Structural insights into RNA binding by NusA and interaction studies of Nun with E. coli Nus factors.
Full text
Structural insights into RNA binding by NusA and interaction studies of Nun with E. coli Nus factors Dissertation Zur Erlangung des Doktorgrades der Fakultät Biologie, Chemie und Geowissenschaften der Universität Bayreuth vorgelegt von M. Sc. Pagadala Santhanam Sujatha Bayreuth 2008
Die vorliegende Arbeit wurde von August 2005 bis Juli 2008 am Lehrstuhl für Struktur und Chemie der Biopolymere der Universität Bayreuth unter der Leitung von Prof. Dr. Paul Rösch angefertigt. Vollständiger Abdruck der von der Fakultät für Biologie, Chemie und Geowissenschaften der Universität Bayreuth genehmigten Dissertation zur Erlangung des akademischen Grades eines Doktors der Naturwissenschaften (Dr. rer. Nat.). Promotionsgesuch eingereicht am : 16.07.2008 Tag des wissenschaftlichen Kolloquiums: 22.10.2008 Erster Gutachter : Prof. Dr. Paul Rösch Zweiter Gutachter: Prof. Dr. Matthias Ullmann Vorsitzender: Prof. Dr. Andreas Fery Prof. Dr. Rainer Schobert
With fond memories of my mom
CONTENTS I Contents 1. Introduction......................................................................................................................1 1.1 Bacteriophages................................................................................................................1 1.2 Life cycle of lambda bacteriophage................................................................................2 1.3 Transcription mechanism................................................................................................5 1.4 nut – RNA of bacteriophage λ.........................................................................................9 1.5 Transcription antitermination and termination in E. coli...............................................11 1.5.1 Phage λ N antitermination....................................................................................11 1.5.2 Mechanism of Nun mediated termination............................................................12 1.6 Elongation factor NusA................................................................................................15 1.7 Thesis objectives...........................................................................................................21 2. Materials and Methods..................................................................................................22 2.1 Culture media................................................................................................................22 2.1.1 Luria Bertani medium..........................................................................................22 2.1.2 Minimal medium (M9).........................................................................................22 2.1.3 P-5052 medium....................................................................................................23 2.2 Estimation of protein concentration..............................................................................24 2.3 SDS – polyacrylamide gel electrophoresis...................................................................24 2.4 Schagger and Jagow gel electrophoresis.......................................................................25 2.5 HK022 Nun protein.......................................................................................................26 2.5.1 Expression of Nun................................................................................................26 2.5.2 Cell lysis and purification of HK022 Nun...........................................................26
2 INTRODUCTION phage must perform some minimal functions for continued survival, like protection of its nucleic acid from environmental chemicals that could alter the molecule, delivery of its nucleic acid to the inside of a bacterium, conversion of an infected bacterium to a phageproducing system which yields a large number of progeny phage and release of progeny phage from an infected bacterium. These functions are carried out in a variety of ways by different phage species. All of the species have certain features in common but differences in detail show the many ways in which specific biological functions can be accomplished [Voet et al., 2nd edition]. Lambda phage The origins of molecular biology are deeply enmeshed with the discovery and characterization of the temperate coliphage λ [Gottesman 2004]. The isolation of λ was first reported in 1951 by Esther Lederberg and then later it was described in greater detail, in 1953 by Esther and Joshua Lederberg [Lederberg 1951; Lederberg et al., 1953]. The temperate coliphage λ has served as a model for the fields of gene regulation and temporal programming of gene expression [Gottesman 1999]. The λ phage has been useful because, following infection, λ development can proceed along two alternative pathways. Some cells enter a productive cycle, in which phage DNA replicates autonomously and is packaged into progeny phage particles, which are then liberated by lysis. Other cells survive infection to become lysogenic and harbor the phage DNA inserted into the chromosome as a prophage, which remains transcriptionally quiescent for genes of the productive cycle [Campbell 1994]. 1.2 Life cycle of lambda bacteriophage The lysis-lysogeny decision of λ bacteriophage is a paradigm for developmental genetic networks [Oppenheim et al., 2005; Court et al., 2007]. There are three key features which characterize the network. First, after infection of the host bacterium, a decision between lytic or lysogenic development is made that is dependent upon environmental signals and the number of infecting phages per cell. Second, the lysogenic prophage state is very stable. Third, the prophage enters lytic development in response to DNA-damaging agents.
INTRODUCTION 3 The CI (activates pRM promoter) and Cro regulators define the lysogenic and lytic states, respectively, as a bistable genetic switch. Whereas CI maintains a stable lysogenic state, recent studies indicate that Cro sets the lytic course not by directly blocking CI expression but indirectly by lowering levels of CII which activates cI transcription (Fig 1.1). Figure 1.1 Gene and transcription map of λ bacteriophage regulatory region. Genes are shown in the shaded rectangle. The early transcripts for pL and pR promoters are shown as red arrows. The late transcript from pR´ is indicated with black arrows. The CII-activated pI, pRE, and pAQ transcripts are indicated with blue arrows. The pRM transcript activated by CI is a green arrow. Transcription terminators (t) are shown as red letters among the genes. The tI terminator is indicated in parenthesis because it is contained within the larger sib processing site. The operators OL and OR where CI and Cro bind are shown next to the pL and pR promoters. Lytic development Transcription is initiated with the synthesis of the early transcripts from the pL and pR promoters (Fig 1.1). Early transcripts which encode two regulators, N and Cro, are attenuated at the tL1 and tR1 terminators. These transcriptional terminators play an important role in controlling the cascade of gene expression. By acting as a weak repressor for both pL and pR promoters, Cro facilitates the lytic mode. For example, the N protein which is a antitermination factor promotes the assembly of a transcription complex [Barik et al., 1987; Greenblatt et al., 1998]. This assembly occurs on the RNA at nutL and nutR sites and is made up of RNA polymerase and a number of host proteins called Nus. Sib (tI) –attp-int-xis---cIII tL1N nutL cI cro nutR-tR1-cII-O-P-ren-tR2-Q tR´ pL OL pI OR pR pR´ pRM pRE pAQ Sib (tI) –attp-int-xis---cIII tL1N nutL cI cro nutR-tR1-cII-O-P-ren-tR2-Q tR´ pL OL pI OR pR pR´ pRM pRE pAQ
4 INTRODUCTION The N and Nus-modified RNA polymerase can overcome the tL1 and tR1 transcription terminators, resulting in expression of the distal delayed early functions. The delayed early functions include the lysogenic regulators CII and CIII, as well as the lytic DNA replication genes O and P, and the late gene regulator Q [Friedman et al., 1995]. After sufficient accumulation, the Q protein modifies RNA polymerase that has just initiated transcription from the pR´ late promoter. This modification causes the RNA polymerase to become resistant to transcription terminators present downstream to pR´, allowing the expression of the late genes, which encode proteins for phage morphogenesis and host cell lysis. During the last stage of the cascade, the late gene products assemble phage virions and lyse the host. Lysogenic development Two phage proteins, Int and CI, are required to form stable lysogens. Int allows the integration of the phage genome into the bacterial chromosome, and CI represses the two early phage promoters to prevent any lytic phage gene expression. When λ bacteriophage first infects, Int and CI are not initially made, and the λ phage initiates gene expression along a set of events that are common to both the lytic and lysogenic pathways. If conditions are favorable during this initial phase, Int and CI synthesis can be switched on, to enable lysogenic development. This activation depends primarily upon the phage CII function. The cII gene is located between the tR1 terminator and the replication genes and, thus, is transcribed with the early lytic genes. However, CII protein is required only for lysogenic development of infecting phages. Another gene required for lysogenic development is cIII, located beyond tL1 in the pL operon. Mutations in these genes as well as in the cI gene encoding the repressor function cause λ bacteriophage plaques to be clear, unlike the normal turbid plaques where the turbidity indicates growth of lysogenic cells. Whereas the CI repressor is required to maintain the repressed lysogenic state, the CII and CIII proteins are only required to initially activate CI synthesis [Kaiser 1957; Friedman et al., 2001]. Once CI has been made, the CII and CIII functions are no longer required because, CI can maintain its own synthesis.
INTRODUCTION 5 1.3 Transcription mechanism RNA polymerase Transcription is regulated at several biochemical steps by protein factors through genetic signals recognized in the form of DNA or RNA [Das 1993; Burgess et al., 1987]. Transcription of all E. coli (Escherichia coli) genes is carried out by a single form of core RNA polymerase, constituted by four subunits (α2ββ') that are encoded by rpoA, rpoB and rpoC genes, respectively. The core RNA polymerase binds to one of several sigma factors that directs the RNA polymerase holoenzyme to the promoter of distinct classes of genes. σ70, encoded by rpoD, serves as the initiator for most E. coli genes. Hence, the complete holoenzyme has 6 subunits: α2ββ'σω (~480 kDa). The catalytic center is constituted by both β and β' subunits, which share homology to the largest subunits of eukaryotic RNA polymerases. The β subunit can be cross-linked to nucleotides, DNA and the RNA product. Mutations in rpoB encoding β affect virtually every aspect of transcription like sensitivity to antibiotics, promoter recognition and interaction with σ [Gross et al., 1992], abortive initiation, elongation kinetics, intrinsic termination and regulation by termination and antitermination factors [von Hippel 1998; Rhodius et al., 1998]. Likewise, mutations in rpoC encoding β' alter promoter-specificity and sensitivity to rifampicin and regulation by elongation control proteins. The alpha subunit, required for core assembly, plays a pivotal role in the positive control of initiation by activators, such as the cAMP-CRP complex. α-CTD of RNA polymerase Activation of gene transcription in a prokaryote system is triggered by several kinds of transcription activators [Ishihama 1988]. In the E. coli RNA polymerase holoenzyme, one of the regions responsible for transcription activation has been localized to the α subunit at COOH terminal. The carboxyl-terminal domain α subunit (α-CTD), is regarded as the contact site for transcription activator proteins and for the promoter UP element. Deletion of this region does not interfere with the assembly of the core or the holoenzyme, but reconstituted RNA polymerase containing C-terminal truncated alpha subunits cannot be activated by a group of transcription activator proteins [Ishihama 1992; Igarashi et al., 1991].
6 INTRODUCTION This group of proteins contains the class I transcription factors, and their contact sites have been placed at various positions in the C-terminal domain. The isolated α subunit and its Cterminal domain protect the UP element region from deoxyribonuclease I (DNase I) digestion, which indicates that the C-terminal portion of the α subunit is responsible for the contact with cis-acting UP elements as well as with trans-acting transcription factors. The solution structure of αCTD, a 98-amino acid COOH-terminal fragment (residues 233 to 329 plus methionine at the NH2-terminus) was determined by NMR [Jeon et al., 1995]. The structure is compactly folded and comprises four helices and two long loops at the terminals of the domain (PDB code - 1COO). Transcription initiation In all organisms, transcription performed by DNA-dependent RNA polymerases can be divided into three mechanistically and structurally distinct stages: initiation, elongation, and termination. In the first step, RNA polymerase binds to the promoter, forming a metastable “closed promoter” complex. The σ70 holoenzyme recognizes two conserved hexamers centered around -10 (TATAAT) and -35 (TTGACA) positions relative to the start site, utilizing two conserved DNA-binding domains in σ70. The closed complex then undergoes several structural transformations to isomerize into a heparin-resistant “open promoter” complex that contains a single stranded DNA bubble encompassing the -12 to +4 region. Finally, the open complex couples two specific ribonucleotides forming a dinucleotide tetraphosphate that serves as the primer for subsequent RNA chain elongation. Transcription elongation During elongation, RNA polymerase performs thousands of nucleotide addition cycles. Each cycle must culminate in forward translocation by one nucleotide (nt) to allow for the incorporation of the next substrate; this step entails the separation of 1 bp of the dwDNA accompanied by the displacement of one nt of the nascent RNA from the DNA template at the upstream edge of the RNA/DNA hybrid and subsequent annealing of the upstream DNA duplex [von Hippel et al., 2002]. Though the elongation complex is capable of the uninterrupted synthesis of RNA chains thousands of nucleotides long, yet, the complex becomes abruptly destabilized at terminators that demarcate the RNA end, in many cases with single nt precision. The interplay between processive synthesis, transient halting at numerous
INTRODUCTION 7 ‘roadblocks’ and RNA release depends on the intricate network of interactions between RNA polymerase, the nucleic acid signals and/or auxiliary transcription factors within the elongation complex [Vassylyev et al., 2007; Uptain et al., 1997; Nudler 1999]. Transcription termination [Gusarov et al., 1999; Greive et al., 2005] Transcript elongation by RNA polymerase involves a processive mechanism. Yet, the RNA chain is not extended at a fixed rate along the DNA. Until recently, two prevalent types of sites were known to impede elongation: (a) the so-called “pause” sites, which induce a temporary, reversible block to nucleotide addition and (b) terminators, which cause the release of RNA and/or RNA polymerase, either intrinsically, or upon activation by a diffusible factor such as NusA, Rho or Tau. The dissociation of the sigma factor is thought to mark the entry of NusA protein, a key elongation modulator that couples termination and antitermination factors to RNA polymerase and itself promotes pausing and termination at specific template sites. As the elongation complex is the target of many more diffusible factors, which also includes transcript cleavage factors, which help RNA polymerase to overcome the “dead-end” sites, and additional Nus factors help RNA polymerase to transcribe processively through both factor-dependent and intrinsic terminators. Bacteria use two main modes of terminating transcription: Rho-independent or ‘intrinsic’ termination, mainly requiring elements located on the mRNA, and Rho-dependent termination, relying on both mRNA elements and trans-acting factors. About half of the transcription terminators identified in E. coli are Rho-dependent. These terminators lie at the natural end of genes or within cistrons and in control regions preceding the coding sequences of genes, where they play an important role in the regulation of gene expression. Rho is a homohexameric protein with RNA-dependent ATPase and helicase activities which binds to the mRNA. Essential sites on the mRNA are the Rho-binding site, known as the Rho utilization site (rut), and a distal region where the transcripts are terminated. During the transcription termination process the Rho factor which is a hexameric RNA–DNA helicase of E. coli binds to the nascent transcript at a ‘loading site’ that is rich in cytosine residues and also relatively unstructured. Once bound, Rho interacts with the E. coli transcription factor (NusG) and translocates directionally (5′→3′) along the RNA chain by an ATP-driven process, moving towards the transcribing RNA polymerase (Fig 1.2).
8 INTRODUCTION Most Rho-dependent termination positions on the template are also pause sites, and therefore function (at least in part) by allowing Rho to ‘catch up’ with the paused RNA polymerase, which leads to termination by allowing Rho to use its RNA–DNA-helicase activity to unwind the RNA–DNA hybrid within the transcription bubble. The stability of elongation complexes, can be modulated by transcription factors that bind directly or indirectly (by cis RNA looping) to the RNA polymerase after binding to the nascent RNA. These transcription factors include NusA and NusG, which increase and decrease termination efficiency at intrinsic terminators, respectively, and increase termination efficiency (NusG) at Rho-dependent terminators. However, when assembled into complexes that contain antitermination proteins (such as the N protein that is encoded by phage λ) — which are often bound in conjunction with host proteins NusB and NusE — NusA and NusG operate together to decrease termination efficiency. Figure 1.2 A model of rho-dependent termination. Rho RNAP RNAP RNAP Rho binds to transcript at rho loading site and pursues polymerase Hairpin forms; polymerase pauses; rho catches up Rho helicase releases transcript, RNAP dissociates and causes termination Rho RNAP RNAPRNAP RNAPRNAP Rho binds to transcript at rho loading site and pursues polymerase Hairpin forms; polymerase pauses; rho catches up Rho helicase releases transcript, RNAP dissociates and causes termination
INTRODUCTION 9 1.4 nut - RNA of bacteriophage λ The genome of the phage λ codes for two cis-acting element called nut site (N-utilization): nutL and nutR each of 60 basepairs long and lies in between 50-250 basepairs of the 3’ side of the promoter PL and PR [Rosenberg et al., 1978]. The nutL and nutR sites are composed of three conserved motifs, including BoxA (8 nucleotides [nt] located upstream from the BoxB stem loop structure), BoxB (15 nt stem loop structure), and BoxC (8 nt) [Washburn et al., 2006; Das et al., 1996]. Transcription of the nut site provides a locus on which N and Nus factors can nucleate the formation of a specific ribonucleoprotein complex [Mogridge et al., 1998]. BoxA RNA recruits NusB and NusE into an antitermination complex that includes RNA polymerase, NusA, and NusG. BoxB RNA forms a stem-loop that binds N or HK022 Nun. As it binds BoxB, N associates with NusA, NusG, and RNA polymerase. It is proposed that N, Nus factors, and nut interact and complex with RNA polymerase while tethered on the same RNA [Nodwell et al., 1991]. Although N is the essential factor for antitermination, nut and the Nus factors confer stability and full activity to the antitermination complex. BoxB RNA alone binds N and Nun with similar affinities. This equivalent affinity for BoxB RNA does not reflect the inability of N to compete with Nun at nutL in vivo. A third conserved motif, BoxC (8 nt), lies downstream of nutL and nutR and does not appear to play a role in antitermination. The two nut sites differ in the spacer regions between BoxA, BoxB, and BoxC and by a single nucleotide change in the BoxB loop and the sixth nucleotide in BoxC. The spacing between BoxA and BoxB is seven and eight nucleotides for nutL and nutR respectively (Fig 1.3) [Patterson et al., 1994]. It has been proposed [Washburn et al., 2003] that the phenotypic difference between nutL and nutR might be explained by the relative distances of the two nut elements from their respective promoters. nutL is 34 nucleotides from pL, whereas nutR lies 227 nucleotides from its cognate promoter. nutL also differs from nutR in that, it lies immediately promoter proximal to RNase III cleavage sites (rIII).
10 INTRODUCTION Figure 1.3 nut sequence showing three elements: BoxA, BoxB and the spacer region located between BoxA and BoxB. The differences are highlighted by red colored alphabets. Although the basic elements of the λ nut region are conserved in many lambdoid phages, there are lambdoid phages that vary from λ paradigm. The most divergent example is phage HK022, which in place of nut sites, has put sites [Weisberg et al., 1999]. Unlike nut sites, which serve as a nucleation site for protein antitermination complexes, the put RNA structure itself appears to be necessary and sufficient for modification of RNA polymerase into an antitermination mode. However, HK022 encodes a protein, Nun, that appears to be an ortholog of N, but does not modify transcription of HK022. Instead, Nun, which is expressed from the HK022 prophage, acts as an exclusion function by binding at λ nut sites to arrest transcription. A A G G G C 5’ C G C U C U U A AA AA U U A A G boxA AG boxB 34 47 3’ U C C C G A Spacer λnutL A G G G C 5’ C G C U C U U A CA CA U U C C A G boxA AA boxB 34 47 3’ U C C C G A A Spacer λnutR A A G G G C 5’ C G C U C U U A AA AA U U A A G boxA AG boxB 34 47 3’ U C C C G A Spacer λnutL A G G G C 5’ C G C U C U U A AA AA U U A A G boxAboxA AG boxB 34 47 3’ U C C C G A SpacerSpacer λnutL A G G G C 5’ C G C U C U U A CA CA U U C C A G boxA AA boxB 34 47 3’ U C C C G A A Spacer λnutR A G G G C 5’ C G C U C U U A CA CA U U C C A G boxAboxA AA boxB 34 47 3’ U C C C G A A SpacerSpacer λnutR
INTRODUCTION 11 1.5 Transcription antitermination and termination in E. coli 1.5.1 Phage λ N antitermination Antitermination is a critical event for genetic regulation of transcription in both eukaryotic and prokaryotic cells. Antitermination involves the interplay of protein host factors with RNA and the RNA polymerase transcription complex to allow transcription through early termination sites [Greenblatt et al., 1993]. The transcriptional regulation process in bacteriophage λ can be viewed as a paradigm for antitermination. In phage λ antitermination, the N protein gene product from bacteriophage λ plays an essential role in transcriptional antitermination in the two phage early operons, which are critical for phage development. The inhibition of termination at intrinsic and Rho-dependent terminators by λ N depends upon the recognition of nut RNA on the nascent phage transcript [Das 1992]. The key component of the antitermination complex is the highly basic 107 amino acid λ N protein, which is largely unfolded in solution [Mogridge et al., 1998]. λ N consists of three functionally distinct regions with different interaction partners: aminoacid residues from 1-22 binds the nutBoxB RNA, 34-47 binds the carboxy terminal part of E. coli NusA acidic repeat domain 2, 73-107 forms the RNA polymerase binding region [Weisberg et al., 1999; Whalen et al., 1988; Devito et al., 1994]. Highly efficient, processive N mediated antitermination requires E. coli transcription elongation factors NusA, NusB, NusG, and NusE (S10), as well as nutBoxA [Friedman et al., 1990; Henkin et al., 2002; Agnieszka et al., 2003]. NusA, a 56 kDa essential protein, was subsequently shown to affect transcriptional pausing, termination, and antitermination. NusB, a 14 kDa protein essential for cell growth only at low temperatures, may be involved in translation as well as transcription. The nusE71 mutation, which defined the NusE product, is an allele of rpsJ, encoding ribosomal protein S10. NusG, first identified through a nusG mutation that suppressed the effects of the nusA1 and nusE71 mutations, is a required factor for the N antitermination in vitro as well as an enhancer of termination factor Rho [Friedman et al., 1995]. The N and Nus proteins function as a complex modifying RNA polymerase to a termination-resistant form. After this complex has been formed, it leads to efficient in vitro and in vivo suppression of terminators located thousands of base pairs downstream of the nut site [Mogridge et al., 1995]. A model of N-dependent antitermination is shown in Fig 1.4 [Greive et al., 2005; von Hippel et al., 1996].
18 INTRODUCTION Figure 1.9 Stereo ribbon diagram of Thermotoga maritima NusA. Domains are indicated with different colors. PDB code – 1HH2. The crystal structures of two non-E. coli NusA factors have been solved so far, Thermotoga maritima [Worbs et al., 2001] and Mycobacterium tuberculosis [Gopal et al., 2001]). These structures show a common domain organization (S1+KH1+KH2) as described before. This NusA core organization is conserved in most of the bacteria. An additional carboxy terminal region, NusA-CTD, comprising 160 residues [(NusA(353–416) and NusA(431–490)] is found in several α-, β-, and γ-proteobacteria like enterobacterium E. coli. Though NusA-CTD is not as highly conserved as the NusA core, the latter region is characterized by its acidity and frequently by an internal sequence repeat of 70 residues. The solution structure of NusA-CTD was solved with high-resolution by NMR [Eisenmann et al., 2005]. The two subdomains of NusA-CTD are connected by a linker region. Either subdomain contains two helix-hairpinhelix (HhH) motifs, each formed by two anti-parallel α helices connected by a short hairpin (Fig 1.10). Figure 1.10 Structure of NusA ar1 (PDB code – 1WCL) and NusA ar2 (PDB code – 1WCN). NTD hinge S1 KH1 KH2 NusA (353-416) ar1 NusA(417-430) linker NusA(431-490) ar2NusA (353-416) ar1 NusA(417-430) linker NusA(431-490) ar2
INTRODUCTION 19 Autoinhibition effect of NusA N protein alone is sufficient to bind and retard the mobility of RNA containing a wild-type nut site, whereas full-length NusA cannot shift the RNA on its own and needs N for its RNA binding activity (Fig 1.11-A and 1.11-C) [Mogridge et al., 1995]. None of the NusA fragments except NusA (1-416) (Fig 1.11-B) can bind the RNA directly in the absence of N. Recently, Greenblatt and coworkers showed that the extra CTD of ecoNusA serves as an autoinhibitor of RNA binding [Mah et al., 2000]. A carboxy-terminal deletion mutant NusA (1–416), which retains the S1 and KH homology regions of NusA but only one of its two HhH motifs, can bind RNA in the absence of N. This suggests that one or more of the RNA-binding domains of NusA might be occluded by the second HhH motif or other determinants within the 79 carboxy-terminal amino acids of NusA (Fig 1.11). It has been inferred that autoinhibition of RNA binding in ecoNusA is mediated via a negative patch on the CTD [Mogridge et al., 1995; Mah et al., 2000]. Consistent with RNA binding to NusA being mediated by the composite positive flank, the CTD could nicely block this area or part thereof through its negative surface. Role of α-CTD subunit of RNA polymerase The inability of full-length NusA to bind RNA resembles the inability of the intact initiation subunit σ70 of RNA polymerase to bind DNA. In analogy to the way in which interaction of σ70 with RNA polymerase relieves the inhibitory effect of the amino terminus of σ70 on promoter-specific DNA binding [Dombroski et al., 1993], it is possible that the interaction of NusA with RNA polymerase relieves the inhibitory effect of the carboxyl terminus of NusA and allows NusA to bind RNA. Nuclease protection experiments and protein-RNA cross-linking experiments [Liu et al., 1995], have already shown that NusA interacts with or is close to RNA nucleotides upstream of the 3´end of the nascent transcript in a transcription complex and these results were consistent with the observation [Mah et al., 2000] made by affinity chromatography experiments, that the α-CTD subunit of RNA polymerase stimulates RNA binding by NusA. Based on various observations, it has been suggested that during elongation, NusA uses its RNA polymerase-binding region (1–137) [Mah et al., 1999] to interact with RNA polymerase subunits β and β', and its carboxy-terminal region to interact with α-CTD subunit.
20 INTRODUCTION The interaction with α-CTD subunit may then cause a conformational change in NusA such that its RNA-binding domains either fold or become exposed and competent to bind the nascent RNA (Fig 1.11-D). Thus, as part of the transcription complex, NusA would be in a position to bind and stabilize pause and termination motifs in the nascent RNA, leading to enhancement of pausing and termination at certain sites. Hence, the interaction of the α-CTD with NusA is essential for NusA to stimulate termination only if the inhibitory carboxy-terminal region of NusA is present and not if it is deleted. Figure 1.11 Model showing the autoinhibition effect of NusA on RNA binding. S1 KH1 KH2 1 -137 348 -416 RNA S1 KH1 KH2 1 -137 348 -416 RNA NusA (1-416) can bind RNA on its own S1 KH1 KH2 1 -137 348 -416 417 - 495 S1 KH1 KH2 1 -137 348 -416 417 - 495 NusA (1-495) cannot bind RNA on its own (Autoinhibition) A B S1 KH1 KH2 1 -137 348 -416 nut site RNA 417 - 495 N S1 KH1 KH2 1 -137 348 -416 nut site RNA 417 - 495 N N activates the RNA-binding activity of NusA (1-495) C NTD NTD CTD CTD β β' α NTD NTD CTD CTD β β' α + S1 KH1 KH2 1 -137 348 -416 417 - 495 S1 KH1 KH2 1 -137 348 -416 417 - 495 S1 KH1 KH2 1 -137 348 -416 nut site RNA 417 - 495 NTD NTD CTD CTD β β' α S1 KH1 KH2 1 -137 348 -416 nut site RNA 417 - 495 NTD NTD CTD CTD β β' α D NusA+RNAP
INTRODUCTION 21 1.7 Thesis objectives Transcription is the primary regulatory process that is used by cells, tissues and organisms to facilitate and control the complex programmes of gene expression, cellular metabolism, and organ and tissue development. In the mechanisms of transcription termination and antitermination, participation of various Nus host factors and their interactions plays a significant role. Four N-utilization substances, NusA, NusB, NusE, and NusG, are important elongation/termination modulators. Transcription regulation through these Nus factors has been intensively studied in the expression of genes from lambdoid phages. In this context, a unique mechanism of transcription elongation control was found in Nun protein of bacteriophage HK022. One part of my work is focused on understanding the role of Nun in the termination complex by studying the interaction of HK022-Nun with various Nus host factors on a structural level by NMR. The other part of my project was mainly aimed at a better understanding of the regulation of RNA binding by NusA and the autoinhibition effect of NusA. Thus, this part of the work is targeted on ●1H, 13C, and 15N backbone resonance assignment of RNA binding domains of NusA (SKK domain). ●Analysis of the interaction between RNA binding domains of NusA and nut site RNA by NMR spectroscopy. ●NMR spectroscopy assessment of RNA binding inhibition by autoinhibition domain of NusA.
22 MATERIALS AND METHODS 2 Materials and Methods 2.1 Culture media The culture media was prepared using the ultra pure water (Filtering unit Milli-Q Biocel, 0.22 µm, Millipore, Eschborn) and heat sterilized at 121 °C (30 min, 1.2 bar, autoclave type 23, Varioklav, Melag, Berlin or Varioklav Dampfsterilisator, H+P labortechnik, Oberschleißheim). Prior to use, sterile filtered (0.2 µm filter, Sartorius, Goettingen) antibiotics were added to the medium as required. 2.1.1 Luria Bertani medium [Sambrook et al., 1989] Luria Bertani (LB) medium was prepared by dissolving 10 g of peptone, 5 g of yeast extract, and 10 g of NaCl in 1000 mL of water and set to autoclave. 2.1.2 Minimal medium (M9) [Sambrook et al., 1989; Meyer et al., 1983] Uniform labeling of proteins with 15N and 13C isotopes were achieved by growing the cells in minimal medium. To prepare a liter of M9 medium, 200 mL of 5 x M9 medium was diluted with 800 mL of autoclaved H2O and supplemented with 2 mL of TS2 - trace element solution [Meyer et al., 1983], 2 mL of 1 M MgSO4, 1 mL of 10 mM Fe (III)-citrate, 0.1 mL of 1 M CaCl2, 20 mL of 20 % (w/v) glucose and 10 mL of 100 x MEM vitamin solution (Gibco, Invitrogen, Karlsruhe). To produce 15N and 13C labeled proteins, 15N NH4Cl or 15N (NH4)2SO4 and 13C glucose were used as the sole nitrogen and carbon source respectively. Table 2.1 Components in the 5 x M9 and trace element stock solution. 5 x M9−Medium: Na2HPO4. 12 H2O 85.5 g KH2PO4 15.0 g NaCl 2.5 g NH4Cl add 1000 mL of H2O 5.0 g
MATERIALS AND METHODS 23 TS2: (components to be added to 1000 mL of H2O) ZnSO4 . 7 H2O 100 mg MnCl2 . 4 H2O 30 mg H3BO3 300 mg CoCl2 . 6 H2O 200 mg NiCl2 . 6 H2O 20 mg CuCl2 . 2 H2O 10 mg Na2MoO. 2 H2O 900 mg Na2SeO3 20 mg 2.1.3 P–5052 medium [Robert et al., 2005; Studier et al., 2005] All components for the medium were prepared using millipore water and were either filtersterilized (0.2 µm filter, Sartorius, Goettingen) or heat-sterilized (121 °C, 30 min, 1.2 bar, autoclave type 23, Varioklav, Melag, Berlin). P-5052 medium contains 2 mM magnesium sulphate, 1 x trace metals solution, 1 x 5052 solution, 1 x NPS solution, 1 x vitamin solution, and respective antibiotic. Stock solutions: 5000 x trace elements: The trace metal solution contains 50 mM FeCl3, 20 mM CaCl2, 10 mM MnCl2, 10 mM ZnSO4, 2 mM CoCl2, 2 mM CuCl2, 2 mM NiSO4, 2 mM Na2MoO4, 2 mM Na2SeO3 and 2 mM H3BO3. The solution was wrapped in an aluminum foil and stored at room temperature. 50 x NPS solution: 1.25 M Na2HPO4, 1.25 M KH2PO4 and 0.25 M Na2SO4. This preparation was prepared fresh, heat-sterilized and used within a week. [(An unlabeled 50 x NPS solution can be prepared by substitution of ammonium chloride as the nitrogen source (2.5 M NH4Cl)]. For labeling, the media contains 5 g of 15N NH4Cl (Cambridge Isotope Laboratories, Andover, USA) per liter. 50 x 5052 solution: 25 % glycerol (v/v), 2.5 % glucose (w/v) and 10 % lactose (w/v). This preparation was prepared fresh and heat-sterilized.
24 MATERIALS AND METHODS 2.2 Estimation of protein concentration A measure of protein and nucleic acid concentration was obtained upon monitoring the absorbance at 280 nm and 260 nm respectively. Absorption was measured either in a black wall quartz cuvette (Hellma, Müllheim) with a thickness of 1 cm, using a Helios γ spectrophotometer (Thermo spectronic, Cambridge, UK) or else in the Nanodrop ND-1000 instrument (Peqlab Biotechnology GmbH, Germany). After measuring, the protein concentration was then determined by applying Beer-Lambert’s law [Ingle et al., 1988] as follows which is related to the amount of light absorbed by the sample. A (λ) = ε. c. b [2.1] Where A (λ) = measured absorbance at 280 nm ε = molar extinction coefficient (M-1 cm-1) c = concentration of the substance that absorbs light (M) b = path length of the sample cell (cm) Molar extinction coefficients [Gill et al., 1989] of proteins and nucleic acids were obtained from amino acid analysis using ProtParam Tool (ExPASy, Expert Protein Analysis System proteomics server, Swiss institute of Bioinformatics, www.expasy.che, Switzerland). 2.3 SDS – polyacrylamide gel electrophoresis [Laemmli 1970] The analytical electrophoresis of proteins was carried out in polyacrylamide gels under the conditions that ensure dissociation of the proteins in to their individual polypeptide subunits. Thereby the molecular mass of the protein was determined by eletrophoresing it together with “marker” protein of known molecular masses that bracket that of the protein of interest [Voet et al., 2nd edition]. In this technique, the proteins were separated on a porous supporting material prepared by cross linking acrylamide by N-N methylene bis-acrylamide. Initially the proteins were denatured by heating them at 95 °C for 10 min in a buffer containing sodium dodecyl sulphate [(SDS)-an ionic detergent] and β-mercaptoethanol (reducing reagent). The gels (10 x 8 x 0.75 cm) were electrophoresed in Mighty small SE250/260 gel electrophoresis chambers (Hoefer, San Francisco, CA, USA) at a constant voltage of 30 mA.
MATERIALS AND METHODS 25 The SDS gel has two distinct zones, a stacking gel overlaying a separation gel, both of Tris buffered system. The two zones are characterized by their porosity and pH conditions. The compositions for the preparation of two gels are mentioned in Table 2.2. Table 2.2 Ingredients for 19 % Sodium dodecyl sulphate polyacrylamide gel (SDS-PAGE). 19 % SDS gel Separation gel Stacking gel Na2SO3 50 mg - H2O 2.13 mL 8.70 mL 0.5 M Tris/HCl; pH 6.8 - 5.0 mL 3 M Tris/HCl; pH 8.8 3.75 mL - 30 % (w/v) Acrylamide rotiphorese® Gel A (Roth, Karlsruhe) 18.50 mL 2.6 mL 2 % (w/v) Bisacrylamide rotiphorese® Gel B (Roth, Karlsruhe) 7.70 mL 1.08 mL 10 % SDS 0.3 mL 0.2 mL TEMED 20 µL 20 µL 10 % (w/v) APS 200 µL 200 µL The separated proteins were visualized by Coomassie Brilliant Blue staining [Wilson 1983] and destaining with concentrated methanol : acetic acid solution. The gel after destaining was photographed using a Gel document system (GEL DOC 2000, Biorad, Munich). 2.4 Schagger and Jagow gel electrophoresis [Schagger et al., 1987] The most generally used technique to visualize the polypeptides with masses below about 15 kDa is the one developed by Schagger and von Jagow. This technique employs a discontinuous gel system containing SDS. However, the interference of SDS with the stacking and separation of small polypeptides is diminished by changing the trailing ion (in the cathode buffer) from glycine to the more mobile Tricine (N-tris[hydroxymethyl]-methylglycine) [Wisdom 1997] and by lowering the pH of the separating gel. The separation gel consists of 16.5 % T and 6 % C in 1 M Tris/HCl, pH 8.45, 0.1 % (w/v) SDS and 6 M urea. The stacking gel comprises 4 % T and 6 % C in 0.775 M Tris/HCl, pH 8.45 and 0.1 % (w/v) SDS. The polymerization was initiated by addition of 10 µL of TEMED and 100 µL of 10 % (w/v) APS for 20 mL gel solution.
26 MATERIALS AND METHODS The upper part of the electrophoresis instrument was filled with cathode buffer (0.1 M Tris/HCl, pH 8.25, 0.1 M Tricine, 0.1 % (w/v) SDS and the base is filled with anode buffer (0.2 M Tris/HCl, pH 8.9). A constant voltage of 28 mA was applied until the samples reached the end of the stacking gel and then the voltage is increased to 40 mA. For the estimation of the molecular weight in gels, Fluka molecular weight standard (Fluka, New-Ulm) or Peptide marker kit (GE Healthcare life sciences, Germany) was used. Staining and destaining of the gels were carried out in the same manner as that of SDS-PAGE. 2.5 HK022 Nun protein 2.5.1 Expression of Nun Nun full length construct (1-112) was expressed in the E. coli BL21(DE3). Pre-inoculum was developed by inoculating the glycerol stock with 200 mL of LB medium containing ampicillin antibiotic (1 μg/mL) and incubating overnight at 37 °C. Expression of protein was carried out by inoculating 1.2 liter of LB medium containing ampicillin antibiotic with overnight culture so as to have an initial concentration of cells corresponding to OD600 (Optical density at 600) of about 0.1. The culture was then incubated with shaking (170 rpm) (C25KC Incubator shaker, New Brunswick Scientific, Edison, NJ, USA) at 37 °C, until the culture has reached the mid-log phase of the growth (OD600 ~0.8). The expression was then induced by addition of 1 mM isopropyl-β-D-thiogalactopyranoside (IPTG) (GERBU, Gaiberg). The cells were allowed to grow till the stationary phase (~4 h) and were then harvested by centrifuging (Centrikon T-124, Rotor A 6.9, Kontron, Eching) at 6000 rpm (5000 g), 4 °C for 30 min. The cell pellets were washed with 50 mM Tris-HCl, pH 8.0 and were harvested again by centrifugation. The cells obtained are then stored at –80 °C until further use. 2.5.2 Cell lysis and purification of HK022 Nun Preparation of cell extract Frozen cell pellets were resuspended in lysis buffer (50 mM Tris-HCl, pH 8.0, 2 mM ethylenediaminetetraacetic acid (EDTA), 1 mM phenylmethylsulfonylflouride (PMSF), 5 mM Dithiothreitol (DTT), 0.2 mg/mL deoxyribonuclease I (DNase I), one protease inhibitor tabletEDTA free (Roche, Mannheim). The cells were freeze and thawed three times. After freeze
MATERIALS AND METHODS 27 and thaw, the suspension was stirred on ice for 30 min. The cell suspension was sonified for 2 times of each 1 minute with ultrasound (Duty cycle 0.5, 200 Watt, Sonifier Labsonic U, B. Braun Biotech International, Melsungen) with 10 min pause in between each step. Cellular debris was cleared from the cell lysate by centrifuging (Biofuge Stratus, Rotor 3334, Heraeus) at 4 °C, 13000 rpm (19000 g) for 30 min. The cleared lysate was filtered (Minisart Sterilfilter, 0.45 μm, Sartorius, Goettingen) and used for the purification. Purification All the buffers used were filtered and degassed before purification. Binding buffer : 50 mM Tris-HCl, pH 8.0, 2 mM EDTA Elution buffer : 50 mM Tris-HCl, pH 8.0, 2 mM EDTA, 2 M NaCl HK022-Nun was purified by employing cation exchange chromatography. The ÄKTA purifier 10-system (Amersham Biosciences, Freiburg) was used to purify the protein with a HiTrapTM Heparin column (5mL ~ 1 CV) (Amersham Biotech). The column was equilibrated with 10 CV of Binding buffer. The combined supernatant after centrifugation were applied on the heparin column at a flow rate of 1mL/min. Flow through was collected in each step. The column was washed with buffer A for 5 CV or more to remove unbound proteins. The bound protein was then eluted by buffer B with a step gradient of 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, and 100 % respectively. Fractions collected during the elution were analyzed by SDSPAGE (2.3). High-performance liquid chromatography (HPLC) [Horvath et al., 1967] Fractions containing Nun which were identified on a 19 % SDS-polyacrylamide gel were pooled and subjected to HPLC (Kontron, Eiching) for further purification. Buffer A: 0.1 % TFA in millipore water Buffer B: 0.1 % TFA, 80 % acetonitrile in millipore water Purification was carried out by using a HPLC C-18 column (PrepLCTM 25 mm Module, Waters, Milford, Massachusetts, USA) by applying a slow linear gradient. Fractions containing Nun were kept in the speedvac (ABM Greiffenberger, Marktredwitz) to dry. The dried samples were stored in the cold room till further use.
34 MATERIALS AND METHODS 2.8 NusA acidic repeat 1 (NusA ar1) 2.8.1 Expression of NusA ar1 NusA ar1 (cloned by Dr. Stefan Prasch, Department of Biopolymers, University of Bayreuth) was expressed in E. coli BL21(DE3). The expression of 15N labeled NusA ar1 was carried out as spar-preparation [Marley et al., 2001]. The cells were grown in 2 x 2 L LBamp medium until OD600 reached 0.8. Cells were then centrifuged at 16 °C, 6000 rpm (5000 g) for 15 min (Centrikon T-124, Rotor A 6.9, Kontron, Eching) and the cell pellet was washed with 500 mL of wash buffer (6.4 g Na2HPO4, 1.5 g KH2PO4 and 0.25 g NaCl). After washing, it was subjected to centrifugation at 16 °C, 6000 rpm (5000 g) for 15 min and the cell pellets were resuspended in 1 L of 1 x M9 minimal medium containing 15NH4Cl and all the additives. Later the cells were incubated at 37 °C for 1 h with shaking at 170 rpm. After 1 h, the cells were induced by 1 mM IPTG. After 4 h of induction the cells were harvested by centrifuging at 6000 rpm, 4 °C for 15 min. Cell pellets were resuspended in binding buffer (20 mM sodium phosphate, pH 7.4, 500 mM NaCl and 1 mM DTT) and stored at -80 °C until further use. 2.8.2 Cell lysis and purification of NusA ar1 Preparation of cell extract The cell pellets were freeze / thawed three times. After freeze and thaw, added 0.2 µg/mL DNase I and 0.2 µg/mL lysozyme and stirred on ice for 45 min. The cell suspension was sonified (Sonifier Labsonic U, B. Braun Biotech International, Melsungen) 2 x 1 minute with 0.9 pulse and 90 % amplitude and 1 x 10 min with 0.5 pulse and 60 % amplitude with 1 min pause on ice and stirring in between each step. The cell lysate was then centrifuged at 4 °C, 13000 rpm (19,000 g) for 30 min to clear the cellular debris. After centrifugation the cleared lysate was filtered by using a syringe filter of pore size 0.45 µM. Purification Binding buffer for Histrap : 20 mM sodium phosphate, pH 8.0, 500 mM NaCl, 1 mM DTT Elution buffer for Histrap : 20 mM sodium phosphate, pH 8.0, 500 mM NaCl, 1 mM DTT, 1 M imidazole
MATERIALS AND METHODS 35 The recombinant protein was purified by nickel affinity chromatography (5 mL Histrap chelating column, Amersham Biosciences, Freiburg). The supernatant was loaded onto a Niion affinity column with a flow rate of 1 mL/min and eluted by applying a imidazole step gradient. The eluted fractions were analyzed by Schagger-Jagow gel. Peak fractions containing NusA ar1 were pooled and dialyzed (Spectra/Por dialysis tubing (MWCO-3500), 6.4mL/cm, Roth, Karlsruhe) against 50 mM Tris/HCl, pH 8.0, 150 mM NaCl and 1 mM DTT overnight. After dialysis, N-terminal deca-Histidine tag was cleaved off using PreScission protease (1 unit for 100 µg) by incubating the enzyme with the dialyzed fractions overnight with gentle shaking. The cleaved sample was then dialyzed against 50 mM Tris/HCl, pH 7.4, 1 mM DTT overnight. Further purification was carried out by loading the sample onto a 5 mL HiTrapTM QXL column (Amersham Biosciences, Freiburg). Binding buffer for QXL : 50 mM Tris/HCl, pH 7.4, 1 mM DTT Elution buffer for QXL : 50 mM Tris/HCl, pH 7.4, 1 mM DTT, 1 M NaCl The sample was eluted from the QXL column by a NaCl step gradient and the eluted fractions were pooled and concentrated using Vivaspin concentrators of MWCO–5000 (Vivascience AG, Hannover, Germany). Concentration was carried out by centrifuging the concentrators at 4 °C, 5000 rpm (Universal 320R, Rotor 1494, Hettich). 2.9 NusA acidic repeat 2 (NusA ar2) 2.9.1 Expression of NusA ar2 The recombinant NusA ar2 construct was cloned in pET 19b (by Dr. Stefan Prasch, Department of Biopolymers, University of Bayreuth) and expressed in E. coli BL21 (DE3). Pre-day culture was grown in 50 mL LB with 0.1 mg/mL ampicillin for 8 h at 37 °C, 180 rpm (Incubator shaker Certomat HK/R, B. Braun Biotech International, Melsungen) and then transferred into 500 mL of LB and grown overnight at 37 °C. 5 L of LBamp was inoculated with the overnight culture to a start OD600 of ~ 0.2, and grown at 37 °C until the OD600 reached 0.8. The gene expression was induced for 4 h with 1 mM IPTG. 4 h after induction, cells were harvested by centrifugation at 4 °C, 6000 rpm (5000 g) for 10 min (Centrikon T-124, Rotor A 6.9, Kontron, Eching) and pellet was resuspended in binding buffer and stored at -80 °C for further use. Gene expression was monitored by Schagger-Jagow gel analysis.
36 MATERIALS AND METHODS 2.9.2 Cell lysis and purification of NusA ar2 Cell lysis and purification Cells were resuspended in (4 mL/g) 20 mM sodium phosphate buffer, pH 7.4, 500 mM NaCl, 1 mM DTT. After three freeze–thaw cycles, lysozyme, DNase I and one protease inhibitor cocktail tablet were added and the suspension was stirred on ice for 30 min. The cell suspension was sonified (Sonifier Labsonic U, B.Braun Biotech International, Melsungen) for 3 x 1 min, pulse 0.9, 100 % amplitude. After sonication the cell extract was centrifuged (Biofuge Stratus, Rotor 3334, Heraeus) for 45 min at 4 °C, 13,000 rpm (19,000 g) to separate the cell debris. The supernatant was filtered using Minisart Sterilfilter, 0.45 μm. Purification of the fusion protein was performed by a step gradient using nickel ion affinity (10 mL Histrap column, Amersham Biosciences, Freiburg, Germany) chromatography by a ÄKTA purifier system. Binding buffer : 20 mM sodium phosphate, pH 7.4, 500 mM NaCl, 1 mM DTT Elution buffer : 20 mM sodium phosphate, pH 7.4, 500 mM imidazole, 1 mM DTT The filtered supernatant was loaded onto the column with a flow rate of 1 mL/min. After loading the sample, the column was washed with 5 CV of binding buffer and eluted with a imidazole step gradient. Fractions containing NusA ar2 were pooled, dialyzed against 50 mM Tris/HCl, pH 8.0, 500 mM NaCl, 1 mM DTT and cleaved with PreScission protease (1 unit for 100 µg protein) overnight at 4 °C. To further purify the protein and to remove the NaCl, the cleaved sample was dialyzed against 50 mM Tris/HCl, pH 7.4, 1 mM DTT overnight in the cold room. The dialyzed sample was loaded onto a 5 mL Q XL column connected in tandem to a 5 mL GST column. After loading, the column was washed with 5 CV of binding buffer and eluted by a NaCl gradient. Binding buffer: 50 mM Tris/HCl, pH 7.4, 1mM DTT Elution buffer : 50 mM Tris/HCl, pH 7.4, 1mM DTT, 1 M NaCl Fractions eluted were analyzed by Schagger-Jagow gel. The pure fractions were then dialyzed against NMR buffer (50 mM sodium phosphate buffer, pH 7.6, 100 mM NaCl, 10 mM βmercaptoethanol, 1 % glycerol (v/v), 0.5 mM EDTA) overnight and concentrated in Vivaspin concentrators with a MWCO-5000 (Vivascience, Stonehouse, UK).
MATERIALS AND METHODS 37 2.10 S1+KH1+KH2 domain of NusA (SKK) 2.10.1 Expression of SKK The NusA RNA binding domains containing amino acid 132–348 referred as SKK was cloned via BamHI and NdeI restriction sites in to the E. coli expression vector pET11a (Dr. Stefan Prasch, Department of Biopolymers, University of Bayreuth). The N-terminal His6 tagged SKK domain was expressed and purified according to the published protocols [Mah et al., 1999; Mah et al., 2000] with minor changes. To study the interaction of NusA with nut RNA, construct (SKK) lacking the N-terminal domain and the two acidic repeat domains was used, since these regions are not directly involved in RNA binding [Mah et al., 2000]. For the expression of unlabeled SKK, plasmid pET 11a-SKK domain was transformed into E. coli BL21(DE3) host cells. The pre-inoculum was set by growing the strain harboring the recombinant plasmid in 100 mL LB medium at 37 °C containing ampicillin antibiotic. The pre-culture was used to inoculate 2 L of LB medium to an OD600 of 0.2. Cells were then incubated at 37 °C, 170 rpm (C25KC Incubator shaker, New Brunswick Scientific, Edison, NJ, USA). At an OD600 of 0.6, expression was induced by addition of 0.1 mM IPTG followed by incubation at 37 °C for 4 h. To monitor the expression, aliquots containing equal amounts of cells were taken from the culture every hour and applied to a Schagger-Jagow gel. Cells were harvested 4 h after induction by centrifugation (Centrikon T-124, Rotor A 6.9, Kontron, Eching) at 6000 rpm (5000 g) for 15 min at 4 °C and the cell pellet was stored at −80 °C. Increasing molecular size of the protein leads to crowded spectra, increase in number of resonances, faster relaxation, broad lines, low intensity, overlapping signals, and long experiment time. So in order to improve the resolution and sensitivity of the NMR spectra in triple resonance experiments and in the binding studies, deuterated SKK was prepared. Deuterated 15N-labeled samples were expressed in cells grown on M9 minimal media containing 1.5 g/L 15N (NH4)2SO4 and 2 g/L glucose. While preparing 13C,15N labeled samples the unlabeled glucose was replaced by 2 g/L of 13C glucose. In order, to optimize the expression of SKK domain, cell cultures were adapted to grow in D2O by increasing the amount of D2O in the M9 minimal medium from 0 to 100 % with each growth cycle. To produce deuterated SKK, five pre-cultures with increasing D2O content were grown prior to inoculation of the main culture. At first, an overnight pre-culture was set at 37 °C in LB
38 MATERIALS AND METHODS containing ampicillin antibiotic (100 µg/mL). Further cultures were grown at 37 °C in M9 minimal medium with increasing D2O concentration of 25 %, 50 %, 75 %, and 100 % respectively. All of the cultures were maintained at subsaturating cell densities, with A600 typically below 0.6. Each pre-culture was inoculated to an OD600 of 0.2 with the respective amount of the preceding pre-culture. The final cell culture containing ~ 100 % D2O was induced with 0.1 mM IPTG when the culture density reached A600 = 0.6 and grown for further 4 h before harvesting. Cells were pelleted at 6000 rpm (5000 g) (Centrikon T-124, Rotor A 6.9, Kontron, Eching) for 10 min and stored at -80 °C overnight. 2.10.2 Cell lysis and purification of SKK domain Cell lysis and purification Frozen cell pellets were thawed and resuspended in cell lysis buffer (20 mM Tris/HCl, pH 7.9, 500 mM NaCl, 10 % glycerol (v/v), 5 mM β-mercaptoethanol; 10 mL/g pellet). The cell suspension was shock freezed three times. Lysozyme, DNase I (0.1 mg/mL) and one protease inhibitor cocktail tablet (Complete, EDTA free, Roche) were added to the suspension. Now the cell suspension was stirred on ice for 30 min and followed by sonication (Sonifier Labsonic U, B. Braun Biotech International, Melsungen) on ice. The cells were sonicated 4 x 1 minute with 1.0 pulse and 100 % amplitude with 1 minute pause on ice and stirring in between each step. The lysate was then centrifuged (Biofuge Stratus, Rotor 3334, Heraeus) at 13,000 rpm (19,000 g) for 45 min at 4 °C. The supernatant was filtered by using a syringe filter of pore size 0.45 µM. Purification of the soluble his-tagged protein was performed by nickel ion affinity chromatography on an ÄKTA purifier 10-FPLC system. The supernatant was loaded on a 5 ml Histrap column (Amersham Biosciences, Freiburg, Germany) at 1 mL/min which was pre-equilibrated with cell lysis buffer. Binding buffer :10 mM HEPES, pH 7.6, 100 mM NaCl, 10 % glycerol (v/v), 5 mM βmercaptoethanol Elution buffer : 10 mM HEPES, pH 7.9, 100 mM NaCl, 10 % glycerol (v/v), 5 mM βmercaptoethanol, 300 mM imidazole
MATERIALS AND METHODS 39 The column was first washed with 10 CV of cell lysis buffer followed by 10 CV of binding buffer. After the washing step, the bound protein was eluted by applying a imidazole step gradient consisting of 5, 10, 20, 50, 80, and 100 % elution buffer. The fractions containing protein were dialyzed (Spectra/Por, MWCO 3500, ROTH, Karlsruhe, Germany) against 5 L of 50 mM sodium phosphate buffer, pH 7.6, 100 mM NaCl, 10 mM β-mercaptoethanol, 0.5 mM EDTA, and 1 % glycerol (v/v). The sample was dialyzed 3 times against 5 L of the above mentioned buffer. The first two dialysis step was done for 5–6 hours and the final dialysis step was done overnight. All the dialysis steps were carried out at 4 °C. After the dialysis, the protein sample was concentrated using vivaspin concentrators of MWCO–5000 Da (Vivascience AG, Hannover, Germany). The concentration was carried out by centrifuging the concentrators at 4 °C, 5000 rpm (Universal 320R, Rotor 1494, Hettich) till a concentration of 400 – 500 µM was reached. The concentrated sample was stored at -80 °C till further use. 2.11 NusG 2.11.1 Expression of NusG BL21 (DE3) cells were transformed with pET 11a/NusG in LB medium containing ampicillin antibiotic and grown with shaking at 170 rpm (Incubator shaker Certomat HK/R, B. Braun Biotech International, Melsungen) overnight. Expression was carried out by inoculating 1.2 L of LB medium containing ampicillin antibiotic with the overnight culture so as to have an initial concentration of cells corresponding to OD600 of about 0.1. The culture was then incubated with shaking (170 rpm) at 37 °C (C25KC Incubator shaker, New Brunswick Scientific, Edison, NJ, USA), until the culture has reached the mid-log phase of the growth (OD600 ~0.7). At this point the expression was induced by the addition of 1 mM IPTG. The cells were then allowed to grow till the stationary phase (~4 h) and were then harvested by centrifuging at 6000 rpm, 4 °C for 30 min (Centrikon T-124, Rotor A 6.9, Kontron, Eching). The cell pellets were stored at –80 °C until further use. Expression analysis was carried out by 19 % SDS page.
40 MATERIALS AND METHODS 2.11.2 Cell lysis and purification of NusG Preparation of cell extract and purification [Pasman et al., 2000] The cell pellets were resuspended at 10 mL/g of lysis buffer (20 mM Tris-HCl, pH 7.8, 3 mM EDTA, 1 mM DTT, 100 mM NaCl, 1mM PMSF, lysozyme, DNase I, protease inhibitor cocktail tablet (Complete, EDTA-free, Roche Diagnostics GmbH, Mannheim). After resuspending the cells were incubated for 10 min at 22 °C (Thermomixer 5436, Eppendorf), and then 20 min on ice. Sodium deoxycholate was added to a final concentration of 0.06 % (w/v), and the resulting solution was incubated for 20 min on ice. After incubation, NaCl was added to a final concentration of 0.3 M from a stock solution of 4 M and stirred for 10 min on ice. The lysate was sonicated 4 times for 30 s at room temperature by applying 0.7 pulse and 70 % amplitude with 3 min on ice between each sonication treatments. Polymin P was added drop wise (from a stock solution of 10 % at pH 7.8) with stirring to a final concentration of 0.6 %, after which the lysate was incubated for 30 min on ice and the lysate was sonicated once again as previously mentioned. After sonication the sample was centrifuged at 13,000 rpm (19,000 g) for 30 min (Biofuge Stratus, Rotor 3334, Heraeus). Saturated ammonium sulphate solution at pH 8.0 was prepared (515,3g/L at 4 °C). Ammonium sulfate at 50 % of saturation was added to the supernatant drop wise, with stirring. After this, the sample was incubated for 30 min on ice. The lysate was centrifuged for 30 min at 13,000 rpm (Biofuge Stratus, Rotor 3334, Heraeus) at 4 °C and the pellet was resuspended in 30 mL (for 1 L culture volume) of buffer Q (10 mM Tris-HCl, pH 7.8, 1 mM EDTA, 1 mM DTT, 5 % glycerol (v/v)). The lysate was then dialyzed against 4 x 1 L of buffer Q for a total of 16 h and after dialysis the solution was spunned at 13,000 rpm (Biofuge Stratus, Rotor 3334, Heraeus) for 30 min and the supernatant was filtered using a syringe filter of pore size 0.45 µM and applied onto HiTrapTM QXL column (Amersham Biosciences, Freiburg) at a flow rate of 0.5 mL/min. Binding buffer : 10 mM Tris-HCl, pH 7.8, 1 mM EDTA, 1 mM DTT, 5 % glycerol (v/v) Elution buffer : 10 mM Tris-HCl, pH 7.8, 1 mM EDTA, 1 mM DTT, 5 % glycerol (v/v), 200 mM NaCl Washed the column with 10 CV of binding buffer and then eluted with a linear of 0-200 mM NaCl gradient. Pure fractions were pooled and concentrated with Vivaspin concentrators.
MATERIALS AND METHODS 41 2.12 NusB 2.12.1 Expression of NusB To produce NusB, auto-induction of recombinant protein expression, a method introduced by Studier [Studier 2004; Grabski et al., 2003] was carried out. Expression plasmids were transformed into E. coli BL21 DE3, by electroporation (MicroTM Pulser, BioRad, Munich). The transformed cells were then plated on a LB agar plate with kanamycin antibiotic and grown overnight at 37 °C. In the morning, a single colony was picked from the transformation plate and transferred into a culture tube containing 20 mL of P-5052 medium (2.1.3). The culture was grown at 37 °C with shaking at 170 rpm overnight (Incubator shaker Certomat HK/R, B. Braun Biotech International, Melsungen). On the next day, 10 mL of the overnight culture was used to inoculate 1 L of 1 x P-5052 medium. Cells were grown at 37 °C till it reaches an OD600 of 0.5 and then transferred to 20 °C and allowed to grow overnight. From the overnight culture the cells were harvested by centrifugation at 6000 rpm for 15 min and the cell pellets were resuspended in the lysis buffer (20 mM of 50 mM Tris/HCl, pH 7.5, 150 mM NaCl) and stored at -80 °C. 2.12.2 Cell lysis and purification of NusB Preparation of cell extract Frozen cell pellets were freeze/thawed three times. After adding one protease inhibitor tablet, 0.2 mg/mL DNase I and 0.2 mg/mL lysozyme, the cell lysate was stirred on ice for 45 min. The sample subjected to sonication (0.5 pulse and 100 % amplitude) for 5 x 1 minute. The crude cell lysate was centrifuged at 4 °C with 13,000 rpm for 30 min. After sonication, to the supernatant added 20 mM imidazole as an end concentration and filtered the sample via syringe filters of pore size 0.45 µM. Purification Binding buffer (A1) : 50 mM Tris/HCl, pH 7.5, 150 mM NaCl and 20 mM imidazole Binding buffer (A2) : 50 mM Tris/HCl, pH 7.5, 150 mM NaCl and 50 mM imidazole Elution buffer (B) : 50 mM Tris/HCl, pH 7.5, 150 mM NaCl and 500 mM imidazole
42 MATERIALS AND METHODS Histrap chelating column, was equilibrated with 10 CV of buffer A1. The cleared lysate was loaded onto the column with a very slow flow rate of 0.2 mL/min. The column was washed with buffer A2 for about 10 CV and eluted with a step gradient by using the buffer B. The peak fractions containing NusB were pooled and dialyzed against 50 mM Tris/HCl, pH 7.5, 10 mM NaCl, 2 mM DTT, and TEV protease to cleave the N-terminal histidine tag. The cleaved sample was further loaded onto the histrap column and the flow through was collected. The flow through was pooled and dialyzed against 50 mM Tris/HCl, pH 7.5. The dialyzed sample was loaded onto the QXL column for further purification. Binding buffer for QXL : 50 mM Tris/HCl, pH 7.5 Elution buffer for QXL : 50 mM Tris/HCl, pH 7.5, 1 M NaCl The loaded protein was then eluted with a step gradient ranging from 0 to 1 M NaCl. The corresponding fractions containing pure protein were pooled, dialyzed against water and subjected to lyophilization. 2.13 RNA oligonucleotide In vitro transcription and RNA preparation All RNAs were prepared by in vitro transcription from synthetic DNA templates (IBA GmbH, Göttingen, Germany) using a single polypeptide chain enzyme-T7 polymerase. The sequence of the nutL DNA template was (GCC CTT CTT CAG GGC TTA ATT TTT AAG AGC GCT ATA GTG AGT CGT ATT A) and the nutR was (GCC CTT TTT CAG GGC TGG AAT GTG TAA GAG CGC TAT AGT GAG TCG TAT TA) respectively. The transcription cocktail contains 100 µM DNA template, 20 mM of each NTP's, 0.5 M of MgCl2, 40 % PEG 8000, 200 µM T7 promoter, 0.1 mg/mL of T7 RNA polymerase enzyme and 10 x transcription buffer which contains (40 mM Tris-HCl pH 8.1, 50 mM DTT, 10 mM spermidine, 0.1 % (v/v) Triton X-100) was set to a total volume of 5 ml and incubated for 4 h at 37 °C (Incubator Model 200, Memmert, Schwabach). The reaction was quenched by adding 0.2 M EDTA, pH 8.0. The reaction mixture was precipitated by adding 3 M sodium acetate, pH 5.3 and 100 % chilled ethanol and incubated overnight at -80 °C. Later, the sample was centrifuged for 30 min at 5000 rpm. The pellet was subjected to speedvac (ABM Greiffenberger Antriebstechnik, Marktredwitz) for drying.
MATERIALS AND METHODS 43 The dried sample was dissolved by heating with 8 M urea at 95 °C (Block thermostat BT100, Kleinfeld labortechnique, Gehrden) for 5 min. The RNA was purified on denaturing 20 % polyacrylamide gels containing 8 M urea by an overnight run. 600–1000V constant by a Multidrive XL (Amersham Biosciences, Freiburg) was used for running the RNA gel. Product bands were cut from the gel using UV shadowing. The RNA was electroeluted using a Schleicher and Schuell electroelution apparatus and subsequent ethanol precipitation. To remove multivalent ions and other low molecular weight impurities the RNA sample was first dialyzed against 10 mM potassium phosphate, pH 6.4, 100 mM NaCl, 5 mM EDTA and then finally dialyzed against water. RNA was quantified by UV absorption at 260 nm wavelength. The extinction-coefficient of the RNAs were obtained from http://www.ambion.com/techlib/misc/oligo_calculator.html. The RNA sample was lyophilized and stored at -20 °C till further use. Approximately five reactions on a 5 mL scale yielded around 6–7 mg of purified RNA. 2.14 NMR spectroscopy 2.14.1 NMR sample preparation NMR samples were prepared by dialyzing the purified protein against the respective NMR buffer. After dialysis, the samples were either concentrated with Vivaspin concentrators (Vivascience AG, Hannover, Germany). For the interaction study of Nun with various Nus factors (NusA ar1, NusB, NusG) either buffer containing 10 mM KPO4, pH 6.4, 50 mM NaCl or buffer with 50 mM NaPO4, pH 7.0, 50 mM NaCl was used. NMR samples of SKK domain were prepared in 50 mM sodium phosphate, pH 7.6, 100 mM NaCl, 10 mM β-mercaptoethanol, 0.5 mM EDTA and 1 % glycerol (v/v). All the NMR samples contained 0.04 % sodium azide as an antimicrobial agent, 2 x complete protease inhibitor tablet from a stock of 25 fold (prepared by dissolving one tablet in 2 ml of sterile water) and 10 % (v/v) D2O for the field frequency lock. The total volume was adjusted to 550 µL or 600 µL and the solution was then transferred to a 5 mm ultra precision NMR tubes (Norell, Landsville, NJ, USA).
50 MATERIALS AND METHODS Table 2.4 Summary and parameters of all NMR experiments recorded for the interaction studies and for the backbone assignment of SKK domain. Dimension Resonance NS SW (Hz) TD SF0 (MHz) Reference 1H15N-HSQC F1 15N 1155.54 192 F2 1H 16/32 7788.16 1024 600 [1, 2] 1H15N-HSQC F1 15N 1905.49 256 F2 1H 16/32 10416.67 1024 800 [1, 2] TROSY F1 15N 1864.98 256 F2 1H 8 11160.71 1024 800 [3] HNCO F1 13C 2817.19 80 F2 15N 1864.90 64 F3 1H 8 10416.67 1024 800 [4] HNCA F1 13C 6036.12 96 F2 15N 1864.98 64 F3 1H 16 10416.67 1024 800 [4] HNCACB F1 13C 13078.08 128 F2 15N 1864.98 64 F3 1H 16 11160.71 1024 800 [5]
MATERIALS AND METHODS 51 Dimension Resonance NS SW (Hz) TD SF0 (MHz) Reference HN(CO)CACB F1 13C 13078.08 128 F2 15N 1864.98 64 F3 1H 16 11160.71 1024 800 [4] HN(CA)CO F1 13C 2615.96 64 F2 15N 2108.24 64 F3 1H 16 10416.67 1024 800 [6] HN(CO)CA F1 13C 6036.12 72 F2 15N 1864.98 64 F3 1H 8 11160.71 1024 800 [7] 1H15N1H-NOESY F1 1H 10401.74 256 F2 15N 1864.98 64 F3 1H 8 10416.67 1024 700 [8] 15N15N1H-NOESY F1 15N 1864.98 64 F2 15N 1864.98 64 F3 1H 32 10416.67 1024 700 [9] SW = spectral width (Hz) in the observe dimension; TD = total number of data points being acquired; SF0 = spectrometer frequency used; NS = number of scans. (1) [Mori et al., 1995]; (2) [Vuister et al., 1992]; (3) [Kojima et al., 2000]; (4) [Grzesiek et al., 1992b]; (5) [Wittekind et al., 1993]; (6) [Clubb et al., 1992]; (7) [Bax et al., 1991]; (8) [Sekhar et al., 1996]; (9) [Ikura et al., 1990].
52 MATERIALS AND METHODS 2.14.5 Protein-Protein, Protein-RNA interaction studies NMR is very well suited to the study of protein-protein and protein-RNA interactions. To study the interactions we carried out titrations, because this allows, in addition to the mapping of the interface, a good estimation of the affinity, stoichiometry, and specificity of binding as well as the kinetics of binding [Zuiderweg 2002]. In a nutshell, the 15N-1H HSQC or 15N-1H TROSY spectrum of one protein is monitored when the unlabeled interaction partner is titrated in, and the perturbations of the chemical shifts are recorded. The interaction causes environmental changes on the protein interfaces and, hence, affect the chemical shifts of the nuclei in this area [Pellacchia et al., 2000; Steven et al., 2001]. The chemical shifts of the labeled protein change during the titration is determined by the kinetics of the interaction. If the complex dissociation is very fast, then the resonances of the nuclei at the interface move in a continuous fashion during the titration. This regime is referred to as “fast chemical exchange” and is often observed for weaker interactions [Hall et al., 2001]. The trajectories of the shifting resonances in fast exchange are informative. If all two-dimensional trajectories are linear and occur at the same rate, a single binding event is indicated. If the trajectories for different resonances occur at a different rate, and/or if they are curved, more than one binding site is implicated. If the complex dissociation is very slow, we observe one set of resonances for the free protein and one set for the bound protein. During the titration, the “free set” will disappear and will be replaced by the bound set. Most of the resonances of the two sets will overlap with each other, but the differences will mark the interaction interface. This regime is referred to as “slow chemical exchange”. In slow exchange one does not automatically know to which new location the resonance has moved, unless one carries out an independent assignment procedure for the bound state. Consequently, we cannot easily quantitate the degree of change. One approach for this problem is to assume that the new resonance which appears closest to the “free” resonance corresponds to its bound state [Williamson et al., 1997; Muskett et al., 1998]. In the slow exchange case, the binding constant can still be quantitated by measuring the intensities of the disappearing and/or appearing peaks as a function of the titration progression [Van nuland et al., 1993].
MATERIALS AND METHODS 53 In the “intermediate chemical exchange” the frequencies of the changing resonances become poorly defined, and extensive kinetic broadening sets in [Zuiderweg et al., 1981]. If the lines become broad enough, the resonances may disappear from the NMR spectrum. Here, the interaction interface become delineated by progressively disappearing resonances. Depending on the nature of the exchange process, the different environments undergoing exchange will be characterized by different values of the NMR parameters: chemical shift, coupling constant and relaxation rates. If the measured variable is chemical shift, with exchange occurring between two environments characterized by shifts δA and δB, then the three exchange regimes are defined by [Jeremy 1995]. Slow exchange K << | δA - δB| Intermediate exchange K ≈ | δA - δB| Fast exchange K >> | δA - δB| Generally a rule of thumb is that the interaction with Kd < 10 µM are in slow exchange and intermediate/fast exchange otherwise. However, there are always many exceptions. During this study 1H-15N labeled samples of Nun-full length, Nun N-terminal domain, Nun Cterminal domain, NusA ar1, NusG, NusB, and 2H-15N labeled sample of SKK domain were used to study the interaction with their respective interactive partners. The most common experiment carried out with these labeled proteins was 1H-15N-heteronuclear single quantum correlation experiment (2.14.4.1). To investigate the interaction of Nun with other Nus factors, a series of [15N, 1H]-HSQC spectra was recorded upon gradual addition of the respective interacting partner to a 3 to 4 fold molar excess. The 1H-15N resonance shift, disappearing of signals and line width changes were monitored by analyzing the spectra. The titrations were carried out until no further changes could be observed in the spectra or in other words till the point of saturation. On regard of SKK domain, to increase the spectral resolution and to decrease the relaxation rates of many of the nuclei during triple resonance experiments, (2H, 13C, 15N) labeled SKK domain samples were prepared. For the backbone assignment and to study the interaction with RNA and other proteins for SKK domain, the methods were combined with TROSY.
54 MATERIALS AND METHODS 2.14.6 Chemical shift mapping Chemical shift mapping is used to identify putative sites of interaction on a protein surface by detecting chemical shift perturbations in simple 1H,15N-HSQC NMR spectra of a uniformly labeled protein as a function of added (unlabeled) target protein. Information on the backbone resonance assignment and the protein structure (or a homology based model) for a protein is a prerequisite for chemical shift mapping. The identity and location of resonances that undergo binding-dependent chemical shift perturbations are mapped onto the three-dimensional structure of the protein to yield the binding site for the partner protein [Jeremy 1995; Rajagopal et al., 1997]. Ligand binding causes change in the electronic environment of the residues which are in the vicinity of the ligand. This changed environment induces change in the chemical shift for these residues in the 1H,15N-HSQC or 1H,15N-TROSY experiments. When the assignments of the free protein were available, they can be readily transferred to the complex by tracking the changes that occur during the titration. Normalized chemical-shift changes are expressed as the weighted geometric average of 1HN and 15N chemical shift changes for each residue. Δδnorm= Δδ1H 20.1Δδ15 N 2 [2.2] Δδ(X) represents the chemical shift difference of spin X between free and bound states. The analysis of perturbation spectra is usually focused on the difference between the perturbed (X) and the non-perturbed (Y) spectra. The cross peaks were picked from the Y spectra and used to define the integration areas of the X spectra. For each X spectra, the integration of data points from these areas are compared with the corresponding ones from the Y spectra to calculate the similarity (correlation coefficient) between the X and the Y spectra. If the shift changes are mapped on to the protein structure, a clear surface patch of affected residues is generally observed, and this indicates the location of the binding site. Due to the high sensitivity of 1H,15N-HSQC and 1H,15N-TROSY experiment, these investigations are frequently used in drug discovery-related ligand binding studies like for example, Structure Activity Relationships (SAR) by NMR [Shuker et al., 1996].
MATERIALS AND METHODS 55 2.14.7 Dissociation constant The dissociation constant KD, in the simplest case of a protein with a single binding site is defined as follows KD = [P][L] / [PL] [2.3] where [P], [L] and [PL] are the equilibrium concentrations of protein, ligand and complexed state, respectively. A value of KD in the mM range implies an approximately 1:1000 ratio of free to bound states in an equimolar mixture of P and L and a KD in the µM range implies an approximately 1:10,00,000 ratio of these states, i.e., a much more stable complex with less of the ‘free’ species present [Fielding et al., 2007]. To measure KD by means of NMR experiments implies quantitative analysis of solutions that are potentially µM in the observed nucleus. The significance of KD is that ligands of weaker affinity have larger KD and thus require the addition of more ligand to saturate the receptor binding site [Christopher et al., 2004]. The dissociation constant KD is determined from the changes in chemical shifts of 15N-labeled SKK domain in 1H-15N TROSY after gradual addition of the corresponding unlabeled binding partner. In the fast exchange region the observed chemical shift represents the population average of the chemical shift of the free and bound state. Therefore, the observed chemical shift is described by the equation 2.4 and can be used for KD determination [Morton et al., 1996]. δobs =δP δPL−δP [ { KD 1 +r [ P ] 0 } 2 [ P ] 0 − KD 1+r [ P ] 0 2−4 [ P ] 0 2r 2 [ P ] 0 ] [2.4] where δobs, δP, and δPL are the chemical shifts for the actual mixture, the free protein, and the completely bound protein, respectively. [P]0 is the total concentration of SKK domain, and r describes the SKK/RNA or SKK/NusA ar2 ratio. The curves were fitted using the program MATLAB (6.0.0.88 Release 12, The Math Works Inc., Natick, Massachusetts ,USA) by using the script kd_fit_func2.m (Appendix 9.1) (in-house written script by Dr. Kristian Schweimer, Department of Biopolymers, University of Bayreuth).
56 EXPERIMENTS AND RESULTS 3 Experiments and Results 3.1 Expression and purification of Nun constructs 3.1.1 Expression and purification of Nun (1-112) The nucleotide sequence and the physical/chemical parameters of Nun encoding 1-112 amino acids are represented in Appendix 9.2. The overexpression and purification of recombinant Nun was performed as described in section 2.5.1/2.5.2. Overexpression of Nun full length was analyzed by 19 % SDS-PAGE (Fig 3.1). From the gel we can observe that the expression rate for Nun was efficient. Figure 3.1 Expression of HK022-Nun (1-112) in E. coli BL21 (DE3). The overexpression of recombinant HK022-Nun protein was induced by 1 mM IPTG. The whole cell extract were subjected to SDS-PAGE and stained with Coomassie Brilliant Blue. As molecular weight standard, low range molecular weight marker from Biorad was laid on the gel. Lane 1, protein marker; Lane 2, uninduced state; Lane 3, 1 hour after induction; Lane 4, 2 hours after induction; Lane 5, 3 hours after induction; Lane 6, 4 hours after induction. 1 2 3 4 5 6 97,400 66,200 = 45,000 31,000 21,500 14,400 Nun (1-112)
EXPERIMENTS AND RESULTS 57 Following the expression, the cell lysis and purification were performed as described in section 2.5.2. Nun was purified by using cation exchange chromatography applying a step gradient elution (Fig 3.2 (A)). Fractions containing Nun were identified on a 19 % SDSPAGE (Fig 3.2 (B)). We had observed that the Nun protein elute from 20 % till 60 % gradient step. Among all the fractions, the eluate at 30 % gradient was more pure compared to the other fractions. (A) (B) Figure 3.2 Purification of Nun (1-112) using cation exchange chromatography. (A)- Chromatogram of the purification monitored at A280. The numbers in the chromatogram corresponds to the lane in the SDS-PAGE. (B)-Lane 1, protein marker; Lane 2, flow through; Lane 3, wash; Lane 5-10 represents the eluates. 97,400 66,200 45,000 31,000 21,500 14,400 1 2 3 4 5 6 7 8 9 10 97,400 66,200 45,000 31,000 21,500 14,400 1 2 3 4 5 6 7 8 9 10 -3000 -2000 -1000 0 1000 2000 3000 mAU 0 20 40 60 80 100 %B 0 50 100 150 200 250 300 ml F3 F5 1 2 3 4 5 6 7 8 9 10111213141516171819202122232425262728293031323334353637383940 4142434445464748495051525354555657585960 61 A280 (mAU) % Elution buffer Volume (ml) 3 7 5 6 4 8 9 10
58 EXPERIMENTS AND RESULTS The Nun fractions which were not pure after the cation exchange chromatography were pooled and further subjected to HPLC for purification. The HPLC run was carried out as mentioned in the section 2.5.2. The elution of Nun protein from the HPLC column was performed by applying a slow linear gradient (Fig 3.3 (A)). The peak fractions eluted were analyzed by 19 % SDS-PAGE (Fig 3.3 (B)). The eluted fractions from HPLC column was sufficiently pure for further studies. (A) (B) Figure 3.3 (A) Chromatogram of the HPLC monitored at A280. The numbers in the chromatogram correspond to the bands assigned in SDS-polyacrylamide gel. (B) The alphabet (M) stands for protein marker; Lane 1 and 2 shows the eluate from the HPLC run. 1 2 1 2 97,400 66,200 = 45,000 31,000 21,500 14,400 1 2 M
EXPERIMENTS AND RESULTS 59 3.1.2 Expression and purification of Nun (45-112) The nucleotide sequence of the Nun C-terminal domain (CTD) is shown in Appendix 9.3. A detailed protocol about the expression and purification of Nun CTD is mentioned in section 2.6.1/2.6.2. Nun CTD was cloned into the expression vector pET-GB1. The fusion protein carried a hexa-histidine-tag at the N-terminus and with a TEV protease cleavage site between GB1 and Nun CTD. The expression was achieved by inducing the cells with 1 mM IPTG. The efficiency of the expression of Nun CTD was visualized on a 19 % SDS-PAGE (Fig 3.4) Figure 3.4 Expression of Nun CTD. Lane 1, Biorad marker; Lane 2, Uninduced Nun CTD; Lane 3, 3.5 hours after induction. Expressed recombinant protein was purified by nickel affinity chromatography. In eluting the protein, a step gradient ranging from 0-500 mM imidazole was used (Fig 3.5 (A)). The eluted fractions were analyzed on a 19 % SDS-PAGE (Fig 3.5.(B)). The Nun CTD eluted at 10 % gradient was about 90 to 95 % pure. (A) 97,400 66,200 = 45,000 31,000 21,500 14,400 1 2 3 0 500 1000 1500 2000 2500 3000 3500 mAU 0 20 40 60 80 100 %B 0 100 200 300 400 500 600 700 ml F3 F5 Waste 1 3 5 7 9 11 14 17 20 23 26 29 32 35 38 41 44 47 50 53 56 59 62 65 68 71 74 77 80 83 86 89 92 9596 A280 (mAU) Volume (ml) % Elution buffer 2 3 45
66 EXPERIMENTS AND RESULTS Purification of the soluble his-tagged protein from the clarified crude cell extract was performed by nickel ion affinity chromatography on an ÄKTA purifier 10-FPLC system as described in section 2.10.2. The supernatant was loaded onto a 5 ml Histrap column and the bound protein was eluted using a stepwise gradient of imidazole. The collected fractions were analyzed for its purity on a 19 % SDS-PAGE (Fig 3.15). Pure protein was eluted at 20 % gradient. Fractions containing the protein was combined and dialyzed against the required buffer and concentrated using Vivaspin concentrators. (Fig 3.16). Figure 3.15 19 % SDS-PAGE analysis of the purification of SKK domain. The numbers in the chromatogram corresponds to the lane in the gel. Lane 1, supernatant after sonication; Lane 2, pellet after sonication; Lane 3, Biorad marker; Lane 4-10, eluted fractions from the Histrap affinity column. Fractions 8-10 shows the pure SKK protein. Figure 3.16 Concentrated sample of SKK protein. The purified fractions were pooled together and concentrated to a concentration of 400-500 µM. Lane 1, Biorad marker; Lane 2, concentrated sample. A280 (mAU) % Elution buffer Volume (mL) 97,400 66,200 45,000 31,000 21,500 14,400 1 2 3 4 5 6 7 8 9 10 4 5 6 7 8 9 10 A280 (mAU) % Elution buffer Volume (mL) 97,400 66,200 45,000 31,000 21,500 14,400 1 2 3 4 5 6 7 8 9 10 4 5 6 7 8 9 10 97,400 66,200 45,000 31,000 21,500 14,400 1 2 97,400 66,200 45,000 31,000 21,500 14,400 1 2
EXPERIMENTS AND RESULTS 67 Effect of perdeuteration on SKK domain Deuteration reduces the relaxation rates of NMR-active nuclei, in particular 13C, because the gyromagnetic ratio of 2H (γ[2H]) is 6.5 times smaller than 1H (γ[1H]) and thereby it improves the resolution and sensitivity of the NMR experiments. During deuteration, replacement of protons with deuterons removes contributions to proton line widths from proton-proton dipolar relaxation and 1H-1H scalar couplings. Perdeuteration of SKK was necessary to yield spectra in a suitable quality for sequential resonance assignment. Significant improvements have been noted in between non-deuterated and deuterated SKK protein sample as shown in the following figure (Fig 3.17). Figure 3.17 Effect of perdeuteration on 1H-15N TROSY spectrum of the 24.4 kDa SKK domain of NusA. Both proteins are uniformly 15N labeled, while the deuterated protein is approximately 80-90% uniformly deuterated. a) non-deuterated sample. b) deuterated sample. 1 H (ppm) 1 H (ppm) 15 N (ppm) a b 1 H (ppm) 1 H (ppm) 15 N (ppm) a b
68 EXPERIMENTS AND RESULTS 3.3 Expression and purification of NusG Full length NusG was expressed in E. coli BL21 (DE3) cells in pET 11a/NusG vector. The protein was constructed with no affinity tag. The expression, cell lysis and protein purification were performed as described in the section 2.11.1/2.11.2. The nucleotide sequence and other parameters concerning NusG construct is shown in Appendix 9.8. After cell lysis, most of the protein was in the soluble fraction. The supernatant was subjected to ammonium sulfate precipitation. The pellet obtained was resuspended and dialyzed against the respective buffer and purified using anion exchange chromatography (QXL) with a linear gradient. The eluted fractions were analyzed by 19 % SDS-PAGE for purity (Fig 3.18). The pure fractions containing NusG were pooled for concentration by Vivaspin concentrators. Figure 3.18 SDS-PAGE analysis of NusG purification. The numbers in the chromatogram corresponds to the lane in the SDS-PAGE. Lane 1, marker; Lane 2, pellet after cell lysis; Lane 3, supernatant after cell lysis; Lane 4, flow through; Lane 5, wash; Lane 6-10, fractions eluted from the QXL column. 15N NUSG 311006:1_UV1_280nm 15N NUSG 311006:1_Conc 15N NUSG 311006:1_Fractions 0 200 400 600 800 1000 1200 1400 1600 mAU 0 20 40 60 80 100 %B 0 50 100 150 200 250 300 350 ml F3 F3 F5 1 2 3 4 5 6 7 8 9 1011 1314 1617 1920 22 2425 2728 3031 3334 3637 3940 4243 4546 4849 51 1 2 3 4 5 6 7 8 9 10 97,400 66,200 = 45,000 31,000 21,500 14,400 A280 (mAU) Volume (ml) % Elution buffer 4 5 6 7 8 9 10
EXPERIMENTS AND RESULTS 69 3.4 Expression and purification of NusB To produce high yield of labeled protein and to have reproducible results, one promising recent approach has been the development of auto-induction of recombinant protein expression, a method introduced by Studier. This approach is based upon the preferences of bacteria to selectively use different carbon sources during diauxic growth and upon the oftenobserved negative regulation of gene expression by catabolite repression. The auto-induction approach has many advantages over traditional induction methods including avoidance of the strong induction and apparent toxicity associated with chemical inducers such as IPTG, the ability to formulate medium compositions to obtain a desired level of cell growth before expression and minimal requirements for handling of the expression culture associated with growth-dependent induction of target protein expression. Nucleotide sequence of NusB is shown in Appendix 9.9. The expression and purification is explained in detail in section 2.12.1/2.12.2. Auto-induction of NusB was carried out as mentioned by Studier et al., 2004. The protein was purified using a Histrap affinity column. The bound protein was eluted with a step gradient using a buffer containing imidazole. The fractions eluted were analyzed by 19 % SDS-PAGE (Fig 3.19). The eluted fractions were very pure. The peak fractions containing NusB were pooled together and set to cleave the N-terminal histidine tag using the TEV protease. The cleaved sample was dialyzed against the required buffer for further purification. The NusB protein was further purified to high level of purity by applying the cleaved sample to an anion exchange chromatography. The sample was loaded onto the QXL column and then eluted with a step gradient ranging from 0 to 1 M NaCl. The fractions eluted from the QXL column were analyzed by SDS-PAGE (Fig 3.20). The fractions corresponding to NusB were pooled for further use.
70 EXPERIMENTS AND RESULTS Figure 3.19 Purification analysis of NusB. The numbers in the chromatogram corresponds to the lane in the SDS gel. Lane 1, marker; Lane 2, pellet after cell lysis; Lane 3, supernatant after cell lysis; Lane 4, wash; Lane 5-9, the fractions collected from the Histrap column. Figure 3.20 Analysis of the fractions eluted from the QXL column as the final purification step of NusB. Lane 1, marker; Lane 2-5, the fractions eluted from the QXL column. NusB second histrap001:1_UV1_280nm NusB second histrap001:1_Conc NusB second histrap001:1_Fractions -1000 0 1000 2000 3000 mAU 0 20 40 60 80 100 %B 0 50 100 150 200 ml 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 97,400 66,200 = 45,000 31,000 21,500 14,400 1 2 3 4 5 6 7 8 9 A280 (mAU) Volume (ml) % Elution buffer 45 6 7 8 9 NusB qxl run 180707:1_UV1_280nm NusB qxl run 180707:1_Conc NusB qxl run 180707:1_Fractions -1000 -500 0 500 1000 1500 2000 2500 mAU 0 20 40 60 80 100 %B 0 50 100 150 200 ml 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 A280 (mAU) Volume (ml) % Elution buffer 97,400 66,200 = 45,000 31,000 21,500 14,400 1 2 3 4 5 2 3 4 5
EXPERIMENTS AND RESULTS 71 3.5 Interaction of Nun with E. coli host factors 3.5.1 Interaction of Nun with NusA ar1 domain The Nun protein of bacteriophage HK022 is a member of the arginine-rich motif family of RNA binding proteins, which also includes the phage λ N transcription antitermination protein. In contrast to λ N, which suppresses transcriptional termination, Nun terminates transcription just distal to BOXB (1.5.2) The Nun C terminus interacts with RNA polymerase and contacts DNA template, which is 7-8 bp downstream to the RNA polymerase active center. It is likely, that Nun intercalates into template via W108 and this intercalation physically blocks RNA polymerase translocation. It has been already reported [Watnick et al., 1998] that NusA, a transcription elongation protein binds to the C terminus of Nun and stimulates the Nun binding to BoxB. In doing so, however, NusA inhibits the interaction between Nun and RNA polymerase, which requires the C terminus of Nun. The mechanism by which NusA stimulates Nun binding appears to be novel among RNA binding proteins. The idea, that NusA interacts with the C-terminal region of Nun consisting of amino acids VMHRVVNHAHQRNPNKKWS was supported based on the results from a binding assay [Watnick et al., 1998]. By interaction with Nun C-terminus, NusA exposes the RNA binding domain and allows Nun to bind BOXB. In an other publication by Kim et al., 2006, it has been shown that Nun binding to NusA, like that of λ N, requires NusA ar1 region located between NusA residues 364 and 415. To determine this, they had expressed N-terminal hexahistidine tagged derivatives of full length NusA and four NusA C-terminal deletion mutants. Nun binding to these derivatives were determined by Ni2+ affinity chromatography. The results obtained indicated that NusA ar1 is crucial for Nun binding as it is for N. Based on the above two reported results, one could suggest that NusA ar1 interacts with the C-terminal domain of Nun. On the context of this fact, interaction between Nun and NusA ar1 was studied at atomic level by NMR.
72 EXPERIMENTS AND RESULTS To observe the interaction between these two proteins, 15N-labeled samples of NusA ar1 (2.8) was used for the titration experiments by NMR. In order to identify which amino acid residues of Nun are involved in the interaction with NusA ar1, three constructs of Nun (Nun C-terminal peptide (92-112); Nun CTD (45-112); Nun (1-112) have been used in this study (Appendix 9.2 and 9.3). Three separate titration experiments were performed in which 15N HSQC spectra of NusA ar1 were collected as a function of added Nun constructs: (1) NusA ar1 + Nun (92-112), (2) NusA ar1 + Nun (45-112), (3) NusA ar1 + Nun (1-112). The NMR titrations were optimized by adopting different buffers, pH and salt concentration. Amide (1HN, 15N) chemical shifts are very sensitive to local structural changes. Therefore, observation of chemical shift changes on titration of a binding partner to a 15N labeled protein provides a powerful method for the identification of the interaction and the binding surface. However, no detectable signal shifting is observed during titration, up to an fourfold molar excess of Nun constructs. Consonant with the lack of chemical shift perturbations (2.14.5) observed in all the three titration experiments, we could conclude that there is a lack of an intermolecular interaction between NusA ar1 and Nun. An overlay of 1H,15N-HSQC spectra of three NMR titrations were shown in Fig 3.21; Fig 3.22, and Fig 3.23 respectively. All the spectra shown here clearly depicts that there is no interaction surface and no significant changes in the conformation of NusA ar1 upon titrating with Nun protein.
EXPERIMENTS AND RESULTS 73 Figure 3.21 Overlay of the 1H,15N-HSQC spectra of free NusA ar1 (black) upon titrating with Nun peptide (92-112) (blue). No significant changes are observed in NusA ar1 upon interacting with nun peptide. The appearance of the overlay did not change with other buffers and in the presence and absence of salt in the buffer. 1 H (ppm) 15 N (ppm) 1 H (ppm) 15 N (ppm)
74 EXPERIMENTS AND RESULTS Figure 3.22 Superimposed 1H,15N-HSQC spectra of free NusA ar1 in the absence (black) and presence (red) of Nun CTD (45-112). During the titration the black colored peaks did not shift indicating that there might be no interaction with Nun CTD. 1 H (ppm) 15 N (ppm) 1 H (ppm) 15 N (ppm)
EXPERIMENTS AND RESULTS 75 Figure 3.23 An overlay of the 1H,15N-HSQC spectra of free NusA ar1 (black) upon titrating with Nun (1-112) (magenta). No major changes in the chemical shift were observed for any residues. 1 H (ppm) 15 N (ppm) 1 H (ppm) 15 N (ppm)
82 EXPERIMENTS AND RESULTS Figure 3.26 Strips of HN(CO)CACB and HNCACB spectra of 2H,13C,15N uniformly labeled SKK domain. Strips from two spectra are shown, corresponding to a single amino acid. Several of these strips are placed in a row to show the sequential connectivities from each amino acid to the preceding one. The coherence transfer in both of these experiments for a pair of consecutive residues are shown below. The arrows indicate the magnetization transfer pathway. HN(CO)CACB HNCACB HN(CO)CACB HNCACB HN(CO)CACB HNCACB HN(CO)CACB HNCACB HN(CO)CACB HNCACB S295 S295 I296 I296 V297 V297 V298 V298 D299 D299 CA (i-1) CB (i-1) CB (i-1) CA (i-1) HN(CO)CACB HNCACB HN(CO)CACB HNCACB HN(CO)CACB HNCACB HN(CO)CACB HNCACB HN(CO)CACB HNCACB S295 S295 I296 I296 V297 V297 V298 V298 D299 D299 CA (i-1) CB (i-1) CB (i-1) CA (i-1) HNCACB HN(CO)CACBHNCACB HN(CO)CACB
EXPERIMENTS AND RESULTS 83 Figure 3.27 Strips showing backbone sequential connectivities of residues 295 to 299 of the SKK domain. The strips are taken from HNCO and HN(CA)CO spectra of 2H,13C,15N uniformly labeled SKK domain and each strips from two spectra corresponds to a single amino acid. Several of these strips are placed in a row to show the sequential connectivities. The flow of magnetization is indicated by arrows. S295 S295 I296 I296 V297 V297 V298 V298 D299 D299 HNCO HN(CA)CO HNCO HN(CA)CO HNCO HN(CA)CO HNCO HN(CA)CO HNCO HN(CA)CO S295 S295 I296 I296 V297 V297 V298 V298 D299 D299 HNCO HN(CA)CO HNCO HN(CA)CO HNCO HN(CA)CO HNCO HN(CA)CO HNCO HN(CA)CO HN(CA)CO HNCOHN(CA)CO HNCO
84 EXPERIMENTS AND RESULTS Figure 3.28 1H,15N-TROSY spectrum of 2H,13C,15N uniformly labeled SKK domain (400 µM; 800 MHz; 298K). Assigned backbone resonances are labeled with amino acid type in one letter code and residue number. The tryptophan NH are marked by “W sc”. The unassigned resonances are indicated by hash (#). 15 N (ppm) 1 H (ppm) 15 N (ppm) 1 H (ppm)
EXPERIMENTS AND RESULTS 85 3.7 Interaction studies of NusA RNA binding domains (SKK) 3.7.1 Binding of SKK with nut RNA As described earlier, the N protein, with a group of E. coli encoded proteins that, in addition to NusA, include NusB, NusG, and NusE, act at nut RNA sites, to modify RNA polymerase to a termination-resistant form. The nut RNA sequences are components of transcripts initiating at the early λ promoters PR and PL. The respective nut site in the PR and PL operons are nutL and nutR which lies upstream of the first terminator (section 1.4). Sequence analyses identified three regions in NusA having homologies with sequences associated with RNA binding; one S1 and two KH domains, in the central portion of ecoNusA. The crystal structure of Thermatoga maritima NusA [Worbs et al., 2001] suggests that NusA creates an extended, mosaic RNA interaction surface by domain arraying. Consistently, all portions of the molecule have been implicated by mutational analyses in RNA binding: the R199A mutation in the interface of S1 and KH1, and point mutation in the GXXG motifs of both KH elements, all impair binding to nut site RNA. It has been shown by anisotropic fluorescence titrations [Prasch et al., 2008; in revision] that titration of SKK domain with λ nutR showed only weak protein-RNA interactions compared with λ nutL which showed slightly higher affinity towards SKK domain. Based on these reports, the interaction of RNA binding domains of NusA with λ nutL RNA was investigated by NMR titration studies. To identify the interaction between SKK and λnutL, 2H,15N labeled SKK protein was titrated with an increasing molar ratio of unlabeled λnutL RNA. The chemical shift changes have been monitored in the 1H,15N-TROSY spectra during each step of the titration upon gradual addition of the λ nutL RNA. Table 3.1 shows the details of the titration experiments.
86 EXPERIMENTS AND RESULTS Table 3.1 Titration table for studying the interaction of SKK with λ nutL RNA. Experiment. No SKK domain (mM) λ nutL RNA (mM) Total volume (µL) Ratio 1 0.1000 0.000 550 1:0 2 0.0965 0.025 570 1:0.25 3 0.0932 0.050 590 1:0.50 4 0.0902 0.075 610 1:0.75 5 0.0873 0.100 630 1:1.0 6 0.0821 0.150 670 1:1.5 7 0.0775 0.200 710 1:2.0 8 0.0733 0.250 750 1:2.5 9 0.0696 0.300 790 1:3.0 An overlay of the 1H,15N-TROSY spectra at each NMR titration step is shown in Fig 3.29. For SKK-λ nutL RNA complex, many peaks had significant Δδ (section 2.14.6) as compared to the free SKK protein, indicating a binding interface. Few resonances moved in a continuous fashion (ex., T240, K235, V238, T264, R270, D272, S295, V297 etc.,) falling in the fast exchange regime on NMR time scale. Thus, the resonances of the nuclei affected by RNA binding gradually shift their position from the resonance of the free state towards the resonance of the bound state. Apart from the differences in chemical shifts of certain residues, it was also noted that some of the resonances disappear completely (For ex., V179, G192, A234, I236, C251, G267, I271, I273, M288, I318 etc.,). Upon immediate titration of λ nutL RNA (0.25 molar equivalence) disappearance in the resonances of these residues were observed. Absence of signals in the 1H,15N-TROSY spectra for some of the residues, could be probably due to exchange processes on the intermediate time scale, suggesting that these residues are involved in binding. This is characteristic for affinities in the low-micromolar range. It is important to recognize that “NMR timescale” is a relative one. For a given equilibrium, different resonances will show slow, intermediate or fast exchange behavior, depending on how much their chemical shifts differ between the free and bound states. The Fig 3.30 shows a expanded region of the overlaid 1H,15N-TROSY spectra from SKK-λ nutL RNA titration.
EXPERIMENTS AND RESULTS 87 Figure 3.29 Titration of SKK domain with λ nutL RNA. Overlay of 1H,15N-TROSY spectra recorded during the titration with different RNA/protein ratios. Key; black 0.0, magenta 0.25, blue 0.50, cyan 0.75, magenta 1.0, yellow 1.5, blue 2.0, green 2.5, and red 3.0. Resonance signals involved in binding are annotated. 1 H (ppm) 15 N (ppm) A294 R270 V297 G253 G192 I245 L275 I221 C251 M288 I318 T264 V238 K235 T240 R228 I236 A227 D229 I271 I273 S295 D272 A234 1 H (ppm) 15 N (ppm) A294 R270 V297 G253 G192 I245 L275 I221 C251 M288 I318 T264 V238 K235 T240 R228 I236 A227 D229 I271 I273 S295 D272 A234
88 EXPERIMENTS AND RESULTS Figure 3.30 1H,15N-TROSY spectra of SKK upon titrating with λ nutL RNA. (A/B)-Residues showing different chemical environment due to λ nutL RNA binding 1 H (ppm) 15 N (ppm) A B L275 A237 I271 I273 V179 T240 I236 T264 V238 K235 1 H (ppm) 15 N (ppm) A B L275 A237 I271 I273 V179 T240 I236 T264 V238 K235
EXPERIMENTS AND RESULTS 89 3.7.2 Normalized chemical shift changes Perturbations of 15N and HN chemical shifts of a protein upon complexation with a ligand are a qualitative tool for mapping of residues involved in binding sites and/or identifying conformational rearrangements (section 2.14.6). Hence, chemical shift mapping was used in order to identify the putative sites of interaction on SKK domain, by detecting the chemical shift perturbation in the 1H,15N-TROSY of SKK upon titrating with λ nutL RNA. In Fig 3.31 (A), changes in chemical shifts are displayed through the use of the normalized weighted chemical shift average between the free SKK and its complex with λ nutL RNA (equation 2.2). Normalized chemical shift changes larger than 0.04 ppm are considered to be significant [Hajduk et al., 1997] as indicated by dashed line in Fig 3.31 (A). Nearly all 1HN and 15N resonances in the KH domains are affected upon binding to λ nutL RNA, whereas, the more prominent changes occurring in the region R210-W276 which encodes for KH1 domain. Previously, it has been implicated that the KH domains are the important contributors to NusA binding to RNA [Worbs et al., 2001]. From our experimental results, it could be deduced that the KH1 domain plays a significant role in nut RNA binding. The observed chemical shift changes were mapped onto the surface of the crystal structure of Thermotoga maritima NusA (S1+KH1+KH2) to get further insight into the binding interface. The Figure 3.31 (B) shows the surface representation of SKK domain highlighting the binding interface and the residues whose resonances are affected upon binding to λ nutL RNA.
90 EXPERIMENTS AND RESULTS Figure 3.31 (A) Chemical shift changes of SKK upon binding to λ nutL RNA as a function of primary sequence; Dotted line represents the significance level of 0.04 ppm; X = residues not assigned. The colored bars represent the three RNA binding domains. (B) Surface representation of SKK highlighting the binding interface. Few of the residues with resonances showing significant chemical shift changes (0.04 < Δδ ≤ 0.1) are shown in green, those with Δδ > 0.1 are in red. Disappearing resonances are presented in orange. Sequence position Normalized chemical shift changes (ppm) 126 176 226 276 326 XXXXXXX X X X X X XXXXXXXX XXXX X X X XX XX X XXXX X X XXX XXX XXXXX XXXXX S1 KH1 KH2 A Sequence position Normalized chemical shift changes (ppm) 126 176 226 276 326 XXXXXXX X X X X X XXXXXXXX XXXX X X X XX XX X XXXX X X XXX XXX XXXXX XXXXX S1 KH1 KH2 Sequence position Normalized chemical shift changes (ppm) 126 176 226 276 326 XXXXXXX X X X X X XXXXXXXX XXXX X X X XX XX X XXXX X X XXX XXX XXXXX XXXXX S1 KH1 KH2 A E218 E216 I211 V262 T264 R270 V238 A234 D272 S295 R258 B A346 K347 H348 E218 E216 I211 V262 T264 R270 V238 A234 D272 S295 R258 B A346 K347 H348
EXPERIMENTS AND RESULTS 91 3.7.3 Dissociation constant for SKK-λ nutL complex The dissociation constant KD is determined from the changes in chemical shifts of 2H,15Nlabeled SKK in a 1H,15N-TROSY after gradual addition of λ nutL RNA (section 2.14.7). Signals showing a behaviour in the limit of fast exchange on the NMR time scale were fitted to equation (2.4) for a two state model. K235, V297 and R270 of SKK domain which show fast exchange regime during the titration was chosen to determine the KD value (Fig 3.32). It has been observed by fluorescence titration that λ nutL binds to SKK with an affinity of 71 µM [Prasch et al., 2008, in revision]. The difference between the KD values obtained from NMR and fluorescence experiment could be supported by the fact that an accurate measurement of KD requires the use of protein concentrations ≤ KD and the low sensitivity of NMR in terms of concentrations required obviously sets a practical limit to the range of dissociation constants which can be measured. For the analysis of KD, ligand concentrations greater than the protein concentration are used, which gives an error up to a factor of ten [Feeney et al., 1979]. Figure 3.32 Dissociation constants for SKKλ nutL complex. Fitting the curves yielded the calculated KD values shown in the inset. V297 K235 R270 10.0R270 10.2V297 16.4K235 K D µM 10.0R270 10.2V297 16.4K235 K D µM Normalized chemical shifts Normalized chemical shifts Normalized chemical shifts nutL/SKK nutL/SKK nutL/SKK
98 EXPERIMENTS AND RESULTS 3.8.2 Displacement by α-CTD subunit of RNA polymerase Based on the observation that NusA could bind nut-site RNA in the presence of α, but not in the absence, Mah and co-workers had suggested, that there might be a direct interaction between NusA and α subunit of RNA polymerase. The gel mobility shift experiments [Mah et al., 2000] had shown that the binding of NusA to nut site RNA is indeed inhibited by the 70 carboxy-terminal amino acids of NusA and suggests that this inhibition could be relieved by an interaction of this portion of NusA with the CTD of the RNA polymerase α subunit. To characterize the α-dependent RNA binding by SKK domain, we titrated the complex containing SKK + NusA ar2 with α-subunit of RNA polymerase. A series of 1H,15N-TROSY spectra of the complex (SKK + NusA ar2) was recorded by gradually adding an increased molar ratio of unlabeled α-CTD. Our main idea through this experiment is to observe whether α-CTD displaces NusA ar2 from SKK domain and releases the autoinhibition effect of NusA ar2 or not. Overlay of the titration spectra are shown in Fig 3.37-A. The same set of amide resonances which showed chemical shift changes during the titration of SKK with NusA ar2, were also affected on titrating the complex (SKK + NusA ar2) with αCTD. But the direction in which the resonances have shifted could be reversed. Fig 3.37-B, shows one such example of the residue G249 exhibiting such kind of shift. When titrating the SKK domain with NusA ar2 the residue G249 showed significant chemical shift change and thereby falling in the fast exchange regime. Upon titrating with NusA ar2, the resonances of G249 gradually shifted its position from downwards (free state) towards upwards (bound state). During the titration of the complex (SKK + NusA ar2) with α-CTD, the resonances of G249 shifted from upwards towards downwards direction, indicating that α-CTD is displacing NusA ar2 from its bound state, thereby opening the SKK domain for RNA binding.
EXPERIMENTS AND RESULTS 99 Figure 3.37 (A) Overlay of 1H,15N-TROSY spectra recorded during the titration of complex (SKK + NusA ar2) with increasing molar ratios of α-CTD. The resonances which were affected during the titration are indicated. (B) G249 of SKK showing the direction of the shift of resonances in both the titration. 1 H (ppm) 15 N (ppm) A R270 G249 A261 S263 Q260 A234 1 H (ppm) 15 N (ppm) 1 H (ppm) 15 N (ppm) A R270 G249 A261 S263 Q260 A234 G249 G249 SKK + NusA ar2 [SKK + NusA ar2] + α-CTD
100 DISCUSSIONS 4 Discussions 4.1 Effect of Nus factors on HK022 Nun The Nun protein of bacteriophage HK022 is a member of the arginine-rich motif family of RNA binding proteins which includes the phage λ N transcription antitermination protein and the HIV Tat and Rev proteins. In contrast to λ N, which suppresses transcription termination, Nun terminates transcription just distal to BoxB (1.5.2). Like λ N, action of Nun also requires the host Nus proteins. As described earlier, the E. coli NusA protein interacts with the Cterminal region of Nun and stimulates the binding of Nun to BoxB. In particular, it has been reported that NusA ar1 which is responsible for binding to phage λ N protein as well as to the C terminus of the RNA polymerase α subunit is also required for the Nun binding [Watnick et al., 1998]. In the context of the reported results, studies have been carried out to determine the interaction between Nun and NusA by NMR titration experiments. To monitor this interaction, three constructs of Nun containing 1-112, 45-112, and 92-112 were used (3.5.1). Upon titrating the Nun constructs with NusA ar1, no detectable changes in chemical shifts as well as no new signals have been observed. Based on these experimental results from NMR, it supports the idea that there might not be any direct interaction between NusA ar1 and Nun. To optimize the experimental conditions we had used two buffer conditions with different pH (10 mM KPO4, pH 6.4, 50 mM NaCl / 50 mM NaPO4, pH 7.0, 50 mM NaCl). The results obtained with these different buffers remained the same. As the binding free energies associated with the formation of macromolecular complexes are generally extremely sensitive to ionic strength, we had performed the titration with three different salt conditions (0, 50, and 100 mM NaCl respectively) in the above mentioned buffer, to see whether is there any observable changes due to the different salt concentration or not. However, we have not observed any significant perturbations in the chemical shift during the titration.
DISCUSSIONS 101 As the C terminus of Nun includes three histidine residues that form a potential zinc binding motif [Watnick et al., 2000], all the NMR experiments have been repeated in the presence of zinc, with an aim that it might facilitate the binding of Nun with NusA. Again, no observable changes occurred in the titration even in the presence of zinc. With the observed results, now the question arises, whether NusA ar1 is critical for Nun binding or not, whether other domains of NusA is also required for binding. With a quest to answer these questions, full length NusA (1-495) have been used for the binding studies. As the entire complex is prohibitively large for studying by NMR spectroscopy, we replaced the Nun full length with Nun C-terminal domain containing 45-112 amino acids (3.1.2) which corresponds to the interacting region. It has been already shown that NusA binds directly to Nun C-terminal domain by affinity chromatography experiments [Watnick et al., 1998]. 15N labeled Nun C-terminal domain was titrated with gradually adding unlabeled NusA to a molar ratio of 1:3. On using the full length NusA as well, no significant chemical shift perturbations have been observed. It has been already reported that λ N forms a complex with NusA ar1 [Prasch et al., 2006]. So, in our case to have a positive control, the titration of λ N with NusA (1-495) have been performed to observe the changes. Even with the full length NusA, one supposed to see few of those changes corresponding to the changes that was observed when the λ N forms a complex with NusA ar1. Same sample conditions were used to avoid the artifacts resulting from the non-similar sample conditions. As expected, distinct resonance changes were seen on λ N upon titrating with NusA full length, indicating clearly the interaction between λ N and NusA. Based on our experimental results from NMR and in accordance to the lack of chemical shift perturbations from all of the performed titration experiments, it is obvious that there is probably a lack of intermolecular interaction between Nun and NusA. It might be that the interaction between Nun and NusA is also in need of other factors which could facilitate Nun binding to NusA. Like λ N protein, apart from NusA, Nun also requires additional host factors (NusB, NusE and NusG) for efficient termination, whereas the presence of NusA alone inhibits the termination activity. With the continuing interest to know more about the interaction of HK022 Nun with Nus factors, has provided us a potent driving force to study the interaction
102 DISCUSSIONS of Nun with various Nus factors (NusG and NusB) by NMR titration studies. For the interaction studies of Nun with other Nus factors, 15N labeled NusG and NusB have been prepared (3.3 and 3.4). The sample conditions were maintained the same as used to study the interaction of HK022 Nun with NusA. It has been reported previously, that E. coli NusG gene product is required for transcription termination by phage HK022 Nun protein in vivo [Burova et al., 1999]. But so far, there are no experiments showing a direct interaction between Nun and NusG. With this as a subject, we proceeded to study the interaction of NusG with Nun. From the overlay of 1H,15N-HSQC experiments (Fig 3.24), no dynamic changes were observed in all stages of titration. This indicates that no direct binding between NusG and Nun exist. Therefore, the role of NusG action in HK022 Nun mediated termination might be not directly interacting with Nun but could be in presence of other Nus factors, NusG might stimulate Nun termination. Mutational studies had described that mutation in nusB genes blocks both Nun and N action in vivo [Friedman et al., 1976]. But up to now, it has not been shown, whether there is any direct binding of Nun to NusB. Hence, we wanted to observe the interaction between NusB and HK022 Nun by NMR. However, titration of NusB upon adding increased molar ratio of Nun, does not cause any significant detectable changes (Fig 3.25). The interaction studies was carried out with the full length and as well as with C-terminal domain of Nun alone, but the results remained the same, leading to the conclusion that there is no direct interaction between HK022 Nun and NusB. In the termination pathway, HK022 Nun uses the host factors NusA, NusB, NusG and NusE. Nevertheless, the involvement of E. coli host factors in Nun termination is still not clearly explained. Based on our NMR experimental results, we were unable to observe a direct binding of any of these Nus factors to HK022 Nun. Based on the published results it is clear that, Nun termination is facilitated by Nus host factors, but from our results we deduce that the facilitation is not by a direct binding to HK022 Nun. Therefore, the proposed role of NusA in Nun mediated termination might be different and the role of NusG and NusB still remains to be solved.
DISCUSSIONS 103 4.2 Backbone assignment of RNA binding domains of NusA (SKK) The central S1 and KH domain regions of NusA (SKK) are involved in interactions with nut site RNA and are required for both transcription termination and antitermination. In order to explore the details of the binding surface on SKK domain upon nut RNA binding, we primarily proceeded to obtain sequence specific backbone resonance assignment. Deuterium labeling strategy (2.10) was used for the SKK domain to increase the sensitivity and the resolution in triple resonance experiments. The labeling strategy results in deuterium incorporation throughout a protein in a roughly site-independent manner (uniform or random labeling). One of the significant advantage of deuteration is that many cross-relaxation pathways are removed, thereby reducing the overall resonance line widths and spin diffusion effects in the system. To achieve high rate of deuteration for the interaction studies, media containing > 99.9 % D2O was used. The main problem to express a deuterated protein is the incorporation of 2H which reduces growth rate of organisms up to 50 %. Since, expression of highly deuterated protein also requires stepwise adaptation of the bacteria to the high deuteration level, the SKK protein production with deuterated media usually resulted in significantly lower yield than that with nondeuterated media. For the backbone resonance assignment of SKK domain, TROSY-based triple resonance experiments with 2H,15N,13C-labeled SKK was carried out which was superior than the conventional triple-resonance experiments. Line broadening at higher magnetic fields which is a manifestation of increased transverse relaxation rates and deterioration of the sensitivity in triple-resonance experiments, has been largely suppressed by using TROSY technique. During the course of study, TROSY combined with deuterated SKK domain was used for the backbone resonance assignments. TROSY based triple-resonance experiments were recorded to allow sequential assignment of the backbone of SKK domain. Typically these experiments include tr-HNCO, tr-HNCA, trHN(CA)CO, tr-HN(CO)CA, tr-HNCACB and tr-HN(CO)CACB which are predominantly run as 3D experiments, recording the chemical shifts of 1HN, 13C and 15N.
104 DISCUSSIONS During the course of finding sequential connectivities of the backbone resonances, we had built chemical shift “clusters” by comparing and correlating several heteronuclear 3D experiments, so that each cluster is composed of the correlated backbone chemical shifts of one amino acid residue and of its preceding or following residue. We then link these clusters to obtain sequential stretches of chemical shift sets of amino acid residues, starting from the residue i and looking for i-1 and so on. Sequential connectivities were also confirmed by the identification of NOE cross-peaks between sequential HN groups, using a 3D-15N-HSQCNOESY and 3D-NNH-NOESY. For a variety of reasons, even modest increase in protein size greatly complicate the assignment process and the same was observed with the SKK domain as well. The SKK domain consist of 222 residues, 9 of which were proline residues and 7 residues in the Nterminal part belongs to the tag region, a maximum of 206 backbone amide 1HN-15N correlation peaks would be predicted in the TROSY spectra of SKK domain (3.6). Sequence specific resonance assignments were made for 166 out of 206 residues (80.5%). The problems encountered during the assignment procedure is depicted in Fig 4.1, showing the strip plots from amino acid T198-K201 derived from HN(CO)CACB and HNCACB. In the strip plot we could observe that its possible to walk along the protein backbone only by using the Cα connectivities because Cβ [in position (i) and (i-1)] are missing for these residues. But in this case, its not possible to unambiguously assign these residues based on Cα resonances, since the chemical shift of Cα resonances could match to various other residues in the amino acid sequence as well. In the process of sequential assignment, always two chemical shifts were matched, and in case of multiple possibilities, we carry out parallel searches for each possible connection until one path leads to the nearest check point.
DISCUSSIONS 105 Figure 4.1 Strip plot showing the difficulties faced during resonance assignments. Strips of HN(CO)CACB and HNCACB spectra of 2H,13C,15N uniformly labeled SKK domain (T198K201). Strips from two spectra are shown, corresponding to a single amino acid. Several of these strips are placed in a row to show the sequential connectivities from each amino acid to the preceding one. The coherence transfer in both of these experiments for a pair of consecutive residues are shown below. The arrows indicate the magnetization transfer pathway. The dotted line represents break of further connectivities. (x) indicates the peaks which are near to noise level. HN(CO)CACB HNCACB HN(CO)CACB HNCACB HN(CO)CACB HNCACB HN(CO)CACB HNCACB T198 T198 R199 R199 S200 S200 K201 K201 X CA CB X X CA(i-1) CB(i-1) CA(i-1) CA(i-1) CA CA CA(i-1) CA CB CB(i-1) HN(CO)CACB HNCACB HN(CO)CACB HNCACB HN(CO)CACB HNCACB HN(CO)CACB HNCACB T198 T198 R199 R199 S200 S200 K201 K201 X CA CB X X CA(i-1) CB(i-1) CA(i-1) CA(i-1) CA CA CA(i-1) CA CB CB(i-1) HNCACB HN(CO)CACBHNCACB HN(CO)CACB
106 DISCUSSIONS Because of the large size of the protein, chemical shift degeneracy (for ex., missing of Cβ chemical shift) poses a challenging problem. To overcome this problem, we utilized the 3D-15N-HSQC-NOESY and 3D-NNH-NOESY spectra to assign those residues where the chemical shifts of Cα or Cβ are missing by observing the NOE cross peaks. In a NOESY spectra, the cross peaks indicate which protons are close in space and also correlates protons which are distant in the amino acid sequence but close in space due to the tertiary structure. The intensity of the NOE is in first approximation proportional to 1/r6, with r being the distance between the protons. The presence of a NOE peak is direct evidence that 2 protons are within 5 Angstroms (5 Å) through space. Assignment of resonances is achieved by detecting the sequential connectivities between amide protons in the bonding network between nuclei. Supporting information for the sequential connectivities which was obtained from the NOESY spectra is represented as a strip plot in Fig 4.2. By using the NOESY spectra, we were able to obtain the sequential connection of spin systems by observing the cross peaks from the amide protons of one residue to the amide, alpha, or beta protons of the next residue. However, to be sure whether the NOEs which were observed are of sequential connectivity or not, we refer back to HNCACB and observe the Cα chemical shift, combining both of these allow strong peak association for T198-R199-S200K201. Though using TROSY triple-resonance experiments combined with 3D-NOESY experiments, we still were not able to assign all the resonances. The main difficulty was the missing resonances for some of the residues and degenerate resonances for some other, for which there was no NOESY cross peaks as well. The big stretch which was not assigned in SKK domain lied in the region of S1 domain from residue L183-V197 which constitutes the β4 and β5 sheet of S1 motif. The possible reasons for the missing resonances could be cross-peak overlap, incomplete deuteron amide exchange or exchange peak broadening or with protein dynamics, where changes in mobility of protein occurs over a wide time scale. It might be possible that the residues are not locked in a more rigid conformation leading to the broadening of the resonance. It could also be possible that during the course of measurements, protein degradation occurs which leads to a reduction in the signal due to sample instability which will then affect the line shape. In some experiments, low signal to noise ratio also hindered us to assign those peaks, which were near to the noise level.
DISCUSSIONS 107 Figure 4.2 NOESY Strip plots of 2H,13C,15N uniformly labeled SKK domain to trace the sequential connectivities. The cross peaks are indicated by connecting lines. The strips show that residues T198-K201 make a series of backward and forward NOEs, indicating that this region could be sequentially connected; (x) indicates the peaks of long range NOEs. T198 R199 S200 K201 3D-NNH-NOESY X S200.HN K201.HN R199.HN T198 R199 S200 K201 3D-NNH-NOESY X S200.HN K201.HN R199.HN T198 R199 S200 K201 3D-15N-HSQC-NOESY K201.HN S200.HN R199.HN T198.HN T198 R199 S200 K201 3D-15N-HSQC-NOESY K201.HN S200.HN R199.HN T198.HN
114 SUMMARY 5 Summary In phage λ, antitermination is initiated by the λ-encoded N protein which recruits a number of host proteins called Nus factors. Several of these host proteins which are essential for effective transcription termination and antitermination have been identified, these includes NusA, NusB, NusE and NusG. The subject of this work is mainly focused on characterization of interactions between various Nus host factors in the termination and antitermination system by NMR spectroscopy. Like N protein, Nun also requires additional host factors for efficient termination. It has been reported already that NusA interacts with C-terminal region of Nun and also that Nun binding to NusA requires NusA ar1 region. On the basis of these results, 1H,15N-HSQC spectra were recorded to monitor the interaction between HK022-Nun and NusA ar1. NMR titration experiments between Nun and NusA clearly showed a lack of chemical shift perturbations. Therefore, it can be concluded that there is no intermolecular interaction between Nun and NusA ar1. Up to date, no information about the interaction between Nun and NusG as well as Nun and NusB are known. Titration experiments between Nun and both Nus factors, have also revealed no direct interaction. Altogether, it can be deduced that there might be no direct interaction between Nun and NusA ar1, and NusG, and NusB. The NusA transcription elongation protein, which binds nut site RNA, contains sequences corresponding to the S1 and KH classes of identified RNA binding domains. To gain comprehensive insights into binding surface on SKK domain upon nut RNA binding, backbone resonances of SKK domain was assigned using sequential Cα, Cβ and CO chemical shift information derived from an array of TROSY based triple-resonance experiments. With virtually complete backbone assignment (80.5 %) of the SKK domain it was possible to characterize the interaction between SKK domain and λ nutL RNA by NMR titration experiments. Significant chemical shift changes observed on SKK domain upon addition of unlabeled λ nutL RNA, had reflected a direct interaction. Mapping of chemical shift perturbations on SKK domain revealed that the RNA binding interface is mainly located in the KH domains. The results implied a sequence-specific RNA binding.
SUMMARY 115 In the free state, NusA cannot bind to RNA. Once α-CTD of RNA polymerase is bound to NusA the RNA binding inhibition is released. A direct interaction between α-CTD and NusA ar2 have been reported and therefore NusA ar2 could be a prime candidate for inhibiting the RNA binding of NusA. To further evaluate the autoinhibition effect of NusA ar2 on SKK domain, titrations between NusA ar2 and SKK domain have been performed. Upon NusA ar2 binding, notable chemical shift changes were observed in the KH1 region of SKK domain. The residues which were affected on binding to NusA ar2 were also affected during the SKK and λ nutL titration experiments. The results are in good agreement with the proposed idea that NusA ar2 possibly occludes the RNA binding domains of NusA. To investigate the effect of α-CTD on RNA binding by NusA, titration of the complex containing SKK domain and NusA ar2 by gradually adding an increased molar ratio of α-CTD have been carried out. On addition of α-CTD, it was clearly observed that α-CTD displaced NusA ar2 from the complex suggesting that the inhibition of RNA binding by NusA ar2 could be released by α-CTD.
116 ZUSAMMENFASSUNG 6 Zusammenfassung Im Phagen λ wird die Antitermination durch das λ-codierte N Protein initiiert, das eine Vielzahl von Wirtsproteinen, die sogenannten Nus Faktoren, rekrutiert. Bisher sind nur einige von diesen Wirtsproteinen, die für eine effiziente Termination und Antitermination der Transkription wichtig sind, identifiziert. Dazu gehören NusA, NusB, NusE und NusG. Gegenstand dieser Arbeit war die Charakterisierung von möglichen Wechselwirkungen zwischen den verschiedenen Nus Wirtsfaktoren im Terminationsund Antiterminations system mit Hilfe von NMR Spektroskopie. Ebenso wie das N Protein benötigt auch Nun zusätzliche Wirtsfaktoren für eine funktionierende Termination. Bisher wurde nur gefunden, dass NusA mit der C-terminalen Region von Nun interagiert, wobei für die Bindung von Nun an NusA die NusA ar1 Region benötigt wird. Darauf aufbauend wurde mit Hilfe von 1H,15N-HSQC Spektren die Wechselwirkung zwischen HK022-Nun und NusA ar1 untersucht. Dabei konnten keinerlei Veränderungen der chemischen Verschiebung während der Titration beobachtet werden. Folglich findet keine Interaktion zwischen NusA ar1 und Nun statt. Über die Wechselwirkung zwischen Nun und NusG oder NusB gibt es bis jetzt noch keine Informationen. Die in dieser Arbeit durchgeführten Titrationsstudien mit Nun und diesen beiden Nus Faktoren zeigten ebenso keine direkten Interaktionen. Basierend auf den durchgeführten Experimente kann gefolgert werden, dass keine direkten Wechselwirkungen zwischen Nun und NusA ar1, NusG oder NusB vorhanden sind. Der Transkriptions-Elongationsfaktor NusA, der die nut RNA bindet, enthält Bereiche, die zu der Klasse der S1 und KH homologen Domänen gehören und als RNA Bindungsdomänen identifiziert wurden. Um einen detaillierten Einblick in die Bindungsfläche der SKK Domänen bei der Bindung an die nut RNA zu bekommen, erfolgte eine sequenzspezifische Zuordnung der Amidresonanzen des Proteinrückgrats. Die fast vollständige Zuordnung (80,5%) ermöglichte nun die Untersuchung der Wechselwirkung zwischen der SKK Domäne und der nut RNA mit Hilfe von NMR Spektroskopie.
ZUSAMMENFASSUNG 117 Bei der Titration der SKK Domäne mit der unmarkierten λ nutL RNA konnten deutliche Veränderungen der chemischen Verschiebung beobachtet werden, die auf eine direkte Interaktion schließen lassen. Eine Visualisierung der Veränderungen der chemischen Verschiebung auf der Oberfläche von NusA SKK zeigt, dass die RNA Bindungsfläche hauptsächlich im Bereich der beiden KH Domänen zu finden ist. Dies deutet somit auf eine sequenzspezifische RNA Bindung hin. NusA kann im freien zustand keine RNA binden. Erst durch die Bindung an die α-CTD der RNA polymerase wird diese Selbstblockade aufgehoben. Da Experimente auf eine Interaktion zwischen der α-CTD und NusA ar2 hindeuteten, könnte möglicherweise NusA ar2 die RNA Bindungsstelle blockieren. Um diesen autoinhibitorischen Effekt zu untersuchen, wurde NusA ar2 zu der SKK Domäne titriert. Dabei konnte für diejenigen Aminosäuren eine Veränderung der chemischen Verschiebung beobachtet werden, die auch an der Bindung der RNA beteiligt sind, so dass hierdurch die Hypothese der Selbstblockade durch NusA ar2 bestätigt werden konnte. Eine Titration des Komplexes aus NusA ar2 und der SKK Domäne mit α-CTD zeigte, dass durch die Zugabe von α-CTD NusA ar2 von der RNA Bindungsstelle verdrängt wird und bestätigt damit ebenso die autoinhibitorische Rolle von NusA ar2.
118 ABBREVIATIONS 7 Abbreviations ε molar extinction coefficient 1D one dimensional 2D two dimensional 3D three dimensional aa amino acid A280 absorption at 280 nm APS ammonium peroxy disulfate ARM arginine rich motif ar1 acidic repeat 1 ar2 acidic repeat 2 ATP adenosine-5'-triphosphate bp base pair CSA chemical shift anisotropy CTD carboxy terminal domain CV column volume Da dalton DSS 2,2-dimethyl-2-silapentane-5-sulfonic acid DD dipole-dipole DNA deoxyribonucleic acid DNase I deoxyribonuclease I DTT dithiothreitol EMSA electrophoretic mobility-shift assay E. coli Escherichia coli EDTA ethylenediaminetetraacetic acid FPLC fast protein liquid chromatography Fig figure h hour HK022 HongKong 022 HPLC high performance liquid chromatography HSQC heteronuclear single quantum coherence INEPT Insensitive Nuclei Enhancement by Polarization Transfer IPTG isopropyl-β-D-thiogalactopyranoside kDa kilo Dalton KDdissociation constant L liter LB Luria Bertani medium mRNA messenger RNA µ micro (10-6) µm micromolar (µmol/L) m milli (10-3) mAU milli-Absorption Unit
ABBREVIATIONS 119 mL milliliter mM millimolar (mmol/L) M9 minimal medium min minute M molar (mol/L) MWCO molecular weight cutoff nm nanometer NMR nuclear magnetic resonance NOE nuclear Overhauser effect NOESY nuclear Overhauser effect spectroscopy nt nucleotide NTD amino terminal domain NTPs nucleoside triphosphates NS number of scans Nus N-utilization substance nut N-utilization OD600 optical density at 600 nm PAGE polyacrylamide gel electrophoresis PEG polyethylene glycol PCR polymerase chain reaction PDB protein data bank PMSF phenylmethylsulfonylflouride ppm parts per million put polymerase utilization RNase ribonuclease RNA ribonucleic acid rut rho-utilization rpm rotations per minute RT room temperature SDS sodium dodecyl sulfate SDS-PAGE sodium dodecyl sulfate-polyacrylamide gel electrophoresis sec second SKK S1+KH1+KH2 SW spectral width SF0 spectrometer frequency used SAR Structure Activity Relationships TEMED N-,N-,N´-,N´-Tetramethyleneethyldiamine TEV tobacco etch virus TD total number of data points TFA trifluoroacetic acid TPPI time proportional phase incrementation Tris tris(hydroxymethyl)aminomethane TROSY Transverse Relaxation Optimized Spectroscopy tsp transcription stop points TS2 trace element solution 2 U unit v/v volume by volume w/v weight by volume
120 REFERENCES 8 References Agnieszka S.P., Barbara S., Antosiewicz A.H., Wegrzyn G and Thomas M.S. (2003) Genetic analysis of bacteriophage lambda-N dependent antitermination suggests a possible role for the RNA polymerase alpha subunit in facilitating specific functions of NusA and NusE. Arch Microbiol. 180, 161-168 Ahmad Z and Huang K.P. (1981) Dephosphorylation of rabbit skeletal muscle glycogen synthase (phosphorylated by cyclic AMP-independent synthase kinase 1) by phosphatases. J Biol Chem. 256, 757-760 Archer S.J., Ikura M., Torchia D.A and Bax A. (1991) An alternative 3D NMR technique for correlating backbone 15N with side chain Hb resonances in larger proteins. J Magn Reson. 95, 636-641 Arnvig K.B., Pennell S., Gopal B., Colston M.J. (2004) A high-affinity interaction between NusA and the rrn nut site in Mycobacterium tuberculosis. Proc Natl Acad Sci U S A. 101, 8325-8330 Barik S., Ghosh B., Whalen W., Lazinski D and Das A. (1987) An antitermination protein engages the elongating transcription apparatus at a promoterproximal recognition site. Cell. 50, 885-899 Barkhuijsen H., De Beer W., Bovee M.M.J and van Ormondt D. (1985) Retrieval of frequencies, amplitudes, damping factors, and phases from time domain signals using a linear least squares procedure. J Magn Reson. 61, 465-481 Bax A and Ikura M. (1991) An efficient 3D NMR technique for correlating the proton and 15N backbone amide resonances with the a-carbon of the preceding residue in uniformly 15N/13Cenriched proteins. J Biomol NMR. 1, 99-104 Berg K.L., Squires C and Squires C.L. (1989) Ribosomal RNA operon antitermination. Function of leader and spacer region boxB-boxA sequences and their conservation in diverse micro-organisms. J Mol Biol. 209, 345–358
REFERENCES 121 Bodenhausen G and David J.R. (1980) Natural abundance nitrogen-15NMR by enhanced heteronuclear spectroscopy. Chem Phys Lett. 69, 185-189 Burgess R.R., Erickson B., Gentry D., Griskov M and Hager D. (1987) RNA polymerase and the regulation of transcription. NewYork: Elsevier, pp. 3-15 Burova E., Hung S.C., Chen J., Court D.L., Zhou J.G., Mogilnitskiy G., Gottesman M.E. (1999) Escherichia coli nusG mutations that block transcription termination by coliphage HK022 Nun protein. Mol Microbiol. 31, 1783–1793 Campbell A. (1994) Comparative molecular biology of lambdoid phages. Annu Rev Microbiol. 48, 193-222 Cavanagh J., Fairbrother W.J., Palmer A.G and Skelton N.J. (1996) Protein NMR Spectroscopy: Principles and Practice. Academic Press, Inc., San Diego Christopher A.L., Jonathan M.M and Jeffrey W.P. (2004) Theory and applications of NMR based screening in pharamaceutical research. Chem Rev. 104, 3641-3675 Clubb R.T., Thanabal V and Wagner G. (1992a) A constant-time 3-dimensional triple-resonance pulse scheme to correlate intra residue H-1(N), N-15, and C-13(') chemical shifts in N-15-C-13-labeled proteins. J Magn Reson. 92, 213-217 Clubb R.T., Thanabal V and Wagner G. (1992b) A new 3D HN(CA)HA experiment for obtaining fingerprint HN-Halpha peaks in 15Nand 13C-labeled proteins. J Biomol NMR. 2, 203-210 Court D.L., Oppenheim A.B., and Adhya S.L. (2007) A new look at bacteriophage lambda genetic networks. J Bacteriol. 189, 298-304 Das A. (1992) How the phage lambda N gene product suppresses transcription termination: communication of RNA polymerase with regulatory proteins mediated by signals in nascent RNA. J Bacteriol. 174, 6711–6716 Das A. (1993) Control of transcription termination by RNA-binding proteins. Annu Rev Biochem. 62, 893-930
122 REFERENCES Das A., Pal M., Mena J.G., Whalen W., Wolska K., Crossley R., Rees W., Hippel P.Y., Costantino N., Court D., Mazzulla M., Altieri A.S., Byrd A., Chatopadhay S., Devito, B and Ghosh B. (1996) Components of multiprotein-RNA complex that controls transcription elongation in E. coli phage lambda. Methods Enzymol. 274, 374-402 DeVito J and Das A. (1994) Control of transcription processivity in phage λ Nus factors strengthen the terminationresistant state of RNA polymerase induced by N antiterminator. Proc Natl Acad Sci U S A. 91, 8660-8664 Dhillon E.K., Dhillon T.S., Lam Y.Y and Tsang A.H. (1980) Temperate coliphages: classification and correlation with habitats. Appl Environ Microbiol. 39, 1046-1053 Dhillon T.S., Dhillon E.K and Lai A.N. (1981) Genetic recombination between phage HK022, lambda, and phi 80. Virology. 109, 198–200 Dodd I.B., Shearwin K.E and Egan B.J. (2005) Revisited gene regulation in bacteriophage λ. Curr Opin Genet Dev. 15, 145-152 Dombroski A.J., Walter W.A and Gross C.A. (1993) Amino-terminal amino acids modulate sigma-factor DNA-binding activity. Genes Dev. 7, 2446-2455 Eisenmann A., Schwarz S., Prasch S., Schweimer K and Rösch P. (2005) The E. coli NusA carboxy-terminal domains are structurally similar and show specific RNAP and lambda N interaction. Protein Sci. 14, 2018-2029 Engelke J and Ruterjans H. (1995) Sequential protein backbone assignments using an improved 3D-HN(CA)CO pulse scheme. J Magn Reson. Series B. 109, 318-322. Ernst R.R., Bodenhausen B and Wokaun A. (1992) Principles of Nuclear magnetic resonances in one or two dimensions. Oxford University Press Faber C., Schärpf M., Becker T., Sticht H and Rösch P. (2001) The structure of the coliphage HK022 Nun protein−lambda−phage boxB RNA complex. Implications for the mechanism of transcription termination. J Biol Chem. 276, 32064−32070 Feeney J., Batchelor J.G., Albrand J.P and Roberts G.C.K. (1979) The effects of intermediate exchange processes on the estimation of equilibrium constants by NMR.
REFERENCES 123 J Magn Reson. 33, 519-529 Fernandez C and Wider G. (2003) TROSY in NMR studies of the structure and function of large biological macromolecules. Curr Opin Struct Biol. 13, 570-580 Fesik S.W and Zuiderweg E.R.P. (1988) Heteronuclear Three-Dimensional NMR Spectroscopy. A Strategy for the Simplification of Homonuclear Two-Dimensional NMR Spectra. J Magn Reson. 78, 588-593 Fielding L. (2007) NMR methods for the determination of protein-ligand dissociation constants. Progress in Nuclear Magnetic Resonance Spectroscopy. 51, 219-242 Fraser C.M., Gocayne J.D., White O., Adams M.D., Clayton R.A., Fleischmann R.D., Bult C.J., Kerlavage A.R., Sutton G and Kelley J.M. (1995). The minimal gene complement of Mycoplasma genitalium. Science. 270, 397–403 Freifelder David. (2001) University of California, San Diego. Molecular biology. Second edition. Jones and Bartlett Publishers, Inc., U.S.A. Friedman D.I., Baumann M.F., Baron L.S. (1976) Cooperative effects of bacterial mutations affecting λN gene expression: Isolation and characterization of a nusB mutant. Virology. 73, 119 127 Friedman D.I., Olson E.R., Johnson L.L., Alessi D and Craven M.G. (1990) Transcription-dependent competition for a host factor: The function and optimal sequence of the phage λ boxA transcription antitermination signal. Genes Dev. 4, 2210-2222 Friedman D.I and Court D.L. (1995) Transcription antitermination: the lambda paradigm updated. Mol Microbiol. 18, 191-200 Friedman D.I and Court D.L. (2001) Bacteriophage lambda: alive and well and still doing its thing. Curr Opin Microbiol. 4, 201-207 Friedrich M.S. (1995) A Model-free algorithm for the removal of baseline artifacts. J Biomol NMR. 5, 147-153 Garber M.E., Wei P., Kewal Ramani V.N., Mayall T.P., Herrmann C.H, et al. (1998) The interaction between HIV-1 Tat and human cyclin T1 requires zinc and a critical cysteine residue that is not conserved in the murine CycT1 protein.
130 REFERENCES site may regulate antitermination. J Mol Biol. 236, 217-228 Pellacchia M., Montgomery D.L., Stevens S.Y., Vander Kooi C.W., Feng H.P., Gierasch L.M and Zuiderweg E.R. (2000) Structural insights in to substrate binding by the molecular chaperone DnaK. Nat Struct Biol. 7, 298-303 Pervushin K. (2000) Impact of transverse relaxation optimized spectroscopy (TROSY) on NMR as a technique in structural biology. Q Rev Biophys. 33, 161-197 Pervushin K., Riek R., Wider G and Wüthrich K. (1997) Attenuated T2 relaxation by mutual cancellation of dipole-dipole coupling and chemical shift anisotropy indicates an avenue to NMR structures of very large biological macromolecules in solution. Proc Natl Acad Sci U S A. 94, 12366-12371 Piotto M., Saudek V and Sklenar V. (1992) Gradient-tailored excitation for single-quantum NMR spectroscopy of aqueous solutions. J Biomol NMR. 2, 661-665. Prasch S., Schwarz S., Eisenmann A., Wöhrl B.M., Schweimer K and Rösch P. (2006) Interaction of the intrinsically unstructured phage λ N protein with Escherichia coli NusA. Biochemistry. 45, 4542-4549 Prasch S., Jurk M.A.W., Washburn R.S., Gottesman M.E., Wöhrl B.M and Rösch P. (2008) E. coli NusA recognizes phage λ nut spacer RNA sequences. In revision. Press W.H., Teukolsky S.A., Vetterling W.T and Flannery B.P. (1992) Numerical recipes in C 2nd ed. New York: Cambridge University Press Ptashne M and Gann A. (2002) Genes and signals. Cold spring harbor, New York, Cold Spring Harbor Laboratory Press Ptashne M. (1992) A genetic switch:Phage lambda and higher organisms. Cambridge, MA: Blackwell Sci. 2nd edition. Rajagopal P., Waygood E.B., Reizer J., Saier M.H and Klevit R.E. (1997) Demonstration of protein-protein interaction specificity by NMR chemical shift mapping. Protein Sci. 6, 2624-2627 Rees W.A., Weitzel S.E., Yager T.D., Das A and von Hippel P.H. (1996) Bacteriophage lambda N protein alone can induce transcription antitermination in vitro.
REFERENCES 131 Proc Natl Acad Sci U S A. 93, 342-346 Rhodius V.A and Stephen Busby J.W. (1998) Positive activation of gene expression. Curr Opin Microbiol. 1, 152-159 Riek R., Pervushin K and Wüthrich K. (2000) TROSY and CRINEPT: NMR with large molecular and supramolecular structures in solution. Trends Biochem Sci. 25, 462-468 Robert C.T., Hassan K.S., Shanteri S., David J.A., Craig A.B., John L.M and Brian G.F. (2005) Auto-induction medium for the production of [U-15N]- and [U-13C, U-15N]-labelled proteins for NMR screening and structure determination. Protein Expr Purif. 40, 268-278 Robledo R.A and Gottesman M.E. (1991) Escherichia coli mutations that block transcription termination by phage HK022 Nun protein. J Mol Biol. 220, 613–619 Roger W Hendrix. (2003) Bacteriophage genomics. Curr Opin Microbiol. 6, 506-511 Rosenberg M., Court D., Shimatake H., Brady C and Wulff D.L. (1978) The relationship between function and DNA sequence in an intercistronic regulatory region in phage lambda. Nature. 272, 414−423 Sambrook J., Fritsch E.F and Maniatis M. (1989) Molecular cloning: a laboratory manual. Sattler M., Schleucher J and Griesinger C. (1999) Heteronuclear multidimensional NMR experiments for the structure determination of proteins in solution employing pulsed field gradients. Progress in Nuclear Magnetic Resonance Spectroscopy. 34, 93-158 Schagger H and Von Jagow G. (1987) Tricine−sodium dodecyl−sulfate−polyacrylamide gel electrophoresis for the separation of proteins in the range from 1 to 100 kDa. Anal Biochem. 166, 368−379 Scharpf M., Sticht H., Schweimer K., Boehm M., Hoffmann S and Rosch P. (2000) Antitermination in bacteriophage λ. The structure of the N36 peptide-boxB RNA complex. Eur J Biochem. 267, 2397-2408 Schleucher J., Sattler M and Griesinger C. (1993) Coherence selection by gradients without signal attenuation: application to the three-
132 REFERENCES dimensional HNCO experiment. Angew Chem. 105, 1518-1521 Schleucher J., Schwendinger M.G., Sattler M., Schmidt P., Schedletzky O., Glaser S.J., Sorensen O.W and Griesinger C. (1994) A general enhancement scheme in heteronuclear multidimensional NMR employing pulsed field gradients. J Biomol NMR. 4, 301-306 Schweimer K. (2000) Mehrdimensionale NMR Spektoskopie zur Bestimmung der Strukturen des Birken pollenallergens Bet v1, des Guillardia theta Rubredoxins und des [2Fe-2S] Ferredoxins aus Halobakterium salinarium. Doctoral Dissertation, University of Bayreuth, Bayreuth, Germany. Sekhar T and Gerhard W. (1996) An optimized 3D NOESY-HSQC. J Magn Reson. B. 112, 200-205 Shuker S.B., Hajduk P.J., Meadows R.P and Fesik S.W. (1996) Discovering high-affinity ligands for proteins: SAR by NMR. Science. 274, 1531-1534 Sklenar V., Piotto M., Leppik R and Saudek V. (1993) Gradient-tailored water suppression for 1H-15N HSQC experiments optimized to retain full sensitivity. J Magn Reson. 102, 241-245 States D.J., Haberkorn R.A and Ruben D.J. (1982) A Two-Dimensional nuclear overhauser experiment with pure absorption phase in four quadrants. J Magn Reson. 48, 286-292 Steven S.Y., Sanker S., Kent C and Zuiderweg E.R. (2001) Delineation of the allosteric mechanism of a cytidylyl transferase exhibiting negative cooperativity. Nat Struct Biol. 8, 947-952 Studier F.W. (2004) Auto-induction for protein production in inducible T7 expression systems. Annual Meeting of the American Crystallographic Association, Chicago, IL, July 17–22 Studier F.W. (2005) Protein production by auto-induction in high density shaking cultures. Protein Expr Purif. 41, 207-234 Sugar I.P and Neumann E (1984) Stochastic model for electric field-induced membrane poresElectroporation. Biophys Chem. 19, 211–25
REFERENCES 133 Sullivan S.L and Gottesman M.E. (1992) Requirement for E. coli NusG protein in factor-dependent transcription termination. Cell. 68, 989–994 Szalewska-Palasz A., Strzelczyk B., Herman-Antosiewicz A., Wegrzyn G and Thomas M.S (2003) Genetic analysis of bacteriophage lambda-N dependent antitermination suggests a possible role for the RNA polymerase alpha subunit in facilitating specific functions of NusA and NusE. Arch Microbiol. 180, 161-168 Thomas M.R. (1994) Simple, effective clean-up of DNA ligation reaction prior to electro−transformation of E. coli. Biotechniques. 16, 988−990. Uptain S.M., Kane C.M and Chamberlin M.J. (1997) Basic mechanisms of transcript elongation and its regulation. Annu Rev Biochem. 66, 117-172 Van Nuland N.A., Kroon G.J., Dijkstra K., Wolters G.K., Scheek R.M and Robillard G.T. (1993) The NMR determination of the IIA (mt1) binding site on Hpr of the Escherichia coli phosphoenol pyruvate-dependent phosphotransferase system. FEBS Lett. 315, 11-15 Vassylyev D.G., Vassylyeva M.N., Perederina A., Tahirov T.H and Artsimovitch I. (2007) Structural basis for transcription elongation by bacterial RNA polymerase. Nature. 448, 157-165 Voet Donald, Voet Judith and Charlotter w-Pratt. Fundamentals of Biochemistry. 2nd edition von Hippel P.H. (1998) An integrated model of the transcription complex in elongation, termination and editing. Science. 281, 660-665 von Hippel P.H., Rees W.A., Rippe K and Wilson K.S. (1996) Specificity mechanisms in the control of transcription. Biophys Chem. 59, 231-246 Von Hippel PH., Pasman Z. (2002) Reaction pathways in transcript elongation. Biophys Chem. 101-102, 401-423 Vuister G.W and Bax A. (1992) Resolution enhancement and spectral editing of uniformly 13C enriched proteins by homonuclear broadband 13C decoupling. J Magn Reson. 98, 428-435
134 REFERENCES Washburn R.S., Court D.L and Gottesman M.E. (2006) Role of Rnase III binding site in transcription termination an lambda nutL by HK022 Nun protein. J Bacteriol. 188, 6824-6831 Washburn R.S., Wang Y and Gottesman M.E. (2003) Role of E. coli transcription-repair coupling factor Mfd in Nun-mediated transcription termination. J Mol Biol. 329, 655–662 Watnick R.S and Gottesman M.E. (1998) Escherichia coli NusA is required for efficient RNA binding by phage HK022 nun protein. Proc Natl Acad Sci U S A. 95, 1546−1551 Watnick R.S., Herring S.C., Palmer A.G and Gottesman M.E. (2000) The carboxyl terminus of phage HK022 Nun includes a novel zinc−binding motif and a tryptophan required for transcription termination. Genes Dev. 14, 731−739 Weisberg R.A and Gottesman M.E. (1999) Processive antitermination. J Bacteriol. 181, 359-367 Weisberg R.A., Gottesman M.E., Hendrix R.W and Little JW. (1999) Family values in the age of genomics:Comparative analyses of temperate bacteriophage HK022. Annu Rev Genet. 33, 565-602 Whalen W., Ghosh B and Das A. (1988) NusA protein is necessary and sufficient in vitro for phage λN gene product to suppress a rhoindependent terminator placed downstream of nutL. Proc Natl Acad Sci U S A. 85, 2494-2498 Wider G and Wüthrich K. (1999) NMR spectroscopy of large molecules and multimolecular assemblies in solution. Curr Opin Struct Biol. 9, 594-601 William R. C and Robert M. K.C. (1994) Two-Dimensional NMR Spectroscopy. Applications for chemists and Biochemists. Second Edition Williamson R.A., Carr M.D., Frenkiel T.A., Feeney J and Freedman R.B. (1997) Mapping the binding site for matrix metalloproteinase on the N-terminal domain of the tissue inhibitor of metalloproteinases-2 by NMR chemical shift perturbation. Biochemistry. 36, 13882-13889 Wilson C.M. (1983) Staining of proteins on gels: Comparisons of dyes and procedures. Methods Enzymol. 91, 236-246
REFERENCES 135 Wisdom G.B. (1997) Molecular weight determinations using polyacrylamide gel electrophoresis with tris-tricine buffers. Methods Mol Biol. 73, 97 -100 Wittekind M and Mueller L. (1993) HNCACB, a High-sensitivity 3D NMR experiment to correlate amide-proton and nitrogen resonances with the alpha and beta carbon resonances in proteins. J Magn Reson. 101, 201-205 Worbs M., Bourenkov G.P., Bartunik H.D., Huber R and Wahl M.C. (2001) An extended RNA binding surface through arrayed S1 and KH domains in transcription factor NusA. Mol Cell. 7, 1177-1189 Wüthrich K., Salzmann M., Pervushin K., Wider G., Senn H. (1998) TROSY in triple-resonance experiments: New perspectives for sequential NMR assignment of large proteins. Proc Natl Acad Sci U S A. 95, 13585-13590 Zheng C and Friedman D.I. (1994) Reduced Rho-dependent transcription termination permits NusA-independent growth of Escherichia coli. Proc Natl Acad Sci U S A. 91, 7543-7547 Zhou P., Lugovskoy A.A and Wagner G. (2001) A solubility-enhancement tag (SET) for NMR studies of poorly behaving proteins. J Biomol NMR. 20, 11-4 Zhou Y., Mah T.F., Greenblatt J and Friedman D.I. (2002) Evidence that the KH RNA-binding domains influence the action of the E. coli NusA protein. J Mol Biol. 318, 1175-1188 Zuiderweg E.R., Hamers L.F., Rollema H.S., de Bruin S.H and Hilbers C.W. (1981) 31P NMR study of the kinetics of binding of myo-inositol hexakisphosphate to human hemoglobin-observation of fast-exchange kinetics in high affinity systems. Eur J Biochem. 118, 95-104. Zuiderweg E.R. (2002) Mapping protein-protein interactions in solution by NMR spectroscopy. Biochemistry. 41, 1-7
136 APPENDIX 9 Appendix 9.1 Script for KD fitting clear; global Data; fqz_1H = 700.13; fqz_15N = 70.5; %fqz_1H = 1.0; %fqz_15N = 1.0; filename_SHIFT = sprintf('../text.data') fp = fopen(filename_SHIFT) shiftdata = fscanf(fp,'%g %g',[2 inf]) fclose(fp) filename_CONC = sprintf('../ratio.dat') fp = fopen(filename_CONC) conc_data = fscanf(fp,'%g %g',[2 inf]) fclose(fp) shiftdata = shiftdata' conc_data = conc_data' ratio = conc_data(:,1) conc = conc_data(:,2) conc = conc .* 1000.0 proton = shiftdata(:,1) proton = proton - proton(1); proton = proton * fqz_1H; nitrogen = shiftdata(:,2) nitrogen = nitrogen(1) - nitrogen nitrogen = nitrogen * fqz_15N; norm_shift = sqrt(proton .* proton + nitrogen .* nitrogen) % plot(ratio, norm_shift, 'ro') Data = zeros(length(conc), 3); Data(:,1) = conc Data(:,2) = ratio Data(:,3) = norm_shift a = Data(:,2) b = Data(:,3) plot(a, b, 'ro') hold on global Plothandle Plothandle = plot(a, b, 'EraseMode','xor'); k = [10 1]; trace = 0; % If this is nonzero, intermediate steps in the solution are displayed. tol = .00001; % This is the termination tolerance. k = fminsearch('kd_fit_func',k,[trace tol]); k
APPENDIX 137 9.2 Nucleotide sequence of HK022 Nun atgctgatggtgaaaaaaaccatttatgtgaacccggatagcggccagaaccgcaaagtg M L M V K K T I Y V N P D S G Q N R K V agcgatcgcggcctgaccagccgcgatcgccgccgcattgcgcgctgggaaaaacgcatt S D R G L T S R D R R R I A R W E K R I gcgtatgcgctgaaaaacggcgtgaccccgggctttaacgcgattgatgatggcccggaa A Y A L K N G V T P G F N A I D D G P E tataaaattaacgaagatccgatggataaagtggataaagcgctggcgaccccgtttccg Y K I N E D P M D K V D K A L A T P F P cgcgatgtggaaaaaattgaagatgaaaaatatgaagatgtgatgcatcgcgtggtgaac R D V E K I E D E K Y E D V M H R V V N catgcgcatcagcgcaacccgaacaaaaaatggagc H A H Q R N P N K K W S Physical/Chemical parameters of HK022 Nun Number of amino acids 112 Molecular weight 13107.8 Theoretical pI 9.52 Extinction coefficient 16960 Instability index 41.05 ----------------------------------------------------------------------------------------------------------------- 9.3 Nucleotide sequence of Nun CTD ggcgcgatgggcgtgaccccgggctttaacgcgattgatgatggcccggaatataaaatt G A M G V T P G F N A I D D G P E Y K I aacgaagatccgatggataaagtggataaagcgctggcgaccccgtttccgcgcgatgtg N E D P M D K V D K A L A T P F P R D V gaaaaaattgaagatgaaaaatatgaagatgtgatgcatcgcgtggtgaaccatgcgcat E K I E D E K Y E D V M H R V V N H A H cagcgcaacccgaacaaaaaatggagc Q R N P N K K W S Physical/Chemical parameters of Nun CTD Number of amino acids 69 Molecular weight 7892.7 Theoretical pI 5.21 Extinction coefficient 8480 Instability index 30.50 -------------------------------------------------------------------------------------------------
138 APPENDIX 9.4 Nucleotide sequence of NusA (1-495) atgaacaaagaaattctggcggtggtggaagcggtgagcaacgaaaaagcgctgccgcgc M N K E I L A V V E A V S N E K A L P R gaaaaaatttttgaagcgctggaaagcgcgctggcgaccgcgaccaaaaaaaaatatgaa E K I F E A L E S A L A T A T K K K Y E caggaaattgatgtgcgcgtgcagattgatcgcaaaagcggcgattttgatacctttcgc Q E I D V R V Q I D R K S G D F D T F R cgctggctggtggtggatgaagtgacccagccgaccaaagaaattaccctggaagcggcg R W L V V D E V T Q P T K E I T L E A A cgctatgaagatgaaagcctgaacctgggcgattatgtggaagatcagattgaaagcgtg R Y E D E S L N L G D Y V E D Q I E S V acctttgatcgcattaccacccagaccgcgaaacaggtgattgtgcagaaagtgcgcgaa T F D R I T T Q T A K Q V I V Q K V R E gcggaacgcgcgatggtggtggatcagtttcgcgaacatgaaggcgaaattattaccggc A E R A M V V D Q F R E H E G E I I T G gtggtgaaaaaagtgaaccgcgataacattagcctggatctgggcaacaacgcggaagcg V V K K V N R D N I S L D L G N N A E A gtgattctgcgcgaagatatgctgccgcgcgaaaactttcgcccgggcgatcgcgtgcgc V I L R E D M L P R E N F R P G D R V R ggcgtgctgtatagcgtgcgcccggaagcgcgcggcgcgcagctgtttgtgacccgcagc G V L Y S V R P E A R G A Q L F V T R S aaaccggaaatgctgattgaactgtttcgcattgaagtgccggaaattggcgaagaagtg K P E M L I E L F R I E V P E I G E E V attgaaattaaagcggcggcgcgcgatccgggcagccgcgcgaaaattgcggtgaaaacc I E I K A A A R D P G S R A K I A V K T aacgataaacgcattgatccggtgggcgcgtgcgtgggcatgcgcggcgcgcgcgtgcag N D K R I D P V G A C V G M R G A R V Q gcggtgagcaccgaactgggcggcgaacgcattgatattgtgctgtgggatgataacccg A V S T E L G G E R I D I V L W D D N P gcgcagtttgtgattaacgcgatggcgccggcggatgtggcgagcattgtggtggatgaa A Q F V I N A M A P A D V A S I V V D E gataaacataccatggatattgcggtggaagcgggcaacctggcgcaggcgattggccgc D K H T M D I A V E A G N L A Q A I G R aacggccagaacgtgcgcctggcgagccagctgagcggctgggaactgaacgtgatgacc N G Q N V R L A S Q L S G W E L N V M T gtggatgatctgcaggcgaaacatcaggcggaagcgcatgcggcgattgatacctttacc V D D L Q A K H Q A E A H A A I D T F T aaatatctggatattgatgaagattttgcgaccgtgctggtggaagaaggctttagcacc K Y L D I D E D F A T V L V E E G F S T ctggaagaactggcgtatgtgccgatgaaagaactgctggaaattgaaggcctggatgaa L E E L A Y V P M K E L L E I E G L D E ccgaccgtggaagcgctgcgcgaacgcgcgaaaaacgcgctggcgaccattgcgcaggcg P T V E A L R E R A K N A L A T I A Q A caggaagaaagcctgggcgataacaaaccggcggatgatctgctgaacctggaaggcgtg Q E E S L G D N K P A D D L L N L E G V gatcgcgatctggcgtttaaactggcggcgcgcggcgtgtgcaccctggaagatctggcg D R D L A F K L A A R G V C T L E D L A
APPENDIX 139 gaacagggcattgatgatctggcggatattgaaggcctgaccgatgaaaaagcgggcgcg E Q G I D D L A D I E G L T D E K A G A ctgattatggcggcgcgcaacatttgctggtttggcgatgaagcg L I M A A R N I C W F G D E A Physical/Chemical parameters of NusA (1-495) Number of amino acids 495 Molecular weight 54870.9 Theoretical pI 4.53 Extinction coefficient 31065 Instability index 35.15 ----------------------------------------------------------------------------------------------------------------- 9.5 Nucleotide sequence of NusA ar1 atgaccgtggatgatctgcaggcgaaacatcaggcggaagcgcatgcggcgattgatacc M T V D D L Q A K H Q A E A H A A I D T tttaccaaatatctggatattgatgaagattttgcgaccgtgctggtggaagaaggcttt F T K Y L D I D E D F A T V L V E E G F agcaccctggaagaactggcgtatgtgccgatgaaagaactgctggaaattgaaggcctg S T L E E L A Y V P M K E L L E I E G L gatgaaccgaccgtggaagcgctgcgcgaacgcgcgaaaaacgcgctggcgaccattgcg D E P T V E A L R E R A K N A L A T I A caggcgcaggaagaaagcctgggc Q A Q E E S L G Physical/Chemical parameters of NusA ar1 Number of amino acids 88 Molecular weight 9751.8 Theoretical pI 4.11 Extinction coefficient 2980 Instability index 40.00 -----------------------------------------------------------------------------------------------------------------