scieee AI-readable full text Open interactive document viewer

Isolation of Methane Enriched Bacterial Communities and Application as Wheat Biofertilizer under Drought Conditions: An Environmental Contribution

Barros Rodríguez, Adoración,García Gálvez, Carlos,Pacheco, Pamela,Kalyuzhnaya, Marina G.,Manzanera Ruiz, Maximino Enrique

Abstract

Spanish Ministry for Economy and Competitiveness within the context of the research project and the program Salvador de Madariaga grant number PID2021-127623OB-I00)

Full text

Citation: Barros-Rodríguez, A.; García-Gálvez, C.; Pacheco, P.; Kalyuzhnaya, M.G.; Manzanera, M. Isolation of Methane Enriched Bacterial Communities and Application as Wheat Biofertilizer under Drought Conditions: An Environmental Contribution. Plants 2023,12, 2487. https://doi.org/ 10.3390/plants12132487 Academic Editors: Loretta Pace and Rihab Djebaili Received: 9 May 2023 Revised: 23 June 2023 Accepted: 27 June 2023 Published: 29 June 2023 Copyright: © 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https:// creativecommons.org/licenses/by/ 4.0/). plants Article Isolation of Methane Enriched Bacterial Communities and Application as Wheat Biofertilizer under Drought Conditions: An Environmental Contribution Adoración Barros-Rodríguez 1,2, Carlos García-Gálvez 1,2, Pamela Pacheco 1, Marina G. Kalyuzhnaya 3 and Maximino Manzanera 1,* 1 Institute for Water Research and Department of Microbiology, University of Granada, 18071 Granada, Spain; [email protected] (P.P.) 2VitaNtech Biotechnology S.L., 18008 Granada, Spain 3Biology Department, San Diego State University, San Diego, CA 92182-4614, USA *Correspondence: [email protected]; Tel.: +34-958-248324; Fax: +34-958-243094 Abstract: The search for methanotrophs as plant-growth-promoting rhizobacteria (PGPR) presents an important contribution to mitigating the impact of global warming by restoring the natural soil potential for consuming methane while benefiting plants during droughts. Our in silico simulations suggest that water, produced as a byproduct of methane oxidation, can satisfy the cell growth requirement. In addition to water, methanotrophs can produce metabolites that stimulate plant growth. Considering this, we proposed that applying methanotrophs as PGPR can alleviate the effect of droughts on crops, while stimulating atmospheric methane consumption. In this work, we isolated a series of methanotrophic communities from the rhizospheres of different crops, including Italian sweet pepper and zucchini, using an atmosphere enriched with pure methane gas, to determine their potential for alleviating drought stress in wheat plants. Subsequently, 23 strains of nonmethanotrophic bacteria present in the methanotrophic communities were isolated and characterized. We then analyzed the contribution of the methane-consuming consortia to the improvement of plant growth under drought conditions, showing that some communities contributed to increases in the wheat plants’ lengths and weights, with statistically significant differences according to ANOVA models. Furthermore, we found that the presence of methane gas can further stimulate the plant–microbe interactions, resulting in larger plants and higher drought tolerance. Keywords: greenhouse gases; methanotrophic communities; PGPR; Triticum aestivum; water stress; biostimulants 1. Introduction Climate change is linked to the rise of average global temperatures, which is driven by anthropogenic greenhouse gases (GHG). The consequences of climate change include dramatic changes in rainfall, floods, and droughts, along with many other costs to human life [ 1 ]. While carbon dioxide (CO 2 ) receives the most attention as a global warming factor, there are other gases to consider, including methane (CH 4 ), nitrous oxide (N 2 O), and black carbon [ 2 ]. The notable and increasing role of current and future emissions of methane in global warming has recently been recognized, as methane is the cause of at least one-fourth of the current gross warming [ 3 ]. Atmospheric concentrations of methane are rising rapidly, principally due to anthropogenic contributions, with wastewater treatment facilities, landfills, and livestock considered to be the key producers. The removal of atmospheric methane is needed to offset the steady release of methane, thereby limiting the contribution of this potent greenhouse gas to climate change [ 3 ]. Methane sinks occur due to chemical reactions in the atmosphere, as well as those in soils, via the action of methane-oxidizing microorganisms (also known as methanotrophs). This recognition has Plants 2023,12, 2487. https://doi.org/10.3390/plants12132487 https://www.mdpi.com/journal/plants Plants 2023,12, 2487 2 of 19 resulted in the advancement of cutting-edge developments and schemes to reduce the release of methane from most major contributors to emissions [4]. Implementing the natural potential of methanotrophs to offset methane emissions is of interest. Still, only minor advances have been made thus far, mostly due to relatively low levels of CH 4 in the atmosphere. The reduction of atmospheric methane via engineered systems has been demonstrated, but the solutions are often energy-intensive or require higher methane inputs [ 5 ]. Enhancing the methanotrophic microbiomes in agricultural soils is one of the most promising solutions due to the scale of operation. Numerous studies suggest that manipulating farming practices to preserve methane sinks is possible; however, a better understanding of the interactions between methanotrophic bacteria and crops in arid environments, as well as the potential of methanotrophic bacteria as biofertilizers, is urgently needed. In this respect, reports have noted that some biofertilizers or plant-growth-promoting rhizobacteria (PGPR) have the ability to oxidize single-carbon compounds, especially methanol. More specifically, a strain of the newly described Methylobacterium symbioticum species, SB0023/3 T , has been described as a PGPR associated with spores of the arbuscular mycorrhizal fungi (AMF) Glomus iranicum var. tenuihypharum [ 6 ]. Other species of the Methylobacterium genus, such as Methylobacterium oryzae,Methylobacterium komagatae, or Methylobacterium fujisawaense, have been described as PGPR for canola plants (Brassica campestris) and crambe (Crambe abyssinica), respectively, due to their ability to produce 1-aminocyclopropane-1-carboxylate (ACC) deaminase [ 7 – 9 ]. A recent review has been published on the use of PGPR to protect plants from drought by Shaffique and coworkers [ 10 ], and another article discussed the way that microorganisms deal with water stress [ 11 ], providing more details in this respect. In general, the production of microbial biofertilizers is limited by the cost of the required nutrient media to produce a large number of microbial cells [ 12 , 13 ]. Using methane as the carbon and energy source for the production of biofertilizers would result in the valorization of a residue, as well as in the reduction of the required nutrient media. In addition, once the biofertilizer is used in the field, atmospheric methane would be transformed into CO 2 . We hypothesize that the stimulation of plant growth will coincide with an additional capture of CO 2 produced during methane oxidation by the plants’ photosynthetic machinery, thereby reducing the production of the two most potent GHGs via the two mechanisms. By reducing theses GHGs, we could theoretically reduce the impacts of droughts, as these climate alterations can result in the reduction of wheat (Triticum aestivum L.) production by up to 20.6%, and this cereal is one of the most important sources of energy and nutrition for nearly 4.5 billion people [14]. In this paper, we explore the potential of methanotrophic bacteria as biofertilizers to improve the soil–water balance and plant growth during droughts. Here, we report on the isolation of methane-consuming microbial communities with the ability to promote wheat growth and reduce water stress in this crop under a drought stress context. 2. Materials and Methods 2.1. Metabolic Water Output Simulations Metabolic water output simulations were carried out using previously constructed metabolic models of methanotrophic bacteria [ 15 ]. To estimate the water content of the cell biomass, a set of cultivation experiments with three methanotrophic cultures— Methylotuvimicrobium alcaliphilum strain 20Z R ,Methylococcus capsulatus Bath, and Methylocystis sp. SVC1—were carried out. Strains were grown in nitrate mineral media [ 15 ]. M. alcaliphilum 20Z R cells were cultivated with 3% and 6% NaCl to test cell-bound water at different salinities, serving as a proxy of water availability. All cultivation experiments were performed in triplicate; methane (as 20% methane headspace) was used as the carbon source. Cell cultures (1 L each) were harvested at OD = 1 by centrifugation at 4130 × g. After centrifugation, media residues were removed, and cell biomass was weighed to obtain the wet cell weight (WCW). Cells were then frozen in liquid nitrogen and lyophilized using a Plants 2023,12, 2487 3 of 19 Labconco freeze drying system. Cell samples were weighed again to obtain the dry cell weight (DCW). 2.2. Soil Samples Soil samples of rhizospheric and nonrhizospheric soil (beige to brown clay loam; moderate, medium granular structure) were taken from various agricultural fields of Italian sweet peppers (Capsicum annuum) and zucchini (Cucurbita pepo) when fruits were ripe. In addition, a sample of soil free of plants was used as well (non-plant soil). Samples were collected from a rainfed area subject to seasonal drought at Las Gabias, Granada, Spain (37 ◦ 10 0 55 00 N, 3 ◦ 41 0 20 00 W). The soil samples were collected in plastic bags, homogenized, and sieved (using a 2 mm mesh). Then, 1 g of soil sample was immediately added to 50 mL of sterile saline solution, and resulting suspensions were serially diluted as described in Section 3.2. 2.3. Enrichment of Methanotrophs from Soil Samples To identify the methanotrophic communities that proliferate under water scarcity, different soil samples were taken from a semiarid soil. Then, 1 g of each type of soil was taken and placed individually in a separate 250 mL flask containing 50 mL of sterile MSM consisting of 1 g KNO 3 ; 0.2 MgSO 4· 7H 2 O; 0.02 g CaCl 2· 2H 2 O; 0.27 g KH 2 PO 4 ; 0.28 g Na 2 HPO 4 ; 0.01 g Na 2 EDTA; 4 mg FeSO 4· 7H 2 O; 0.6 mg ZnSO 4· 7H 2 O; 0.06 mg MnCl 2· 4H 2 O; 0.4 mg CoCl 2· 6H 2 O; 2.4 mg CuSO 4· 5H 2 O; 0.1 mg NiCl 2· 6H 2 O; 0.1 mg Na 2 MoO 4· 2H 2 O; and 0.06 mg H 3 BO 3 [ 16 ] at a pH of 6.4 per 1 L. Each bottle was supplied with 50 mL of methane gas (99.9%; Air Liquide) to represent a 20% headspace [ 17 ]. Flasks were incubated at 30 ◦ C with shaking at 180 rpm (Infors HT Multitron). Thereafter, 2.5 mL was taken from each flask and transferred into another 250 mL flask with 50 mL of fresh sterile MSM. Again, 50 mL of sterile methane gas was supplied to each flask, incubated at 30 ◦ C, and shaken at 180 rpm for an additional week. This procedure was repeated up to a total of five times; in the last two passes, only 250 µ L was transferred to 50 mL of fresh media. At dilution 4 and dilution 5, these split samples were designated as 1 and 2 thereafter. Therefore, the samples included the rhizospheric soil from pepper plants (RP1 and RP2), from zucchini plants (RC1 and RC2), as well as the nonrhizospheric soil close to pepper plants (SP1 and SP2) and zucchini plants (SC1 and SC2). In addition, a sample of soil free from plants was taken and labeled as “no-plant soil” (S1 and S2). A total of 2 weeks after the last dilution, 1 mL of the culture was used for DNA extraction and microbial diversity determination, 1 mL of culture was serially diluted and plated in MSM for the isolation of methanotrophs, and the rest was used for plant inoculation. Absorbance (600 nm) measurements were collected at time point 0 and after every subsequent 12–24 h period using a Shimadzu UV-160A spectrophotometer (Shimadzu, Kyoto, Japan). For the selection of heterotrophs, trypticase soy agar (TSA) plates were used for the seeding of colonies isolated from serial dilutions of the methane-enriched cultures [18]. 2.4. Plant-Growth Condition and Bacterial Inoculation The surfaces of the wheat seeds (Triticum aestivum) were sterilized for 3 min with 5% commercial bleach (v/v) and were washed 3 times with sterile double-distilled water (H 2 Odd) for 2 h. A total of 20 seeds were placed in 0.5-L, air-tight, sealed pots that previously had been filled with 18 g of vermiculite. Pots were watered using 18 mL of water at time 0; then, the pots were sealed, and no additional water was supplied, apart from that corresponding to the inoculum. For the inoculation with the different communities, seeds were sown in the air-tight, sealed pots (VitaNtech Biotechnology, Granada, Spain) and treated with 12 mL of the liquid inoculant (consisting of a bacterial suspension from the enriched cultured on M9 buffer at an absorbance of 1 600nm ) 1 day after being sown, which represented a concentration between 1 · 10 6 and 1 · 10 8 of colony-forming units (CFU). Just after inoculation, the air-tight pots were sealed, and pure methane gas was Plants 2023,12, 2487 4 of 19 supplemented (20% of the bottle headspace). The time was recorded as time 0 of the assay, and no additional water was supplied during the experiment. Seeds were incubated for 12 days under the following controlled conditions: a temperature of 20 ◦ C and diurnal cycles of illumination consisting of 8 h with a power of 66 Watts/cm·s2. 2.5. Seed Inoculation and Plant Sampling This experiment was designed to test the growth-promoting ability of the different methane-enriched communities on wheat seedlings. Wheat seeds were surface-sterilized as previously described [ 19 ] and were sown in air-tight, sealed pots. The following treatments were prepared: (1) for the control (non-inoculated), 3 mL 0.5 × M9 buffer was added; (2) the RP community, derived from the rhizospheric soil from pepper plants; (3) the SP community, derived from the nonrhizospheric soil of pepper plants; (4) the SC community, derived from nonrhizospheric soil of zucchini plants; and (5) bulk soil, taken in the absence of any plants. The RC community, derived from the rhizospheric soil from zucchini plants, did not reach a significant level of absorbance; therefore, it was eliminated from further analysis. Each bacterial community was suspended to obtain 12 mL at an absorbance of 1 (660 nm) in 0.5 × M9 buffer, which was then added to each pot. No additional water was added to the wheat seedlings until the end of the experiment. Pots were opened on day 6 of the assay to gather three seedling samples, with the aim of measuring the following parameters: shoot length, root length, fresh weight, and dry weight. The same experiment was conducted on day 12, with the aim of measuring the same parameters for the remaining samples [20]. 2.6. Extraction of Nucleic Acids, and Next-Generation Sequencing Nucleic acid extraction (gDNA) was performed using a FastDNA SPIN Kit for Soil (MP Biomedicals, Solon, OH, USA) and a FastPrep centrifuge. The deoxyribonucleic acid (DNA) of each biological sample was extracted in duplicate and then merged into a DNA pool, which was kept at −20 ◦C. Library preparation and Illumina sequencing were carried out at the IPBLN Genomics Facility (CSIC, Granada, Spain). Amplicon libraries targeting the 16S rRNA gene were generated by a two-step PCR strategy. Gene-specific amplification was performed in triplicate, with 15 ng of gDNA in a final volume of 10 µ L. Gene-specific primers, Pro341F (5 0 CCTACGGGNBGCASCAG3 0 ) and Pro805R (5 0 GACTACNVGGGTATCTAATCC3 0 ), were designed with Nextera overhang adapters [ 21 ]. Primers were used at a final concentration of 0.2 µ M. The reaction was performed using 1 × KAPA HiFi HotStart ReadyMix DNA polymerase (Roche Diagnostics, West Sussex, UK). Cycling conditions were 95 ◦ C for 3 min, 25 PCR cycles, 95 ◦ C for 30 s, 55 ◦ C for 30 s, 72 ◦ C for 30 s, and then 72 ◦ C for 5 min. Triplicates were pooled together and validated through visualization on 1.8% (w/v) agarose gel. Amplicons were then purified using NucleoMag ® NGS Clean-up and Size Select Kit (Macherey-Nagel, Düren, Germany). A second PCR step attached dual combinatorial indices and Illumina sequencing adapters using the Nextera XT v2 index kit. Cycling conditions were 95 ◦ C for 3 min, 8 PCR cycles, 95 ◦ C for 30 s, 55 ◦ C for 30 s, 72 ◦ C for 30 s, and then 72 ◦ C for 5 min. Amplicon generation was validated again through visualization on 1.8% (w/v) agarose gel and cleaned with NucleoMag ® NGS Clean-up and Size Select Kit (Macherey-Nagel). Concentrations were measured on the Qubit ® fluorometer (Thermo). Amplicons were pooled in an equimolecular manner, and the final library mix was run on a Bioanalyzer HS DNA chip to verify quality and size distribution. The library pool was then diluted and denatured, as recommended by the Illumina MiSeq library preparation guide. The 300 ×2 nt paired-end sequencing was conducted on a MiSeq sequencer. 2.7. Next-Generation Sequencing Postprocess The raw sequencing data were analyzed using mothur v1.39 software [ 22 ]. First, the paired-end reads were merged into contigs and underwent quality trimming based on the avoidance of the generation of any ambiguous bases in the overlap region arising from Plants 2023,12, 2487 5 of 19 differences in overlapping [ 23 ]. Contigs with more than 8 bp homopolymers and any ambiguous bases were removed. The remaining contigs were aligned against the full SiLVA SEED v128 database and were calculated by the k-nearest neighbor method with a k-mer size of 8, using the Needleman criterion. Sequences that failed in the alignment of the forward and reverse primer positions were removed. Then, chimerical sequences were identified using the VSEARCH algorithm implemented in mothur [ 24 ]. The non-chimerical sequences were taxonomically classified against the MiDAS database [ 25 ] and were used to construct operational taxonomic units (OTUs) through the abundance-based greedy clustering algorithm [ 26 ] using a cut-off of 97% for Prokarya. Finally, singleton OTUs were deemed to be failures and were removed. 2.8. Plant-Growth-Promoting Traits 2.8.1. Phosphate Solubilization Assay To find out if the strain could solubilize phosphate, SMRS 1 medium was used [ 27 ]. It contained a pH indicator that changes from purple to yellow due to medium acidification. The halo’s diameter and the brightness’s intensity indicate the phosphate-solubilizing potential of the strain used. For this test, a colony of each strain was suspended in 1 mL of 1 × M9 buffer; then, 20 µ L was seeded into SMRS 1 plates. The diameters of the solubilization halos were measured after 24 h of incubation in an oven at 30 ◦ C. SMRS 1 medium was composed of: 0.5 g (NH 4 ) 2 SO 4 ; 0.2g KCl; 0.2648g MgSO 4 ; 0.004 g MnSO 4· H 2 O; 0.0004 FeSO 4· 7H 2 O; 0.2g NaCl; 10 g glucose; 0.5 yeast extract; 0.1 g bromocresol purple; 5 g Ca 3 (PO 4 ) 2 ; 18 g Bacto Agar; and distilled H 2 O up to 1 L. To prepare this medium, all of the components except the Bacto Agar and Ca 3 (PO 4 ) 2 were added, and the pH was adjusted to 7.2 with 1 N NaOH. Both the agar and the mixture were autoclaved at 120 ◦ C for 30 min at 1 atmosphere of pressure. Finally, after cooling, the Ca 3 (PO 4 ) 2 , which had been previously incubated for 16 h in the oven (Memmert, Germany) at 50 ◦C, was added. 2.8.2. Plant Hormone Production The production of indole-3-acetic acid (IAA) was tested using an Acquity Class I ultrahigh-pressure liquid chromatograph (UPLC) (Waters, The Netherlands) coupled to a mass spectrometer with a Xevo TQ-XS triple quadrupole analyzer (Waters, The Netherlands). For this assay, the strains were inoculated in SG medium supplemented with 50 mg/L L-tryptophan, as previously described [28]. 2.8.3. PCR for mxaF, pmoA, nifH, nirK, and gst Genes For the PCR, the first total DNA sample was extracted from both communities and individual colonies using the DNeasy ® Blood and Tissue Kit (Qiagen, Venlo, The Netherlands ), following the manufacturer’s instructions. The quantification of the extracted DNA was performed using a NanoDrop 2000 (Thermo Scientific, Wilmington, CA, USA). For the PCR, 30–80 ng template DNA, 1 × buffer (Sigma Aldrich, St. Louis, MO, USA), 60 pmol of each primer, 0.625 U Horse-Power DNA Taq Polymerase (Canvax, Córdoba, Spain), 200 µ M deoxynucleotide triphosphates (dNTPs) (Kapa biosystems, France), 2 mM MgCl 2 (Sigma Aldrich, St. Louis, MO, USA), 0.625 µ g bovine serum albumin (BSA) (New England BioLabs, Beverly, MA, USA), and 0.125 µ L DMSO (Sigma Aldrich, St. Louis, MO, USA) were used. The total volume of the reaction was completed with milli-Q water up to 25 µ L. The program used consisted of an initial polymerase activation phase of 4 min at 95 ◦ C, followed by 25 cycles composed of a denaturation phase of 15 s at 95 ◦ C, another one for hybridization for 30 s at a temperature according to each pair of primers (see Table 1), and one for elongation for 45 s at 72 ◦ C. This was followed by a final extension at 72 ◦ C for 7 min using an Eppendorf Mastercycler Pro S vapo thermocycler (Eppendorf, Hamburg, Germany). Primer sequences are shown in Table 1. Plants 2023,12, 2487 6 of 19 Table 1. Primers used for the amplification of mxaF, pmoA, nifH, and nirK genes in this study. Primers Sequence 50→30Target Gene Hybridization Temperature Reference F1003 GCGGCACCAACTGGGGCTGGT mxaF60 ◦C[29] R1561 GGGAGCCCTCCATGCTGCCC A189gc GGNGACTGGGACTTCTGG pmoA55 ◦C[30] mb661 TGCGAYCCSAARGCBGACTC polF TGCGAYCCSAARGCBGACTC nifH55 ◦C[31] polR ATSGCCATCATYTCRCCGGA Nirk-F-Brady 96 GACGAGAAGGGCAATTTC nirK 58 ◦C[32] Nirk-R-Brady 96 ACTTGCCTTCGACCTTGAA Gst_f CTGGAAGGCCAAGACCAAC gst 56 ◦C[32] Gst_r ACCAGATCTTGACCGAGG 2.9. Statistical Analysis To elucidate whether there were significant differences between treatments, statistical analysis was performed using RStudio i386, v4.0.3 software (PBC, Boston, MA (USA), 2011). First, a 95% confidence interval was applied, and the ANOVA model for the analysis of variance was obtained. Post hoc analysis was then carried out using Tukey’s HSD procedure to compare the means, two by two, thus making all possible comparisons exhaustively. The null hypothesis of equality of means was rejected when the p-value obtained was less than 0.05, assuming the difference to be statistically significant. Subsequently, the Bonferroni outlier test was used to check whether any of the data deviated too much from the normal distribution. If so, they were removed from the study. 3. Results 3.1. CH4-Derived Metabolic Water Output Since methane oxidation leads to water production as a byproduct (i.e., CH 4 + O 2 = [CH 2 O] + H 2 O), it was speculated that methane-consuming microbes produce water intracellularly and are capable of surviving with a limited external water supply. The possibility of metabolic water to fulfill cell requirements for growth was evaluated using the flux balance model, with water integrated as one of the objective functions. Different levels of water content in the cell biomass were considered (g/g, H 2 O:DCW): 4:1, 3:1, 2:1, and 1:1. The summary of in silico and experimental data is presented in Table 2. The FBA simulation indicates that cells with a water content < 65% will release water into the environment. To further investigate the possibility of water release, we examined the water content of three strains of methanotrophic bacteria representing Type I (M. capsulatus Bath and M. alcaliphilum 20Z R ) and Type II (Methylocystis sp. SVC1) methanotrophs. The water contents of the cells depended on the strain and were 74.7 +/ − 2.2 for Bath, 77.4 +/ − 1.9 for SVC1, and 69.5 +/ − 10.17 for 20Z R cells. However, in the 20Z R cells grown at high salinity (6% NaCl), the water content dropped to 63 +/ − 1.3%. The initial data suggest that methanotrophic bacteria have the potential to fulfill most of their water requirements using methane. Thus, methane can be considered a critical but underexplored nutrient resource, especially in (semi-)arid ecosystems. Plants 2023,12, 2487 7 of 19 Table 2. In silico prediction of water output in a methanotrophic organism grown with methane as the sole source of carbon and energy. Water Content (%) H2O:DCW (g/g) Ex_H2O_e Flux # 80% 4:1 −20.71 75% 3:1 −10.98 67% 2:1 −1.24 50% 1:1 8.49 # Ex_H 2 O_e represents water exchange as µ mol per h −1 per g cells Negative flux indicates input from the environment, and positive flux indicates secretion. The FBA analyses predict that cells will produce and secrete water if the cellular water content is below 65%. 3.2. Enrichment Studies Soil samples were added to MSM media, and serial dilutions were performed, as described in Section 2.3. Despite the theoretical 10 −9 dilution generated, nearly 25 different colonies were isolated in the MSM agar plates (MSMA) and then streaked onto TSA to determine whether nonmethanotrophs were associated with methanotrophic colonies. To double check for the inability of the latest isolates to grow on methane as their sole carbon source, they were inoculated into the MSM media. Therefore, the different isolates identified in TSA seemed to be associated with growth in methane-enriched media, although they themselves were unable to grow on MSM using methane as a sole carbon source. 3.3. Taxonomical Characterization of Methane-Enriched Bacteria In order to characterize the microbial diversity of the different cultures after incubation in a methane-enriched atmosphere, DNA samples obtained from each culture were used to amplify the 16S rRNA, and Illumina technology was used for metagenomic analysis. The DNA concentrations ranged from 15.0 ng/ µ L for the RP1 sample to 173 ng/ µ L for the SC2 sample. An average DNA concentration of 3.11 ng/µL was used for amplification. Prokaryotic community structures retrieved from the different soil samples were determined by Illumina sequencing of the partial 16S rRNA gene. There were 178,409.71 raw sequences. After filtering, chimera analysis, and misaligned sequence filtering, there were 69,785 sequences. The average length of retained sequences was 374 ± 5 base pair (mean ± SD). The clustering of the sequences into OTUs resulted in 2775 different OTUs. Finally, the elimination of singletons led to 1269 OTUs. As a result, based on this analysis, we identified that the cultures termed as S1, S2, SC1, SC2, SP1, SP2, RP1, and RP2 consisted predominantly of species associated with the Methylocystaceae and Methylophilaceae families in all cases, with representation between 38.9% for the RP2 and 65.58%, with the exception of the sample SC2, where 29.14% of the OTUs accounted for strains associated with the oxidation of methane (see Figure 1and Table 3). In addition to the methanotrophic and methylotrophic traits identified, the enrichment cultures also produced sequences (>2%) that can be affiliated with Chitinophagaceae, Comamonadaceae,Cytophagaceae, and Rhizobiaceae families, or with the genera Mesorhizobium, Pseudoxanthomonas,Flavobacterium,Brevudimonas,Terrimonas,Bosea,Acidovorax,Bradyrhizobium,Ferrovibrio,Opitutus, and Ferruginibacter. 3.4. Plant-Growth-Promotion of the Methane-Enriched Communities To determine whether the methane-enriched communities were useful for the promotion of plant growth, 12 mL from each community (at an absorbance of 1) was added to 18 g vermiculite containing 20 seeds of wheat (Triticum aestivum) and 34 mL of deionized water dispensed into 1 L, air-tight, sealed pots in triplicate. Methane gas was supplemented (20% of the headspace) every time that the bottles were opened for plant measures, and the growth of these plants was measured at 6 and 12 days after germination. The fresh and dry weights were measured. In addition, the lengths of the shoots and roots were registered. The addition of the RP1 and RP2 communities showed the highest values of root and shoot Plants 2023,12, 2487 8 of 19 lengths, with statistical differences (p< 0.005) with the sample supplemented only with fresh MSM solution (in the absence of microorganisms). In contrast, samples from the S1 community showed reduced shoot and root lengths (p< 0.005) (see Figure 1). As the RP1 community included the largest plants (the best results in terms of plant length and plant biomass), a test was included to compare the effect of methane using a bottle containing the same conditions but not supplemented with methane. In this latest case, although plants inoculated with RP1 without methane were larger than the control in the absence of microorganisms, they were comparatively smaller than the same sample in the presence of methane. Plants 2023, 11, x FOR PEER REVIEW 8 of 20 Mesorhizobium, Pseudoxanthomonas, Flavobacterium, Brevudimonas, Terrimonas, Bosea, Acidovorax, Bradyrhizobium, Ferrovibrio, Opitutus, and Ferruginibacter. Figure 1. Family-level NGS analysis results from microbial diversity in different methane-enriched communities. Cultures termed as S1 and S2 corresponded to bulk soil, taken in the absence of any plants; SC1 and SC2 were derived from nonrhizospheric soil of zucchini plants; SP1 and SP2 corresponded to those derived from the nonrhizospheric soil of pepper plants; and RP1 and RP2 corresponded to the community, derived from the rhizospheric soil from pepper plants. Samples were designated as 1 and 2 for dilution 4 and dilution 5, respectively. Table 3. Relative abundance of taxa in the different samples. Sample Relative Abundance (%) Taxonomy (Genus) Confidence (%) S1 47.3 14.7 5.65 4.61 4.37 2.77 2.62 2.10 1.80 Methylophilaceae_ unclassified Methylophilaceae_ unclassified Chitinophagaceae_ unclassified Terrimonas Uncultured Fam. Chitinophagaceae Methylobacter Mesorhizobium Cytophagaceae Flavobacterium 92 100 100 99 100 62 97 100 100 Figure 1. Family-level NGS analysis results from microbial diversity in different methaneenriched communities. Cultures termed as S1 and S2 corresponded to bulk soil, taken in the absence of any plants; SC1 and SC2 were derived from nonrhizospheric soil of zucchini plants; SP1 and SP2 corresponded to those derived from the nonrhizospheric soil of pepper plants; and RP1 and RP2 corresponded to the community, derived from the rhizospheric soil from pepper plants. Samples were designated as 1 and 2 for dilution 4 and dilution 5, respectively. Plants 2023,12, 2487 9 of 19 Table 3. Relative abundance of taxa in the different samples. Sample Relative Abundance (%) Taxonomy (Genus) Confidence (%) S1 47.3 14.7 5.65 4.61 4.37 2.77 2.62 2.10 1.80 1.62 1.46 1.40 1.26 1.12 0.9 Methylophilaceae_ unclassified Methylophilaceae_ unclassified Chitinophagaceae_ unclassified Terrimonas Uncultured Fam. Chitinophagaceae Methylobacter Mesorhizobium Cytophagaceae Flavobacterium Rhizobiaceae_ unclassified Pseudomonas Bradyrhyzobium Devosia Mesorhizobium Comamonadaceae_ unclassified 92 100 100 99 100 62 97 100 100 52 100 66 100 75 100 S2 47.7 16.8 6.53 5.53 4.23 2.71 2 1.90 1.29 1.14 1.08 1.07 0.96 Methylophilaceae_ unclassified Methylophilaceae_ unclassified Terrimonas Uncultured Fam. Chitinophagaceae Comamonadaceae_ unclassified Cytophagaceae Rhrizobiaceae_ unclassified Pseudoxanthomonas Dyadobacter Mesorhizobium Methylobacter Pseudoxantomonas Mesorhizobium 92 100 99 100 100 100 52 100 100 97 62 100 75 SC1 40.1 11.2 7.7 7.2 5.3 5.01 4.74 2.12 2.09 1.54 1.53 1.09 0.9 Methylobacter Bacteria_ unclassified Uncultured Fam. Chitinophagaceae Terrimonas Flavobacterium Methylophilus Brevundimonas Pseudoxantomonas Mesorhizobium Flavobacterium Methylophilaceae_ unclassified Caulobacter Terrimonas 62 97 100 99 100 100 100 100 75 100 92 76 97 Plants 2023,12, 2487 16 of 19 stimulate the growth and activity of methanotrophs via the production of additives, such as cobalamin [40]. The identification of PGPR traits, such as phosphate solubilization, IAA production, or the presence of genes involved in gst production in the nonmethanotrophs isolates, points to a direct or indirect role of these microorganisms in the promotion of wheat plant growth. However, the increased growth of the wheat plants with the RP1 community when methane is supplied indicates that the methanotrophs provide essential but yet-to-be established resources that support plants. Several interactions can be predicted. Methane oxidation results in CO 2 , which wheat plants then consume. The genome-scale flux balance simulations suggest that methanotrophic bacteria can fulfill their growth requirements using just methane as an energy, carbon, and water source. Thus, the methanotrophic microbiomes do not compete with plants for critical resources. A number of additional interactions can be predicted. It has been well-described that terrestrial plants release methanol through their root systems and that this metabolite can be consumed by methanotrophs [ 41 – 43 ], which in return, produce beneficial metabolites for the plant, including plant hormones for the improved development of the plant, such as auxins [ 44 ], zeatin [ 45 ], or cytokinins [ 46 ]. Some microorganisms, such as pink-pigmented facultative methylotrophs (PPFMs), have been noted for their ability to protect plants from abiotic stresses such as heat and cold [ 47 , 48 ] by inducing a systemic resistance to counterbalance the stresses and, in addition, to increase photosynthetic activity in crops [ 49 ]. Nevertheless, CO 2 promotes the metabolisms of γ-proteobacterial methanotrophs via the Calvin cycle [50,51]. Cultivating methanotrophs using polluting emissions from different industries could potentially reduce the concentration of methane released into the atmosphere. However, the presence of other gases that accompany the methane in these emissions, such as carbon dioxide (CO 2 ), nitrous oxide (N 2 O), fluorinated gases, including HFCs, PFC, SF6, hydrogen sulfide, etc., could have a counterproductive effect on the growth of these microorganisms, preventing their development [ 52 ]. Therefore, it is necessary to propose a study similar to the one depicted here, but one which uses the mixture of gases that are emitted by the most polluting industries for the microbial enrichment of the community. The presence of other accompanying gases may affect the resulting community composition and metabolic reactions. Therefore, additional studies with real gas mixtures are needed in addition to this one. Obtaining such communities would reduce the emission of pollutant gases by using them as a source of nutrients. In addition, the selection of plant-biostimulant methanotrophs would permit the development of plant cover that harbors methane-oxidizing communities in its root system to mitigate the methane and CO 2 emissions from especially polluting industries, such as rice fields and landfills [53–55]. 5. Conclusions The enrichment of microorganisms in a medium with methane as the only carbon source can give rise to communities with the capacity to promote the growth of wheat. This stimulation may come from the presence of microorganisms with PGPR activity present in these enrichments that, without having the capacity to oxidize methane, do enhance it, promoting activity in the presence of methane. On the other hand, the presence of methane and its metabolism by methanotrophs seems to result in a higher degree of moisture in the vermiculite used as a substrate for plant growth. The growth of microbial communities in environments rich in methane can result in the stimulation of plant growth, with this being greater in the presence of methane, allowing for the valorization of this gas with a potent greenhouse effect. However, these microbial communities may sometimes play a counterproductive role in the growth of wheat, which is why a prior study of the community and its interaction with the plant is necessary before its use in the field. Overall, the present study uncovered the highly positive impacts of methanotrophic bacteria on plants. Uncovering the mechanisms behind those interactions is critical for understanding the functioning of natural systems, obtaining feedback on GHG emissions, and discovering novel pathways for accelerating the adaptation of crops to climate change. Plants 2023,12, 2487 17 of 19 Supplementary Materials: The following supporting information can be downloaded at: https:// www.mdpi.com/article/10.3390/plants12132487/s1, Figure S1: Amplification of pmoA gene from nonmethanotrophic isolate DNA by PCR.; Figure S2: Amplification of mxaF gene from nonmethanotrophic isolate DNA by PCR.; Figure S3: Amplification of communities of methanotrophs’ and associated microorganisms’ DNA by PCR using specific oligonucleotides for pmoA (A) and mxaF (B) genes. Author Contributions: Conceptualization, M.M. and M.G.K.; methodology, M.M., M.G.K., C.G.-G., A.B.-R. and P.P.; formal analysis, M.M., M.G.K., C.G.-G. and A.B.-R.; investigation, A.B.-R., M.G.K., C.G.-G. and P.P.; data curation, A.B.-R. and C.G.-G.; writing—original draft preparation, M.M., M.G.K., C.G.-G. and A.B.-R.; writing—review and editing, M.M. and A.B.-R.; supervision, M.M.; project administration, M.M.; funding acquisition, M.M. and M.G.K. All authors have read and agreed to the published version of the manuscript. Funding: This research was funded by the Spanish Ministry for Economy and Competitiveness within the context of the research project and the program Salvador de Madariaga grant number PID2021-127623OB-I00), by FEDER funds, and by the Fondo Social Europeo, through grants from the Junta de Andalucía (grant P18-RT-976). Kalyuzhnaya’s laboratory was supported by DOE DE-SC0019181. Institutional Review Board Statement: Not applicable. Informed Consent Statement: Not applicable. Data Availability Statement: MDPI Research Data Policies. Acknowledgments: Work in Manzanera’s laboratory was funded by the Spanish Ministry for Economy and Competitiveness within the context of the research project PID2021-127623OB-I00 and the program Salvador de Madariaga (to fund the residence of Manzanera in Kalyuznaya’s laboratory), by FEDER funds, and by the Fondo Social Europeo, through grants from the Junta de Andalucía (grant P18-RT-976). Kalyuzhnaya’s laboratory was supported by DOE DE-SC0019181. Conflicts of Interest: The authors declare no conflict of interest. References 1. Broecker, W.S. Climatic Change: Are We on the Brink of a Pronounced Global Warming? Science 1975 ,189, 460–463. [CrossRef] [PubMed] 2. Shindell, D.; Kuylenstierna, J.C.; Vignati, E.; van Dingenen, R.; Amann, M.; Klimont, Z.; Anenberg, S.C.; Muller, N.; JanssensMaenhout, G.; Raes, F.; et al. Shindell Simultaneously Mitigating Near-Term Climate Change and Improving Human Health and Food Security. Science 2012,335, 183–189. [CrossRef] [PubMed] 3. Jackson, R.B.; Abernethy, S.; Canadell, J.G.; Cargnello, M.; Davis, S.J.; Féron, S.; Fuss, S.; Heyer, A.J.; Hong, C.; Jones, C.D.; et al. Atmospheric Methane Removal: A Research Agenda. Philos. Trans. R. Soc. A 2021,379, 20200454. [CrossRef] [PubMed] 4. Ocko, I.B.; Sun, T.; Shindell, D.; Oppenheimer, M.; Hristov, A.N.; Pacala, S.W.; Mauzerall, D.L.; Xu, Y.; Hamburg, S.P. Acting Rapidly to Deploy Readily Available Methane Mitigation Measures by Sector Can Immediately Slow Global Warming. Environ. Res. Lett. 2021,16, 054042. [CrossRef] 5. Yoon, S.; Carey, J.N.; Semrau, J.D. Feasibility of Atmospheric Methane Removal Using Methanotrophic Biotrickling Filters. Appl. Microbiol. Biotechnol. 2009,83, 949–956. [CrossRef] 6. Pascual, J.A.; Ros, M.; Martínez, J.; Carmona, F.; Bernabé, A.; Torres, R.; Lucena, T.; Aznar, R.; Arahal, D.R.; Fernández, F. Methylobacterium Symbioticum Sp. Nov., a New Species Isolated from Spores of Glomus Iranicum Var. Tenuihypharum. Curr. Microbiol. 2020,77, 2031–2041. [CrossRef] 7. Madhaiyan, M.; Poonguzhali, S.; Sa, T. Characterization of 1-Aminocyclopropane-1-Carboxylate (ACC) Deaminase Containing Methylobacterium Oryzae and Interactions with Auxins and ACC Regulation of Ethylene in Canola (Brassica Campestris). Planta 2007,226, 867–876. [CrossRef] 8. Madhaiyan, M.; Poonguzhali, S.; Ryu, J.; Sa, T. Regulation of Ethylene Levels in Canola (Brassica Campestris) by 1Aminocyclopropane-1-Carboxylate Deaminase-Containing Methylobacterium Fujisawaense. Planta 2006 ,224, 268–278. [CrossRef] 9. de Aquino, G.S.; Ventura, M.U.; Alexandrino, R.P.; Michelon, T.A.; de Araujo Pescador, P.G.; Nicio, T.T.; Watanabe, V.S.; Diniz, T.G.; de Oliveira, A.L.M.; Hata, F.T. Plant-Promoting Rhizobacteria Methylobacterium Komagatae Increases Crambe Yields, Root System and Plant Height. Ind. Crops Prod. 2018,121, 277–281. [CrossRef] 10. Shaffique, S.; Khan, M.A.; Imran, M.; Kang, S.-M.; Park, Y.-S.; Wani, S.H.; Lee, I.-J. Research Progress in the Field of Microbial Mitigation of Drought Stress in Plants. Front. Plant Sci. 2022,13, 870626. [CrossRef] Plants 2023,12, 2487 18 of 19 11. Manzanera, M. Dealing with Water Stress and Microbial Preservation. Environ. Microbiol. 2021 ,23, 3351–3359. [CrossRef] [PubMed] 12. Herrmann, L.; Lesueur, D. Challenges of Formulation and Quality of Biofertilizers for Successful Inoculation. Appl. Microbiol. Biotechnol. 2013,97, 8859–8873. [CrossRef] [PubMed] 13. Barros-Rodríguez, A.; Rangseekaew, P.; Lasudee, K.; Pathom-aree, W.; Manzanera, M. Impacts of Agriculture on the Environment and Soil Microbial Biodiversity. Plants 2021,10, 2325. [CrossRef] [PubMed] 14. Daryanto, S.; Wang, L.; Jacinthe, P.-A. Global Synthesis of Drought Effects on Maize and Wheat Production. PLoS ONE 2016 , 11, e0156362. [CrossRef] [PubMed] 15. Akberdin, I.R.; Collins, D.A.; Hamilton, R.; Oshchepkov, D.Y.; Shukla, A.K.; Nicora, C.D.; Nakayasu, E.S.; Adkins, J.N.; Kalyuzhnaya, M.G. Rare Earth Elements Alter Redox Balance in Methylomicrobium Alcaliphilum 20ZR. Front. Microbiol. 2018 , 9, 2735. [CrossRef] [PubMed] 16. Khmelenina, V.N.; Kalyuzhnaya, M.G.; Starostina, N.G.; Suzina, N.E.; Trotsenko, Y.A. Isolation and Characterization of Halotolerant Alkaliphilic Methanotrophic Bacteria from Tuva Soda Lakes. Curr. Microbiol. 1997,35, 257–261. [CrossRef] 17. Ojala, D.S.; Beck, D.A.C.; Kalyuzhnaya, M.G. Genetic Systems for Moderately Halo(Alkali)Philic Bacteria of the Genus Methylomicrobium. In Methods in Enzymology; Elsevier: Amsterdam, The Netherlands, 2011; Volume 495, pp. 99–118, ISBN 978-0-12-386905-0. 18. Calvo, C.; Rodríguez-Calvo, A.; Robledo-Mahón, T.; Manzanera, M.; González-López, J.; Aranda, E.; Silva-Castro, G.A. Biostimulation of Crude Oil-Polluted Soils: Influence of Initial Physicochemical and Biological Characteristics of Soil. Int. J. Environ. Sci. Technol. 2019,16, 4925–4934. [CrossRef] 19. Rangseekaew, P.; Barros-Rodríguez, A.; Pathom-aree, W.; Manzanera, M. Deep-Sea Actinobacteria Mitigate Salinity Stress in Tomato Seedlings and Their Biosafety Testing. Plants 2021,10, 1687. [CrossRef] 20. Narváez-Reinaldo, J.J.; Barba, I.; González-López, J.; Tunnacliffe, A.; Manzanera, M. Rapid Method for Isolation of DesiccationTolerant Strains and Xeroprotectants. Appl. Environ. Microbiol. 2010,76, 5254–5262. [CrossRef] 21. Takahashi, S.; Tomita, J.; Nishioka, K.; Hisada, T.; Nishijima, M. Development of a Prokaryotic Universal Primer for Simultaneous Analysis of Bacteria and Archaea Using Next-Generation Sequencing. PLoS ONE 2014,9, e105592. [CrossRef] 22. Schloss, P.D. Application of a Database-Independent Approach To Assess the Quality of Operational Taxonomic Unit Picking Methods. mSystems 2016,1, e00027-16. [CrossRef] [PubMed] 23. Unno, T. Bioinformatic Suggestions on MiSeq-Based Microbial Community Analysis. J. Microbiol. Biotechnol. 2015 ,25, 765–770. [CrossRef] [PubMed] 24. Rognes, T.; Flouri, T.; Nichols, B.; Quince, C.; Mahé, F. VSEARCH: A Versatile Open Source Tool for Metagenomics. PeerJ 2016 , 4, e2584. [CrossRef] 25. Nierychlo, M.; Andersen, K.S.; Xu, Y.; Green, N.; Jiang, C.; Albertsen, M.; Dueholm, M.S.; Nielsen, P.H. MiDAS 3: An EcosystemSpecific Reference Database, Taxonomy and Knowledge Platform for Activated Sludge and Anaerobic Digesters Reveals Species-Level Microbiome Composition of Activated Sludge. Water Res. 2020,182, 115955. [CrossRef] 26. Westcott, S.L.; Schloss, P.D. De Novo Clustering Methods Outperform Reference-Based Methods for Assigning 16S RRNA Gene Sequences to Operational Taxonomic Units. PeerJ 2015,3, e1487. [CrossRef] 27. Estrada-Bonilla, G.A.; Lopes, C.M.; Durrer, A.; Alves, P.R.L.; Passaglia, N.; Cardoso, E.J.B.N. Effect of Phosphate-Solubilizing Bacteria on Phosphorus Dynamics and the Bacterial Community during Composting of Sugarcane Industry Waste. Syst. Appl. Microbiol. 2017,40, 308–313. [CrossRef] [PubMed] 28. Vílchez, J.I.; García-Fontana, C.; Román-Naranjo, D.; González-López, J.; Manzanera, M. Plant Drought Tolerance Enhancement by Trehalose Production of Desiccation-Tolerant Microorganisms. Front. Microbiol. 2016,7, 1577. [CrossRef] [PubMed] 29. McDonald, I.R.; Kenna, E.M.; Murrell, J.C. Detection of Methanotrophic Bacteria in Environmental Samples with the PCR. Appl. Environ. Microbiol. 1995,61, 116–121. [CrossRef] 30. Costello, A.M.; Lidstrom, M.E. Molecular Characterization of Functional and Phylogenetic Genes from Natural Populations of Methanotrophs in Lake Sediments. Appl. Environ. Microbiol. 1999,65, 5066–5074. [CrossRef] 31. Poly, F.; Ranjard, L.; Nazaret, S.; Gourbière, F.; Monrozier, L.J. Comparison of NifH Gene Pools in Soils and Soil Microenvironments with Contrasting Properties. Appl. Environ. Microbiol. 2001,67, 2255–2262. [CrossRef] 32. Sessitsch, A.; Hardoim, P.; Döring, J.; Weilharter, A.; Krause, A.; Woyke, T.; Mitter, B.; Hauberg-Lotte, L.; Friedrich, F.; Rahalkar, M.; et al. Functional Characteristics of an Endophyte Community Colonizing Rice Roots as Revealed by Metagenomic Analysis. MPMI 2012,25, 28–36. [CrossRef] 33. Deng, Y.; Cui, X.; Dumont, M.G. Identification of Active Aerobic Methanotrophs in Plateau Wetlands Using DNA Stable Isotope Probing. FEMS Microbiol. Lett. 2016,363, fnw168. [CrossRef] [PubMed] 34. Striegl, R.G.; McConnaughey, T.A.; Thorstenson, D.C.; Weeks, E.P.; Woodward, J.C. Consumption of Atmospheric Methane by Desert Soils. Nature 1992,71, 145–147. [CrossRef] 35. Ahlström, A.; Raupach, M.R.; Schurgers, G.; Smith, B.; Jung, M.; Reichstein, M.; Canadell, J.G. The Dominant Role of Semi-Arid Ecosystems in the Trend and Variability of the Land CO2 Sink. Science 2015,348, 895–899. [CrossRef] [PubMed] 36. Gomez, O.A. Microbial Communities Involved in Methane Cycling in the Anza Borrego Desert Soil. Master’s Thesis, San Diego State University, San Diego, CA, USA, 2019. 37. Iguchi, H.; Umeda, R.; Taga, H.; Oyama, T.; Yurimoto, H.; Sakai, Y. Community Composition and Methane Oxidation Activity of Methanotrophs Associated with Duckweeds in a Fresh Water Lake. J. Biosci. Bioeng. 2019,128, 450–455. [CrossRef] Plants 2023,12, 2487 19 of 19 38. Jeong, S.-Y.; Kim, T.G. Development of a Novel Methanotrophic Process with the Helper Micro-Organism Hyphomicrobium sp. NM3. J. Appl. Microbiol. 2019,126, 534–544. [CrossRef] 39. Singh, R.; Ryu, J.; Kim, S.W. Microbial Consortia Including Methanotrophs: Some Benefits of Living Together. J. Microbiol. 2019 , 57, 939–952. [CrossRef] 40. Iguchi, H.; Yurimoto, H.; Sakai, Y. Stimulation of Methanotrophic Growth in Cocultures by Cobalamin Excreted by Rhizobia. Appl. Environ. Microbiol. 2011,77, 8509–8515. [CrossRef] 41. Sy, A.; Timmers, A.C.J.; Knief, C.; Vorholt, J.A. Methylotrophic Metabolism Is Advantageous for Methylobacterium extorquens during Colonization of Medicago truncatula under Competitive Conditions. Appl. Environ. Microbiol. 2005 ,71, 7245–7252. [CrossRef] 42. Gourion, B.; Rossignol, M.; Vorholt, J.A. A Proteomic Study of Methylobacterium Extorquens Reveals a Response Regulator Essential for Epiphytic Growth. Proc. Natl. Acad. Sci. USA 2006,103, 13186–13191. [CrossRef] 43. Abanda-Nkpwatt, D.; Musch, M.; Tschiersch, J.; Boettner, M.; Schwab, W. Molecular Interaction between Methylobacterium Extorquens and Seedlings: Growth Promotion, Methanol Consumption, and Localization of the Methanol Emission Site. J. Exp. Bot. 2006,57, 4025–4032. [CrossRef] 44. Ivanova, E.G.; Doronina, N.V.; Trotsenko, Y.A. Aerobic Methylobacteria Are Capable of Synthesizing. Microbiology 2001 ,70, 392–397. [CrossRef] 45. Koenig, R.L.; Morris, R.O.; Polacco, J.C. TRNA Is the Source of Low-Level Trans-Zeatin Production in Methylobacterium spp. J. Bacteriol. 2002,106, 6805. [CrossRef] [PubMed] 46. Meena, K.K.; Kumar, M.; Kalyuzhnaya, M.G.; Yandigeri, M.S.; Singh, D.P.; Saxena, A.K.; Arora, D.K. Epiphytic Pink-Pigmented Methylotrophic Bacteria Enhance Germination and Seedling Growth of Wheat (Triticum Aestivum) by Producing Phytohormone. Antonie Van Leeuwenhoek 2012,101, 777–786. [CrossRef] [PubMed] 47. Freyermuth, S.K.; Long, R.L.G.; Mathur, S.; Holland, M.A.; Holtsford, T.P.; Stebbins, N.E.; Morris, R.O.; Polacco, J.C. Metabolic Aspects of Plant Interaction with Commensal Methylotrophs. In Microbial Growth on C1 Compounds; Lidstrom, M.E., Tabita, F.R., Eds.; Springer: Dordrecht, The Netherlands, 1996; pp. 277–284, ISBN 978-94-010-6580-1. 48. Holland, M.A. Occam’s Razor Applied to Hormonology (Are Cytokinins Produced by Plants?). Plant Physiol. 1997 ,115, 865–868. [CrossRef] [PubMed] 49. Cervantes, S.E.; Graham, E.A.; Andrade, J.L. Light Microhabitats, Growth and Photosynthesis of an Epiphytic Bromeliad in a Tropical Dry Forest. Plant Ecol. 2005,179, 107–118. [CrossRef] 50. Taylor, S.C.; Dalton, H.; Dow, C.S. Ribulose-1,5-Bisphosphate Carboxylase/Oxygenase and Carbon Assimilation in Methylococcus Capsulatus (Bath). Microbiology 1981,122, 89–94. [CrossRef] 51. Rasigraf, O.; Kool, D.M.; Jetten, M.S.M.; Sinninghe Damsté, J.S.; Ettwig, K.F. Autotrophic Carbon Dioxide Fixation via the Calvin-Benson-Bassham Cycle by the Denitrifying Methanotroph “Candidatus Methylomirabilis Oxyfera”. Appl. Environ. Microbiol. 2014,80, 2451–2460. [CrossRef] 52. Chen, Y.-C. Estimation of Greenhouse Gas Emissions from a Wastewater Treatment Plant Using Membrane Bioreactor Technology. Water Environ. Res. 2019,91, 111–118. [CrossRef] 53. Hernandez Elizabeth, M.E. Suelos De Humedales Como Sumideros De Carbono Y Fuentes De Metano Wetland Soils as Carbon Sinks and Sources of Methane. Terra Latinoam. 2009,28, 139–147. 54. Laing, C.G.; Shreeve, T.G.; Pearce, D.M.E. Methane Bubbles in Surface Peat Cores: In Situ Measurements: Methane Bubbles In Surface Peat Cores. Glob. Chang. Biol. 2008,14, 916–924. [CrossRef] 55. Solomon, S. (Ed.) Climate Change 2007: The Physical Science Basis: Contribution of Working Group I to the Fourth Assessment Report of the Intergovernmental Panel on Climate Change. In Intergovernmental Panel on Climate Change, Intergovernmental Panel on Climate Change; Cambridge University Press: Cambridge, UK; New York, NY, USA, 2007; ISBN 978-0-521-88009-1. Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.