Beneficial Effects of Limosilactobacillus fermentum in the DCA Experimental Model of Irritable Bowel Syndrome in Rats

Citation: Rodríguez-Sojo, M.J.; Garcia-Garcia, J.; Ruiz-Malagón, A.J.; Diez-Echave, P.; Hidalgo-García, L.; Molina-Tijeras, J.A.; González-Lozano, E.; López-Escanez, L.; Rodríguez-Cabezas, M.E.; Rodríguez-Sánchez, M.J.; et al. Beneficial Effects of Limosilactobacillus fermentum in the DCA Experimental Model of Irritable Bowel Syndrome in Rats. Nutrients 2023,15, 24. https://doi.org/10.3390/ nu15010024 Received: 8 November 2022 Revised: 15 December 2022 Accepted: 16 December 2022 Published: 21 December 2022 Copyright: © 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https:// creativecommons.org/licenses/by/ 4.0/). nutrients Article Beneficial Effects of Limosilactobacillus fermentum in the DCA Experimental Model of Irritable Bowel Syndrome in Rats María Jesús Rodríguez-Sojo 1,2,†, Jorge Garcia-Garcia 1,† , Antonio Jesús Ruiz-Malagón1,2, Patricia Diez-Echave 1,2 , Laura Hidalgo-García1,2, JoséAlberto Molina-Tijeras 1,2 , Elena González-Lozano 1,2, Laura López-Escanez 1,2, María Elena Rodríguez-Cabezas 1,2 , Maria JoséRodríguez-Sánchez 2,3,* , Alba Rodríguez-Nogales 1,2,* , Cristina Mediavilla 4,‡ and Julio Galvez 1,2,5,‡ 1Departamento de Farmacología, Centro de Investigación Biomédica (CIBM), Universidad de Granada, 18071 Granada, Spain 2Instituto de Investigación Biosanitaria de Granada (ibs.GRANADA), 18071 Granada, Spain 3Servicio de Digestivo, Hospital Universitario Virgen de las Nieves, 18071 Granada, Spain 4Department of Psychobiology, Mind, Brain, and Behavior Research Center (CIMCYC), University of Granada, 18071 Granada, Spain 5Centro de Investigación Biomédica en Red de Enfermedades Hepáticas y Digestivas (CIBEREHD), 08036 Barcelona, Spain *Correspondence: [email protected] (M.J.R.S.); [email protected] (A.R.N.) † These authors have contributed equally to this work and share first authorship. ‡ These authors have contributed equally to this work and share last authorship. Abstract: Limosilactobacillus fermentum CECT5716, a probiotic strain isolated from human milk, has reported beneficial effects on different gastrointestinal disorders. Moreover, it has shown its ability to restore altered immune responses, in association with microbiome modulation in different pathological conditions. Therefore, our aim was to assess the effects of a Limosilacbacillus fermentum CECT5716 in a rat experimental model of irritable bowel syndrome (IBS) that resembles human IBS. The experimental IBS was induced by deoxycholic acid (DCA) in rats and then, Limosilactobacillus fermentum CECT5716 (10 9 CFU/day/rat) was administered. Behavioral studies, hyperalgesia and intestinal hypersensitivity determinations were performed and the impact of the probiotic on the inflammatory and intestinal barrier integrity was evaluated. Additionally, the gut microbiota composition was analyzed. Limosilactobacillus fermentum CECT5716 attenuated the anxiety-like behavior as well as the visceral hypersensitivity and referred pain. Moreover, this probiotic ameliorated the gut inflammatory status, re-establishing the altered intestinal permeability, reducing the mast cell degranulation and re-establishing the gut dysbiosis in experimental IBS. Therefore, our results suggest a potential use of Limosilactobacillus fermentum CECT5716 in clinical practice for the management of IBS patients. Keywords: IBS rat model; probiotic; Limosilactobacillus fermentum CECT5716; Intestine anti-inflammatory activity; visceral analgesia 1. Introduction Irritable bowel syndrome (IBS) is a highly prevalent disorder, in which a dysfunction in the gut–brain axis seems to have a prominent role. This gut disorder is characterized by abdominal discomfort, together with pain and altered bowel habits, associated stomach bloating and flatulence [ 1 ]. It is estimated that 1 in 10 people worldwide suffers from IBS [ 2 ], but its prevalence differs across reporting regions considering the disparity of the various potential risk factors, including diet, gastrointestinal infections, genetics, and gut microbiome composition [ 3 ]. The aetiology of IBS remains not completely unveiled; however, recent experimental and clinical studies have shown that both physiological and psychological variables are responsible for triggering the IBS symptoms [ 4 ]. The pathophysiological mechanisms comprise alterations in the intestinal epithelial barrier Nutrients 2023,15, 24. https://doi.org/10.3390/nu15010024 https://www.mdpi.com/journal/nutrients Nutrients 2023,15, 24 2 of 19 function, in the composition of the gut microbiota (termed as dysbiosis) and in the immune response, characterized by an increased number of intraepithelial lymphocytes, as well as enteroendocrine and mast cells, in the gut mucosa [ 5 ]. In addition, psychological factors, such as anxiety, stress, or depression, have also been shown to bias symptom perception [ 6 ], although, at present, it is unknown if they are the cause or the consequence of the development of IBS [ 7 ]. Furthermore, one of the main manifestations observed in IBS is intestinal hypersensitivity in association with impairment of the intestinal function, which often coexists with other frequent symptoms, including loss of appetite, sleep disturbances, stress, and depressive states [8,9]. Therefore, the complexity of the pathophysiological mechanisms involved in IBS together with a multifactorial etiopathogenesis makes its therapeutic management a challenge [ 10 ], which involves, in most cases, the combination of lifestyle and dietary interventions with behavioral and pharmacological strategies. In this regard, many different types of drugs have been proposed to exert beneficial effects in this condition, including antidepressants, laxatives, prokinetics, antidiarrheal drugs, serotonin 5-HT3 receptor antagonists, antibiotics, intestinal secretagogues, opiate derivatives, stimulants of gabapentin-mediated neuronal signaling as well as natural products [ 11 , 12 ] although their efficacy is controversial [ 13 ]. In consequence, nowadays no pharmacological treatment that combines optimal efficacy and safety has been reported. However, recent studies have described the modulatory effects of some nutraceuticals on mast cells which may influence (increase or reduce) IBS symptoms [ 5 ]. Moreover, since IBS patients display an altered gut microbiome, its selective modulation with using probiotics and/or prebiotics has emerged as a promising therapy. In this sense, Limosilactobacillus fermentum CECT5716 is a probiotic strain isolated from human milk that has shown to prevent the development of mastitis in breastfeeding women [ 14 ], to reduce gastrointestinal infections in infants [ 15 ], as well as to modulate the gut dysbiosis and the altered intestinal barrier function in experimental rodent models of colitis [16,17], obesity [18] and hypertension [19], among others. Considering all the above, the objective of the present study was to assess the beneficial effects of L. fermentum in a rat model of chronic post-inflammatory visceral pain induced by deoxycholic acid (DCA), which produces persistent visceral hyperalgesia and referred pain resembling human IBS. Additionally, the impact of L. fermentum administration has been evaluated on behavioral alterations, specifically those associated with stress, together with its capacity to modulate the altered immune response and/or restore the dysbiosis described in this experimental model of IBS. The effect of the probiotic treatment in this IBS experimental model in rats was compared with two treatments used in IBS patients; gabapentin (a GABAergic agent) and rifaximin (an antibiotic) that have been clinically assayed for visceral pain, diarrhea and abdominal discomfort in human IBS [20–22]. 2. Materials and Methods 2.1. Reagents, Drugs and Probiotics The chemicals and drugs were purchased from Sigma Chemical (Madrid, Spain), except when mentioned specifically. The probiotic Limosilactobacillus fermentum CECT5716 was provided by Biosearch, S.A. (Granada, Spain) and grown in MRS media for a period of 24 h at 37 ◦ C under anaerobic conditions using the Anaerogen system (Oxoid, Basingstoke, UK). For probiotic treatment, bacteria were daily suspended in sterile phosphate-buffered saline (PBS) solution. The in vitro studies was performed in complete DMEM Advanced (Gibco, ThermoFisher Scientific, Waltham, MS, USA) (containing 10% fetal bovine serum, 2 mM glutamine (Lonza Barcelona, Spain), 1% penicillin/streptomycin and 1% amphotericin B) and cultured at 37 ◦C and 5% CO2. 2.2. Cell Viability and Proliferation Assay Viability and proliferation of rat basophilic leukemia-2H3 basophils (RBL-2H3) obtained from the Cell Culture Unit of the University of Granada (Granada, ES, Spain) and Nutrients 2023,15, 24 3 of 19 human mast cells (HMC 1.2; Sigma Aldrich, MO, USA) after Compound 48/80 (50 µ g/mL), L. fermentum (1 × 10 9 CFU/mL), gabapentin (5, 10 or 25 µ M) or rifaximin (5, 10 or 25 µ M) incubation were assessed by CellTiter 96 ® AQueous One Solution Cell Proliferation Assay (MTS) from Promega (Madison, WI, USA) following the recommended protocol. Concisely, the cells were seeded into 96-well plates and after 24 h, the [3-(4,5-dimethylthiazol-2-yl)-5- (3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium] (MTS) solution was added to each well and incubated for 1–4 h. Then, the absorbance of the supernatant was measured at 490 nm. Cell viability and proliferation (%) were calculated by comparing sample absorbance values with untreated control cultures. 2.3. Quantification of β-Hexosaminidase Release In Vitro The cell degranulation response was quantified measuring the level of β -hexosaminidase released in culture supernatants from RBL-2H3 and HMC 1.2. RBL-2H3 (1.25 × 10 6 cells/mL) and HMC 1.2 (1.25 × 10 6 cells/mL) cells were incubated in 96-well plates for 24 h at 37 ◦ C under 5% CO 2 . Next day, after washing, cells were incubated for 30 min with L. fermentum (1 × 10 9 CFU/mL), gabapentin or rifaximin at 5, 10 or 25 µ M diluted in Tyrode’s buffer (137 mM NaCl, 2.7 mM KCl, 1 mM MgCl 2 , 1.8 mM CaCl 2 , 0.2 mM Na 2 HPO 4 , 12 mM NaHCO 3 , 5.5 mM D-Glucose). Then, cells were stimulated with Compound 48/80 at 50 µ g/mL. Tyrode’s buffer and Compound 48/80 at 50 µ g/mL diluted in Tyrode’s buffer were used as negative and positive controls, respectively. After 90 min of incubation with the substrate solution (3.5 mg/mL p-nitrophenyl-N-acetylβ -Dglucosaminide in 40 mM citric acid, pH 4.5) at 37 ◦ C, the supernatants were collected and the β -hexosaminidase released was measured. The reaction was stopped by adding glycine 400 mM, pH 10.7, and optical density was measured at 405 nm in a microplate reader (Tecan, Männedorf, CH, Switzerland). The spontaneous enzyme release was deducted from this total value and data were expressed as a percentage (%) of the total β -hexosaminidase content in the cells measured by lysing cells with 0.1% Triton X100. 2.4. Rat Model of Irritable Bowel Syndrome by DCA The animal studies were performed in agreement with the “Guide for the Care and Use of Laboratory Animals” as promulgated by the National Institute of Health, ARRIVE guidelines and the protocols approved by the Ethics Committee of Laboratory Animals of the University of Granada (17/07/2020/084). Adult (10 weeks old) male Sprague Dawley rats (240–320 g) were purchased from Janvier Labs (St Berthevin Cedex, FR) and housed in Makrolon cages (5 rats/cage; 2 cages per group), maintained with a 12 h light–dark cycle and provided with ad libitum food and tap water in an air-conditioned atmosphere (20–22 ◦ C and 45–55% humidity). The rats were randomly assigned to 5 study groups (n= 10). To develop IBS, rats were fasted overnight. Next day, rats were anesthetized and 1 mL of 4 mmol/L DCA in Krebs’ solution was administered through the colon by a gavage needle once daily for three consecutive days. Rats were kept on a mound of bedding in a head-down position to avoid leakage of DCA. A control group (Non-IBS) was included for reference, which was given the DCA vehicle. Once IBS had developed, the different compounds were administered daily by oral gavage, for 14 days. Rats were treated with rifaximin (150 mg/kg), gabapentin (70 mg/kg) or L. fermentum (10 9 CFU/day) depending on the group. The IBS control group followed the same protocol but received sterile water (vehicle used for all compounds). Rats’ body weights, water and food intake and diarrhea episodes were daily recorded during the experiment by a blinded observer. After finishing the administration and physical/behavioral determinations, rats were sacrificed with an overdose of halothane. Then, the colon was removed aseptically and kept frozen at − 80 ◦ C or fixed in 10% neutral buffered formalin until future studies. 2.5. Measurement of Response to Colorectal Distension Visceral hypersensitivity was evaluated 7 and 14 days after the last administration of DCA by the response of rats to colorectal distension (CRD) as previously described [ 23 ]. Nutrients 2023,15, 24 4 of 19 Briefly, under light anesthesia, a mini balloon was trans-anally inserted into the colon and inflated to 60 mmHg for a 20 s stimulation period followed by a 5 min period of rest. Behavioral responses to CRD were collected by a blinded observer in triplicate following a score system based on abdominal withdrawal reflex (AWR). The scores were as follows: 0 = normal behavior without response; 1 = brief head movement at the onset of the stimulus followed by immobility; 2 = contraction of abdominal muscles; 3 = lifting of the abdomen off the platform; 4 = body arching and lifting of pelvic structures [24,25]. 2.6. Determination of Referred Pain Rats were checked for referred hyperalgesia 7 and 14 days after the last administration of DCA. For this purpose, rats were shaved on the abdomen and then located in individual plastic boxes. Once calm and acclimatized, a series of von Frey filaments (Stoelting Co, Wood Dale, IL, USA) ranging from 8 g down to 1 g were perpendicularly applied to the abdomen. Each filament was tried 5 times for 10 s. If the rat had a positive response (brisk escape), then the filament of the next lower force was applied. The test ended when two filaments were applied without a positive response. 2.7. Intestinal Permeability Regarding intestinal permeability, 12 days after the last administration of DCA, rats were fasted for 12 h and administered 4000 Da fluorescent dextran–FITC (DX-4000–FITC) (350 mg/kg) by oral gavage. Four hours later, blood was collected from the abdominal aorta and DX-4000–FITC concentration was analyzed in plasma (diluted 1:20) using a Fluorostart fluorescence spectrophotometer (BMG Labtechnologies, Offenburg, Germany). The excitation wavelength was 485 nm and the emission one was 535 nm. FITC–dextran diluted in PBS was used to obtain the standard curves [26]. 2.8. Gene Expression Analysis In order to test the impact of the compounds, colonic gene expression of Muc-3,Vegfα , Cox-2 and Trpv1 were analyzed by RT-qPCR. Total RNA was isolated from colonic samples employing NucleoZOL ® (Macherey-Nagel GmbH & Co. KG, Dueren, Germany) following the manufacturer’s protocol. Then, RNA was quantified and reverse transcribed using oligo (dT) primers (Promega, Southampton, UK). Real time quantitative PCR amplification and detection were carried out using 20 ng of cDNA, the KAPA SYBR ® FAST qPCR Master Mix (Kapa Biosystems, Wilmington, MA, USA) and specific primers at their annealing temperature (Ta) (Table 1). The values of the housekeeping glyceraldehyde-3-phosphate dehydrogenase (Gapdh) gene were used to normalize mRNA expression. The 2- ∆∆ Ct method was employed to calculate the mRNA relative quantitation. Table 1. Primer sequences employed for real-time PCR assays. Gene Sequence 50–30Annealing Temperature (◦C) Muc-3 FW: CACAAAGGCAAGAGTCCAGA RV: ACTGTCCTTGGTGCTGCTGAATG 60 Cox-2 FW: TGATGACTGCCCAACTCCCATG RV: AATGTTGAAGGTGTCCGGCAGC 60 Vegf-αFW: CTTCCGAGGGATTCAATATTTC RV: CTCATCTCTCCTATGTGCTG 55 Trpv1 FW: AAGAGTTTGTTTGTGGACAG RV: TGTAGTAGAGCATGTTGGTC 56 Gapdh FW: CCATCACCATCTTCCAGGAG RV: CCTGCTTCACCACCTTCTTG 60 Nutrients 2023,15, 24 5 of 19 2.9. Western Blot Analysis Proteins were extracted from colon samples, their concentration were measured using a BCA Protein Assay Kit (Pierce Biotechnology, Waltham, MA, USA), and run on SDS-PAGE gel (Beyotime Biotechnology, Haimeng, China) and transferred onto a polyvinylidene fluoride membrane (Millipore, Berlington, MA, USA). After 5% milk blocking, the membranes were incubated at 4 ◦ C overnight in the primary antibody: Occludin (E-5) sc-133256 (Santa Cruz Biotechnology, Heidelberg, DE, USA). β -actin (Santa Cruz) at 1:1000 dilution was used as an internal reference. Then, the membranes were incubated with a secondary antibody (Cell Signaling Technology, Danvers, MA, USA) for 2 h at room temperature and exposed to enhanced chemiluminescence for signal intensity quantification (Bio-Rad Laboratories, Madrid, ES, Spain). The obtained images were evaluated using ImageJ Fiji Software [27]. 2.10. DNA Extraction and Illumina MiSeq Sequencing Fecal DNA was isolated using the protocol reported by Rodríguez-Nogales et al. [ 16 ]. DNA was amplified with primers targeting regions flanking the variable regions 4 through 5 of the bacterial 16 S rRNA gene (V4–5) and explored employing Illumina MiSeq technology. The PCR reactions from the same samples were pooled in one plate, cleaned, and normalized in Invitrogen SequalPrep 96-well Plate kit. The quantified sequences that resulted were completed, quality-filtered, clustered and taxonomically assigned on the basis of 97% similarity level against the RDP (Ribosomal Database Project) [ 28 ] with the QIIME2 software package (2021.11 version; https://qiime2.org; California, USA) and “R” statistical software package (version 3.6.0; https://www.r-project.org/) [29]. 2.11. Histology Colon specimens were fixed in 10% neutral buffered formalin for a minimum of 3 days, dehydrated, embedded in paraffin, and sectioned. Then, histological sections of 5 µ m were stained with either hematoxylin and eosin (H&E) or Toluidine Blue (TB). The H&E histological staining was used to assess the inflammatory cell infiltration in the colon. On the other hand, TB staining was applied to visualize mast cells in the connective tissue. Specimens were evaluated independently by 3 individual researchers who were blinded to the experimental procedure. The results were analyzed using ImageJ Fiji Software (version 2.9.0.) [27]. 2.12. Anxiety Behavior Associated with Visceral Hypersensitivity Animals were placed in the center of a brightly illuminated arena from the top openfield (OF) for a 10 min trial. The OF arena was a translucent polyethylene box with internal dimensions of 60 cm × 60 cm × 45 cm. Behavioral responses were recorded by a camera above the center of the open-field and connected to a computer. Then, the obtained videos were analyzed by a blinded observer. The time elapsed in central and peripheral zones was recorded using a software designed for this purpose (CPP.OF version 21, Tiselius company, Madrid, Spain). Results were expressed as the percentage of time that the animal spent in the central zone. The excreted feces were collected and the OF arena was cleaned with ethanol (70%) at the end of each session. 2.13. Statistics In the in vivo and in vitro studies the data are expressed as the mean ± standard error of the mean (SEM) and are representative of three independent experiments. Differences between means were tested for statistical significance using a one-way analysis of variance (ANOVA) followed by the Bonferroni post hoc test. For non-parametric data, median and CI 95% were used and the Kruskal–Wallis test was performed. The von Frey data were registered as areas under the curve (AUC) that were quantified with the trapezoid method. The distribution of force threshold AUC’s was evaluated for normality using the Nutrients 2023,15, 24 6 of 19 Kolmogorov–Smirnov one-sample test and the data were transformed prior to analysis using the histogram transformation. The AUC data of the five treatment groups were compared using a generalized linear model treatment group as factors. Microbiome evaluation including α -diversity indices and taxa abundance of the different groups were compared using Kruskal–Wallis test followed by pairwise Mann–Whitney U comparison. Resulting p-values were adjusted by the Bonferroni method. Analysis of α -diversity was carried out on the output normalized data, which were assessed using Mothur. Principal coordinate analysis (PCoA) was accomplished to identify principal coordinates and visualize β -diversity in complex multidimensional data of bacteriomes from different groups of rats. Differences in beta-diversity were tested by permutational multivariate analysis of variance (PERMANOVA). The data are expressed as the mean ± standard error of the mean (SEM). Multiple comparisons between groups were performed using the one-way ANOVA, followed by the Bonferroni post hoc test. For the correlation analysis between fold gene expression data and gut microbiome abundance values, the “stat_cor” function of R package was used. We then calculated the Spearman rank correlation coefficients for each group of study and the corresponding p values applying the cor.test() function with a two-sided alternative hypothesis. All statistical analyses were performed with the GraphPad Prism version 8.1 (GraphPad Software Inc., San Diego, CA, USA), with the statistical significance placed at p< 0.05. 3. Results and Discussion IBS is one of the most diagnosed gastrointestinal diseases, with a 10% prevalence in the general population, considering the Rome IV criteria [ 1 ]. IBS has a great negative impact on well-being and socioeconomic status, considering that the current treatments frequently show side effects and are not effective [ 30 , 31 ], most likely due to the complicated pathophysiology and the variability of the clinical manifestations of the condition [ 10 ]. This has made the patients more prone to self-medicating and using alternative and complementary medicines, which may treat a broader range of symptoms. Among these, probiotics have been proposed for exerting beneficial effects against these conditions [ 32 ]. In this study, we have evaluated the effects of the probiotic L. fermentum in DCA-induced post-inflammatory IBS in rats. 3.1. L. fermentum Administration Ameliorates the Anxiety-like Behavior in Experimental IBS Studies conducted in both humans and animals have shown that chronic intestinal diseases are frequently linked to anxiety-like behaviors as well as high levels of stress [ 9 , 33 ]. These behaviors would be the product of changes in corticolimbic areas related to emotion processing [ 34 ]. In this study, the open field maze was used to explore if this experimental model of IBS would also be related to anxiety-like behaviors, as well as the impact of the different treatments. In fact, the administration of DCA to rats produced a significant reduction in the time in the central zone compared with Non-IBS rats (Figure 1), which is considered as an evident sign of anxiety. However, those groups treated with L. fermentum, rifaximin and gabapentin, significantly spent more time in the central zone, thus indicating an improvement in the state of anxiety associated with the visceral hyperexcitability developed in this model of IBS (p< 0.05; Figure 1). 3.2. L. fermentum Administration Ameliorates IBS-Associated Visceral Pain Previous studies have shown that DCA administration to rats for three consecutive days increases visceral hypersensitivity [ 35 ], being this the most incapacitating symptom in human IBS. Moreover, this model is characterized by a mild and transient colonic inflammation, with no symptoms of ulceration or epithelial damage and with persistent visceral hyperalgesia. Different methods have been employed to assess this visceral hypersensitivity, which shows some similarities to visceral pain in human IBS [ 36 ]. Correspondingly, the results revealed higher visceral hypersensitivity to CRD (pressure applied 60 mm Hg), one and two weeks after DCA administration (IBS group), in comparison with Non-IBS Nutrients 2023,15, 24 7 of 19 rats (p< 0.05; Figure 2a,b). Remarkably, the administration of L. fermentum (10 9 CFU/day) significantly lowered the CRD scores after both periods of time when compared with the IBS control group (p< 0.05; Figure 2a,b). Remarkably, the probiotic treatment showed a similar reduction in the CRD values to the treatments with gabapentin or rifaximin (p< 0.05; Figure 2a,b), which are frequently prescribed to treat chronic neuropathic pain and visceral hyperalgesia in human IBS [ 37 ]. Actually, other probiotics, including lactobacilli and bifidobacteria, have reported beneficial effects on visceral pain in different IBS experimental models [38,39]. Nutrients 2022, 14, x FOR PEER REVIEW 7 of 20 impact of the different treatments. In fact, the administration of DCA to rats produced a significant reduction in the time in the central zone compared with Non-IBS rats (Figure 1), which is considered as an evident sign of anxiety. However, those groups treated with L. fermentum, rifaximin and gabapentin, significantly spent more time in the central zone, thus indicating an improvement in the state of anxiety associated with the visceral hyperexcitability developed in this model of IBS (p < 0.05; Figure 1). Figure 1. Time spent in central zones of the OF was quantified to assess anxiety-like behavior of DCA vehicle (Non-IBS), 4 mmol/L DCA (IBS), L. fermentum (10 9 CFU) (L. ferm), Gabapentin at 70 mg/kg (GBP) and Rifaximin at 150 mg/kg (RFX)-treated rats. Data are expressed as means (triplicate measurements) ± SEM (n = 10). Groups with different letters are statistically different (p < 0.05). 3.2. L. fermentum Administration Ameliorates IBS-Associated Visceral Pain Previous studies have shown that DCA administration to rats for three consecutive days increases visceral hypersensitivity [35], being this the most incapacitating symptom in human IBS. Moreover, this model is characterized by a mild and transient colonic inflammation, with no symptoms of ulceration or epithelial damage and with persistent visceral hyperalgesia. Different methods have been employed to assess this visceral hypersensitivity, which shows some similarities to visceral pain in human IBS [36]. Correspondingly, the results revealed higher visceral hypersensitivity to CRD (pressure applied 60 mm Hg), one and two weeks after DCA administration (IBS group), in comparison with Non-IBS rats (p < 0.05; Figure 2a,b). Remarkably, the administration of L. fermentum (10 9 CFU/day) significantly lowered the CRD scores after both periods of time when compared with the IBS control group (p < 0.05; Figure 2a,b). Remarkably, the probiotic treatment showed a similar reduction in the CRD values to the treatments with gabapentin or rifaximin (p < 0.05; Figure 2a,b), which are frequently prescribed to treat chronic neuropathic pain and visceral hyperalgesia in human IBS [37]. Actually, other probiotics, including lactobacilli and bifidobacteria, have reported beneficial effects on visceral pain in different IBS experimental models [38,39]. Figure 2. Response to colorectal distension (CRD) was collected using a score system; one (a) and two (b) weeks after intracolonic administration of DCA vehicle (Non-IBS), 4 mmol/L DCA (IBS), L. fermentum (10 9 CFU) (L. ferm), Gabapentin at 70 mg/kg (GBP) and Rifaximin at 150 mg/kg (RFX) Figure 1. Time spent in central zones of the OF was quantified to assess anxiety-like behavior of DCA vehicle (Non-IBS), 4 mmol/L DCA (IBS), L. fermentum (10 9 CFU) (L. ferm), Gabapentin at 70 mg/kg (GBP) and Rifaximin at 150 mg/kg (RFX)-treated rats. Data are expressed as means (triplicate measurements) ±SEM (n= 10). Groups with different letters are statistically different (p< 0.05). Nutrients 2022, 14, x FOR PEER REVIEW 7 of 20 impact of the different treatments. In fact, the administration of DCA to rats produced a significant reduction in the time in the central zone compared with Non-IBS rats (Figure 1), which is considered as an evident sign of anxiety. However, those groups treated with L. fermentum, rifaximin and gabapentin, significantly spent more time in the central zone, thus indicating an improvement in the state of anxiety associated with the visceral hyperexcitability developed in this model of IBS (p < 0.05; Figure 1). Figure 1. Time spent in central zones of the OF was quantified to assess anxiety-like behavior of DCA vehicle (Non-IBS), 4 mmol/L DCA (IBS), L. fermentum (10 9 CFU) (L. ferm), Gabapentin at 70 mg/kg (GBP) and Rifaximin at 150 mg/kg (RFX)-treated rats. Data are expressed as means (triplicate measurements) ± SEM (n = 10). Groups with different letters are statistically different (p < 0.05). 3.2. L. fermentum Administration Ameliorates IBS-Associated Visceral Pain Previous studies have shown that DCA administration to rats for three consecutive days increases visceral hypersensitivity [35], being this the most incapacitating symptom in human IBS. Moreover, this model is characterized by a mild and transient colonic inflammation, with no symptoms of ulceration or epithelial damage and with persistent visceral hyperalgesia. Different methods have been employed to assess this visceral hypersensitivity, which shows some similarities to visceral pain in human IBS [36]. Correspondingly, the results revealed higher visceral hypersensitivity to CRD (pressure applied 60 mm Hg), one and two weeks after DCA administration (IBS group), in comparison with Non-IBS rats (p < 0.05; Figure 2a,b). Remarkably, the administration of L. fermentum (10 9 CFU/day) significantly lowered the CRD scores after both periods of time when compared with the IBS control group (p < 0.05; Figure 2a,b). Remarkably, the probiotic treatment showed a similar reduction in the CRD values to the treatments with gabapentin or rifaximin (p < 0.05; Figure 2a,b), which are frequently prescribed to treat chronic neuropathic pain and visceral hyperalgesia in human IBS [37]. Actually, other probiotics, including lactobacilli and bifidobacteria, have reported beneficial effects on visceral pain in different IBS experimental models [38,39]. Figure 2. Response to colorectal distension (CRD) was collected using a score system; one (a) and two (b) weeks after intracolonic administration of DCA vehicle (Non-IBS), 4 mmol/L DCA (IBS), L. fermentum (10 9 CFU) (L. ferm), Gabapentin at 70 mg/kg (GBP) and Rifaximin at 150 mg/kg (RFX) Figure 2. Response to colorectal distension (CRD) was collected using a score system; one ( a ) and two ( b ) weeks after intracolonic administration of DCA vehicle (Non-IBS), 4 mmol/L DCA (IBS), L. fermentum (10 9 CFU) (L. ferm), Gabapentin at 70 mg/kg (GBP) and Rifaximin at 150 mg/kg (RFX) treated rats. Data are expressed as means (triplicate measurements) ± SEM (n= 10). Groups with different letters statistically differ (p< 0.05). 3.3. L. fermentum Administration Reduces Visceral Hyperalgesia and Allodynia in the DCA Experimental Model The intracolonic administration of DCA causes moderate intestinal inflammation, associated with somatic hyperalgesia and allodynia [ 40 ]. Thus, the referred pain was tested by the response (brisk escape) induced by the application of von Frey filaments in the lower abdomen. The results showed a significantly lower response threshold to pressure in the IBS control group in comparison with the Non-IBS group, revealing the higher visceral hyperalgesia at both time points evaluated (Figure 3a,b). Additionally, the percentages of responses were significantly higher at all the pressure points evaluated, being those more intense after 7 days (Figure 3a) than 14 days later (Figure 3b). The treatment with L. fermentum or rifaximin significantly diminished the nociceptive score (from 4 to 26 g), when compared to the IBS group, one and two weeks after the last DCA administration (p< 0.05) (Figure 3a,b). Conversely, in the groups treated with gabapentin, although they failed to show significant differences in the nociceptive score in comparison with the IBS Nutrients 2023,15, 24 8 of 19 control group, a tendency was noticed in the second week and no statistical differences were seen among treated groups. On the other hand, it is important to remark that, despite the fact that other probiotics have been shown to have the potential to modulate visceral hyper sensation and to alleviate the visceral pain responses in animal studies [ 41 , 42 ], this study shows for the first time the capacity of L. fermentum to alleviate the increased sensitivity induced by DCA administration in rats. Nutrients 2022, 14, x FOR PEER REVIEW 8 of 20 treated rats. Data are expressed as means (triplicate measurements) ± SEM (n = 10). Groups with different letters statistically differ (p < 0.05). 3.3. L. fermentum Administration Reduces Visceral Hyperalgesia and Allodynia in the DCA Experimental Model The intracolonic administration of DCA causes moderate intestinal inflammation, associated with somatic hyperalgesia and allodynia [40]. Thus, the referred pain was tested by the response (brisk escape) induced by the application of von Frey filaments in the lower abdomen. The results showed a significantly lower response threshold to pressure in the IBS control group in comparison with the Non-IBS group, revealing the higher visceral hyperalgesia at both time points evaluated (Figure 3a,b). Additionally, the percentages of responses were significantly higher at all the pressure points evaluated, being those more intense after 7 days (Figure 3a) than 14 days later (Figure 3b). The treatment with L. fermentum or rifaximin significantly diminished the nociceptive score (from 4 to 26 g), when compared to the IBS group, one and two weeks after the last DCA administration (p < 0.05) (Figure 3a,b). Conversely, in the groups treated with gabapentin, although they failed to show significant differences in the nociceptive score in comparison with the IBS control group, a tendency was noticed in the second week and no statistical differences were seen among treated groups. On the other hand, it is important to remark that, despite the fact that other probiotics have been shown to have the potential to modulate visceral hyper sensation and to alleviate the visceral pain responses in animal studies [41,42], this study shows for the first time the capacity of L. fermentum to alleviate the increased sensitivity induced by DCA administration in rats. Figure 3. Evaluation of referred hyperalgesia one (a) and two (b) weeks after DCA instillation. Von Frey filaments (1–8 g) were applied to the abdomen of DCA vehicle (Non-IBS), 4 mmol/L DCA (IBS)- , L. fermentum (10 9 CFU) (L. ferm)-, Gabapentin at 70 mg/kg (GBP)- and Rifaximin at 150 mg/kg (RFX)- treated rats. Referred hyperalgesia was calculated considering the percentage of response to filaments (number of animals responding to the filament) and area under the curve (AUC) was determined. Data are expressed as means ± SEM (n = 10). * p < 0.05 vs. IBS group. Groups with different letters are statistically differ (p < 0.05). 3.4. L. fermentum Administration Ameliorates Gut Inflammatory Status in Experimental IBS Figure 3. Evaluation of referred hyperalgesia one ( a ) and two ( b ) weeks after DCA instillation. Von Frey filaments (1–8 g) were applied to the abdomen of DCA vehicle (Non-IBS), 4 mmol/L DCA (IBS)-, L. fermentum (10 9 CFU) (L. ferm)-, Gabapentin at 70 mg/kg (GBP)- and Rifaximin at 150 mg/kg (RFX)-treated rats. Referred hyperalgesia was calculated considering the percentage of response to filaments (number of animals responding to the filament) and area under the curve (AUC) was determined. Data are expressed as means ± SEM (n= 10). * p< 0.05 vs. IBS group. Groups with different letters are statistically differ (p< 0.05). 3.4. L. fermentum Administration Ameliorates Gut Inflammatory Status in Experimental IBS The IBS-associated intestinal inflammatory process plays a pathogenic role in IBS. In fact, several studies have reported gut mucosal inflammation at the microscopic and molecular levels [ 43 ]. Moreover, chronic, low-grade, subclinical inflammation has also been thought to perpetuate the symptoms of IBS [ 35 ]. Specifically, in this experimental model, the DCA administration also induces a low-grade inflammatory process and an altered immune response [ 36 ]. The gene expression profile of different markers, including Vegfα , Cox-2 and Trpv-1, was significantly increased in the IBS group in comparison with Non-IBS control (Figure 4a–c, respectively). Previous studies have described higher levels of these mediators in IBS patients [ 44 – 47 ]. Remarkably, the probiotic and rifaximin treatments significantly reduced their expression (Figure 4). These results agree with our previous results regarding visceral pain evaluation. It has been well known that active immunogenic mediators induce activation of COX-2 leading to an increase in the synthesis of prostaglandin E 2 , which contributes to visceral hypersensitivity and diarrhea related to IBS [ 48 ]. Here, we can observe that the probiotic and rifaximin treatment reduced the Cox-2 gene expression, which was associated with the amelioration of the visceral pain and the referred hyperalgesia. Additionally, the increase in TRPV1, a receptor of pain perception, has been reported in gut and primary sensory neurons from animals and IBS patients [ 49 ]. It is important to note that different studies have revealed that species from Lactobacillus as well as the rifaximin can improve the visceral hyperalgesia via the TRPV1 channel [ 50 , 51 ]. On the other hand, it Nutrients 2023,15, 24 9 of 19 is widely recognized that VEGF plays a key role in wound repair and chronic inflammation, being also able to promote vascular permeability, as well as the adhesion of leukocytes to the endothelium and chemotaxis of monocytes [ 52 ]. Moreover, VEGF upregulates NFκ B and the production of many proinflammatory cytokines and chemokines [ 53 ]. Consequently, a significantly increased gene expression of Vegfα was seen in the IBS control group when compared with the Non-IBS control group (Figure 4a), whereas the treatment with rifaximin and the probiotic significantly reduced it. Thus, although it is not well known why these markers are overexpressed, it could be linked to an unbalanced stimulation of the immune response by the intestinal microorganisms, including a mucosal barrier dysfunction, and/or stress-caused activation of the immune system. Consequently, our results sustain that the immunomodulatory properties of L. fermentum can contribute to its positive effect. Nutrients 2022, 14, x FOR PEER REVIEW 9 of 20 The IBS-associated intestinal inflammatory process plays a pathogenic role in IBS. In fact, several studies have reported gut mucosal inflammation at the microscopic and molecular levels [43]. Moreover, chronic, low-grade, subclinical inflammation has also been thought to perpetuate the symptoms of IBS [35]. Specifically, in this experimental model, the DCA administration also induces a low-grade inflammatory process and an altered immune response [36]. The gene expression profile of different markers, including Vegf-α, Cox-2 and Trpv-1, was significantly increased in the IBS group in comparison with Non-IBS control (Figure 4a–c, respectively). Previous studies have described higher levels of these mediators in IBS patients [44–47]. Remarkably, the probiotic and rifaximin treatments significantly reduced their expression (Figure 4). These results agree with our previous results regarding visceral pain evaluation. It has been well known that active immunogenic mediators induce activation of COX-2 leading to an increase in the synthesis of prostaglandin E 2 , which contributes to visceral hypersensitivity and diarrhea related to IBS [48] . Here, we can observe that the probiotic and rifaximin treatment reduced the Cox-2 gene expression, which was associated with the amelioration of the visceral pain and the referred hyperalgesia. Additionally, the increase in TRPV1, a receptor of pain perception, has been reported in gut and primary sensory neurons from animals and IBS patients [49]. It is important to note that different studies have revealed that species from Lactobacillus as well as the rifaximin can improve the visceral hyperalgesia via the TRPV1 channel [50,51]. On the other hand, it is widely recognized that VEGF plays a key role in wound repair and chronic inflammation, being also able to promote vascular permeability, as well as the adhesion of leukocytes to the endothelium and chemotaxis of monocytes [52]. Moreover, VEGF upregulates NF-κB and the production of many proinflammatory cytokines and chemokines [53]. Consequently, a significantly increased gene expression of Vegf-α was seen in the IBS control group when compared with the Non-IBS control group (Figure 4a), whereas the treatment with rifaximin and the probiotic significantly reduced it. Thus, although it is not well known why these markers are overexpressed, it could be linked to an unbalanced stimulation of the immune response by the intestinal microorganisms, including a mucosal barrier dysfunction, and/or stress-caused activation of the immune system. Consequently, our results sustain that the immunomodulatory properties of L. fermentum can contribute to its positive effect. Figure 4. Effect of DCA vehicle (Non-IBS), 4 mmol/L DCA (IBS), L. fermentum (10 9 CFU) (L. ferm), Gabapentin at 70 mg/kg (GBP) or Rifaximin at 150 mg/kg (RFX) treatment on colonic gene expression of Vegfα ( a ), Cox-2 ( b ) and Trpv-1 ( c ) assessed by real-time qPCR and normalized with the housekeeping gene Gapdh. Data are expressed as means ± SEM (n= 10). Groups with different letters statistically differ (p< 0.05). 3.5. L. fermentum Administration Reduces Cell Degranulation As commented above, IBS is more and more considered as a low-grade inflammatory disorder and attention has been centered on the roles of mast cells (MCs) in the intestinal wall. Many other immune cells (T and B cells, eosinophils, monocytes, macrophages) may also participate in the pathophysiology of IBS, however, mast cells have been identified as key connectors of the intestinal mucosa and the nerve fibers of the enteric nervous system [ 54 , 55 ]. MCs are related with major intestinal functions, such as epithelial secretion, epithelial permeability, blood flow, neuroimmune interactions and visceral sensation [ 56 ]. In fact, MCs hyperplasia and activation would lead to anomalous gastrointestinal sensitivity, motility and secretion, which in turn promote abdominal pain and/or discomfort, bloating and abnormal intestinal function [ 57 ]. In this sense, many therapies targeting mast cells have been explored in IBS patients and have shown good effectiveness to some extent [58,59] . Therefore, and in order to disclose the mechanism involved in the positive effects of L. fermentum in the IBS experimental model, the impact of the probiotic was evaluated on the mastocytosis process. The confocal microscopy using blue toluidine Nutrients 2023,15, 24 16 of 19 L.H.-G. and M.J.R.-S. (Maria JoséRodríguez-Sánchez); Writing—original draft, M.J.R.-S. (Maria José Rodríguez-Sánchez), A.R.-N., C.M. and J.G.; Writing—review & editing, M.E.R.-C., A.R.-N., C.M. and J.G.; Visualization, P.D.-E. and J.G.; Supervision, A.R.-N., C.M. and J.G.; Funding acquisition, C.M. and J.G.. All authors have read and agreed to the published version of the manuscript. Funding: This study was supported by the Junta de Andalucía (A-CTS-447-UGR18 and CTS 164), and by the Instituto de Salud Carlos III (ISCIII) (PI19/01058, PI20/01447; CIBER-EHD). Institutional Review Board Statement: The animal study was performed following the “Guide for the Care and Use of Laboratory Animals” as declared by the National Institutes of Health and the protocols certified by the Ethics Committee of Laboratory Animals of the University of Granada (Granada, Spain) (17/07/2020/084). All studies concerning animals are described in agreement with the ARRIVE guidelines for reporting experiments concerning animals (Kilkenny et al., 2010; McGrath et al., 2010). Data Availability Statement: Not applicable. Conflicts of Interest: The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. References 1. Mearin, F.; Lacy, B.E.; Chang, L.; Chey, W.D.; Lembo, A.J.; Simren, M.; Spiller, R. Bowel Disorders. Gastroenterology 2016 ,150, 1393–1407. 2. Ford, A.C.; Lacy, B.E.; Talley, N.J. Irritable Bowel Syndrome. N. Engl. J. Med. 2017,376, 2566–2578. [CrossRef] [PubMed] 3. Black, C.J.; Ford, A.C. Global burden of irritable bowel syndrome: Trends, predictions and risk factors. Nat. Rev. Gastroenterol. Hepatol. 2020,17, 473–486. [CrossRef] [PubMed] 4. Lee, Y.J.; Park, K.S. Irritable bowel syndrome: Emerging paradigm in pathophysiology. World J. Gastroenterol. 2014 ,20, 2456–2469. [CrossRef] [PubMed] 5. Uranga, J.A.; Martínez, V.; Abalo, R. Mast Cell Regulation and Irritable Bowel Syndrome: Effects of Food Components with Potential Nutraceutical Use. Molecules 2020,25, 4314. [CrossRef] [PubMed] 6. Zamani, M.; Alizadeh-Tabari, S.; Zamani, V. Systematic review with meta-analysis: The prevalence of anxiety and depression in patients with irritable bowel syndrome. Aliment. Pharm. 2019,50, 132–143. [CrossRef] 7. Van Oudenhove, L.; Crowell, M.D.; Drossman, D.A.; Halpert, A.D.; Keefer, L.; Lackner, J.M.; Murphy, T.B.; Naliboff, B.D.; Levy, R.L. Biopsychosocial Aspects of Functional Gastrointestinal Disorders. Gastroenterology 2016,150, 1355–1367.e2. [CrossRef] 8. Coss-Adame, E.; Rao, S.S. Brain and gut interactions in irritable bowel syndrome: New paradigms and new understandings. Curr. Gastroenterol. Rep. 2014,16, 379. [CrossRef] 9. Foster, J.A.; Rinaman, L.; Cryan, J.F. Stress & the gut-brain axis: Regulation by the microbiome. Neurobiol. Stress 2017 ,7, 124–136. 10. Bellini, M.; Gambaccini, D.; Stasi, C.; Urbano, M.T.; Marchi, S.; Usai-Satta, P. Irritable bowel syndrome: A disease still searching for pathogenesis, diagnosis and therapy. World J. Gastroenterol. 2014,20, 8807–8820. 11. Camilleri, M.; Boeckxstaens, G. Dietary and pharmacological treatment of abdominal pain in IBS. Gut 2017 ,66, 966–974. [CrossRef] [PubMed] 12. Bordbar, G.; Miri, M.B.; Omidi, M.; Shoja, S.; Akhavan, M. Efficacy and Safety of a Novel Herbal Medicine in the Treatment of Irritable Bowel Syndrome: A Randomized Double-Blinded Clinical Trial. Gastroenterol. Res. Pr. 2020 ,2020, 8213082. [CrossRef] [PubMed] 13. Camilleri, M. Diagnosis and Treatment of Irritable Bowel Syndrome: A Review. Jama 2021,325, 865–877. [CrossRef] [PubMed] 14. Bond, D.M.; Morris, J.M.; Nassar, N. Study protocol: Evaluation of the probiotic Lactobacillus Fermentum CECT5716 for the prevention of mastitis in breastfeeding women: A randomised controlled trial. BMC Pregnancy Childbirth 2017 ,17, 148. [CrossRef] [PubMed] 15. Pastor-Villaescusa, B.; Blanco-Rojo, R.; Olivares, M. Evaluation of the Effect of Limosilactobacillus fermentum CECT5716 on Gastrointestinal Infections in Infants: A Systematic Review and Meta-Analysis. Microorganisms 2021 ,9, 1412. [CrossRef] [PubMed] 16. Rodríguez-Nogales, A.; Algieri, F.; Vezza, T.; Garrido-Mesa, N.; Olivares, M.; Comalada, M.; Riccardi, C.; Utrilla, M.P.; RodriguezCabezas, M.E.; Galvez, J. The viability of Lactobacillus fermentum CECT5716 is not essential to exert intestinal anti-inflammatory properties. Food Funct. 2015,6, 1176–1184. [CrossRef] 17. Rodríguez-Nogales, A.; Algieri, F.; Garrido-Mesa, J.; Vezza, T.; Utrilla, M.P.; Chueca, N.; Garcia, F.; Olivares, M.; RodriguezCabezas, M.E.; Galvez, J. Differential intestinal anti-inflammatory effects of Lactobacillus fermentum and Lactobacillus salivarius in DSS mouse colitis: Impact on microRNAs expression and microbiota composition. Mol. Nutr. Food Res. 2017 ,61, 144. [CrossRef] 18. Molina-Tijeras, J.A.; Diez-Echave, P.; Vezza, T.; Hidalgo-Garcia, L.; Ruiz-Malagon, A.J.; Rodriguez-Sojo, M.J.; Romero, M.; Robles-Vera, I.; Garcia, F.; Plaza-Diaz, J.; et al. Lactobacillus fermentum CECT5716 ameliorates high fat diet-induced obesity in mice through modulation of gut microbiota dysbiosis. Pharm. Res. 2021,167, 105471. [CrossRef] Nutrients 2023,15, 24 17 of 19 19. Robles-Vera, I.; Toral, M.; de la Visitación, N.; Sánchez, M.; Romero, M.; Olivares, M.; Jiménez, R.; Duarte, J. The Probiotic Lactobacillus fermentum Prevents Dysbiosis and Vascular Oxidative Stress in Rats with Hypertension Induced by Chronic Nitric Oxide Blockade. Mol. Nutr. Food Res. 2018,62, e1800298. [CrossRef] 20. Lee, K.J.; Kim, J.H.; Cho, S.W. Gabapentin reduces rectal mechanosensitivity and increases rectal compliance in patients with diarrhoea-predominant irritable bowel syndrome. Aliment. Pharm. 2005,22, 981–988. [CrossRef] 21. Pimentel, M.; Park, S.; MIrocha, J.; Kane, S.V.; Kong, Y. The effect of a nonabsorbed oral antibiotic (rifaximin) on the symptoms of the irritable bowel syndrome: A randomized trial. Ann. Intern. Med. 2006,145, 557–563. [CrossRef] [PubMed] 22. Menees, S.B.; Maneerattannaporn, M.; Kim, H.M.; Chey, W.D. The efficacy and safety of rifaximin for the irritable bowel syndrome: A systematic review and meta-analysis. Am. J. Gastroenterol. 2012,107, 28–35. [CrossRef] [PubMed] 23. Rodríguez-Nogales, A.; Algieri, F.; Vezza, T.; Garrido-Mesa, J.; Molina-Tijeras, J.A.; ROdriguez-Cabezas, M.E.; Utrilla, M.P.; Pischel, I.; Galvez, J. Calcium Pyruvate Exerts Beneficial Effects in an Experimental Model of Irritable Bowel Disease Induced by DCA in Rats. Nutrients 2019,11, 140. [CrossRef] 24. Keszthelyi, D.; Troost, F.J.; Masclee, A.A. Irritable bowel syndrome: Methods, mechanisms, and pathophysiology. Methods to assess visceral hypersensitivity in irritable bowel syndrome. Am. J. Physiol. Gastrointest. Liver Physiol. 2012 ,303, G141–G154. [CrossRef] 25. Zhang, C.; Rui, Y.-Y.; Zhou, Y.-Y.; Ju, Z.; Zhang, H.-H.; Hu, C.-Y.; Xiao, Y.; Xu, G.-Y. Adrenergic β 2-receptors mediates visceral hypersensitivity induced by heterotypic intermittent stress in rats. PLoS ONE 2014,9, e94726. [CrossRef] 26. Vezza, T.; Algieri, F.; Rodriguez-Nogales, A.; Garrido-Mesa, J.; Utrilla, M.P.; Talhaoui, N.; Gómez-Caravaca, A.M.; SeguraCarretero, A.; Rodriguez-Cabezas, M.E.; Monteleone, G. Immunomodulatory properties of Olea europaea leaf extract in intestinal inflammation. Mol. Nutr. Food Res. 2017,61, 1066. [CrossRef] [PubMed] 27. Schindelin, J.; Arganda-Carreras, I.; Frise, E.; Kaynig, V.; Longair, M.; Pietzsch, T.; Preibisch, S.; Rueden, C.; Saalfeld, S.; Schmid, B. Fiji: An open-source platform for biological-image analysis. Nat. Methods 2012,9, 676–682. [CrossRef] 28. Mañé, J.; Lorén, V.; Pedrosa, E.; Ojanguren, I.; Xaus, J.; Cabré, E.; Domenèch, E.; Gassull, M.A. Lactobacillus fermentum CECT 5716 prevents and reverts intestinal damage on TNBS-induced colitis in mice. Inflamm. Bowel Dis. 2009 ,15, 1155–1163. [CrossRef] 29. R: A Language and Environment for Statistical Computing: R Core Team, R Foundation for Statistical Computing, Vienna, Austria. 2019. Available online: https://www.R-project.org (accessed on 7 November 2022). 30. Lucak, S.; Chang, L.; Halpert, A.; Harris, L.A. Current and emergent pharmacologic treatments for irritable bowel syndrome with diarrhea: Evidence-based treatment in practice. Ther. Adv. Gastroenterol. 2017,10, 253–275. [CrossRef] 31. Patel, S.; Doerfler, B.; Boutros, K.; Ng, S.; Manuel, M.; DeSimone, E. Review of Treatment Options for Irritable Bowel Syndrome with Constipation and Chronic Idiopathic Constipation. Int. J. Gen. Med. 2021,14, 1457–1468. [CrossRef] 32. Nee, J.; Lembo, A. Review Article: Current and future treatment approaches for IBS with diarrhoea (IBS-D) and IBS mixed pattern (IBS-M). Aliment. Pharm. 2021,54 (Suppl. S1), S63–S74. [CrossRef] 33. Jiang, H.-Y.; Zhang, X.; Yu, Z.-H.; Zhang, Z.; Deng, M.; Zhao, J.-H.; Ruan, B. Altered gut microbiota profile in patients with generalized anxiety disorder. J. Psychiatr. Res. 2018,104, 130–136. [CrossRef] [PubMed] 34. Elsenbruch, S. Abdominal pain in Irritable Bowel Syndrome: A review of putative psychological, neural and neuro-immune mechanisms. Brain Behav. Immun. 2011,25, 386–394. [CrossRef] [PubMed] 35. Traub, R.J.; Tang, B.; Ji, Y.; Pandya, S.; Yfnatis, H.; Sun, Y. A rat model of chronic postinflammatory visceral pain induced by deoxycholic acid. Gastroenterology 2008,135, 2075–2083. [CrossRef] [PubMed] 36. Guthrie, E.; Barlow, J.; Fernandes, L.; Ratcliffe, J.; Read, N.; Thompson, D.G.; Tomenson, B.; Creed, F.; North of England IBS research group. Changes in tolerance to rectal distension correlate with changes in psychological state in patients with severe irritable bowel syndrome. Psychosom. Med. 2004,66, 578–582. [CrossRef] [PubMed] 37. Trinkley, K.E.; Nahata, M.C. Medication management of irritable bowel syndrome. Digestion 2014,89, 253–267. [CrossRef] 38. Ait-Belgnaoui, A.; Payard, I.; Rolland, C.; Harkat, C.; Braniste, V.; Théodorou, V.; Tompkins, T.A. Bifidobacterium longum and Lactobacillus helveticus Synergistically Suppress Stress-related Visceral Hypersensitivity Through Hypothalamic-PituitaryAdrenal Axis Modulation. J. Neurogastroenterol. Motil. 2018,24, 138–146. [CrossRef] 39. Eutamene, H.; Lamine, F.; Chabo, C.; Theodorou, V.; Rochat, F.; Bergonzelli, G.E.; Corthésy-Theulaz, I.; Fioramonti, J.; Bueno, L. Synergy between Lactobacillus paracasei and its bacterial products to counteract stress-induced gut permeability and sensitivity increase in rats. J. Nutr. 2007,137, 1901–1907. [CrossRef] 40. McGrath, J.C.; Drummond, G.B.; McLachlan, E.M.; Kilkenny, C.; Wainwright, C.L. Guidelines for reporting experiments involving animals: The ARRIVE guidelines. Br. J. Pharm. 2010,160, 1573–1576. [CrossRef] 41. Wang, B.; Mao, Y.-K.; Diorio, C.; Wang, L.; Huizinga, J.D.; Bienenstock, J.; Kunze, W. Lactobacillus reuteri ingestion and IK(Ca) channel blockade have similar effects on rat colon motility and myenteric neurones. Neurogastroenterol. Motil. 2010 ,22, 98–107.e33. 42. Verdú, E.F.; Bercik, P.; Verma-Gandhu, M.; Huang, X.-X.; Blennerhassett, P.; Jackson, W.; Mao, Y.; Wang, L.; Rochat, F.; Collins, S.M. Specific probiotic therapy attenuates antibiotic induced visceral hypersensitivity in mice. Gut 2006 ,55, 182–190. [CrossRef] [PubMed] 43. Ng, Q.X.; Soh, A.Y.S.; Loke, W.; Lim, D.Y.; Yeo, W.-S. The role of inflammation in irritable bowel syndrome (IBS). J. Inflamm. Res. 2018,11, 345–349. [CrossRef] [PubMed] Nutrients 2023,15, 24 18 of 19 44. Hassanin, T.M.; Fouad, Y.; Mohamed, F.E.; Abdel-Hafeez, E.H.; Hassnine, A. Colonic mucosal eosinophilia and immunohistochemical expression of COX-2 and NF-kB in patients with irritable bowel syndrome. Eur. J. Gastroenterol. Hepatol. 2022 ,34, 512–517. [CrossRef] [PubMed] 45. Holzer, P. TRPV1: A new target for treatment of visceral pain in IBS? Gut 2008,57, 882–884. [CrossRef] [PubMed] 46. Dasgupta, Y.; Golovine, K.; Nieborowska-Skorska, M.; Luo, L.; Matlawska-Wasowska, K.; Mullighan, C.G.; Skorski, T. Drugging DNA repair to target T-ALL cells. Leuk. Lymphoma 2018,59, 1746–1749. [CrossRef] [PubMed] 47. Lee, J.; Lee, B.J.; Lee, Y.M.; Park, H.; Kim, J.H.; Kim, W.J. Self-Assembled Nanoconstructs Modified with Amplified Aptamers Inhibited Tumor Growth and Retinal Vascular Hyperpermeability via Vascular Endothelial Growth Factor Capturing. Mol. Pharm. 2017,14, 1460–1468. [CrossRef] 48. Grabauskas, G.; Wu, X.; Gao, J.; Li, J.-Y.; Turgeon, D.K.; Owyang, C. Prostaglandin E(2), Produced by Mast Cells in Colon Tissues From Patients With Irritable Bowel Syndrome, Contributes to Visceral Hypersensitivity in Mice. Gastroenterology 2020 ,158, 2195–2207.e6. [CrossRef] 49. Akbar, A.; Yiangou, Y.; Facer, P.; Walters, J.R.; Anand, P.; Ghosh, S. Increased capsaicin receptor TRPV1-expressing sensory fibres in irritable bowel syndrome and their correlation with abdominal pain. Gut 2008,57, 923–929. [CrossRef] 50. Perez-Burgos, A.; Wang, L.; Neufeld, K.-A.M.; Mao, Y.-K.; Ahmadzai, M.; Janssen, L.J.; Stanisz, A.M.; Bienenstock, J.; Kunze, W.A. The TRPV1 channel in rodents is a major target for antinociceptive effect of the probiotic Lactobacillus reuteri DSM 17938. J. Physiol. 2015,593, 3943–3957. [CrossRef] 51. Yang, C.Q.; Guo, X.-S.; Wei, Z.-B.; Zhao, L.; Zhao, G.-T.; Sheng, S.-T. Rifaximin Improves Visceral Hyperalgesia via TRPV1 by Modulating Intestinal Flora in the Water Avoidance Stressed Rat. Gastroenterol. Res. Pr. 2020,2020, 4078681. 52. Ribatti, D.; Vacca, A.; Dammacco, F. The role of the vascular phase in solid tumor growth: A historical review. Neoplasia 1999 ,1, 293–302. [CrossRef] [PubMed] 53. Chen, L.; Deng, H.; Cui, H.; Fang, J.; Zuo, Z.; Deng, J.; Li, Y.; Wang, X.; Zhao, L. Inflammatory responses and inflammationassociated diseases in organs. Oncotarget 2018,9, 7204–7218. [CrossRef] [PubMed] 54. Casado-Bedmar, M.; Keita, Å.V. Potential neuro-immune therapeutic targets in irritable bowel syndrome. Ther. Adv. Gastroenterol. 2020,13, 1756284820910630. [CrossRef] [PubMed] 55. Carabotti, M.; Scirocco, A.; Maselli, M.A.; Severi, C. The gut-brain axis: Interactions between enteric microbiota, central and enteric nervous systems. Ann. Gastroenterol. 2015,28, 203–209. [PubMed] 56. Bischoff, S.C.; Krämer, S. Human mast cells, bacteria, and intestinal immunity. Immunol. Rev. 2007,217, 329–337. [CrossRef] 57. O’Sullivan, M.; Clayton, N.; Breslin, N.P.; Harman, I.; Bountra, C.; McLaren, A.; O’morain, C.A. Increased mast cells in the irritable bowel syndrome. Neurogastroenterol. Motil. 2000,12, 449–457. [CrossRef] 58. Camilleri, M. Current and future pharmacological treatments for diarrhea-predominant irritable bowel syndrome. Expert Opin Pharm. 2013,14, 1151–1160. [CrossRef] 59. Klooker, T.K.; Braak, B.; Koopman, K.E.; Welting, O.; Wouters, M.M.; van der Heide, S.; Schemann, M.; Bischoff, S.C.; van den Wijingaard, E.M.; Boeckxstaerns, G.E. The mast cell stabiliser ketotifen decreases visceral hypersensitivity and improves intestinal symptoms in patients with irritable bowel syndrome. Gut 2010,59, 1213–1221. [CrossRef] 60. Buhner, S.; Li, Q.; Vignali, S.; Barbara, G.; De Giorgio, R.; Stanghellini, V.; Cremon, C.; Zeller, F.; Langer, R.; Daniel, H.; et al. Activation of human enteric neurons by supernatants of colonic biopsy specimens from patients with irritable bowel syndrome. Gastroenterology 2009,137, 1425–1434. [CrossRef] 61. Barbara, G.; Stanghellini, V.; De Giorgio, R.; Cremon, C.; Cottrell, G.S.; Santini, D.; Pasquinelli, G.; Morselli-Labate, A.M.; Grady, E.F.; Bunnett, N.W.; et al. Activated mast cells in proximity to colonic nerves correlate with abdominal pain in irritable bowel syndrome. Gastroenterology 2004,126, 693–702. [CrossRef] 62. Harata, G.; He, F.; Takahashi, K.; Hosono, A.; Miyazawa, K.; Yoda, K.; Hiramatsu, M.; Kaminogawa, S. Human Lactobacillus Strains from the Intestine can Suppress IgE-Mediated Degranulation of Rat Basophilic Leukaemia (RBL-2H3) Cells. Microorganisms 2016,4, 40. [CrossRef] [PubMed] 63. Forsythe, P.; Wang, B.; Khambati, I.; Kunze, W.A. Systemic effects of ingested Lactobacillus rhamnosus: Inhibition of mast cell membrane potassium (IKCa) current and degranulation. PLoS ONE 2012,7, e41234. [CrossRef] [PubMed] 64. Kawahara, T. Inhibitory effect of heat-killed Lactobacillus strain on immunoglobulin E-mediated degranulation and late-phase immune reactions of mouse bone marrow-derived mast cells. Anim. Sci. J. 2010,81, 714–721. [CrossRef] [PubMed] 65. Piche, T. Tight junctions and IBS–the link between epithelial permeability, low-grade inflammation, and symptom generation? Neurogastroenterol. Motil. 2014,26, 296–302. [CrossRef] [PubMed] 66. Zeng, H.; Umar, S.; Rust, B.; Lazarova, D.; Bordonario, M. Secondary Bile Acids and Short Chain Fatty Acids in the Colon: A Focus on Colonic Microbiome, Cell Proliferation, Inflammation, and Cancer. Int. J. Mol. Sci. 2019 ,20, 1214. [CrossRef] [PubMed] 67. Vancamelbeke, M.; Vermeire, S. The intestinal barrier: A fundamental role in health and disease. Expert Rev. Gastroenterol. Hepatol. 2017,11, 821–834. [CrossRef] 68. Chen, X.; Oshima, T.; Tomita, T.; Fukui, H.; Watari, J.; Matsumoto, T.; Miwa, H. Acidic bile salts modulate the squamous epithelial barrier function by modulating tight junction proteins. Am. J. Physiol. Gastrointest. Liver Physiol. 2011 ,301, G203–G209. [CrossRef] 69. Ghosh, S.; Whitley, C.S.; Haribabu, B.; Jala, V.R. Regulation of Intestinal Barrier Function by Microbial Metabolites. Cell Mol. Gastroenterol. Hepatol. 2021,11, 1463–1482. [CrossRef] Nutrients 2023,15, 24 19 of 19 70. Duan, R.; Zhu, S.; Wang, B.; Duan, L. Alterations of Gut Microbiota in Patients With Irritable Bowel Syndrome Based on 16S rRNA-Targeted Sequencing: A Systematic Review. Clin. Transl. Gastroenterol. 2019,10, e00012. [CrossRef] 71. Jeffery, I.B.; Das, A.; O ´ Herlihy, E.; Coughlan, S.; Cisek, K.; Moore, M.; Bradley, F.; Carty, T.; Pradhan, M.; Dwibedi, C.; et al. Differences in Fecal Microbiomes and Metabolomes of People With vs Without Irritable Bowel Syndrome and Bile Acid Malabsorption. Gastroenterology 2020,158, 1016–1028.e8. [CrossRef] 72. Tap, J.; Derrien, M.; Törnblom, H.; Brazeilles, R.; Cools-Portier, S.; Doré, J.; Störsrud, S.; Le Nevé, B.; Öhman, L.; Simrén, M. Identification of an Intestinal Microbiota Signature Associated With Severity of Irritable Bowel Syndrome. Gastroenterology 2017 , 152, 111–123.e8. [CrossRef] [PubMed] 73. Su, T.; Liu, R.; Lee, A.; Long, Y.; Du, L.; LAi, S.; Chen, X.; Wang, L.; Si, J.; Owyang, C.; et al. Altered Intestinal Microbiota with Increased Abundance of Prevotella Is Associated with High Risk of Diarrhea-Predominant Irritable Bowel Syndrome. Gastroenterol. Res. Pr. 2018,2018, 6961783. [CrossRef] [PubMed] 74. Kovatcheva-Datchary, P.; Nilsson, A.; Akrami, R.; Lee, Y.S.; De Vadder, F.; Arora, T.; Hallen, A.; Martens, E.; Björck, I.; Bäckhed, F. Dietary Fiber-Induced Improvement in Glucose Metabolism Is Associated with Increased Abundance of Prevotella. Cell Metab. 2015,22, 971–982. [CrossRef] [PubMed] 75. Staudacher, H.M.; Irving, P.M.; Lomer, M.C.E.; Whelan, K. Mechanisms and efficacy of dietary FODMAP restriction in IBS. Nat. Rev. Gastroenterol. Hepatol. 2014,11, 256–266. [CrossRef] [PubMed] 76. Chen, J.; Wright, K.; Davis, J.M.; Jeraldo, P.; Marietta, E.V.; Murray, J.; Nelson, H.; Matteson, E.L.; Taneja, V. An expansion of rare lineage intestinal microbes characterizes rheumatoid arthritis. Genome Med. 2016,8, 43. [CrossRef] [PubMed] 77. Menees, S.; Chey, W. The gut microbiome and irritable bowel syndrome. F1000Res 2018,7, 1029. [CrossRef] 78. Bailey, M.T.; Dowd, S.E.; Galley, J.D.; Hufnagle, A.R.; Allen, R.G.; Lyte, M. Exposure to a social stressor alters the structure of the intestinal microbiota: Implications for stressor-induced immunomodulation. Brain Behav. Immun. 2011,25, 397–407. [CrossRef] 79. Kuti, D.; Dowd, S.E.; Galley, J.D.; Hufnagle, A.R.; Allen, R.G.; Lyte, M. Gastrointestinal (non-systemic) antibiotic rifaximin differentially affects chronic stress-induced changes in colon microbiome and gut permeability without effect on behavior. Brain Behav. Immun. 2020,84, 218–228. [CrossRef] 80. Bercik, P. The microbiota-gut-brain axis: Learning from intestinal bacteria? Gut 2011,60, 288–289. [CrossRef] 81. Smith, K.B.; Murray, E.; Gregory, J.G.; Liang, J.; Ismail, N. Pubertal probiotics mitigate lipopolysaccharide-induced programming of the hypothalamic-pituitary-adrenal axis in male mice only. Brain Res. Bull. 2021,177, 111–118. [CrossRef] Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.