4304449 revision C (Applied Biosystems). TaqMan Gene Expression assays for interleukin 1β(IL-1β, Mm00434228_m1), monocyte chemoattractant protein 1 (MCP-1, Mm00441242_m1), tumor necrosis alpha (TNF-α, Mm00443260_g1), glucose transporter 2 (GLUT2, Mm00446229_m1), serum amyloid A2 (SAA2, Mm04208126_mH), C-X-C motif chemokine ligand 14 (CXCL-14, Mm00444699_m1), S100 calcium-binding protein A10 (S100A10, Mm00501458_g1), and insulin receptor (Insr, Mm01211875_m1) were used (Thermo Fisher Scientific) and expression levels were calculated using the 2(−ΔΔCT) method. When calculating results, all of the mRNA expression levels were first normalized against GAPDH mRNA levels. PLOS ONE Beneficial effects of lingonberry (Vaccinium vitis-idaea L.) supplementation in a mouse model of obesity PLOS ONE | https://doi.org/10.1371/journal.pone.0232605 May 7, 2020 4 / 17 Statistics Results are expressed as mean + standard error of mean (SEM). One-way and two-way ANOVA with Bonferroni’s post-test, and the analysis of covariance were performed using GraphPad InStat version 3.10 and GraphPad Prism 8 (GraphPad Software, San Diego, USA), and IBM SPSS Statistics version 25.0 (IBM Corporation, Armonk, NY, USA). Asterisks �,� � , and � � � indicate p values smaller than 0.05, 0.01 and 0.001, respectively. 3. Results 3.1. Weight gain The weight of mice in the high-fat (HF) group increased considerably during the study as compared to the mice in the low-fat (LF) control group. Interestingly, lingonberry supplementation prevented significantly the high-fat diet induced weight gain (p <0.001 between HF and HF+LGB groups). After 6 weeks, the average weight of the low-fat group was 28.0±0.4 g, 37.4 ±0.6 g in the high-fat group and 34.1±0.6 g in the lingonberry supplemented high-fat group, respectively (p <0.001 between groups). The development of weight of the mice in the test groups is presented in the Fig 1. The amount of epididymal fat increased in the high-fat diet group, when compared to the low-fat control group (p <0.001). Lingonberry supplementation prevented significantly the accumulation of epididymal fat when compared to the high-fat control group (p <0.001). At the end of the study, the amount of epididymal fat was 2.4±0.1 g in the high-fat group and 1.8 ±0.1 g in the lingonberry supplemented high-fat group. Both high-fat groups had significantly Fig 1. Body weight gain of the mice during the study. Animals received low-fat diet (LF diet, 10% of energy from fat, dark grey line), high-fat diet (HF diet, 46% of energy from fat, black line) or high-fat diet supplemented with lingonberry (HF + LGB diet, light grey line). Weight was measured once a week. The results are expressed as grams (g). Values represent mean + SEM, n= 10 mice per group. Repeated measures two-way ANOVA with Bonferroni post-test was used in the statistical analysis. Mean values significantly different from the high-fat group (HF diet) are marked with �p<0.05, � � p<0.01 and � � � p<0.001. https://doi.org/10.1371/journal.pone.0232605.g001 PLOS ONE Beneficial effects of lingonberry (Vaccinium vitis-idaea L.) supplementation in a mouse model of obesity PLOS ONE | https://doi.org/10.1371/journal.pone.0232605 May 7, 2020 5 / 17 (p <0.001) higher amount of epididymal fat than the low-fat group (0.9±0.0 g; Fig 2). When the ratio of the epididymal fat to the whole-body mass was calculated, it was lower in the HF +LGB group than in the HF group (p <0.01) suggesting that lingonberry supplementation prevents particularly the accumulation of the metabolically highly detrimental visceral adipose tissue. That was also supported by the fact that in the analysis of covariance when the body weight was set as a covariate, the epididymal fat mass was lower in the LF and the HF+LGB groups than in the HF group (p <0.01). Food consumption (kcal/g body weight) was measured weekly and it did not differ between the high-fat and the lingonberry supplemented high-fat diet groups although energy intake in the low-fat diet group was lower, particularly during the first half of the study (Fig 3A). We also calculated the cumulative food consumption (kcal/g body weight) during the six weeks’ study: no difference was found between the high-fat and the lingonberry supplemented highfat groups while the value in the low-fat group was lower (p <0.01; Fig 3B). This result was reproduced in repeated measures analysis of covariance with body weight as a covariate. 3.2. Glucose and insulin Fasting blood glucose level at the end of the study was increased in the high-fat diet group, as compared to the low-fat control group (p <0.01). Interestingly, in the lingonberry supplemented high-fat diet group, the glucose level (10.0±0.5 mmol/L) was lower than that in the Fig 2. The amount of epididymal fat of the mice at the end of the study. Animals received low-fat diet (LF diet, 10% energy from fat, grey column), high-fat diet (HF diet, 46% energy from fat, black column) or high-fat diet supplemented with lingonberry (HF + LGB diet, white column). The amount of epididymal fat was measured at the end of the study. The results are expressed as grams (g). Values represent mean + SEM, n= 10 mice per group. One-way ANOVA with Bonferroni post-test was used in the statistical analysis. Differences between the groups are marked with � � � p<0.001. https://doi.org/10.1371/journal.pone.0232605.g002 PLOS ONE Beneficial effects of lingonberry (Vaccinium vitis-idaea L.) supplementation in a mouse model of obesity PLOS ONE | https://doi.org/10.1371/journal.pone.0232605 May 7, 2020 6 / 17 high-fat control group (11.2±0.4 mmol/L; p <0.05), and there was no statistically significant difference between the low-fat and the lingonberry supplemented high-fat groups (Fig 4). As expected, fasting insulin level was significantly higher in the high-fat group (156.5 pmol/ L) as compared to the low-fat group (65.5 pmol/L; p <0.001). In the lingonberry supplemented high-fat group, the insulin level (113.7 pmol/L) was lower than in the high-fat group, although the effect did not reach statistical significance (Fig 5). 3.3. Cholesterol and triglycerides Cholesterol level was significantly increased in the high-fat group when compared to the lowfat group (p <0.001) being 2.6±0.1 mmol/L in the high-fat group and 1.7±0.1 mmol/L in the low-fat group at the end of the study. Importantly, the cholesterol level in the lingonberry supplemented high-fat group (2.0±0.2 mmol/L) was significantly lower when compared to the high-fat group (p <0.01). There was no statistically significant difference in the cholesterol levels between the low-fat and the lingonberry supplemented high-fat groups indicating that lingonberry supplementation prevented the high-fat diet induced increase in cholesterol levels (Fig 6A). There were no differences in the triglyceride levels between the low-fat and high-fat groups whereas the triglyceride level in the lingonberry supplemented high-fat group was lower than that in the two other groups (p <0.05; Fig 6B). 3.4. Adipokines and inflammatory factors As expected, leptin levels were significantly higher in the high-fat group as compared to the low-fat group (p <0.001). Leptin levels were lower in the lingonberry supplemented high-fat group (27.1±3.5 ng/mL) than in the high-fat control group (39.7±2.8 ng/mL; p <0.01, Fig 3. Food consumption during the study. Fig 3A shows the weekly and Fig 3B the cumulative food consumption during the six weeks’ study. Animals received low-fat diet (LF diet, 10% energy from fat, grey columns), high-fat diet (HF diet, 46% energy from fat, black columns) or high-fat diet supplemented with lingonberry (HF + LGB diet, white columns). Food consumption was measured once a week. The results are expressed as kcal/body weight in grams. Values represent mean + SEM, n= 10 mice per group; as the mice were housed two mice per cage, n= 5 was used in the statistical calculations. Repeated measures two-way ANOVA (Fig 3A) and one-way ANOVA (Fig 3B) with Bonferroni post-test was used in the statistical analysis. Differences between the groups are marked with � � p<0.01 and � � � p<0.001. https://doi.org/10.1371/journal.pone.0232605.g003 PLOS ONE Beneficial effects of lingonberry (Vaccinium vitis-idaea L.) supplementation in a mouse model of obesity PLOS ONE | https://doi.org/10.1371/journal.pone.0232605 May 7, 2020 7 / 17 Table 2). Interestingly, the statistically significant difference was also observed in weightrelated values (1.1±0.1 ng/mL/body weight (g) in HF group vs. 0.8±0.1 ng/mL/body weight (g) in HF+LGB group, p <0.01). In adiponectin, there was a trend towards decreased levels in the high-fat group when compared to low-fat control group (p = 0.277). Adiponectin level was maintained at normal levels with lingonberry supplementation. There were no significant differences in the resistin levels between the groups (Table 2). The levels of the inflammatory acute phase reactant serum amyloid A (SAA) were increased (p <0.001) in the high-fat diet group (11.7±0.7 μg/mL) as compared to the low-fat diet group (6.6±0.6 μg/mL). Importantly, the SAA levels in the lingonberry supplemented high-fat group (7.4±0.4 μg/mL) were significantly lower (p <0.001) than those in the high-fat control group. Similarly, alanine aminotransferase activity was increased in the high-fat diet group as compared to the low-fat diet group (p<0.001) which was prevented by the lingonberry supplementation (p <0.001) (Table 2). High-fat diet is known to induce metabolic and inflammatory changes in the liver. Therefore, we analyzed the expression of insulin receptor and glucose transporter GLUT2 as well as the inflammatory factors TNF-α, IL-1β, IL-6, MCP-1, SAA2, CXCL-14 and S100A10 in the liver by quantitative RT-PCR. As shown in the Fig 7, the hepatic expression of CXCL-14 (p <0.001), S100A10 (p <0.05), and SAA2 (p <0.01) were significantly lower in the lingonberry supplemented high-fat diet group than in the high-fat control group, while IL-6 was under detection limit and no statistically significant differences in the expression of TNF-α, IL-1β, MCP-1, GLUT2 or insulin receptor were observed between the groups. Fig 4. The fasting blood glucose levels of mice at the end of the study. Animals received low-fat diet (LF diet, 10% energy from fat, grey column), high-fat diet (HF diet, 46% energy from fat, black column) or high-fat diet supplemented with lingonberry (HF + LGB diet, white column). At the end of the study, blood samples for glucose measurements were collected after 6 h fasting. The results are expressed as mmol/L. Values represent mean + SEM, n= 10 mice per group. One-way ANOVA with Bonferroni post-test was used in the statistical analysis. Differences between the groups are marked with �p<0.05, � � p<0.01 and ns = not significant. https://doi.org/10.1371/journal.pone.0232605.g004 PLOS ONE Beneficial effects of lingonberry (Vaccinium vitis-idaea L.) supplementation in a mouse model of obesity PLOS ONE | https://doi.org/10.1371/journal.pone.0232605 May 7, 2020 8 / 17 Discussion In the present study, we found that lingonberry supplementation prevented high-fat diet induced adverse effects on blood cholesterol, glucose and insulin levels as well as visceral fat gain in a murine model of obesity. In addition, the circulating levels of the pro-inflammatory adipocytokine leptin and the inflammatory acute phase reactant and biomarker serum amyloid A (SAA), as well as the alanine aminotransferase (ALT) activity were maintained at lower level by lingonberry supplementation, and the same was detected in hepatic expression of the inflammatory factors CXCL-14, S100A10 and SAA. To our knowledge, this is the first study in which such significant results have been obtained with an air-dried lingonberry powder. The results are remarkable also considering the rather short duration (6 weeks) of the study. Obesity is a risk factor for glucose intolerance leading to diabetes, which is first detected as increased circulating insulin concentrations followed by increased fasting blood glucose levels [33,34]. In the present study, increased insulin and glucose levels were found already after six weeks on high-fat diet. Lingonberry supplementation prevented these effects. These findings are supported by previous studies with freeze-dried lingonberries and lingonberry extract on a longer follow-up [21–23,25,35] while bilberry supplementation did not have any effect on Fig 5. The insulin levels of mice at the end of the study. Animals received low-fat diet (LF diet, 10% energy from fat, grey column), high-fat diet (HF diet, 46% energy from fat, black column) or high-fat diet supplemented with lingonberry (HF + LGB diet, white column). At the end of the study, blood samples were collected after 6 h fasting and serum insulin concentrations were analyzed with ELISA. The results are expressed as pmol/L. Values represent mean + SEM, n= 10 mice per group. One-way ANOVA with Bonferroni post-test was used in the statistical analysis. Differences between the groups are marked with � � � p<0.001. https://doi.org/10.1371/journal.pone.0232605.g005 PLOS ONE Beneficial effects of lingonberry (Vaccinium vitis-idaea L.) supplementation in a mouse model of obesity PLOS ONE | https://doi.org/10.1371/journal.pone.0232605 May 7, 2020 9 / 17 43. AbuMweis SS, Jones PJH. Cholesterol-lowering effect of plant sterols. Curr Atheroscler Rep. 2008; 10: 467–472. https://doi.org/10.1007/s11883-008-0073-4 PMID: 18937893 44. Prior RL, Wu X, Gu L, Hager T, Hager A, Wilkes S, et al. Purified berry anthocyanins but not whole berries normalize lipid parameters in mice fed an obesogenic high fat diet. Molecular Nutrition and Food Research. 2009; 53: 1406–1418. https://doi.org/10.1002/mnfr.200900026 PMID: 19743407 45. Eid HM, Ouchfoun M, Brault A, Vallerand D, Musallam L, Arnason JT, et al. Lingonberry (Vaccinium vitis-idaea L.) exhibits antidiabetic activities in a mouse model of diet-induced obesity. Evidence-based Complementary and Alternative Medicine. 2014; 2014: 645812–10. https://doi.org/10.1155/2014/ 645812 PMID: 25013446 46. Tonstad S, Despre ´s J. Treatment of lipid disorders in obesity. Expert Review of Cardiovascular Therapy. 2011; 9: 1069–1080. https://doi.org/10.1586/erc.11.83 PMID: 21878051 47. Biddinger SB, Almind K, Miyazaki M, Kokkotou E, Ntambi JM, Kahn CR. Effects of Diet and Genetic Background on Sterol Regulatory Element-Binding Protein-1c, Stearoyl-CoA Desaturase 1, and the Development of the Metabolic Syndrome. Diabetes. 2005; 54: 1314–1323. https://doi.org/10.2337/ diabetes.54.5.1314 PMID: 15855315 48. Guo J, Jou W, Gavrilova O, Hall KD. Persistent diet-induced obesity in male C57BL/6 mice resulting from temporary obesigenic diets. PLoS ONE. 2009; 4: e5370. https://doi.org/10.1371/journal.pone. 0005370 PMID: 19401758 49. Podrini C, Cambridge EL, Lelliott CJ, Carragher DM, Estabel J, Gerdin A, et al. High-fat feeding rapidly induces obesity and lipid derangements in C57BL/6N mice. Mammalian Genome. 2013; 24: 240–251. https://doi.org/10.1007/s00335-013-9456-0 PMID: 23712496 50. Smith BW, Adams LA. Nonalcoholic fatty liver disease and diabetes mellitus: Pathogenesis and treatment. Nature Reviews Endocrinology. 2011; 7: 456–465. https://doi.org/10.1038/nrendo.2011.72 PMID: 21556019 51. Shibata R, Ouchi N, Ohashi K, Murohara T. The role of adipokines in cardiovascular disease. J Cardiol. 2017; 70: 329–334. https://doi.org/10.1016/j.jjcc.2017.02.006 PMID: 28325521 52. Scotece M, Conde J, Vuolteenaho K, Koskinen A, Lo ´pez V, Go ´mez-Reino J, et al. Adipokines as drug targets in joint and bone disease. Drug Discov Today. 2014; 19: 241–258. https://doi.org/10.1016/j. drudis.2013.07.012 PMID: 23906693 53. Pan H, Guo J, Su Z. Advances in understanding the interrelations between leptin resistance and obesity. Physiol Behav. 2014; 130: 157–169. https://doi.org/10.1016/j.physbeh.2014.04.003 PMID: 24726399 54. Zhou Y, Rui L. Leptin signaling and leptin resistance. Frontiers of Medicine. 2013; 7: 207–222. https:// doi.org/10.1007/s11684-013-0263-5 PMID: 23580174 55. Paz-Filho G, Mastronardi C, Franco CB, Wang KB, Wong M, Licinio J. Leptin: molecular mechanisms, systemic pro-inflammatory effects, and clinical implications. Arquivos Brasileiros de Endocrinologia & Metabologia. 2012; 56: 597–607. 56. Sack GH. Serum amyloid A—a review. Mol Med. 2018; 24: 46. https://doi.org/10.1186/s10020-0180047-0 PMID: 30165816 57. Sun L, Ye RD. Serum amyloid A1: Structure, function and gene polymorphism. Gene. 2016; 583: 48– 57. https://doi.org/10.1016/j.gene.2016.02.044 PMID: 26945629 58. Joseph SV, Edirisinghe I, Burton-Freeman BM. Berries: Anti-inflammatory effects in humans. J Agric Food Chem. 2014; 62: 3886–3903. https://doi.org/10.1021/jf4044056 PMID: 24512603 59. Bujor O, Ginies C, Popa VI, Dufour C. Phenolic compounds and antioxidant activity of lingonberry (Vaccinium vitis-idaea L.) leaf, stem and fruit at different harvest periods. Food Chemistry. 2018; 252: 356– 365. https://doi.org/10.1016/j.foodchem.2018.01.052 PMID: 29478554 60. Heinonen M. Antioxidant activity and antimicrobial effect of berry phenolics—A Finnish perspective. Molecular Nutrition and Food Research. 2007; 51: 684–691. https://doi.org/10.1002/mnfr.200700006 PMID: 17492800 61. Ek S, Kartimo H, Mattila S, Tolonen A. Characterization of phenolic compounds from lingonberry (Vaccinium vitis-idaea). J Agric Food Chem. 2006; 54: 9834–9842. https://doi.org/10.1021/jf0623687 PMID: 17177509 62. Ka ¨hko ¨nen MP, Hopia AI, Heinonen M. Berry phenolics and their antioxidant activity. J Agric Food Chem. 2001; 49: 4076–4082. https://doi.org/10.1021/jf010152t PMID: 11513713 63. Hajazimi E, Landberg R, Zamaratskaia G. Simultaneous determination of flavonols and phenolic acids by HPLC-CoulArray in berries common in the Nordic diet. LWT—Food Science and Technology. 2016; 74: 128–134. 64. Nardi GM, De Farias Janua ´rio Adriana Graziele, Freire CG, Megiolaro F, Schneider K, Perazzoli MRA, et al. Anti-inflammatory activity of berry fruits in mice model of inflammation is based on oxidative stress PLOS ONE Beneficial effects of lingonberry (Vaccinium vitis-idaea L.) supplementation in a mouse model of obesity PLOS ONE | https://doi.org/10.1371/journal.pone.0232605 May 7, 2020 16 / 17 modulation. Pharmacognosy Research. 2016; 8: S42–S49. https://doi.org/10.4103/0974-8490.178642 PMID: 27114691 65. Ha ¨ma ¨la ¨inen M, Nieminen R, Vuorela P, Heinonen M, Moilanen E. Anti-inflammatory effects of flavonoids: Genistein, kaempferol, quercetin, and daidzein inhibit STAT-1 and NF-κB activations, whereas flavone, isorhamnetin, naringenin, and pelargonidin inhibit only NF-κB activation along with their inhibitory effect on iNOS expression and NO production in activated macrophages. Mediators Inflamm. 2007; 2007: 1–10. 66. Yoon JS, Chae MK, Lee SY, Lee EJ. Anti-inflammatory effect of quercetin in a whole orbital tissue culture of Graves’ orbitopathy. Br J Ophthalmol. 2012; 96: 1117–1121. https://doi.org/10.1136/ bjophthalmol-2012-301537 PMID: 22661653 67. Ahn J, Lee H, Kim S, Park J, Ha T. The anti-obesity effect of quercetin is mediated by the AMPK and MAPK signaling pathways. Biochem Biophys Res Commun. 2008; 373: 545–549. https://doi.org/10. 1016/j.bbrc.2008.06.077 PMID: 18586010 68. Jung CH, Cho I, Ahn J, Jeon T, Ha T. Quercetin Reduces High-Fat Diet-Induced Fat Accumulation in the Liver by Regulating Lipid Metabolism Genes. Phytotherapy Research. 2013; 27: 139–143. https:// doi.org/10.1002/ptr.4687 PMID: 22447684 69. Grace MH, Esposito D, Dunlap KL, Lila MA. Comparative analysis of phenolic content and profile, antioxidant capacity, and anti-inflammatory bioactivity in wild Alaskan and commercial Vaccinium berries. J Agric Food Chem. 2014; 62: 4007–4017. https://doi.org/10.1021/jf403810y PMID: 24219831 70. Bakowska-Barczak AM, Marianchuk M, Kolodziejczyk P. Survey of bioactive components in Western Canadian berries. Can J Physiol Pharmacol. 2007; 85: 1139–1152. https://doi.org/10.1139/Y07-102 PMID: 18066116 71. Debnath SC, Sion M. Genetic Diversity, Antioxidant Activities, and Anthocyanin Contents in Lingonberry. International Journal of Fruit Science. 2009; 9: 185–199. 72. Zheng S, Huang K, Zhao C, Xu W, Sheng Y, Luo Y, et al. Procyanidin attenuates weight gain and modifies the gut microbiota in high fat diet induced obese mice. Journal of Functional Foods. 2018; 49: 362–368. 73. Garbacki N, Kinet M, Nusgens B, Desmecht D, Damas J. Proanthocyanidins, from Ribes nigrum leaves, reduce endothelial adhesion molecules ICAM-1 and VCAM-1. J Inflamm. 2005; 2: 9. 74. Wu T, Yin J, Zhang G, Long H, Zheng X. Mulberry and cherry anthocyanin consumption prevents oxidative stress and inflammation in diet-induced obese mice. Molecular Nutrition & Food Research. 2016; 60: 687–694. 75. Wu T, Qi X, Liu Y, Guo J, Zhu R, Chen W, et al. Dietary supplementation with purified mulberry (Morus australis Poir) anthocyanins suppresses body weight gain in high-fat diet fed C57BL/6 mice. Food Chemistry. 2013; 141: 482–487. https://doi.org/10.1016/j.foodchem.2013.03.046 PMID: 23768383 76. Rimando AM, Kalt W, Magee JB, Dewey J, Ballington JR. Resveratrol, pterostilbene, and piceatannol in Vaccinium berries. J Agric Food Chem. 2004; 52: 4713–4719. https://doi.org/10.1021/jf040095e PMID: 15264904 77. Wahab A, Gao K, Jia C, Zhang F, Tian G, Murtaza G, et al. Significance of resveratrol in clinical management of chronic diseases. Molecules. 2017; 22: 1329. 78. Era¨salo H, Ha¨ma¨la¨inen M, Leppa¨nen T, Ma¨ki-Opas I, Laavola M, Haavikko R, et al. Natural Stilbenoids Have Anti-Inflammatory Properties in Vivo and Down-Regulate the Production of Inflammatory Mediators NO, IL6, and MCP1 Possibly in a PI3K/Akt-Dependent Manner. J Nat Prod. 2018; 81: 1131–1142. https://doi.org/10.1021/acs.jnatprod.7b00384 PMID: 29726680 79. Laavola M, Nieminen R, Leppa ¨nen T, Eckerman C, Holmbom B, Moilanen E. Pinosylvin and Monomethylpinosylvin, Constituents of an Extract from the Knot of Pinus sylvestris, Reduce Inflammatory Gene Expression and Inflammatory Responses in Vivo. J Agric Food Chem. 2015; 63: 3445–3453. https://doi.org/10.1021/jf504606m PMID: 25763469 80. Ji G, Wang Y, Deng Y, Li X, Jiang Z. Resveratrol ameliorates hepatic steatosis and inflammation in methionine/choline-deficient diet-induced steatohepatitis through regulating autophagy. Lipids in Health and Disease. 2015; 14: 134. https://doi.org/10.1186/s12944-015-0139-6 PMID: 26498332 81. Ohara K, Kusano K, Kitao S, Yanai T, Takata R, Kanauchi O. ε-Viniferin, a resveratrol dimer, prevents diet-induced obesity in mice. Biochem Biophys Res Commun. 2015; 468: 877–882. https://doi.org/10. 1016/j.bbrc.2015.11.047 PMID: 26596701 82. Chang C, Lin K, Peng K, Day Y, Hung L. Resveratrol exerts anti-obesity effects in high-fat diet obese mice and displays differential dosage effects on cytotoxicity, differentiation, and lipolysis in 3T3-L1 cells. Endocr J. 2016; 63: 169–178. https://doi.org/10.1507/endocrj.EJ15-0545 PMID: 26698690 83. Bhatt JK, Thomas S, Nanjan MJ. Resveratrol supplementation improves glycemic control in type 2 diabetes mellitus. Nutr Res. 2012; 32: 537–541. https://doi.org/10.1016/j.nutres.2012.06.003 PMID: 22901562 PLOS ONE Beneficial effects of lingonberry (Vaccinium vitis-idaea L.) supplementation in a mouse model of obesity PLOS ONE | https://doi.org/10.1371/journal.pone.0232605 May 7, 2020 17 / 17