scieee AI-readable full text Open interactive document viewer

The use of macroarray as a simple tool to follow the metabolic profile of Lactobacillus plantarum during fermentation

Kahala, Minna,Ahola, Virpi,Mäkimattila, Elina,Paulin, Lars,Joutsjoki, Vesa

Full text

Advances in Microbiology, 2014, 4, 996-1016 Published Online October 2014 in SciRes. http://www.scirp.org/journal/aim http://dx.doi.org/10.4236/aim.2014.414111 How to cite this paper: Kahala, M., Ahola, V., Mäkimattila, E., Paulin, L. and Joutsjoki, V. (2014) The Use of Macroarray as a Simple Tool to Follow the Metabolic Profile of Lactobacillus plantarum during Fermentation. Advances in Microbiology, 4, 996-1016. http://dx.doi.org/10.4236/aim.2014.414111 The Use of Macroarray as a Simple Tool to Follow the Metabolic Profile of Lactobacillus plantarum during Fermentation Minna Kahala1, Virpi Ahola2, Elina Mäkimattila1, Lars Paulin3, Vesa Joutsjoki1 1Biotechnology and Food Research, MTT Agrifood Research Finland, Jokioinen, Finland 2Department of Biosciences, University of Helsinki, Helsinki, Finland 3Institute of Biotechnology, University of Helsinki, Helsinki, Finland Email: [email protected] Received 25 June 2014; revised 11 July 2014; accepted 16 August 2014 Copyright © 2014 by authors and Scientific Research Publishing Inc. This work is licensed under the Creative Commons Attribution International License (CC BY). http://creativecommons.org/licenses/by/4.0/ Abstract This study focused on defining the differences in L. plantarum gene expression levels in different media and in different growth phases using an easy and cost-efficient monitoring of gene expression. A macroarray based on a group of selected L. plantarum genes, 178 genes belonging to 18 main groups, printed onto a nitrocellulose filter was designed in this work. Using the macrofilters designed, the expression of a selected set of L. plantarum genes was assayed in synthetic MRS medium and in extracted carrot juice. To compare the potential differences of starter gene expression in hygienic and contaminated cultivation media, the L. plantarum strain was cultivated in both sterile and contaminated (yeast and Escherichia coli) MRS and carrot juice. The number of genes found to be regulated as a function of growth was clearly higher in MRS-based growth medium than in carrot juice, In carrot juice, expression of the gene encoding malolactic enzyme (MLE), which makes L. plantarum an advantageous microbe in e.g. wine making, was found to be upregulated in logarithmic phase of growth. The current study demonstrated that macroarrays printed on nitrocellulose filters with simple robotic systems can be analyzed by standard laboratory equipment and methods usually available in molecular laboratories. Using this technology, rapid and cost-efficient analysis of genome function of L. plantarum can be carried out e.g. in developing regions, where lactic acid fermentation of food and feed matrices is a common practice. Keywords Macroarray, Gene Expression, L. plantarum M. Kahala et al. 997 1. Introduction Lactic acid bacteria (LAB) are widely used for the preservation of food and feed raw materials and to intensify the flavour and texture of fermented products. Of the lactobacilli commonly used in food processes, Lactobacillus plantarum is important in the production of many fermented foods of both plant (pickled vegetables, silage, sourdough) and animal (dry ferment sausages, fermented fish, cheese) origin [1]. This versatility and ecological flexibility is most likely associated with the genome size of L. plantarum, which is one of the largest known among LAB [2]. Based on complete genome sequencing, L. plantarum has a capacity to use a large variety of carbon sources and encompasses a relatively high number of regulatory functions concentrated within a defined genomic region, which was designated the lifestyle adaptation region [3]. These genomic features exhibit an efficient adaptation capacity of L. plantarum to versatile environmental conditions. Due to the ability to maintain pH homeostasis at low external pH, L. plantarum is tolerant to acidic environment and often becomes the dominant LAB at the end of spontaneous vegetable fermentation [4]. Therefore, this species is common in vegetable and silage fermentations. Yet, spontaneous fermentation is generally poorly controlled and unstable, and the quality of products varies depending on fermented material and inherent microbiota. Spontaneously fermented vegetables may also contain among other things biogenic amines, which have been associated with certain toxicological characteristics and outbreaks of food poisoning. The formation of biogenic amines has been repressed by the use of a pure L. plantarum starter instead of spontaneous fermentation [5]. For the above reasons, well-characterized starter cultures with desirable properties would be of particular importance. Previously, the technological properties of potential starter LAB could be determined almost exclusively in pilotand full-scale food and feed production experiments. Today, the development of molecular techniques has made possible the exploitation of genomic and proteomic data for the observation of potential genotypic and phenotypic differences between individual strains in specific growth conditions. Studies based on L. plantarum DNA-microarrays [6], proteomic patterns [7]-[10] and sequencing technologies, like metagenomic sequencing and RNAseq [11]-[13] and transcriptional profiling [14]-[17] have been carried out to elucidate strain-specific differences in genome composition and adaptation to various growth conditions. Both microarray and proteomic studies require specific laboratory facilities and expertise, which may not be available in all research laboratories. Yet, L. plantarum is used worldwide for food and feed fermentations and there is a growing demand for the design of starter cultures with well-characterized technological properties. For easy and cost-efficient monitoring of gene expression in L. plantarum, a macroarray based on a group of selected L. plantarum genes printed onto a nitrocellulose filter was designed in this work. Using the macrofilters designed, the expression of a selected set of L. plantarum genes was assayed in synthetic MRS medium and in extracted carrot juice. To compare the potential differences of starter gene expression in hygienic and contaminated cultivation media, the studied L. plantarum strain was cultivated in both sterile and contaminated (yeast and Escherichia coli) MRS and carrot juice. 2. Materials and Methods 2.1. Bacterial Strains and Growth Conditions L. plantarum strain MLBPL1 has been isolated from sauerkraut [18] [19]. The strain was routinely grown in microaerophilic conditions at 32˚C and maintained in MRS broth (Difco, BD, Franklin Lakes, NJ, USA). For plating, MRS was solidified with 1.5% agar. E. coli DH5 α , carrying the plasmid vector pBluescript, was grown in Luria Bertani broth supplemented with ampicillin (50 µg/ml) as a selective agent at 37˚C 200 rpm. For contamination cultivations, a yeast and an E. coli strain originating from spoiled vegetables were propagated in YGC broth at 30˚C and in Luria Bertani broth at 37˚C, respectively. For macroarray analyses, L. plantarum strain MLBPL1 was grown in synthetic medium MRS and carrot juice. To simulate contaminated growth conditions, the spoiling E. coli and yeast strains were inoculated into MRS and carrot juice. Cultivations were performed using Spectra/Por Float-A-Lyzer dialysis tube (MWCO 100 kDa, Spectrum Laboratories, Rancho Dominguez, CA, USA) in order to make it easier to separate the L. plantarum cells, the vegetable matrix and the spoiling strains of yeast and E. coli. By using the dialysis tube, no filtering of plant material was needed and in addition, the cells of contaminating strains didn’t interfere with the extraction of RNA. Carrot juice was prepared from fresh vegetables with a juice extractor. The extracted juice was centrifuged at 18,500 g for 40 min and pasteurized in a water bath at 95˚C for 30 min. An overnight culture of MLBPL1, grown in MRS-medium at 32˚C, was used to inoculate MRS broth and M. Kahala et al. 998 carrot juice. For MRS cultivation, a 1% inoculumn was used. For carrot juice cultivation and contamination cultivations, the inoculumn was centrifuged at 13,000 g for 3 min and the pellet was suspended into centrifuged (18,500 g for 40 min) and filter-sterilized (0.8/0.2 µm pore sizes) carrot juice (carrot cultivations) or MRS broth (MRS contamination cultivation), after which the suspension was transferred to a Spectra/Por Float-A-Lyzer dialysis tube. The tube was then transferred to a bottle containing carrot juice, contaminated MRS broth or contaminated carrot juice. In contamination cultivations, MRS broth and carrot juice were contaminated by inoculating them with 1% E. coli and yeast. The cultivations were performed at 32˚C. The growth was determined by plating onto MRS agar plates appropriate dilutions from the samples taken during the growth. The plates were incubated at 32˚C for 48 h, until single bacterial colonies appeared. 2.2. Extraction and Labeling of RNA Bacterial cells of the L. plantarum strain MLBPL1 grown in MRS broth and carrot juice were harvested at exponential (6 h) and stationary phase (14 h) of growth by centrifugation for 3 min at 4˚C at 11,000 g. The collected cells were frozen immediately in liquid nitrogen and stored at −70˚C. Extraction of total RNA was carried out with SV total RNA isolation system (Promega, Madison, WI, USA) with some modifications to the protocol on the disruption of the cells. Briefly, bacterial cells thawed slowly on ice were first washed with sterile water treated with diethyl pyrocarbonate (DEPC) and collected by centrifugation. Next, the pellet was resuspended into 225 µl of SV RNA lysis buffer of the Promega kit and transferred to an eppendorf tube containing 100 µl of nitric acid-washed glass beads. The cells were disrupted with glass beads in a cell homogenizer as described before (Kahala, et al., 2008). After that, the lysate was transferred to a new tube and 350 µl of SV RNA dilution buffer of the Promega kit was added per 175 µl of lysate. From this step on, the extraction was carried on as recommended by the manufacturer. Two technical duplicates from the RNA extraction on each culture medium and harvesting point were made. mRNA was enriched from total RNA samples by removing the 16S and 23S rRNAs with MICROB Express Bacterial mRNA Purification kit (Ambion, Austin, TX, USA) according to the instructions of the manufacturer. The RNA concentration was determined spectrophotometrically at 260 nm. The integrity of the isolated prokaryotic RNA was determined by total RNA gel electrophoresis and Northern blot carried out as described by [20]. Total RNA samples, denatured with glyoxal and dimethylsulphoxide, were separated by size in a 1.0% (w/v) agarose gel in 10 mM sodium phosphate buffer, pH 6.5 followed by a transfer to a positively charged nylon membrane (Roche) and hybridization with a ldhD-specific 736 bp probe, amplified with primer pair 5’-AAGTTAGCCGACGAAGGG-3’ and 5’-CCATGTTGTGAACGGCAG-3’ targeted to L. plantarum strain D90339.1. The probe was labelled with digoxigenin-dUTP according to the instructions of the manufacturer (Roche). Luminescent DIG detection kit (Roche) was used for hybrid detection. To detect the potential residual chromosomal DNA in the isolated mRNA sample, primers 5’-AAGTTAGCCGACGAAGGG-3’ and 5’-GGGCGTATAATTCGTCCAAA-3’ designed to produce a 403 bp fragment from the target ldhD gene of L. plantarum strain D90339.1 were used. PCR-procedure using Dynazyme II DNA polymerase (Finnzymes, Espoo, Finland) was carried out in the reaction conditions recommended by the enzyme manufacturer. cDNA was synthesized by RT from DNA-free mRNA and cDNA labelling was performed with an alkalilabile digoxigenin-11-dUTP (DIG) (Roche, Basel, Switzerland) in a reverse transcription reaction with Im-Prom-II Reverse Transcription System kit (Promega) as follows: 1 µg of mRNA was mixed with 0.5 µg of random hexamer primers provided by the kit manufacturer. The mixture was heated at 70˚C for 5 min and chilled on ice for 5 min. cDNA synthesis was carried out by combining RNA-primer mixture with 1 × ImProm-II reaction buffer, 5 mM MgCl2, 0.5 mM dATP, 0.5 mM dGTP, 0.5 mM dCTP, 0.325 mM dTTP, 0.175 mM DIG-11dUTP, 1 U/µl RNasin Ribonuclease Inhibitor, and 1 µl ImProm-II Reverse Transcriptase. Annealing was performed at 25˚C for 5 min, followed by extension at 43˚C for 1h and enzyme inactivation at 70˚C for 15 min. The labeled cDNA was purified with Microarray Target Purification kit (Roche) according to the instructions of the manufacturer. 2.3. PCR and Labeling of the Positive Control for Macroarray Human-based HbGAM (heparin-binding growth-associated molecule) gene [21] inserted into the plasmid pBluescript (Agilent Technologies, Santa Clara, CA) was amplified with polymerase chain reaction (PCR) to be used as a positive control in macroarray analyses. PCR reactions were carried out with Dynazyme II DNA polymerase (Finnzymes, Espoo, Finland) using the reaction conditions recommended by the manufacturer. Bacte- M. Kahala et al. 999 rial lysate of the E. coli strain DH5α, harbouring the recombinant pBluescript-HbGAM plasmid to be used as a template for PCR, was obtained by disrupting the cells with glass beads. To amplify the HbGAM gene, the primer pair 5’-GTAAAACGACGGCCAG-3’ and 5’-CAGGAAACAGCTATGAC-3’ targeting the plasmid was used. The amplified PCR product was purified with Wizard® SV Gel and PCR Clean-Up System (Promega) and labelled with DIG-11-dUTP using DIG-High Prime labeling kit (Roche). 2.4. Amplification of L. plantarum MLBPL1 Genes and Macroarray Printing Primers were designed for the amplification of selected genes from the fully sequenced genome of L. plantarum WCFS1 [3]. The gene list and designed primers are listed in Supplement 1. To enable an easy re-amplification of the PCR-products, universal nucleotide sequences were added to the 5’ termini of the specific forward and reverse primers. A nucleotide sequence 5’ CCGCTGCTAGGCGCGCCGTG was added to the forward primers and, respectively, a nucleotide sequence 5’ GCAGGGATGCGGCCGCTGAC was added to the reverse primers. Amplification of the selected genes was done as described for the positive control for macroarray. For the PCR reaction, a 10 pmol primer concentration and 20 ng of corresponding genomic template DNA were used in a 100 µl reaction volume in a 96 well PCR plate. The success of the PCR amplification was checked by analyzing 5 µl from the reactions on a 1% agarose gel. The obtained PCR products were purified using Montage PCR Purification 96 Well Plates (Millipore). PCR fragments in the 96 well plates were transferred to 384 plates for printing on the nitrocellulose macroarray (Supplement 2). Purified PCR fragments were gridded in duplicate on nitrocellulose membranes with a QPix automated colony picker (Genetix Ltd., UK) using a 384-pin gridding head as described in [22]. 2.5. Hybridization and Detection Macroarrays were prehybridized for 2 h at 60˚C with 20 ml of DIG Easy Hyb buffer (Roche). Hybridizations were performed overnight at 60˚C with 6 ml DIG Easy Hyb buffer (Roche) containing 5 µl of labeled cDNA probe and HbGAM which was used as a positive control in hybridization reactions. After hybridization, macroarrays were washed twice at room temperature for 5 min with washing solution containing 2 × SSC (1 × SSC is 0.15 M NaCl and 15 mM sodium citrate) and 0.1% sodium dodecyl sulphate (SDS) and twice at 68˚C for 15 min with washing solution (0.1 × SSC, 0.1% SDS). Hybridized spots were detected with chemiluminesence-based DIG detection kit (Roche) using CDP-Star (Roche) as a substrate and chemiluminescence produced was detected by FluorChem (Alpha Innotech Corp., San Leandro, CA) gel image system. For reprobing, the DIG-labelled probe was removed with a following procedure. The membrane was rinsed thoroughly in sterile water, washed twice with 0.2 M NaOH containing 0.1% SDS at 37˚C for 20 min and rinsed with 2 × SSC for 5 min. 2.6. Statistical Methods The DNA probes spotted on the macroarray were selected using results from the previous proteomics results using 2-DE and HPLC-ESI-MS/MS [8]. Additionally, computationally predicted expression values were used for choosing the remaining probes. Codon usage differences (codon bias) were used for predicting gene expression levels for all 3009 genes of L. plantarum (C) [3], and the set of 63 genes encoding ribosomal proteins (RB). Codon bias for a gene g with respect to gene set G was calculated by the formula ( ) ( ) ( ) ( ) ( ) ,, ,, ,, a xyz a BgG pag f xyz gxyz =  = −    ∑∑ (1) where f(x,y,z) denotes a normalized frequency of the codon triplet (x,y,z) coding for an amino acid a in a gene g, g(x,y,z) denotes the frequency of the codon triplet (x,y,z) in the gene set G, and pa(g) is the fraction of the amino acid a in the gene g [23]. The gene g was predicted as highly expressed if the relative codon bias ( ) ( ) B gC RCB B g RB = (2) exceeded 1.05. The genes obtaining the greatest RCB values were chosen for the DNA macroarray filter in addi- M. Kahala et al. 1000 tion to those identified by the HPLC-ESI-MS/MS. After scanning of the macroarray images, the quantification of the hybridized signals and background subtraction were done by the TIGR Spotfinder image processing software [24]. After quantification and background correction, the signals were normalized using median array intensities. Finally, the expression levels for each gene and sample was obtained by taking median of the normalized intensity values across the two replicates of each sample. Gene expression levels were compared between MRS, carrot juice and contaminated versions of the growth media in exponential (6 h) and stationary (14 h) growth phases. The pair-wise comparisons were made using fold changes, ratios of the mean expression levels. Fold changes greater than two are reported in the results. All genes in the array were grouped into functional groups according to their main roles. Gene set enrichment analysis was made for the gene sets with fold change greater than two in order to test whether any functional group is overrepresented among the differentially expressed genes between two growth media. Analyses were made using SAS® (SAS for Windows 9.1). 3. Results Growth rate of L. plantarum MLBPL1 cells was similar in MRS and carrot juice (Figure 1). Integrity and purity of the isolated RNA were demonstrated by Northern blot and PCR of the ldhD gene (data not shown). The macroarray included 178 genes belonging to 18 main groups. The largest groups were energy metabolism (59 genes), protein synthesis (30 genes), protein fate (10 genes), regulatory functions (10 genes), cell envelope (9 genes) and DNA metabolism (9 genes). Of the 178 genes tested, 18 (10%) showed a mean fold change greater than 2.0 in at least one of the ten comparisons between growth media or growth phases (Table 1). The most frequent functions included were energy metabolism, cell envelope, protein fate and nucleotide metabolism. 3.1. Expression Levels of the Genes as a Function of Growth The majority of the genes studied on the membranes showed no significant change in levels of expression during the growth or between the growth media. The number of the genes found to be regulated as a function of growth was clearly higher in MRS-based growth medium than in carrot juice, in which only genes involved in fatty acid and phospholipid metabolism showed differential expression in different growth phases. The function of the genes showing upregulation in logarithmic phase in MRS medium was mostly related to energy metabolism, but also to cell division, cell envelope biosynthesis and pyrimidine ribonucleotide biosynthesis. Generation of sufficient energy for growth in logarithmic phase is important and was evidenced in the MRS based medium. In MRS cultivation, when entering in the stationary phase of growth, transcription of genes involved in energy metabolic pathways decreased and higher expression levels were found for genes involved in protein fate, protein folding and stabilization, like “folding” chaperones DnaK and GroEL. In contaminated MRS medium, especially the expression levels of genes involved in sugar metabolism pathways (galK, lacM) were found to be higher in logarithmic phase. This reflects higher demand for energy in the logarithmic phase and probably competition between the Lactobacillus and contaminating strains in the utilization of sugars that are needed for growth. Figure 1. Growth of L. plantarum MLBPL1 in two growth media. 1.0E+06 1.0E+07 1.0E+08 1.0E+09 1.0E+10 0 5 10 15 20 25 CFU/ml time/h MRS Carrot M. Kahala et al. 1001 Table 1. Genes and their main roles showing mean fold change > 2.0 in ten comparisons among growth media and two growth phases. Minus and plus signs show which of the compared groups has higher expression: +: shows higher expression in the first; −: in the second group. Main role gene ORF gene product MRS vs MRS cont. 6 h MRS vs MRS cont. 14 h Carrot juice vs Carrot juice cont. 6 h Carrot juice vs Carrot juice cont. 14 h MRS vs Carrot juice 6 h MRS vs Carrot juice 14 h MRS 6h vs 14 h MRS cont. 6 h vs 14 h Carrot juice 6 h vs 14 h Carrot juice cont 6 h vs 14 h Energy metabolism— Pyruvate dehydrogenase pdhB lp_2153 pyruvate dehydrogenase complex, E1 component, beta subunit −2.20 - - - - - - - - - Energy metabolism— Sugars galK lp_3482 galactokinase −3.01 - - - - - - +2.13 - - lacM lp_3484 beta-galactosidase, small subunit −2.30 - - - - - - +2.43 - - Energy metabolism— Glycolysis/ gluconeogenesis pyk lp_1897 pyruvate kinase - - - - - −2.32 - - - - Energy metabolism— Pentose phosphate pathway rpiA1 lp_0602 ribose 5-phosphate epimerase - - - - - - +2.02 - - - DNA metabolism— DNA replication, recombination dnaN lp_0002 DNA-directed DNA polymerase III, beta chain - - - - - - - - - +2.15 Cellular processes— Cell division ftsH lp_0547 cell division protein FtsH, ATP-dependent zinc metallopeptidase - −2.06 - - - - +2.28 - - - Cell envelope— Biosynthesis and degradation lp_0304 extracellular protein - - - - - - +2.16 - - - Cell envelope—Other lp_2290 integral membrane protein - - - - - - +2.41 - - - Signal transduction— PTS pts16ABC lp_2097 fructose PTS, EIIABC - −2.50 - - - −2.86 - - - - Enzymes of unknown specificity mleS lp_1118 malolactic enzyme - - +2.32 +2.17 −2.56 −2.28 - - - - Fatty acid and phospholipid metabolism— Biosynthesis fabF lp_1675 3-oxoacyl-[acyl-carrier protein] synthase II - - - - - - - - +2.18 Purines, pyrimidines, nucleosides, and nucleotides— Pyrimidine ribonucleotide biosynthesis pyrD, lp_2697 pyrC, lp_2699 dihydroorotate oxidase, dihydroorotase - - - - - - - - +3.74 +3.36 - - - +2.54 +2.02 - - - - - Transport and binding proteins— Amino acids, peptides oppA lp_1261 oligopeptide ABC transporter, substrate binding protein - - - - −2.41 - - - - - Protein fate— Protein folding and stabilization groEL lp_0728 dnaK lp_2027 GroEL chaperonin heat shock protein DnaK - - - - - - - - - - - - −2.25 −2.17 - - - - - - Unknown function typA lp_2146 lp_3092 GTP-binding protein TypA fumarate reductase, flavoprotein subunit precursor, N-terminally truncated - - - - - - - - - - - - +2.45 −2.13 - - - - - - M. Kahala et al. 1002 3.2. Expression Levels of the Genes between Different Growth Media The mRNA level of several genes was shown to be regulated in response to different growth media. At the exponential (6 h) phase of growth, the genes encoding dihydroorotate oxidase and dihydroorotase enzymes were differentially expressed in MRS and carrot juice. They showed 3.7and 3.4-fold higher expression in the MRS compared to carrot juice growth medium, respectively (Table 1). Differential expression (p = 0.015) of these genes encoding proteins involved in pyrimidine ribonucleotide biosynthesis is an indication of distinct gene regulation and, consequently, potentially different rate of pyrimidine biosynthesis in synthetic MRS compared to vegetable-based carrot juice cultivation medium. Expression of malolactic enzyme (mle) gene was clearly higher in logarithmic phase when grown in plant based medium. Upregulation of cell division protein FtsH was observed in contaminated MRS 14 h compared to MRS 14 h, probably indicating higher stress response in contaminated MRS. 4. Discussion This study focused on defining the differences in L. plantarum gene expression levels in different media and in different growth phases by the use of a simple and low-cost macroarray technique. Previously described DNA macroarray technique [22] has been further developed for studying gene expression profile of the industrially important lactic acid bacterium. Fermentation conditions may dramatically affect functional characteristics of LAB [13]. Marked changes in expression levels upon entry in the stationary phase have been found out [25] [26]. Highly expressed genes are turned off or markedly repressed and genes, mostly inactive in the growing cells, begin to be expressed in the stationary phase [25] [26]. In this study, transcription of genes involved in energy metabolic pathways decreased in stationary phase and higher expression levels were found for genes like “folding” chaperones DnaK and GroEL. GroEL basal expression is enhanced by environmental stress, including elevated temperature, oxygen limitation, and nutrient deprivation [27] [28]. DnaK plays a central role in protein folding, refolding, translocation and in the stress conditions. The elevated expression of these genes is probably a response to the diminishing nutrients and high concentration of lactic acid in the medium which is known to cause stress especially in the late-stationary phase [29]. Proteomic studies by [10] has revealed significant changes on fermentation profiles of L. plantarum strains previously grown under food-like conditions compared to cultivation in MRS broth. In our study, expression of a malolactic enzyme (mle) gene in plant-based medium was found to be upregulated in logarithmic phase of growth. Mle enzymes, involved in decarboxylation of L-malic acid to L-lactic acid and CO2 [30], have been purified from several lactic acid bacteria, including Leuconostoc mesenteroides, L. plantarum, and Leuconostoc oenos [31]. In several studies, L. plantarum has been shown to have malolactic activity and therefore is of interest in wine production [32]. The significance of malolactic activity of LAB in sauerkraut fermentation has also been reported. Conversion of malic acid into lactic acid before significant sugar metabolism may play some role in early fermentation [30] [33]. Higher expression of cell division protein FtsH in contaminated MRS compared to MRS probably indicated higher stress response in contaminated MRS. Functional studies have revealed an important role for FtsH in the bacterial stress response. In several bacteria, including E. coli, B. subtilis, Lactococcus lactis, O. oeni, Helicobacter pylori, and L. plantarum, ftsH expression is induced in response to heat and other stress factors controlled by additional regulators [34]. Macroarray was found to be an applicable method for studying expression of defined genes of L. plantarum during fermentation. Macroarray technology has been successfully applied also e.g. for the detection of pathogens in chicken samples [35] and studies on environmental samples for the presence of specific antibiotic resistance genes [36] communities of diazotrophs [37], and expression of 375 genes in L. lactis subsp. lactis IL1403 during stress conditions [38]. L. plantarum is encountered in a variety of environmental niches, which include dairy, meat and many vegetable or plant fermentations as well as the human gastrointestinal tract. Because of this flexibility and versatility, strains of this species have been traditionally used for food and feed preservation and as starters in the manufacture of fermented products. Formerly, the technological properties and suitability of certain strains to selected applications could be ensured almost exclusively by laborious and time-consuming food processing and preservation experiments. Today, the long history of use and on the other hand the development of molecular and ge- M. Kahala et al. 1003 nomic techniques have made L. plantarum one of the most studies food microbes. Modern DNA microarray [6], next-generation sequencing technologies [39] and especially transcriptomic studies are accurate and sensitive and have enabled the detailed examination of L. plantarum genome structure and function. The most advanced technologies, however, require specific instrumentation and have often high running costs, which may rule out their use in many cases. The current study demonstrated that macroarrays printed on nitrocellulose filters with simple robotic systems can be analyzed by standard laboratory equipment and methods usually available in molecular laboratories. Using this technology, rapid and cost-efficient analysis of genome function of L. plantarum can be carried out e.g. in developing regions, where lactic acid fermentation of food an feed matrices is a common practice, but research and analysis laboratories often lack the most expensive specific laboratory instrumentation. Acknowledgements Tekes, the Finnish Funding Agency for Technology and Innovation, is gratefully acknowledged for the financial support of this work. The authors wish to thank Anneli Paloposki for the skilful technical assistance, Ari-Matti Sarén for designing the primers, Markku Ala-Pantti and Hannu Väänänen for printing the membranes. References [1] Rose, A. (1982) History and Scientific Basis of Microbial Activity in Fermented Foods. In: Rose, A., Ed., Fermented Foods, Academic Press, New York, 1-13. [2] Chevallier, B., Hubert, J.C. and Kammerer, B. (1994) Determination of Chromosome Size and Number of rrn Loci in Lactobacillus plantarum by Pulsed-Field Gel Electrophoresis. FEMS Microbiology Letters, 120, 51-56. http://dx.doi.org/doi:10.1111/j.1574-6968.1994.tb07006.x [3] Kleerebezem, M., Boekhorst, J., van Kranenburg, R., Molenaar, D., Kuipers, O.P., Leer, R., Tarchini, R., Peters, S.A., Sandbrink H.M., Fiers, M., Stiekema, W., Lankhorst, R., Bron, P., Hoffer, S., Groot, M., Kerkhoven, R., de Vries, M., Ursing, B., de Vos, W.M. and Siezen, R.J. (2003) Complete Genome Sequence of Lactobacillus plantarum WCFS1. Proceedings of the National Academy of Sciences of the United States of America, 100, 1990-1995. http://dx.doi.org/10.1073/pnas.0337704100 [4] McDonald, L.C., Fleming, H.P. and Hassan, H.M. (1990) Acid Tolerance of Leuconostoc mesenteroides and Lactobacillus plantarum. Applied and Environmental Microbiology, 56, 2120-2124. [5] Mäki, M. (2004) Lactic Acid Bacteria in Vegetable Fermentations. In: Salminen, S., von Wright, A. and Ouwehand, A., Eds., Lactic Acid Bacteria: Microbiological and Functional Aspects, 2nd Edition, Marcel Dekker, Inc., New York, 419-430. http://dx.doi.org/10.1201/9780824752033.ch14 [6] Molenaar, D., Bringel, F., Schuren, F.H., De Vos, W.M., Siezen, R.J. and Kleerebezem, M. (2005) Exploring Lactobacillus plantarum Genome Diversity by Using Microarrays. Journal of Bacteriology, 187, 6119-6127. [7] Koistinen, K.M., Plumed-Ferrer, C., Lehesranta, S.J., Kärenlampi, S.O. and von Wright, A. (2007) Comparison of Growth-Phase-Dependent Cytosolic Proteomes of Two Lactobacillus plantarum Strains Used in Food and Feed Fermentations. FEMS Microbiology Letters, 273, 12-21. http://dx.doi.org/10.1111/j.1574-6968.2007.00775.x [8] Plumed-Ferrer, C., Koistinen, K.M., Tolonen, T.L., Lehesranta, S.J., Kärenlampi, S.O., Mäkimattila, E., Joutsjoki, V., Virtanen, V. and von Wright, A. (2008) Comparative Study of Sugar Fermentation and Protein Expression Patterns of Two Lactobacillus plantarum Strains Grown in Three Different Media. Applied and Environmental Microbiology, 74, 5349-5358. http://dx.doi.org/10.1128/AEM.00324-08 [9] Di Cagno, R., Surico, R.F., Siragusa, S., De Angelis, M., Paradiso, A., Minervini, F., De Gara, L. and Gobbetti, M. (2008) Selection and Use of Autochthonous Mixed Starter for Lactic Acid Fermentation of Carrots, French Beans or Marrows. International Journal of Food Microbiology, 127, 220-228. http://dx.doi.org/10.1016/j.ijfoodmicro.2008.07.010 [10] Siragusa, S., De Angelis, M., Calasso, M., Campanella, D., Minervini, F., Di Cagno, R. and Gobbetti, M. (2013) Fermentation and Proteome Profiles of Lactobacillus plantarum Strains during Growth under Food-Like Conditions. Journal of Proteomics, 96, 366-380. http://dx.doi.org/10.1016/j.jprot.2013.11.003 [11] Stevens, M.J.A., Wiersma, A., de Vos, W.M., Kuipers, O.P., Smid, E.J., Molenaar, D. and Kleerebezem, M. (2008) Improvement of Lactobacillus plantarum Aerobic Growth as Directed by Comprehensive Transcriptome Analysis. Applied and Environmental Microbiology, 74, 4776-4778. http://dx.doi.org/10.1128/AEM.00136-08 [12] Wels, M., Overmars, L., Francke, C., Kleerebezem, M. and Siezen, R.J. (2011) Reconstruction of the Regulatory Network of Lactobacillus plantarum WCFS1 on Basis of Correlated Gene Expression and Conserved Regulatory Motifs. M. Kahala et al. 1004 Microbial Biotechnology, 4, 333-344. http://dx.doi.org/10.1111/j.1751-7915.2010.00217.x [13] Bron, P.A., Wels, M., Bongers, R.S., de Veen, H., Wiersma, A., Overmars, L., Marco, M.L. and Kleerebezem, M. (2012) Transcriptomes Reveal Genetic Signatures Underlying Physiological Variations Imposed by Different Fermentation Conditions in Lactobacillus plantarum. PloS ONE, 7, e38720. http://dx.doi.org/10.1371/journal.pone.0038720 [14] Reverón, I., Rivas, B., Muñoz, R. and de Felipe, F.L. (2012) Genome-Wide Transcriptomic Responses of a Human Isolate of Lactobacillus plantarum Exposed to p-Coumaric Acid Stress. Molecular Nutrition & Food Research, 56, 18481859. http://dx.doi.org/10.1002/mnfr.201200384 [15] Todt, T.J., Wels, M., Bongers, R.S., Siezen, R.S., van Hijum, S.A.F.T. and Kleerebezem, M. (2012) Genome-Wide Prediction and Validation of Sigma70 Promoters in Lactobacillus plantarum WCFS1. PloS ONE, 7, e45097. http://dx.doi.org/10.1371/journal.pone.0045097 [16] de Veen, H., Abee, T., Tempelaars, M., Bron, P.A., Kleerebezem, M. and Marco, M.L. (2011) Shortand Long-Term Adaptation to Ethanol Stress and Its Cross-Protective Consequences in Lactobacillus plantarum. Applied and Environmental Microbiology, 77, 5247-5256. http://dx.doi.org/10.1128/AEM.00515-11 [17] Wegkamp, A., Mars, A.E., Faijes, M., Molenaar, D., de Vos, R.C.H., Klaus, S.M.J., Hanson, A.D., de Vos, W.M. and Smid, E.J. (2010) Physiological Responses to Folate Overproduction in Lactobacillus plantarum WCFS1. Microbial Cell Factories, 9, 100. http://dx.doi.org/10.1186/1475-2859-9-100 [18] Tamminen, M., Mäki, M. and Joutsjoki, T. (2003) Differentiation of Lactobacilli Related to Lactobacillus plantarum from Naturally Fermented Cucumbers and White Cabbage. Applied Biotechnology, Food Science and Policy, 1, 125128. [19] Tamminen, M., Joutsjoki, T., Sjöblom, M., Joutsen, M., Palva, A., Ryhänen, E.L. and Joutsjoki, V. (2004) Screening of Lactic Acid Bacteria from Fermented Vegetables by Carbohydrate Profiling and PCR-ELISA. Letters in Applied Microbiology, 39, 439-444. http://dx.doi.org/10.1111/j.1472-765X.2004.01607.x [20] Hames, B. and Higgins, S. (1985) Nucleic Acid Hybridization: A Practical Approach. IRL Press, Oxford. [21] Raulo, E., Chernousov, M.A., Carey, D.J., Nolo, R. and Rauvala, H. (1994) Isolation of a Neuronal Cell Surface Receptor of Heparin Binding Growth-Associated Molecule (HB-GAM). Identification as N-Syndecan (Syndecan-3). The Journal of Biological Chemistry, 269, 12999-13004. [22] Hultman, J., Pitkäranta, M., Romantschuk, M., Auvinen, P. and Paulin, L. (2008) Probe-Based Negative Selection for Underrepresented Phylotypes in Large Environmental Clone Libraries. Journal of Microbiological Methods, 75, 457463. http://dx.doi.org/10.1016/j.mimet.2008.07.016 [23] Karlin, S. and Mrázek, J. (2000) Predicted Highly Expressed Genes of Diverse Prokaryotic Genomes. Journal of Bacteriology, 182, 5238-5250. http://dx.doi.org/10.1128/JB.182.18.5238-5250.2000 [24] Saeed, A.I., Sharov, V., White, J., Li, J., Liang, W., Bhagabati, N., Braisted, J., Klapa, M., Currier, T., Thiagarajan, M., Sturn, A., Snuffin, M., Rezantsev, A., Popov, D., Ryltsov, A., Kostukovich, E., Borisovsky, I., Liu, Z., Vinsavich, A., Trush, V. and Quackenbush, J. (2003) TM4: A Free, Open-Source System for Microarray Data Management and Analysis. BioTechniques, 34, 374-378. http://dx.doi.rg/12613259 [25] Ishihama, A. (1997) Adaptation of Gene Expression in Stationary Phase Bacteria. Current Opinion in Genetics and Development, 7, 582-588. http://dx.doi.org/10.1016/S0959-437X(97)80003-2 [26] Ishihama, A. (1999) Modulation of the Nucleoid, the Transcription Apparatus, and the Translation Machinery in Bacteria for Stationary Phase Survival. Genes to Cells, 4, 135-143. http://dx.doi.org/10.1046/j.1365-2443.1999.00247.x [27] Bergonzelli, G.E., Granato, D., Pridmore, R.D., Marvin-Guy, L.F., Donnicola, D. and Corthésy-Theulaz, I.E. (2006) GroEL of Lactobacillus johnsonii La1 (NCC 533) Is Cell Surface Associated: Potential Role in Interactions with the Host and the Gastric Pathogen Helicobacter pylori. Infection and Immunity, 74, 425-434. http://dx.doi.org/10.1128/IAI.74.1.425-434.2006 [28] Lamberti, C., Mangiapane, E., Pessione, A., Mazzoli, R., Giunta, C. and Pessione, E. (2011) Proteomic Characterization of a Selenium-Metabolizing Probiotic Lactobacillus reuteri Lb2 BM for Nutraceutical Applications. Proteomics, 11, 2212-2221. http://dx.doi.org/10.1002/pmic.201000747 [29] Cohen, D.P.A., Renes, J., Bouwman, F.G., Zoetendal, E.G., Mariman, E., de Vos, W.M. and Vaughan, E.E. (2006) Proteomic Analysis of Log to Stationary Growth Phase Lactobacillus plantarum Cells and a 2-DE Database. Proteomics, 6, 6485-6493. http://dx.doi.org/10.1002/pmic.200600361 [30] Johanningsmeier, S.D., Fleming, H.P. and Breidt Jr., F. (2004) Malolactic Activity of Lactic Acid Bacteria during Sauerkraut Fermentation. Journal of Food Science, 69, M222-M227. http://dx.doi.org/10.1111/j.1365-2621.2004.tb09891.x [31] Labarre, C., Guzzo, J., Cavin, J.F., Diviès, C., Labarre, C. and Guzzo, J. (1996) Cloning and Characterization of the Genes Encoding the Malolactic Enzyme and the Malate Permease of Leuconostoc oenos. Applied and Environmental Microbiology, 62, 1274-1282. M. Kahala et al. 1011 Continued lp_2256 2039314 2040324 337 - ccpA catabolite control protein A 625 AGGCTAAGATT CCGTTTGAC 1008 AATCAGCAGACTT GGTTGAG 383 lp_2301 2078957 2080099 381 - recA recombinase A 678 GCAGAACAGAT CAAGGAAGG 1077 TACTTTGACCTTT ACTGCCA 399 lp_2323 2100621 2101115 165 - tpx thiol peroxidase 150 ATGCCAGATAT TGATACGCG 463 GCAACGTAATTTG GCTCGTG 313 lp_2345 2120498 2121610 371 - ddl D-alanine-D-alanine ligase 616 CCGATGCGTTC AAATATGAC 1021 GCCGTATAACTAA TGCCCGA 405 lp_2349 2123935 2124852 306 - hicD3 L-2-hydroxyisocaproate dehydrogenase 467 AAAGTATGTCG GACAAGCAG 863 TAACGACGCTCGT TCATCAG 396 lp_2359 2130199 2131200 334 - mreB2 cell shape determining protein MreB 467 GACTAGTGATA TCGCTGTCC 853 CCACCAGTCAACG TAATTCC 386 lp_2366 2137118 2138632 505 - atpA H(+)-transporting two-sector ATPase, alpha subunit 950 AATTATCGAAA CGCAAGCTG 1364 ACGGGCAATATCA TCAACTG 414 lp_2544 2269594 2270949 452 + npr2 NADH peroxidase 848 GACCTTAGTCC CATTTGCCC 1264 GCTAAGTCAGCAA CAGTCAG 416 lp_2596 2313948 2314751 268 - pflA1 formate acetyltransferase activating enzyme 374 TGAGACAACTG GTTACGCAC 793 TTCACCCGTACTT TAACACC 419 lp_2598 2315865 2318309 815 + pflB1 formate C-acetyltransferase 1991 AACCTCTTCTAT TTCGGCCA 2404 GTTTCTTTGGATA GGCCCAC 413 lp_2681 2380421 2381905 495 + gpd glucose-6-phosphate 1-dehydrogenase 937 CTTTCGTCGCTG GTAAAGTC 1355 AACGAATTTCCAC GAATCGG 418 lp_2690 2398345 2398983 213 - pyrE orotate phosphoribosyltransferase 97 GTATTCGCCAA CCAGAACAG 490 GTACCGGCATCAT TGATCAG 393 lp_2697 2398345 2398983 213 - pyrE orotate phosphoribosyltransferase 97 GTATTCGCCAA CCAGAACAG 490 GTACCGGCATCAT TGATCAG 393 lp_2699 2399695 2400612 306 - pyrD dihydroorotate oxidase 124 TGACGATTTCTT ATCCGGCG 527 GTTGGACAAACTG AACAGCG 403 lp_2702 2404915 2406207 431 - pyrC dihydroorotase 422 ATTTGGAACTG ATCCAGCGA 838 ATGTCTGTACAAG CAGTCGG 416 lp_2703 2406211 2407146 312 - pyrB aspartate carbamoyltransferase 869 GTTAGTTGCGG GATTGTTGG 1284 GCGTTTCCTTTCC ATATGCC 415 lp_2704 2407293 2407835 181 - pyrR1 pyrimidine operon regulator 554 CAAAGAATGGT ATGGCCGTG 932 AACCTCCACTTGA GTTGCTG 378 lp_2728 2428365 2429495 377 - purK1 phosphoribosylaminoimidazole carboxylase, ATPase subunit 11 AGTCGTTGATG CAATGACCA 411 GTCCACGATCGAC TAAGACC 400 lp_2766 2457282 2458373 364 + hypothetical protein 680 AGCTAATGTTC AGCCCAGTG 1073 TAATACGGTGACA TGACCCA 393 lp_2807 2504803 2506059 419 - tyrS tyrosine-tRNA ligase 540 TCAAATGATGC GACTTATGG 950 GTATTGCCCAAAC TCATCGT 410 lp_2873 2558269 2559309 347 - adh2 alcohol dehydrogenase 760 TCAACCAGGAT GATCGAGAC 1144 CCATTGATTCGAA TCGCACC 384 lp_3051 2712741 2713913 391 + dhaT 1,3-propanediol dehydrogenase 440 AGCCTTAGCTG ACGTAATGG 856 CGTAAGCCAATGT TCTTCCA 416 lp_3092 2751334 2752746 471 + gabD succinate-semialdehyde dehydrogenase (NAD(P)+) 682 AAACATCATTA CGCGAAGCC 1092 CGTCTTTAAGCGC ATTAGTC 410 lp_3125 2791021 2792502 494 + fumarate reductase, flavoprotein subunit precursor, N-terminally truncated 864 AAATTAGTCCC TGGCGATCC 1270 AGTTCTGGTAAGG AGCTGAG 406 lp_3265 2904444 2905385 314 + cell surface hydrolase, membrane-bound (putative) 960 GGGAACTTCAT GGGCTTAGG 1371 ACGTATCACCAGT TAGTCCA 411 lp_3270 2910392 2911681 430 + purA adenylosuccinate synthase 474 CGTCACACGGA TATCATCCT 896 TTGATACTCGGCA GGATCGA 422 lp_3314 2951354 2952175 274 + pflA2 formate acetyltransferase activating enzyme 850 AAGTCGGTGAT TTCATTCGT 1266 TAACGTTAGTTTG TTGGCGA 416 lp_3352 2981556 2981999 148 - hsp3 small heat shock protein 398 GTTCGAACGTC TAATGAAGG 794 CTTGTACCCGTTG TAATCAG 396 lp_3403 3017894 3018754 287 - oxidoreductase 64 TGGACGATTTG GTTAATGGA 431 AATATGATGGGTA TCCGCAG 367 lp_3480 3089259 3090263 335 - UTP-galactose-1-P uridylyltransferase 321 GTTGACCTCTAC TTGATCCA 711 AGAAACCGTGTTG TAATGAC 390 lp_3484 3093639 3094598 320 + lacM beta-galactosidase, small subunit 486 GGTCTGCGGTTT ATCATACC 882 AACTATCAATGCC ACCGACC 396 M. Kahala et al. 1012 Continued lp_3534 3151784 3154084 767 + agl5 alpha-glucosidase 1834 GTGACGACATAC TAGTTGCC 2242 AATTCAACTGTGA TCTGCTG 408 lp_3544 3163853 3164476 208 - gph3 phosphoglycolate phosphatase (putative) 143 CGGTGAGATGAT CCTGAGAG 517 CCTGCATTCTTTG AAGCCTG 374 lp_3545 3164582 3165640 353 - gutB L-iditol 2-dehydrogenase 575 TGTTTCTGGGAT CACTAAGG 969 AGTGTTCAAGATC AAAGACC 394 lp_3549 3168152 3168919 256 + transcription regulator 285 TTCCTAGATTAT GGCACCAC 685 GCGTCCACGTTAC TAATGTC 400 lp_3555 3174155 3174883 243 - araD L-ribulose 5-phosphate 4-epimerase 305 CTATGCAGCTGC TCAAATGG 716 TGCATGATCCTTA GAATGCG 411 lp_3583 3199392 3201506 705 - clpL ATP-dependent Clp protease, ATP-binding subunit ClpL 1698 ATCGCTACTTCT AATGCTGG 2110 GCTGCCGATATCA CAATCTC 412 lp_3586 3202767 3203867 367 - lox lactate oxidase 628 TCATGGAAATCT ATGCTGCT 1029 GCTCATCATTAAG GTGACTC 401 lp_3589 3206328 3208139 604 - pox5 pyruvate oxidase 1319 GGTGTTTAATCT GGCTGGTG 1734 AATCTTGAGCTTC ATACCGT 415 lp_3592 3209669 3210514 282 - rhaD rhamnulose-1-phosphate aldolase 376 CTCGGTTGAAGC AAGATCCT 783 AACGCTTGATTAA GTCACGG 407 lp_3603 3219914 3220636 241 + sugar-phosphate aldolase 258 CAACAAATTGAC GGTGTAGG 685 TGGTACTGCTTAA TTAGCCC 427 Supplement 2. Transfer of the amplified PCR products to 348 well plates for 384-pin gridding onto nitrocellulose membranes. ORF Gene Product Plate_96 96 Well Target Plate 384 Well 384 Well lp_0175 malE maltose/maltodextrin ABC transporter, substrate binding protein M2_1_96 A01 Plate_1 A01 A16 lp_0230 pts2CB mannitol PTS, EIICB M2_1_96 B01 Plate_1 C01 C16 lp_0233 mtlD mannitol -1-phosphate 5-dehydrogenase M2_1_96 C01 Plate_1 E01 E16 lp_0257 pepM methionyl aminopeptidase M2_1_96 D01 Plate_1 G01 G16 lp_0302 extracellular protein M2_1_96 E01 Plate_1 I01 I16 lp_0304 extracellular protein M2_1_96 F01 Plate_1 K01 K16 lp_0330 fba fructose -bisphosphate aldolase M2_1_96 G01 Plate_1 M01 M16 lp_0447 mvaA hydroxymethylglutaryl -CoA reductase M2_1_96 H01 Plate_1 O01 O16 lp_0480 rpoE DNA -directed RNA polymerase, delta subunit M2_1_96 A02 Plate_1 A02 A17 lp_0537 ldhL1 L -lactate dehydrogenase M2_1_96 B02 Plate_1 C02 C17 lp_0539 mfd transcription -repair coupling factor M2_1_96 C02 Plate_1 E02 E17 lp_0547 ftsH cell division protein FtsH, ATP-dependent zinc metallopeptidase M2_1_96 D02 Plate_1 G02 G17 lp_0576 pts9C mannose PTS, EIIC M2_1_96 E02 Plate_1 I02 I17 lp_0577 pts9D mannose PTS, EIID M2_1_96 F02 Plate_1 K02 K17 lp_0601 pepC1 cysteine aminopeptidase M2_1_96 G02 Plate_1 M02 M17 lp_0609 gltX glutamate -tRNA ligase M2_1_96 H02 Plate_1 O02 O17 lp_0619 rplK ribosomal protein L11 M2_1_96 A03 Plate_1 A03 A18 lp_0620 rplA ribosomal protein L1 M2_1_96 B03 Plate_1 C03 C18 lp_0621 rplJ ribosomal protein L10 M2_1_96 C03 Plate_1 E03 E18 lp_0690 integral membrane protein (putative) M2_1_96 D03 Plate_1 G03 G18 lp_0692 nrdF ribonucleoside -diphosphate reductase, beta chain M2_1_96 E03 Plate_1 I03 I18 lp_0715 phnD phosphonates ABC transporter, substrate binding protein (putative) M2_1_96 F03 Plate_1 K03 K18 lp_0728 groEL GroEL chaperonin M2_1_96 G03 Plate_1 M03 M18 lp_0757 galU UTP -glucose-1-phosphate uridylyltransferase M2_1_96 H03 Plate_1 O03 O18 lp_0786 clpP endopeptidase Clp, proteolytic subunit M2_1_96 A04 Plate_1 A04 A19 M. Kahala et al. 1013 Continued lp_0789 gapB glyceraldehyde 3 -phosphate dehydrogenase M2_1_96 B04 Plate_1 C04 C19 lp_0790 pgk phosphoglycerate kinase M2_1_96 C04 Plate_1 E04 E19 lp_0791 tpiA triosephosphate isomerase M2_1_96 D04 Plate_1 G04 G19 lp_0792 enoA1 phosphopyruvate hydratase M2_1_96 E04 Plate_1 I04 I19 lp_0800 cell surface protein precursor M2_1_96 F04 Plate_1 K04 K19 lp_0923 cell surface protein precursor M2_1_96 G04 Plate_1 M04 M19 lp_0938 hsdR type I site -specific deoxyribonuclease, HsdR subunit M2_1_96 H04 Plate_1 O04 O19 lp_0959 pepD3 dipeptidase M2_1_96 A05 Plate_1 A05 A20 lp_1012 serS2 serine -tRNA ligase M2_1_96 B05 Plate_1 C05 C20 lp_1021 rpoB DNA -directed RNA polymerase, beta subunit M2_1_96 C05 Plate_1 E05 E20 lp_1022 rpoC DNA -directed RNA polymerase, beta’ subunit M2_1_96 D05 Plate_1 G05 G20 lp_1025 rpsL ribosomal protein S12 M2_1_96 E05 Plate_1 I05 I20 lp_1026 rpsG ribosomal protein S7 M2_1_96 F05 Plate_1 K05 K20 lp_1027 fusA2 elongation factor G M2_1_96 G05 Plate_1 M05 M20 lp_1033 rplC ribosomal protein L3 M2_1_96 H05 Plate_1 O05 O20 lp_1034 rplD ribosomal protein L4 M2_1_96 A06 Plate_1 A06 A21 lp_1036 rplB ribosomal protein L2 M2_1_96 B06 Plate_1 C06 C21 lp_1040 rpsC ribosomal protein S3 M2_1_96 C06 Plate_1 E06 E21 lp_1041 rplP ribosomal protein L16 M2_1_96 D06 Plate_1 G06 G21 lp_1047 rplE ribosomal protein L5 M2_1_96 E06 Plate_1 I06 I21 lp_1051 rplF ribosomal protein L6 M2_1_96 F06 Plate_1 K06 K21 lp_1053 rpsE ribosomal protein S5 M2_1_96 G06 Plate_1 M06 M21 lp_1055 rplO ribosomal protein L15 M2_1_96 H06 Plate_1 O06 O21 lp_1058 adk adenylate kinase M2_1_96 A07 Plate_1 A07 A22 lp_1062 rpoA DNA -directed RNA polymerase, alpha subunit M2_1_96 B07 Plate_1 C07 C22 lp_1070 lipoprotein precursor M2_1_96 C07 Plate_1 E07 E22 lp_1077 rplM ribosomal protein L13 M2_1_96 D07 Plate_1 G07 G22 lp_1118 mleS malolactic enzyme M2_1_96 E07 Plate_1 I07 I22 lp_1261 oppA oligopeptide ABC transporter, substrate binding protein M2_1_96 F07 Plate_1 K07 K22 lp_1274 ptsI phosphoenolpyruvate -protein phosphatase M2_1_96 G07 Plate_1 M07 M22 lp_1316 leuS leucine -tRNA ligase M2_1_96 H07 Plate_1 O07 O22 lp_1329 dgk2 deoxyguanosine kinase M2_1_96 A08 Plate_1 A08 A23 lp_1468 ABC transporter, ATP -binding protein M2_1_96 B08 Plate_1 C08 C23 lp_1508 polA DNA -directed DNA polymerase I M2_1_96 C08 Plate_1 E08 E23 lp_1514 thrS threonine -tRNA ligase 1 M2_1_96 D08 Plate_1 G08 G23 lp_1615 priA primosomal protein N ' M2_1_96 E08 Plate_1 I08 I23 lp_1632 smc cell division protein Smc M2_1_96 F08 Plate_1 K08 K23 lp_1643 cell surface protein precursor M2_1_96 G08 Plate_1 M08 M23 lp_1767 lysin M2_1_96 H08 Plate_1 O08 O23 lp_1882 rpsA ribosomal protein S1 M2_1_96 A09 Plate_1 A09 A24 lp_1897 pyk pyruvate kinase M2_1_96 B09 Plate_1 C09 C24 lp_1899 dnaE DNA -directed DNA polymerase III, alpha chain M2_1_96 C09 Plate_1 E09 E24 lp_1941 nox4 NADH oxidase M2_1_96 D09 Plate_1 G09 G24 M. Kahala et al. 1014 Continued lp_2027 dnaK heat shock protein DnaK M2_1_96 E09 Plate_1 I09 I24 lp_2054 tsf elongation factor TS M2_1_96 F09 Plate_1 K09 K24 lp_2055 rpsB ribosomal protein S2 M2_1_96 G09 Plate_1 M09 M24 lp_2057 ldhD D-lactate dehydrogenase M2_1_96 H09 Plate_1 O09 O24 lp_0002 dnaN DNA-directed DNA polymerase III, beta chain M2_2_96 A01 Plate_1 B01 B16 lp_0006 gyrB DNA gyrase, B subunit M2_2_96 B01 Plate_1 D01 D16 lp_0061 acetoacetate decarboxylase (putative) M2_2_96 C01 Plate_1 F01 F16 lp_0129 hsp1 small heat shock protein M2_2_96 D01 Plate_1 H01 H16 lp_0184 sacK1 fructokinase M2_2_96 E01 Plate_1 J01 J16 lp_0210 ack1 acetate kinase M2_2_96 F01 Plate_1 L01 L16 lp_0233 mtlD mannitol-1-phosphate 5-dehydrogenase M2_2_96 G01 Plate_1 N01 N16 lp_0244 oxidoreductase (putative) M2_2_96 H01 Plate_1 P01 P16 lp_0301 membrane-bound protease, CAAX family M2_2_96 A02 Plate_1 B02 B17 lp_0313 ndh1 NADH dehydrogenase M2_2_96 B02 Plate_1 D02 D17 lp_0329 acdH acetaldehyde dehydrogenase M2_2_96 C02 Plate_1 F02 F17 lp_0466 purR purine biosynthesis operon repressor M2_2_96 D02 Plate_1 H02 H17 lp_0481 pyrG CTP synthase M2_2_96 E02 Plate_1 J02 J17 lp_0566 nadE NAD synthase M2_2_96 F02 Plate_1 L02 L17 lp_0575 pts9AB mannose PTS, EIIAB M2_2_96 G02 Plate_1 N02 N17 lp_0585 transcription regulator M2_2_96 H02 Plate_1 P02 P17 lp_0597 pgm2 phosphoglycerate mutase M2_2_96 A03 Plate_1 B03 B18 lp_0602 rpiA1 ribose 5-phosphate epimerase M2_2_96 B03 Plate_1 D03 D18 lp_0725 hypothetical protein M2_2_96 C03 Plate_1 F03 F18 lp_0737 ribosomal protein S30EA M2_2_96 D03 Plate_1 H03 H18 lp_0754 hprK bifunctional protein: HPr kinase, P-serHPr phosphatase M2_2_96 E03 Plate_1 J03 J18 lp_0807 pta phosphate acetyltransferase M2_2_96 F03 Plate_1 L03 L18 lp_0852 pox2 pyruvate oxidase M2_2_96 G03 Plate_1 N03 N18 lp_0853 pepR1 prolyl aminopeptidase M2_2_96 H03 Plate_1 P03 P18 lp_1005 als acetolactate synthase M2_2_96 A04 Plate_1 B04 B19 lp_1090 ttdA L(+)-tartrate dehydratase, subunit A M2_2_96 B04 Plate_1 D04 D19 lp_1101 ldhL2 L-lactate dehydrogenase M2_2_96 C04 Plate_1 F04 F19 lp_1108 citE citrate lyase, beta chain M2_2_96 D04 Plate_1 H04 H19 lp_1148 gatA glutamyl-tRNA amidotransferase, subunit A M2_2_96 E04 Plate_1 J04 J19 lp_1149 gatB glutamyl-tRNA amidotransferase, subunit B M2_2_96 F04 Plate_1 L04 L19 lp_1200 galE2 UDP-glucose 4-epimerase M2_2_96 G04 Plate_1 N04 N19 lp_1250 gntK gluconokinase M2_2_96 H04 Plate_1 P04 P19 lp_1273 hpr phosphocarrier protein Hpr M2_2_96 A05 Plate_1 B05 B20 lp_1301 metK methionine adenosyltransferase M2_2_96 B05 Plate_1 D05 D20 lp_1500 narI nitrate reductase, gamma chain M2_2_96 C05 Plate_1 F05 F20 lp_1521 oxidoreductase M2_2_96 D05 Plate_1 H05 H20 lp_1541 gnd2 phosphogluconate dehydrogenase (decarboxylating) M2_2_96 E05 Plate_1 J05 J20 lp_1563 greA2 transcription elongation factor GreA M2_2_96 F05 Plate_1 L05 L20 lp_1665 adh1 alcohol dehydrogenase M2_2_96 G05 Plate_1 N05 N20 M. Kahala et al. 1015 Continued lp_1675 fabF 3 -oxoacyl-[acyl-carrier protein] synthase II M2_2_96 H05 Plate_1 P05 P20 lp_1779 fhs formate -tetrahydrofolate ligase M2_2_96 A06 Plate_1 B06 B21 lp_1783 pyrAA2 carbamoyl-phosphate synthase (glutamine-hydrolysing), small chain M2_2_96 B06 Plate_1 D06 D21 lp_1817 ribitol -5-phosphate 2-dehydrogenase (putative) M2_2_96 C06 Plate_1 F06 F21 lp_1898 pfk 6 -phosphofructokinase M2_2_96 D06 Plate_1 H06 H21 lp_1981 hisS histidine -tRNA ligase M2_2_96 E06 Plate_1 J06 J21 lp_2030 aldB alpha -acetolactate decarboxylase M2_2_96 F06 Plate_1 L06 L21 lp_2052 frr ribosome recycling factor M2_2_96 G06 Plate_1 N06 N21 lp_2086 apt adenine phosphoribosyltransferase M2_2_96 H06 Plate_1 P06 P21 lp_2094 GTP -binding protein M2_2_96 A07 Plate_1 B07 B22 lp_2096 fruK 1 -phosphofructokinase M2_2_96 B07 Plate_1 D07 D22 lp_2123 dapA1 dihydrodipicolinate synthase M2_2_96 C07 Plate_1 F07 F22 lp_2153 pdhB pyruvate dehydrogenase complex, E1 component, beta subunit M2_2_96 D07 Plate_1 H07 H22 lp_2154 pdhA pyruvate dehydrogenase complex, E1 component, alpha subunit M2_2_96 E07 Plate_1 J07 J22 lp_2189 divIVA cell division initiation protein DivIVA M2_2_96 F07 Plate_1 L07 L22 lp_2231c ppiB peptidylprolyl isomerase M2_2_96 G07 Plate_1 N07 N22 lp_2256 ccpA catabolite control protein A M2_2_96 H07 Plate_1 P07 P22 lp_2301 recA recombinase A M2_2_96 A08 Plate_1 B08 B23 lp_2323 tpx thiol peroxidase M2_2_96 B08 Plate_1 D08 D23 lp_2345 ddl D -alanine-D-alanine ligase M2_2_96 C08 Plate_1 F08 F23 lp_2349 hicD3 L -2-hydroxyisocaproate dehydrogenase M2_2_96 D08 Plate_1 H08 H23 lp_2359 mreB2 cell shape determining protein MreB M2_2_96 E08 Plate_1 J08 J23 lp_2366 atpA H(+) -transporting two-sector ATPase, alpha subunit M2_2_96 F08 Plate_1 L08 L23 lp_2544 npr2 NADH peroxidase M2_2_96 G08 Plate_1 N08 N23 lp_2596 pflA1 formate acetyltransferase activating enzyme M2_2_96 H08 Plate_1 P08 P23 lp_2598 pflB1 formate C -acetyltransferase M2_2_96 A09 Plate_1 B09 B24 lp_2681 gpd glucose -6-phosphate 1-dehydrogenase M2_2_96 B09 Plate_1 D09 D24 lp_2690 pyrE orotate phosphoribosyltransferase M2_2_96 C09 Plate_1 F09 F24 lp_2697 pyrD dihydroorotate oxidase M2_2_96 D09 Plate_1 H09 H24 lp_2699 pyrC dihydroorotase M2_2_96 E09 Plate_1 J09 J24 lp_2702 pyrB aspartate carbamoyltransferase M2_2_96 F09 Plate_1 L09 L24 lp_2703 pyrR1 pyrimidine operon regulator M2_2_96 G09 Plate_1 N09 N24 lp_2704 purK1 phosphoribosylaminoimidazole carboxylase, ATPase subunit M2_2_96 H09 Plate_1 P09 P24 lp_2097 pts16ABC fructose PTS, EIIABC M2_1_96 A10 Plate_2 A01 A22 lp_2118 tig trigger factor M2_1_96 B10 Plate_2 C01 C22 lp_2119 tuf elongation factor Tu M2_1_96 C10 Plate_2 E01 E22 lp_2146 typA GTP -binding protein TypA M2_1_96 D10 Plate_2 G01 G22 lp_2193 ftsZ cell division protein FtsZ M2_1_96 E10 Plate_2 I01 I22 lp_2290 integral membrane protein M2_1_96 F10 Plate_2 K01 K22 lp_2324 gshA glutamate -cysteine ligase (putative) M2_1_96 G10 Plate_2 M01 M22 lp_2331 rpsD ribosomal protein S4 M2_1_96 H10 Plate_2 O01 O22 lp_2486 cell surface protein precursor, GY family M2_1_96 A11 Plate_2 A02 A23 M. Kahala et al. 1016 Continued lp_2502 pgi glucose -6-phosphate isomerase M2_1_96 B11 Plate_2 C02 C23 lp_2659 xpk1 phosphoketolase M2_1_96 C11 Plate_2 E02 E23 lp_2694 rexB ATP -dependent nuclease, subunit B M2_1_96 D11 Plate_2 G02 G23 lp_3001 cell surface protein precursor (putative) M2_1_96 E11 Plate_2 I02 I23 lp_3075 cell surface protein (putative) M2_1_96 F11 Plate_2 K02 K23 lp_3114 cell surface protein precursor M2_1_96 G11 Plate_2 M02 M23 lp_3170 pmg9 phosphoglycerate mutase M2_1_96 H11 Plate_2 O02 O23 lp_3174 cfa2 cyclopropane -fatty-acyl-phospholipid synthase M2_1_96 A12 Plate_2 A03 A24 lp_3204 nupC nucleoside transport protein M2_1_96 B12 Plate_2 C03 C24 lp_3313 pflB2 formate C-acetyltransferase M2_1_96 C12 Plate_2 E03 E24 lp_3421 extracellular protein, gamma-D-glutamatemeso-diaminopimelate muropeptidase (putative) M2_1_96 D12 Plate_2 G03 G24 lp_3485 melA alpha -galactosidase M2_1_96 E12 Plate_2 I03 I24 lp_3551 xpk2 phosphoketolase M2_1_96 F12 Plate_2 K03 K24 lp_3662 adhE bifunctional protein: alcohol dehydrogenase, acetaldehyde dehydrogenase M2_1_96 G12 Plate_2 M03 M24 lp_3665 pdc p -coumaric acid decarboxylase M2_1_96 H12 Plate_2 O03 O24 lp_2728 hypothetical protein M2_2_96 A10 Plate_2 B01 B22 lp_2766 tyrS tyrosine -tRNA ligase M2_2_96 B10 Plate_2 D01 D22 lp_2807 adh2 alcohol dehydrogenase M2_2_96 C10 Plate_2 F01 F22 lp_2873 dhaT 1,3 -propanediol dehydrogenase M2_2_96 D10 Plate_2 H01 H22 lp_3051 gabD succinate -semialdehyde dehydrogenase (NAD(P)+) M2_2_96 E10 Plate_2 J01 J22 lp_3092 fumarate reductase, flavoprotein subunit precursor, N-terminally truncated M2_2_96 F10 Plate_2 L01 L22 lp_3125 cell surface hydrolase, membrane -bound (putative) M2_2_96 G10 Plate_2 N01 N22 lp_3265 purA adenylosuccinate synthase M2_2_96 H10 Plate_2 P01 P22 lp_3270 pflA2 formate acetyltransferase activating enzyme M2_2_96 A11 Plate_2 B02 B23 lp_3314 hsp3 small heat shock protein M2_2_96 B11 Plate_2 D02 D23 lp_3352 oxidoreductase M2_2_96 C11 Plate_2 F02 F23 lp_3403 galE4 UDP -glucose 4-epimerase M2_2_96 D11 Plate_2 H02 H23 lp_3482 galK galactokinase M2_2_96 E11 Plate_2 J02 J23 lp_3484 lacM beta -galactosidase, small subunit M2_2_96 F11 Plate_2 L02 L23 lp_3534 agl5 alpha -glucosidase M2_2_96 G11 Plate_2 N02 N23 lp_3544 gph3 phosphoglycolate phosphatase (putative) M2_2_96 H11 Plate_2 P02 P23 lp_3545 gutB L -iditol 2-dehydrogenase M2_2_96 A12 Plate_2 B03 B24 lp_3549 transcription regulator M2_2_96 B12 Plate_2 D03 D24 lp_3555 araD L -ribulose 5-phosphate 4-epimerase M2_2_96 C12 Plate_2 F03 F24 lp_3583 clpL ATP-dependent Clp protease, ATP-binding subunit ClpL M2_2_96 D12 Plate_2 H03 H24 lp_3586 lox lactate oxidase M2_2_96 E12 Plate_2 J03 J24 lp_3589 pox5 pyruvate oxidase M2_2_96 F12 Plate_2 L03 L24 lp_3592 rhaD rhamnulose -1-phosphate aldolase M2_2_96 G12 Plate_2 N03 N24 lp_3603 sugar -phosphate aldolase M2_2_96 H12 Plate_2 P03 P24