scieee AI-readable full text Open interactive document viewer

Identification of substrate proteins of FtsH during sporulation of Bacillus subtilis

Nguyen, Hue Bach Thi

Full text

Identification of substrate proteins of FtsH during sporulation of Bacillus subtilis Dissertation zur Erlangung des Grades eines -Doktors der Naturwissenschaftender Fakultät für Biologie, Chemie und Geowissenschaften der Universität Bayreuth vorgelegt von Hue Bach Thi Nguyen Bayreuth 2012     Die vorliegende Arbeit wurde in der Zeit von Dezember 2007 bis Januar 2012 an der Universität Bayreuth am Lehrstuhl für Genetik unter der Betreuung von Prof. Dr. Wolfgang Schumann angefertigt. Vollständiger Abdruck der von der Fakultät für Biologie, Chemie und Geowissenschaften der Universität Bayreuth genehmigten Dissertation zur Erlangung des akademischen Grades eines Doktors der Naturwissenschaften (Dr. rer. nat.) Promotionsgesuch eingereicht am: 18.01.2012 Tag des wissenschaftlichen Kolloquiums: 19.04.2012 Erstgutachter: Prof. Dr. Wolfgang Schumann Zeitgutachter: Prof. Dr. Franz-Xaver Schmid Drittgutachter: PD. Dr. Stefan Heidmann Vorsitzender: Prof. Dr. Heike Feldhaar     ACKNOWLEDGEMENTS I would like to thank for all people who have inspired and encouraged me during my doctoral study. First of all, I would like to express my deepest gratitude to my supervisor Prof. Dr. Wolfgang Schumann who taught me how to question thoughts and encouraged me to express my ideas. His insightful comments and constructive criticisms during my graduate studies helped me to overcome many difficulties and finish this dissertation. I am indebted to him for his unflagging encouragement and guidance. I would like to thank to Prof. Dr. Thomas Wiegert for his scientific advice and many considerable suggestions and discussions. I would also thank to Prof. Dr. Olaf Stemmann, PD. Dr. Stefan Heidmann and the members of their groups for their help and support. My special thanks go to Markus Hermann for helping me with using the machines in their lab. I would like to gratefully and sincerely thank PD. Dr. Birgit Voigt and Prof. Dr. Michael Hecker, University of Greifswald, Prof. Dr. Bernd Bukau and member of his group in University of Heidelberg for helping me with experiments. Especial thanks go to PD. Dr. Axel Mogk with numerous insightful comments and consistent discussions. I am also grateful to people in the Department of Genetics, University of Bayreuth, for their help since I arrived at Bayreuth. In particular, I would like to thank Karin Angermann, Margit Barrera and Petra Helies for their assistance and kindness. My sincere thanks go to Quynh Anh, Kelly, Katharina for being my wonderful colleagues and real friends. Special thanks to Anja Maier, an undergraduate student, for her construction of some plasmids used in last part of my dissertation. I would like to acknowledge and thank Prof. Dr. Gabriele Obermaier, Dr. Arnim Heinemann, Mrs. Daniela Kasel and Mrs. Helga Simper for helping me with the financial support from Bayreuth University women's representative and Bayreuth International Office. My special thank to Dr. Nicodemus in Bayreuth Welcome Center for her support and encouragement in the last stage of my study.     I would like to be thankful to all of my friends who have helped and encouraged me to overcome setbacks and stay focused on my study. My heart-felt gratitude goes to bé Minh, Quỳnh Dung, Ngọc Anh, Phượng, Hồng Ánh, Lê Na, Loan, Hà, Hường, Sơn, Quỳnh, anh Bình L.V, anh Hiếu C. X, chị Ái, chị Trinh, anh Định, chị Hường, chị Tuyết, Cô Vẽ, chú Thanh, Cô Nhị, Chú Viễn, Saeedeh, Nebojsa, Johannes, Milene and Livia, my sincere thanks to them for giving me their friendship, as deep and as rich as friendship can be. Last but not least, my deepest gratitude goes to my family: my brother, my sisters, my nephews and nieces for their unflagging love and encouragement throughout my life. I am forever indebted to my parents who have sacrificed their lives for me. This dissertation is dedicated to them for their unconditional love and providing me with unending encouragement and care. I love them all dearly. Bayreuth, 18.01.2012     Table of contents Table of contents Zusammenfassung....................................................................................................... 1 Summary...................................................................................................................... 3 1. INTRODUCTION............................................................................................... 4 1.1. Bacillus subtilis - the most important genetic model organism................. of the Gram-positive bacteria .................................................................... 4 1.1.1. Overview of regulatory network in sporulation of B. subtilis................. 4 1.1.1.1. Morphology of B. subtilis sporulation and formation of protective ......... structures ..................................................................................................... 4 1.1.1.2. Key transcriptional regulators during B. subtilis sporulation................ 7 1.1.2. Genetic networks and key regulators controlling initiation ..................... of sporulation............................................................................................... 8 1.1.2.1. Activation of Spo0A, the master regulator of phase 0, occurs.................. through a phosphorelay.............................................................................. 9 1.1.2.2. Positive and negative autoregulatory loops control production............... of Spo0A~P ................................................................................................ 10 1.1.2.3. Role of phosphorylated Spo0A during initiation of sporulation .......... 12 1.1.2.4. Sigma H, a positive regulator of sporulation.......................................... 13 1.1.2.5. AbrB, an important transcription factor during initiation....................... of sporulation............................................................................................. 15 1.2. The metalloprotease FtsH ........................................................................ 16 1.2.1. Introduction of FtsH................................................................................. 16 1.2.2. Discovery of FtsH...................................................................................... 17 1.2.3. The structure of FtsH ............................................................................... 17 1.2.4. Substrate binding...................................................................................... 19 1.2.5. Mechanism of substrate recognition and degradation by FtsH............ 21 1.2.5.1. Recognition of Nor C-terminal motifs for FtsH degradation............. 21 1.2.5.2. Complex substrate recognition mechanisms .......................................... 22 i   Table of contents 1.2.6. Biological functions of the FtsH protease ............................................... 23 1.2.6.1. Membrane proteins as substrates of FtsH.............................................. 23 1.2.6.2. Cytoplasmic substrates of FtsH ............................................................... 24 1.3. The objective of the thesis ........................................................................ 27 2. MATERIALS AND METHODS ..................................................................... 29 2.1. Materials .................................................................................................... 29 2.1.1. Bacterial strains ........................................................................................ 29 2.1.2. Plasmids ..................................................................................................... 30 2.1.3. Oligonucleotides ........................................................................................ 31 2.1.4. Media.......................................................................................................... 31 2.1.5. Antibiotics.................................................................................................. 32 2.1.6. Chemicals and enzymes............................................................................ 32 2.1.7. Antibodies .................................................................................................. 33 2.2. Methods...................................................................................................... 33 2.2.1. Identification of FtsH substrates by proteomics .................................... 33 2.2.1.1. Growth conditions..................................................................................... 33 2.2.1.2. Sample preparation .................................................................................. 33 2.2.1.3. Two-dimensional polyacrylamide gel electrophoresis (2D-PAGE)...... 33 2.2.1.4. Proteome analysis and mass spectrometry for protein identification.. 34 2.2.1.5. Construction of plasmids and recombinant strains............................... 35 2.2.1.5.1. Construction of pBH1 for the spo0M transcription analysis......... 35 2.2.1.5.2. Construction of pBH2 for spo0M expression................................. 36 2.2.1.6. Expression and purification of GST-tagged proteins............................ 37 2.2.1.7. β-Galactosidase assays.............................................................................. 37 2.2.1.8. Proteolysis experiments............................................................................ 37 2.2.2. Identification of FtsH substrates by trap-mutant approach................. 38 2.2.2.1. Construction of FtsHtrap ........................................................................... 38 ii    Table of contents 2.2.2.2. Construction of plasmids and strains in B. subtilis for protein ................ trapping by FtsHtrap in vivo...................................................................... 38 2.2.2.3. Complementation of the ftsH alleles in an ftsH knockout strain .......... 40 2.2.2.3.1. Morphology complementation in the wild-type and ftsHtrap .......... 40 2.2.2.3.2. Sporulation complementation......................................................... 40 2.2.2.4. Identification of FtsH substrates by the pull-down assay ..................... 40 2.2.2.4.1. Sample preparation for protein trapping in vivo............................ 40 2.2.2.4.2. Ex vivo cross - linking with DSP .................................................... 41 2.2.2.4.3. Pull-down assay for FtsH substrate trapping in vivo..................... 41 2.2.2.5. SDS-PAGE and Western blotting............................................................ 41 2.2.2.6. Silver Staining ........................................................................................... 42 3. RESULTS .......................................................................................................... 43 3.1. Identification of FtsH substrate proteins by proteomics.............................. 43 3.1.1. Identification of the Spo0M protein as a putative substrate..................... of FtsH by 2D-gel electrophoresis............................................................ 43 3.1.2. FtsH does not influence expression of spo0M......................................... 48 3.1.3. Spo0M is confirmed as a substrate protein of FtsH by an in vitro........... degradation experiment............................................................................ 49 3.2. Identification of FtsH substrate proteins by the ftsHtrap mutant .................. 50 3.2.1. Construction and characterization of FtsHtrap ....................................... 51 3.2.1.1. Determination of expression of FtsHtrap and its controls by IPTG .......... induction .................................................................................................... 51 3.2.1.2. Physiological characterization of the ftsHtrap mutant in vivo ................ 52 3.2.1.2.1. Expression of FtsH+ restores the wild type phenotype, while ...................... FtsHtrap is defective in phenotypic complementation................................ 52 3.2.1.2.2. Expression of ftsH+ in a depletion strain shows recovery of the.................. sporulation frequency while ftsHtrap does not........................................... 53 3.2.1.3. Construction and characterization of FtsHtrap in vitro.......................... 54 iii    Table of contents 3.2.2. Identification of FtsH substrates in vivo using ........................................... the GST-FtsHtrap variant .......................................................................... 55 3.2.3. Most FtsHtrap and its co-purified proteins were detected in the ............... membrane fraction and DSP cross-linking caused protein....................... aggregation ................................................................................................ 55 3.2.4. Identification of potential FtsH substrate by SDS-PAGE and ................. silver staining............................................................................................. 57 3.2.5. YwnF was identified as a potential substrate of FtsH ........................... 59 3.3. Is the Eag protein involved in the regulation of the activity of Spo0E?....... 60 3.3.1. Construction of an eag null mutant by insertion of the pMUTIN4.......... integration vector...................................................................................... 60 3.3.2. Does the eag gene affect the sporulation frequency?............................. 62 3.3.3. Does the eag gene influence the amount of Spo0A protein? ................. 62 4. DISCUSSION .................................................................................................... 65 4.1. Identification of the Spo0M protein as a novel substrate..................... 65 4.1.1. Spo0M, a target of FtsH and its function in sporulation....................... 65 4.1.2. The function of FtsH during in the regulation of Spo0M...................... 66 4.1.3. The mechanism of substrate recognition by the FtsH protease............ 67 4.2. Construction of an FtsHtrap mutant allowing identification...................... of novel substrate proteins ....................................................................... 68 4.3. Putative role of the Eag protein in modulating the activity...................... of the Spo0E phosphatase......................................................................... 71 Reference List............................................................................................................ 74 List of abbreviations and symbols........................................................................... 88 Publication................................................................................................................. 90 Publication submitted............................................................................................... 90 Publication in preparation ....................................................................................... 90 Erklärung .................................................................................................. 91 iv    Zusammenfassung Zusammenfassung FtsH ist eine ATPund Zn -abhängige Metalloprotease, welche mittels zweier 2+ Transmembran-Segmente in der cytoplasmatischen Membran verankert ist. Sie ist die einzige beschriebene Membran-verankerte AAA-Protease bei Bakterien mit verschiedenen regulatorische Funktionen. Eine ftsH-Knockout Mutante zeigt einen pleiotropen Phänotyp. Dazu gehören filamentöses Wachstum der Zellen, Sensitivität gegenüber einem Hitzeschock und osmotischen Schock, und die Zellen können nicht mehr sporulieren. Kürzlich konnten wir zeigen, dass ftsH-Knockout Zellen nicht das Sporulations-Stadium II erreichen aufgrund einer zu geringen Menge an Spo0A~P. Außerdem haben wir Spo0E, eine Spo0A~P-spezifische Phosphatase, als erstes Substrat von FtsH identifiziert. Da die Sporulationsfrequenz in einer spo0E ftsH Doppelmutante nur teilweise wiederhergestellt wird, vermuten wir, dass FtsH weitere Substratproteine abbaut, die die Sporulation negativ beeinflussen. Um weitere Proteine zu identifizieren, wurden zwei verschiedene Strategien angewendet. Mittels der 2D-Gel Technik wurden die Proteome einer ftsH Wildtypund einer ftsH-Knockout-Mutante miteinander verglichen. Es konnten eine Reihe von Proteinen identifiziert werden, die in Abwesenheit von FtsH entweder vermehrt oder reduziert produziert wurden. Eines der mengenmäßig etwa 4-fach erhöhten Proteine wurde als Spo0M identifiziert. Da ftsH nicht mit der Transkription von spo0M interferiert, wurde ein in-vitro-Proteolysetest mit gereinigten Komponenten etabliert. Es konnte gezeigt werden, dass Spo0M ATPund Zeit-abhängig von FtsH abgebaut wird. In der zweiten Strategie wurde zunächst eine ftsHtrap Mutante konstruiert und auf Verlust der Proteolyse-Aktivität getestet. Protease Trap-Mutanten sind noch in der Lage ihre Substrate zu binden, können diese aber nicht mehr abbauen. Mit Hilfe einer GSTftsHtrap Mutante konnte das Membran-Protein YwnF gebunden und dann mittels Massen-Spektrometrie identifiziert werden. Weitere Experimente sind notwendig, um YwnF als Substrat-Protein zu verifizieren. Der letzte Teil der Dissertation galt dem eag-Gen, welches mit spo0E ein bicistronisches Operon bildet. Die Konstruktion und Analyse einer eag Insertions-Mutante ergab einen leichten Anstieg in der Sporulationsfrequenz und in der Menge an Spo0A. Eine Transkriptionsfusion zwischen dem Promotor des spo0E-eag Operons und dem lacZ Reportergen zeigte einen Anstieg in der β-Galactosidase Aktivität ab t0 bei Wachstum der Zellen in Sporulationsmedium. Da es sich bei Eag vermutlich um ein integrales Membranprotein handelt, kann es 1   Introduction Table 1.1. Key transcriptional regulators during B. subtilis sporulation. This table was taken from Kroos, 2007 Protein Aliases Function σARpoD, SigA Major σ factor in growing cells; entry into sporulation σHSpo0H Entry into sporulation Spo0A Entry into sporulation; activity persists in the mother cell σFSpoIIAC, SigF Early forespore gene expression RsfA YwfN Regulator of σF-dependent gene expression σESpoIIGB, SigE Early mother cell gene expression SpoIIID Regulator of σE-dependent gene expression, primarilya GerRbYlbO Regulator of σE-dependent gene expression σGSpoIIIG, SigG Late forespore gene expression SpoVT YabL Regulator of σG-dependent gene expression σKSpoIVCB/SpoIIICc, SigK Late mother cell gene expression GerE Regulator of σK-dependent gene expression (a): SpoIIID also represses some σK-dependent genes (Halberg and Kroos, 1994; Ichikawa and Kroos, 2000). (b): Ger, germination; a mutation in a ger gene interferes with this process, which involves rehydration of the spore and outgrowth of a rod-shaped cell in response to nutrients. (c): σK is encoded in two genes, spoIVCB and spoIIIC, which are separated by 48 kb until joined by site-specific recombination in the mother cell to form the sigK gene (Stragier et al., 1989). 1.1.2. Genetic networks and key regulators controlling initiation of sporulation Initiation of sporulation in B. subtilis is induced by nutritional, cell density, and cell cycle signals that result in an elevated concentration of Spo0A~P (Kroos, 2007). Due to nutrient deprivation, B. subtilis cells leave vegetative growth and enter the stationary 8   Introduction phase (termed transition state). In order to survive, the cells redirect their metabolism and physiology in different ways to deal with starvation (Phillips and Strauch, 2002). The cell’s first priorities are to regulate the alterations in gene expression to utilize alternative nutrients and to successfully compete with other species for scarce resources. Various extracellular proteases and other degradative enzymes are produced and the alternate pathways are applied to maximize the utilization of nutrient resources (Strauch, 1993). A variety of antibiotics and antimicrobial compounds are secreted during this stage to outcompete with other microbial species. Cells also establish a genetically competent state to uptake exogenous DNA and sporulating cells are able to cannibalize non-sporulating cells (Gonzalez-Pastor et al., 2003). Sporulation is only committed as a last resort when all other attempts to grow, to compete and to survive have been exhausted. Once initiation of sporulation has occurred, there is no turning back (Phillips and Strauch, 2002). Two key regulatory proteins involved in the inititation of sporulation are σH and Spo0A and another important factor is AbrB, a negative regulator that regulates various stationary phase responses during initiation (Errington, 1993). 1.1.2.1. Activation of Spo0A, the master regulator of phase 0, occurs through a phosphorelay Spo0A, the master regulator of stage 0, is activated by phosphorylation via a phosphorelay, an expanded version of a two-component system including protein kinases and phosphatases (Molle et al., 2003; Muchova et al., 2004). When cells enter the transition phase, unknown starvation signals trigger autophosphorylation at an invariant histidine residue of one of five sensor kinases (KinA through KinE) (Ireton et al., 1993; Jiang et al., 2000). The phosphoryl group is then transferred sequentially from the kinase(s) to Spo0F, then to Spo0B and finally to the response regulator Spo0A (Burbulys et al., 1991). Dephosphorylation of Spo0F~P may be caused by at least four Rap proteins, RapA, RapB, RapE and RapH (Perego and Hoch, 1996; Baker and Neiditch, 2011). It was thought that these Rap proteins function directly as phosphatases. Indeed, dephosphorylation of Spo0F~P is caused by the binding of Rap phosphatases to Spo0F~P stimulating its autophosphatase activity (Piggot and Hilbert, 2004; Core and Perego, 2003). The Rap proteins are inhibited specifically by their corresponding pentapeptides PhrA, PhrB, PhrE and PhrH. Their specific activity on the target Rap phosphatase is determined by the amino acid sequence of each pentapeptide (Core et al., 2001). Spo0A~P 9   Introduction itself is also dephosphorylated by the action of three phosphatases: Spo0E is produced during the transition state and two homologues, YisI and YnzD, are present during the vegetative phase of growth (Perego and Hoch, 1987). Spo0E acts as a negative regulator of sporulation by specifically dephosphorylating Spo0A~P and converting it into an inactive form. Overproduction of Spo0E represses sporulation and deletion of spo0E results in inappropriate timing of sporulation (Fig. 1.2) (Perego and Hoch, 1991). KinA KinB KinC KinD KinE S p o0F~P S p o0A~P S p o0B~P Ra p A , Ra p B , Ra p E , Ra p HSpo0E YisI YnzD PhrA PhrB PhrE PhrH Fig. 1. 2: Schematic representation of the phosphorylation of Spo0A. Spo0A is indirectly phosphorylated by a multicomponent phosphorelay involving the kinases KinA, KinB, KinC, KinD, KinE and two intermediate proteins. The kinases phosphorylate Spo0F resulting in Spo0F~P. Then, the phosphoryl group will be transferred to Spo0B and finally to Spo0A to activate it. Phr peptides sense cell density and inhibit several Rap phosphatases that can dephosphorylate Spo0F~P; Spo0E, YisI and YnzD can dephosphorylate Spo0A~P. 1.1.2.2. Positive and negative autoregulatory loops control production of Spo0A~P Production of Spo0A~P is controlled by both positive and negative regulatory loops during initiation of sporulation (Grossman, 1995). Spo0A~P can directly stimulate its own expression and contribute to the transcription of genes that regulate further accumulation of Spo0A~P via a positive feedback loop involving in AbrB and σH (Fig. 1.3). Transcription of the spo0A gene is controlled by a mechanism called “promoter switching mechanism”, involving two Spo0A~P - dependent promoters: a vegetative σArecognized promoter, Pv, and a sporulation σH-recognized promoter, Ps, controlled by the amount of phosphorylated Spo0A (Chastanet and Losick, 2011). It has been proposed that 10    Introduction a low level of spo0A is transcribed from Pv during the exponential phase of growth while Ps is silent because of the absence of Spo0A~P and σH. When Spo0A~P is formed via the phosphorelay, transcription of the spo0A gene is switched from Pv to Ps (Chastanet et al., 2010). Once activated, Spo0A~P represses transcription of abrB causing derepression of transcription of the spo0H gene coding for the sigma-H protein, thereby stimulating transcription of spo0A from a sigma-H-recognized promoter. σH also directs transcription of two response regulators, kinA and spo0F. As a result, a positive feedback loop is set up to control production of Spo0A~P (Fig. 1.3) (Britton et al., 2002). A negative feedback loop is also controlled by Spo0A~P via Spo0E and its repressor, AbrB. Transcription of spo0E is repressed by AbrB and is derepressed during early sporulation due to Spo0A~P repression of abrB (Perego and Hoch, 1991). An increase in the amount of the Spo0E phosphatase causes the removal of phosphate from Spo0A~P that converts it into the inactive form and prevents cells from entry into sporulation. This negative feedback loop presumably functions in the maintenance of a subpopulation of cells that do not sporulate under these conditions or delays fast Spo0A~P induction (Grossman, 1995; Chastanet et al., 2010). 11    Introduction Pv = σASpo0A box Spo0A box Ps = σ H σ H Spo0A~P σ A s p o0H σ A spo0E abrB - + σ H s p o0F s p o0A σ H kinA +phosphorelay Fig. 1.3. Schematic representation of positive and negative regulatory loops controlling the production of Spo0A~P. Spo0A is activated through the phosphorelay. Spo0A~P represses transcription of abrB. A decrease in AbrB protein causes derepression of transcription of spo0H, leading to increased transcription of spo0A and two response regulators of the phosphorelay, kinA and spo0F [a positive feedback loop (+)]. The decrease of AbrB level also causes derepression of spo0E, leading to increased accumulation of the phosphatase that removes phosphate from Spo0A~P thereby setting upon a negative feedback loop (-). 1.1.2.3. Role of phosphorylated Spo0A during initiation of sporulation The master regulator of sporulation, Spo0A~P, is a DNA-binding protein activated through a phosphorelay (Molle et al., 2003). It is a member of the response regulator family of two-component regulatory systems consisting of two distinct domains. The highly conserved N-terminal domain called phosphoacceptor (or receiver) domain containing an invariant aspartic acid residue (Asp-56) is the target of phosphorylation by the phosphorelay and mediates dimerization of Spo0A. The C-terminal DNA-binding (or effector) domain which is responsible for binding to specific DNA sequences, called 0A boxes, regulates transcription of target genes (Perego et al., 1991; Muchova et al., 2004). Dimerization of Spo0A after phosphorylation is required to target 0A boxes (Asayama et al., 1995). Spo0A~P acts as a repressor and activator protein regulating a 12    Introduction total of 121 genes including genes with vegetative σA-recognized promoters as well as sporulation σH-recognized promoters (Seredick and Spiegelman, 2001; Molle et al., 2003). It plays two major roles in the cell’s adaptive responses to starvation. First, a low amount of Spo0A~P initially represses transcription of abrB that causes an increase in AbrBdependent gene expression during the transition state. Second, when the Spo0A~P concentration reaches a critical level, it will regulate expression of genes required for entry into sporulation (Phillips and Strauch, 2002). The basal level of Spo0A~P is not constant from cell to cell. These regulatory loops and the interconnectedness of the phosphorelay influences production of Spo0A~P and results in a bi-stable switch - a state where some cells in the population accumulate a higher level of Spo0A~P than others (Kroos, 2007; Dubnau and Losick, 2006). Cells with a high level of Spo0A~P produce killing factors to lyse those cells with a low Spo0A~P level to get more nutrients resulting in a delay in initiation of sporulation. They also resist their killing factor by synthesizing an export pump and an immunity protein to protect them from the toxin (Grossman, 1995; Dubnau and Losick, 2006). About 60% of the cells with a sufficient amount of Spo0A~P, called Spo0A-ON stage, are able to sporulate while the remaining 40% are in the Spo0AOFF stage and fail to enter into sporulation. This mechanism is called “bistability” which means the simultaneous existence of two subpopulations in one population of genetically identical cells. The explanation for this mechanism is still unknown. 1.1.2.4. Sigma H, a positive regulator of sporulation Sigma-H (σH) is an alternative RNA polymerase sigma factor activating the transcription of many genes required for formation of the polar septum, the initiation of cell-type-specific expression and activation of Spo0A (Burkholder and Grossman, 2000). Many sporulation genes are directly activated by sigma-H including spo0A, spo0F, kinA, spo0M, spoVG, and spoVS and the spoIIA operon (Bai et al., 1990; Johnson et al., 1983; Predich et al., 1992; Han et al., 1998; Resnekov et al., 1995; Wu et al., 1991). Sigma-H also regulates transcription of some members of the phr family, coding for secreted peptide pheromones that inhibit specifically the corresponding Rap phosphatases, modulating cell entry into genetic competence, sporulation, and other processes (Perego and Brannigan, 2001; Lazazzera et al., 1999; McQuade et al., 2001). Several of the genes transcribed by sigma-H are also under control of σA-dependent promoters including spo0A, ftsA (cell division), dnaG (DNA replication), sigA (encoding sigma-A, the major sigma factor), and citG (tricarboxylic acid cycle) (Britton et al., 2002). 13    Introduction Sigma-H also contributes indirectly to the expression of Spo0A and KinB by activating expression of sinI and repressing sinR - a spo0A synthesis repressor, thereby activating indirectly the spo0A synthesis (Bai et al., 1993). In addition, sigma-H stimulates expression of CSF (competence stimulating factor), which inhibits the RapB phosphatase that dephosphorylates Spo0F~P and thereby contributes to the increase in spo0A transcription during the early stage of sporulation (Fig. 1.4). In turn, Spo0A~P contributes to the induction of sigma-H by repressing its transcriptional repressor, AbrB (Burkholder and Grossman, 2000). Regulation of sigma-H itself is quite complicated. spo0H, coding for sigma-H, is transcribed from a σA-dependent promoter and directly under negative control of AbrB which is in turn repressed by Spo0A~P (Burkholder and Grossman, 2000; Strauch, 1995; Weir et al., 1991). Under appropriate conditions, increased levels of Spo0A~P result in repression of AbrB resulting in enhanced levels of spo0H transcription. Therefore, a high level of Spo0A~P is produced resulting in more repression of AbrB and increasing levels of sigH transcription, thereby establishing a self-reinforcing cycle to regulate both sigmaH and Spo0A. Sigma-H plays important roles in response to a diversity of external conditions including pH, carbon source, and existence of amino acids. It controls many genes involved in several cellular processes including proteolysis, cell wall metabolism, transport, and cytochrome biogenesis that helps cells to adapt to conditions of starvation and impacts physiological decisions during entry into stationary phase (Britton et al., 2002). Schematic representation of regulation of sigma-H transcription and its regulation of expression and activation of Spo0A is illustrated and shortly explained in Fig. 1.4. 14    Introduction Fig. 1.4. Regulation of sigma-H transcription and its regulation of expression and activation of Spo0A. Sigma-H regulates transcription of kinA, spo0F, and spo0A, contributing to the high level accumulation of Spo0A~P. Sigma-H also stimulates the activation of Spo0A by regulating expression of the secreted peptide pheromone, CSF, which inhibits the phosphatase, RapB, that dephosphorylates Spo0F~P. Similarly, sigmaH regulates expression of sinI, which inhibits sinR, resulting in further derepression of spo0A transcription. This figure was taken from Burkholder and Grossman, 2000. 1.1.2.5. AbrB, an important transcription factor during initiation of sporulation AbrB is a transcriptional repressor that plays an important role during initiation of sporulation (Kroos, 2007). This DNA-binding protein plays a role as a repressor of several competence genes as well as genes expressed during the transition state (Strauch and Hoch, 1993; Strauch et al., 1989b). At least three sporulation genes controlled by AbrB are spo0E (Perego and Hoch, 1991), spo0H (Weir et al., 1991) and spoVG (Zuber and Losick, 1987). AbrB also regulates an antibiotic-synthetic gene, tycA (Fürbass et al., 1991; Robertson et al., 1989), and abrB itself (Strauch et al., 1989a). Over 40 different genes are directly regulated by AbrB and many other genes indirectly due to its influence on the transcription of other regulatory proteins. For example, the regulatory proteins ScoC, Abh, SinR and SigH are controlled by AbrB. These proteins also regulate numerous genes in different regulatory networks leading to a wide variety of genes controlled indirectly by AbrB (Phillips and Strauch, 2002). AbrB acts as a DNA-binding factor and controls gene expression in at least three different ways (Dixon et al., 2001; Errington, 1996; Johnson et al., 1983). First, AbrB acts 15    Introduction as a unique repressor of some genes that are constitutively expressed during all phases of growth in an abrB mutant strain. In most of the cases, AbrB plays a role as a preventer to become a factor in series of redundant regulatory networks for ensuring that no regulator has complete control over genes that must remain silent during active growth. AbrB also plays a role as an activator of some genes when it represses activation of other repressors (two negatives = a positive) (Phillips and Strauch, 2002). The transcription of the abrB gene is autoregulated. In an active growth state, the AbrB concentration is maintained at a threshold that is sufficient for its regulatory activity (Strauch et al., 1989a). During starvation, Spo0A, a repressor of abrB transcription, is activated by phosphorylation through the phosphorelay, resulting in a decrease of the AbrB level below the threshold for its negative regulatory activity thereby increasing the expression of AbrB-repressed genes. The genes under control of AbrB may function in many metabolic and physiological processes, including production of extracellular degradative enzymes, antibiotics, motility, development of competence, transport systems, oxidative stress response, phosphate, nitrogen and amino acid metabolism, cell surface components and sporulation (Phillips and Strauch, 2002). 1.2. The metalloprotease FtsH 1.2.1. Introduction of FtsH FtsH is member of the AAA family (ATPases associated with a variety of cellular activities) inserted into the cytoplasmic membrane by two transmembrane segments (Schumann, 1999). It is comprised of an N-terminal region with two transmembrane segments and a C-terminal cytoplasmic region consisting of AAA-ATPase and Zn2+- metalloprotease domains. While other AAA proteases are located in the cytoplasm, FtsH is a unique membrane-bound AAA protease able to degrade integral membrane proteins. It plays crucial roles in controlling the quality of membrane proteins by rapidly degrading abnormal membrane proteins and some short-lived proteins present in the cytosol (Ito and Akiyama, 2005). Bacterial cells with FtsH malfunction in bacteria result in cell division defects and growth arrest (Bieniossek et al., 2006). In E. coli, the FtsH protease is essential for growth whereas it is dispensable in B. subtilis. However, ftsH mutant cells in B. subtilis appear more sensitive to heat, salt, and defective for cell division and sporulation (Kiran et al., 16    Introduction 2009). Orthologs of FtsH also exist in chloroplasts and mitochondria of eukaryotes (Bieniossek et al., 2006). The FtsH protease of Arabidopsis thaliana contributes to the tolerance of the plant to uplifted temperatures. It may alleviate light stress by degrading photodamaged photosystem II D1 protein and unassembled thylakoid membrane proteins (Chen et al., 2006). The loss of a close FtsH-orthologs in humans results in hereditary spastic paraplegia (Bieniossek et al., 2006). 1.2.2. Discovery of FtsH The E. coli ftsH gene was discovered and described independently by four groups through detection of different phenotypes, thereby received four different designations: ftsH, stands for filamentous temperature-sensitive; tolZ, exhibits tolerance against colicins and hflB, causes high frequency of lysogenization by phage lambda and mrsC, stands for mRNA stability (Schumann, 1999). In B. subtilis, the ftsH gene has been discovered separately by three different groups. First, the group of Schumann detected FtsH as an insertion mutant causing a growth defect under hyperosmotic conditions (Geisler and Schumann, 1993). Later, ftsH was detected by the group of S. Cutting as a regulatory factor of SpoVM, a protein requiring for spore cortex and coat formation (Cutting et al., 1997) and the group of P. Zuber identified ftsH as an essential gene for fermentation and nitrate respiration (Nakano et al., 1997). In general, the ftsH gene is present in one single copy in the examined prokaryotic genomes except for cyanobacteria such as Synechocystis (J05708), which has four ftsH genes in its genome (Nixon et al., 2005). Yeast genomes contain three copies of the gene (Schnall et al., 1994), whereas plant genomes possess a larger ftsH gene family. For example, the Arabidopsis genome has 12 ftsH genes and mutations in these genes result in leaf color variegation (Chen et al., 2006). 1.2.3. The structure of FtsH The membrane-bound metalloprotease FtsH is a ring-like homo-hexamer complex that carries the AAA and proteolytic domain on the same polypeptide chain (Ito and Akiyama, 2005). The FtsH monomer of E. coli consists of 647 amino acid residues with a calculated molecular mass of 71.0 kDa. FtsH is an integral cytoplasmic membrane protein 17    Introduction One example is YccA, a short-lived membrane protein of unknown function. It has been suggested to be naturally degraded by FtsH, and its function seems to be linked to biofilm formation (Beloin et al., 2004). FtsH also degrades unassembled membrane proteins such as the subunit SecY of the SecYEG translocase and F0α of the H+-ATPase. Degradation of these proteins only occurs when they fail to assemble with their partner proteins (Akiyama et al., 1996a; Akiyama et al., 1996b). SecY forms a stable translocon complex with SecE and SecG allowing translocation of presecretory proteins through the cytoplasmic membrane or integration into the lipid bilayer of newly synthesized membrane proteins. Therefore, incomplete assemblies of the translocon could be harmful to the cell (Akiyama et al., 1996b). The F0α is a subunit of a proton channel across the membrane and its redundance might be also harmful to the cells (Akiyama et al., 1996a). Therefore, these examples show that FtsH protects cells from the harmful conditions by degrading abundant membrane protein subunits when they failed to form functional complexes (Ito and Akiyama, 2005). 1.2.6.2. Cytoplasmic substrates of FtsH FtsH degrades a majority of cytoplasmic substrates of FtsH (Fig. 1.8 and Table 1.2) and many of them are short-lived soluble substrates. At least three substrates of FtsH are bacteriophage encoded proteins and they belong to the group of short-live proteins. The cII gene product is a transcription factor required for setting up the lysogenic cycle (Kihara et al., 1997; Shotland et al., 1997; Shotland et al., 2000a). The Xis protein is responsible for excision of prophage DNA from the bacterial genome (Leffers and Gottesman, 1998). The cIII gene product is a competitive inhibitor of FtsH (Herman et al., 1997). By degrading these substrates, FtsH exhibits its regulatory impact on the development and life cycle of infecting by degrading their key regulatory molecules (Ito and Akiyama, 2005). FtsH also degrades SsrA-tagged proteins where the SsrA-tag consists of 11 residues added to stalled nascent chains during translation to enable ribosome recycling and remove of abnormal proteins from the cell (Lies and Maurizi, 2008; Herman et al., 1998). In another case, FtsH can degrade E. coli apo-flavodoxin in in vitro proteolytic 24    Introduction tests but the effect of FtsH on flavodoxin levels in vivo is still unknown (Okuno et al., 2006a; Okuno et al., 2006b). FtsH is considered as the only essential AAA protein in E. coli due to its regulation on the level of LpxC, the key enzyme in lipid A biosynthesis. Both too much and too little lipid A is lethal for E. coli. Thus, FtsH maintains a sufficient amount of lipid A within the cells. FtsH also plays a dual role in LPS biosynthesis by degrading KdtA, a KDO transferase, catalyzes the KDO attachment to lipid A (Katz and Ron, 2008). Therefore, FtsH acts as the crucial protease required for protein and membrane lipid homeostasis (Narberhaus et al., 2009). Another important function of FtsH is to regulate expression of σ32, the heat shock sigma factor required for heat shock or other stress responses in E. coli. Regulation of σ32 by FtsH is assumed to involve its association with the DnaKJ chaperone system in which the DnaK chaperone is assumed to have a positive role in the degradation by presenting σ32 to FtsH (Tatsuta et al., 2000; Tatsuta et al., 1998; Tomoyasu et al., 1998). FtsH also affects the proteolytic degradation of the alternative sigma factors SigF (σF) in C. crescentus that indirectly regulates the oxidative stress response in stationary phase (Varez-Martinez et al., 2006). The σW of B. subtilis might be another substrate of FtsH (Zellmeier et al., 2003). The Spo0E phosphatase involved in dephosphorylation of Spo0A~P has been shown to be a substrate of FtsH, and the recognition sequence is located in the C-terminal end (Le and Schumann, 2009). SpoVM has been shown to be a target and an inhibitor of the FtsH protease (Cutting et al., 1997). It shares structural similarities with λ CIII, another target and inhibitor of FtsH in E. coli, implying that both proteins share comparable inhibition and degradation mechanisms toward to FtsH (Kobiler et al., 2007). FtsH is involved in nitrogen metabolism in Corynebacterium glutamicum due to its degradation of the GlnK protein, a response protein for nitrogen starvation. Under nitrogen starvation conditions, GlnK interacts with AmtR to induce expression of nitrogen starvation genes. In the medium with high nitrogen concentrations, GlnK is sequestered to the cytosolic membrane to interact with the transporter AmtB, which results in blocking ammonium uptake (Strosser et al., 2004). In Synechocystis sp. PCC 6803, a phototropic model organism that possesses four copies of the ftsH gene in its genome, FtsH2 is thought to be involved in osmoregulation 25    Introduction by degradation of the cytoplasmic glycosyl glycerol (GG) synthase GgpS (Stirnberg et al., 2007). This uncomplexed GgpS is degraded by FtsH2 when it fails to form a complex with the GG phosphate phosphatase GgpP to catalyze GG synthesis. In summary, FtsH is a protease with many talents that degrades a wide variety of structurally and functionally diverse substrates present either in the cytoplasm or in the cytoplasmic membrane. Numerous FtsH substrates have been identified in various bacteria and shown in Table 1.2 (Narberhaus et al., 2009). However, a great deal of FtsH substrates remain to be discovered to clarify the physiological importance of FtsH in prokaryotic organisms as well as in eukaryotic cells (Narberhaus et al., 2009). Fig. 1.8. Schematic view of FtsH functions in E. coli. The hexameric FtsH protease controls quality of membrane proteins by either refolding misfolded proteins or degrading unassembled membrane proteins. FtsH degrades λ-encoded substrates, and is involved in the superoxide stress response, heat shock gene expression and controls the synthesis of membrane components. IM: inner membrane; OM: outer membrane; LPS: lipopolysaccharides. This figure was taken from Narberhaus et al., 2009. 26    Introduction Table 1.2. Identified cytoplasmic substrates of the FtsH protease in bacteria. Adaptor or modulator proteins and localization of degradation signal are given if analyzed; ND: not determined. This table was taken from the Narberhaus et al., 2009. Protein Organism Adaptor/modulator proteins; Localization of degradation signal SsrA-tag E. coli The tag itself λ CII Phage λ/E. coli HflD, HflK/C; C-terminus Λ CIII Phage λ/E. coli Internal Λ Xis Phage λ/E. coli ND SoxS E. coli N-terminus (Lon) Flavodoxin E. coli Internal LpxC E. coli C-terminus KdtA E. coli ND RpoH (σ32) E. coli DnaK/J, GroEL/ES; internal RpoH (σ32) C. crescentus ND σF C. crescentus ND σW B. subtilis ND SpoVM B. subtilis Internal Spo0E B. subtilis C-terminus GgpS Synechocystis sp. PCC 6803 ND GlnK C. glutamicum ND 1.3. The objective of the thesis As already mentioned, a B. subtilis ftsH null mutant is viable, but exhibits a pleiotropic phenotype including a drastically reduced sporulation efficiency (Deuerling et al., 1997; Le and Schumann, 2009). Further analysis has shown that the amount of Spo0A is significantly reduced in such a knockout mutant (Le and Schumann, 2009). I hypothesized that FtsH may degrade one or more proteins involved in reducing the level of phosphorylated Spo0A. One sporulation-specific protein has been recently identified, the phosphatase Spo0E, which specifically dephosphorylates Spo0A~P (Le and Schumann, 2009). Since a spo0E ftsH double knockout restored the sporulation frequency to only 0.85% (wild type: ~ 60%), additional protein(s) have to be identified as substrate(s) of FtsH. Therefore, the objective of this doctoral thesis was first to identify additional substrate proteins by using two different techniques and second, to understand their function. Two experimental approaches were applied. The first is 2D-gel proteomics. 27    Introduction The hypothesis for this approach is the substrates might be overproduced in an ftsH null mutant when compared with an ftsH wild-type strain. By the 2D gel electrophoresis technique, these proteins can be detected and identified by mass spectrometry. Another approach is called “FtsH trap-mutant”. The aim of this approach was to construct an FtsH mutant which binds substrates without cleaving them. Therefore, the substrates can be trapped in the proteolytic chamber of FtsH in vivo and co-purified with FtsH by a pulldown assay. Finally, the role of the eag gene located downstream of spo0E was analyzed. 28    Materials and Methods 2. MATERIALS AND METHODS 2.1. Materials 2.1.1. Bacterial strains The bacterial strains used in this study are listed in Table 2.1 Table 2.1. Bacterial strains used in this study Strains Description Source Escherichia coli DH10B mcrA Δ(mrr hsdRMS mcrBC) φ80d lacZM15 ΔlacX74 deoR recA1 araD139 Δ(ara leu)7697 Bethesda Research Laboratories (BRL) BL21 E. coli B F– dcm ompT hsdS(rB– mB–) gal BRL A8926 sfhC zad-220::Tn10 ΔftsH3::kan Tatsuta et al., 1998 BHEQ A8926 PIPTG –ftsHE424Q (AmpR) This study AL60 A8926 PIPTG –GST-FtsH (AmpR) Le and Schumann, 2009 Bacillus subtilis 1012 leuA8 metB5 trpC2 hsrM1 Saito et al., 1979 WW01 1012 ftsH::erm (ErmR) Wehrl et al., 2000 BH1 1012 Pspo0M - bgaB (NeoR) This study BH2 1012 Pspo0M - bgaB ftsH::erm (NeoR) (ErmR) This study BH3 1012, pbgaB (NeoR) This study BH4 1012 PIPTG-GST-fstHtrap (CmR) This study BH5 1012 PIPTG-GST-ftsH+ (CmR) This study BH6 1012 PIPTG-GST (CmR) This study BH7 1012 PIPTG-GST-ftsHtrap ∆ftsH::erm (CmR) (ErmR) This study BH8 1012 PIPTG-GST-ftsH+ ∆ftsH::erm (CmR) (ErmR) This study 29    Materials and Methods BH9 1012 PIPTG -GST ∆ftsH::erm (CmR) (ErmR) This study AB07 1012 ∆spo0E::bleo (BleoR) Le and Schumann, 2009 AM01 1012 ∆eag::pMUTIN4 (ErmR) A. Maier AM02 1012, Pskf-lacZ, eag::Pmutin4 (SpcR) (ErmR) A. Maier AM03 1012, amyE::Pskf-lacZ, (SpcR) A. Maier 2.1.2. Plasmids The plasmids used in this study are listed in Table 2.2 Table 2.2. Plasmids used in this study Name Description Reference pBgaB Integration plasmid carrying the promoter-less bgaB gene, NeoRMogk et al., 1996 pBH1 spo0M promoter inserted into pBgaB, NeoR This study pGEX-2T Expression vector with GST-tag, AmpR Amersham pBH2 pGEX-2T with GST – spo0M fusion, AmpRLe and Schumann, 2009 pGST-ftsH ftsH+ gene from B. subtilis inserted into pGEX2T, AmpRThis study pBH3 pGEX2T carrying ftsHE424Q mutant, AmpR This study pHT08 A plasmid-based expression vector for B. subtilis with the IPTG-inducible Pgrac promoter, CmRNguyen et al., 2007 pBH4 Fusion GST - ftsHE424Q mutant inserted into pHT08, CmR This study pBH5 Fusion GSTftsH+ inserted into pHT08, CmRThis study pBH6 GST inserted into pHT08, CmRThis study pMUTIN4 Integration plasmid to create a gene fusion with the lacZ reporter gene, ErmR Vagner et al., 1998 pMUTIN4eag eag gene inserted into pMUTIN4, ErmRA. Maier 30    Materials and Methods 2.1.3. Oligonucleotides The oligonucleotides used in this study are listed in Table 2.3 Table 2.3. Oligonucleotides used in this study Name Sequence (5’ to 3’) Description ON01 CACCAGGAATTCATCGGTCTAAACTGA AATCG 5’ end of spo0M promoter ON02 CACCAGGAATTCTCCGGCACTTGCCGC AAGCTT 3’ end of spo0M promoter ON03 TCTGTTGGATCCATGTCATTTTTTAAGA AGCTTGCGGCA 5’ end of spo0M gene ON04 TCCCGGGGATCCCTATTACTCAACGTA TTGGTCTAGGATCT 3’ end of spo0M gene ON05 CTTATCACCAAGGCGGACACACCGT mutagenic primer with substitution of FtsHE424Q ON06 CAATTCAAGCTTGTCACGATTTTCAGTC AGGA flanking at 3’ end of ftsH gene ON07 CACCATGGATCCATGAATCGGGTCTTC CGTAATACCA 5’ end of ftsH gene ON08 CACCATGACGTCATGTCCCCTATACTA GGTTATTGGA 5’ end of ftsH gene ON09 CACCATGACGTCATTACTCTTTCGTATC GTCTTTCT 3’ end of ftsH gene ON10 CACCATGGATCCATGTCCCCTATACTA GGTTATTGGA 5’ end of GST gene ON11 CTGGTGGGATCCTTATCAAACAGATGC ACGACGAGATCCA 3’ end of GST gene 2.1.4. Media Luria-Bertani broth (LB medium): 1 % (w/v) tryptone, 0.5 % (w/v) yeast extract, 1 % (w/v) NaCl. Difco Sporulation Medium (DSM): 0.8 % (w/v) Nutrient Broth, 0.1 % (w/v) KCl and 1 mM MgSO4.7H2O. Adjust the pH to 7.4 with KOH. After autoclaving, the medium was supplied with 0.5 mM CaCl2, 0.01 mM MnCl2 and 0.001 mM FeCl2 Agar was added to 1.5 % (w/v) to prepare plates. 31    Materials and Methods 2.1.5. Antibiotics Concentrations of the antibiotics used in this study are given in Table 2.4. Table 2.4. Antibiotic solutions used in this study Antibiotic Concentration of stock solution (mg/ml) Dissolved in Final concentration (μg/ml) Ampicillin 50 - 100 70% ethanol 100 Chloramphenicol 20 Ethanol 10 Erythromycin 1 or 100 Ethanol 1 or 100 Neomycin 10 Water 10 Spectinomycin 100 Water 100 Bleomycin 20 Water 1 or 5 2.1.6. Chemicals and enzymes All standard enzymes and chemicals used for common buffers and solutions were purchased from Sigma-Aldrich, Merck or Roth, Karlsruhe, Germany. Other chemicals, solutions, buffers and kits were purchased from the suppliers listed below: − New England Biolabs: Taq DNA polymerase, T4 DNA-Ligase − Fermentas: Restriction enzymes, DNA ladder and Protein Molecular Weight Marker − Amersham: ECL™ Reagent, antibody − Pierce: Dithiobis[succinimidyl propionate] (DSP) cross linker − Qiagen: PCR purification kit, gel-extraction kit, midi purification kit − Roche: Complete Protease inhibitor cocktail, Alkaline phosphatase, Lysozyme, Proteinase K, RNase A 32    Materials and Methods 2.1.7. Antibodies Table 2.5. Antibodies used in this study Name Dilution for Immunoblotting Reference Spo0A 1 : 5000 Fujita et al., 2005 GST 1 : 5000 AmershamTM Anti-Rabbit IgG 1: 10000 AmershamTM 2.2. Methods 2.2.1. Identification of FtsH substrates by proteomics 2.2.1.1. Growth conditions B. subtilis strains 1012 and its isogenic ftsH mutant (WW01) were cultivated at 37oC under vigorous agitation in Difco Sporulation Medium (DSM), erythromycin was added to a final concentration of 50 μg/ml during cultivation of WW01 strain (∆ftsH::erm). Samples were taken at stage 0 (to) and experiments were repeated twice. 2.2.1.2. Sample preparation Cells were harvested at stage 0 (to) by centrifugation (6.000 x g, 4oC, 10 min), washed in TE buffer (10 mM Tris, pH 7.5, 1 mM EDTA), resuspended in TE urea buffer (8 M urea, 2 M thio-urea) and disrupted by ultrasonication. After centrifugation (20,000 x g, 4°C, 30 min), the protein concentration of the extract was determined with the RotiNanoquant Kit (Roth, Karlsruhe, Germany). 2.2.1.3. Two-dimensional polyacrylamide gel electrophoresis (2D-PAGE) To separate by 2D-PAGE, protein extracts (500 mg protein/sample) were loaded onto duplicate immobilized pH gradient (IPG) strips, pH 4-7 by rehydration for 18-24 h in 33    Materials and Methods 2.2.2.3. Complementation of the ftsH alleles in an ftsH knockout strain 2.2.2.3.1. Morphology complementation in the wild-type and ftsHtrap Cells of ftsH knockout strains BH7 and BH8 allowing ftsHtrap and ftsH+ expression under control of the IPTG-inducible Pgrac promoter were grown in DSM medium, induced with IPTG at an OD578 of 0.5, collected samples at stationary phase, washed and resuspended in ddH2O. Mixtures of 5 μl of suspensions with 10 μl of 1% agarose were spread onto a glass slide and the cell’s morphology was observed under the microscope. 2.2.2.3.2. Sporulation complementation B. subtilis strains were inoculated into DS medium and incubated with shaking for 24 h at 37oC. The experiments were repeated twice. Cells were harvested from 10 ml cultures, resuspended in 1 ml potassium phosphate buffer (10 mM K2HPO4, 50 mM KCl, 1 mM MgSO4) and heated for 30 min at 80oC. Samples of the heated cultures as well as of the untreated parental culture were diluted and plated on DS medium for viable cell counting. 2.2.2.4. Identification of FtsH substrates by the pull-down assay 2.2.2.4.1. Sample preparation for protein trapping in vivo Strains BH7, BH8, BH9 for expression of GST-FtsHtrap, GST-FtsH+ and GST, respectively, were routinely grown in 1 liter of DSM with chloramphenicol 5 μg/ml and erythromycin 1 μg/ml at 37oC to an OD578 of 0.5, induced with 0.1 mM IPTG and further grown until cells reached the transition state (stage 0 of sporulation). The experiments were repeated three times. Then, the cultures were taken and chilled. Cells were harvested by centrifugation at 4oC, 8.000 x g, washed and resuspended in 7 ml of lysis buffer (140 mM NaCl, 1,8 mM KH2PO4, 27 mM KCl, 10 mM Na2HPO4, 5% glycerol, pH 7.3) containing 20 mM DTT, 10 μl Complete Protease Inhibitor Cocktail (Roche Diagnostics). Cells were disrupted by using a Mixer Mill at 15 Hz, 5 x 30s. 40    Materials and Methods 2.2.2.4.2. Ex vivo cross - linking with DSP After disruption of the cells by the Mixer Mill, freshly DSP (Dithiobis- [succinimidylpropionate]) stock at 100 mg/ml was prepared in DMSO, 150 μl DSP stock was added into 7 ml cell lysate and allowed cross-linking reaction proceeding for 5 min at room temperature. Then, the unreacted DSP was quenched by adding 100 mM Tris pH 8.5, and stirred for 5-10 min at room temperature. After crossed linking with DSP, the lysates were centrifuged for 30 min at 21.000 x g to separate the cytoplasmic fraction (supernatant) from the membrane fraction (pellet). The membrane proteins in the pellet were solubilized with the non-ionic detergent NP-40 (final concentration 0.5%), the cell debris were removed by centrifugation (25.000 x g, 4oC, 30 min) and collected as the supernatant containing membrane fraction. 2.2.2.4.3. Pull-down assay for FtsH substrate trapping in vivo The membrane fraction and the supernatant were added to 1 ml glutathione agarose beads, gently agitated at 4oC for 4 h, washed with 5 volumes of PBS buffer (140 mM NaCl, 1.8 mM KH2PO4, 10 mM Na2HPO4, 2.7 mM KCl, pH 7.3), eluted in 0.5 ml elution buffer (10 mM GSH reduced glutathione in 50 mM Tris-HCl, pH 8.0), and the elution fraction was taken for analyses by SDS-PAGE. The protein bands were detected by silver staining and individual proteins were identified by Mass spectrometry. 2.2.2.5. SDS-PAGE and Western blotting Sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) was peformed according to the method of Laemmli (1970) using 10, 12 or 15% SDSpolyacrylamide gels. Western blotting was performed as described by Towbin et al., (1979) with the detection step using an ECL Western blotting detection kit (Amersham). The signals were recorded by the LAS4000 machine (Fujifilm) and analyzed by Multi Gauge Ver 3.1 Software (Fujifilm). 41    Materials and Methods 2.2.2.6. Silver Staining Gels were fixed by Fixing Solution (50% Ethanol, 10% glacial acetic acid, 0.05% formalin [35% formaldehyde]) and then shaken for 1 h. Gels were rinsed with Rinse Solution (50% Ethanol) and shaken for 5 min (2X). The Rinse Solution was replaced with Sensitizer (0.02% sodium thiosulphate), shaken for 2 min and then washed with milli-Q water and shaken for another 2 min. Gels were stained with Staining solution (0.2% silver nitrate, 0.075% formaldehyde 37% v/v) and shaken for 20 min. Then, the gel was washed with water for 1 min (5 - 6X) and developed with Developer Solution (5% sodium carbonate, 0.05% formaldehyde 37% v/v, 0.0004% sodium thiosulphate), shaken for 5 - 10 min as required. A Stop Solution was added to stop the reaction. Gels were washed with milli-Q water (3X) and kept at 4ºC in 1% glacial acetic acid for analyses and FtsH substrate identification by mass spectrometry. 42    Results 3. RESULTS 3.1. Identification of FtsH substrate proteins by proteomics 3.1.1. Identification of the Spo0M protein as a putative substrate of FtsH by 2D-gel electrophoresis To identify putative substrates of FtsH, the proteomes of a wild type ftsH and its isogenic ftsH::erm knockout strain taken at stage 0 were analyzed by 2D-gel electrophoresis and individual protein spots were identified by mass spectrometry. The protein quantity of each spot in both strains was compared and analyzed by the Delta 2D software. Approximately 50 proteins were strongly increased or decreased in the ftsH knockout strain as compared to the wild type strain (Table 3.1 and Table 3.2). According to the SubtiList functional categories, the identified proteins were classified into functional groups and most of them perform basic metabolic functions in the cell such as translation, amino acid metabolism, glycolysis and being part of the tricarboxylic acid (TCA) cycle (Table 3.3 and Table 3.4). 43    Results Table 3.1. List of proteins increasing in an ftsH knockout strain No. Ratio Accession number Protein name 1 4.54962 Spo0M Sporulation-control gene 2 3.73728 YjoA Unknown similar to unknown proteins 3 3.13626 Tkt Transketolase 4 3.04021 TufA Elongation factor Tu 5 2.84877 GlnA Glutamine synthetase 6 2.59722 YoxD Unknown similar to 3-oxoacylacyl-carrier protein reductase 7 2.38021 SodA Superoxide dismutase 8 2.36637 YjbG Unknown similar to oligoendopeptidase 9 2.3513 Icd Isocitrate dehydrogenase 10 2.34449 Dat Probable D-alanine aminotransferase 11 2.31573 FabI Enoyl-acyl carrier protein reductase 12 2.31573 YvqH Unknown similar to unknown proteins from B. subtilis 13 2.31118 Ddl D-Alanyl-D-alanine ligase A 14 2.31118 Pgk Phosphoglycerate kinase 15 2.28535 YvgN Unknown similar to dehydrogenase 16 2.27029 BkdB Lipoamide acyltransferase 17 2.19324 YceC Unknown similar to tellurium resistance protein 18 2.19095 Hag Flagellin protein 19 2.15821 Pyk Pyruvate kinase 20 2.12796 Tpx Probable thiol peroxidase 21 2.0957 Eno Enolase 22 2.0957 SucC Succinyl-CoA synthetase (beta subunit) 23 2.08144 YvaB Unknown similar to NAD(P)H dehydrogenase (quinine) 24 2.05179 GcvPB Probable glycine decarboxylase (subunit 2) 25 2.05179 YumC Unknown similar to thioredoxin reductase 26 2.00393 AsnS Asparaginyl-tRNA synthetase 27 2.00393 CysS Cysteinyl-tRNA synthetase 28 2.00393 DhaS Aldehyde dehydrogenase 44    Results Table 3.2. List of proteins decreasing in an ftsH knockout strain No. Ratio Accession number Protein name 1 0.49203 Drm Phosphopentomutase 2 0.49203 RocD Ornithine aminotransferase 3 0.48638 GapB Glyceraldehyde-3-phosphate dehydrogenase 4 0.48287 PyrAB Carbamoyl-phosphate synthetase (catalytic subunit) 5 0.48002 CysC Putative adenylylsulfate kinase 6 0.48002 PyrH Uridylate kinase 7 0.47701 NusG Transcription antitermination factor 8 0.46497 PnpA Polynucleotide phosphorylase (PNPase) 9 0.46428 Fmt Methionyl-tRNA formyltransferase 10 0.44283 ResD Two-component response regulator involved in aerobic and anaerobic respiration 11 0.44283 SucD Succinyl-CoA synthetase (alpha subunit) 12 0.44091 PdhC Pyruvate dehydrogenase (dihydrolipoamide acetyltransferase E2 subunit) 13 0.43359 Upp Uracil phosphoribosyltransferase 14 0.42343 OppD Oligopeptide ABC transporter (ATP-binding protein) (initiation of sporulation, competence developme 15 0.41514 RocG Glutamate dehydrogenase (major) 16 0.39438 OdhA 2-Oxoglutarate dehydrogenase (E1 subunit) 17 0.38879 IolD Myo-inositol catabolism 45    Results Table 3.3. Functional groups of proteins increasing in the absence of FtsH according to the SubtiList database COGs Protein Name Functional groups Information storage and processing COG0050J TufA Elongation factor Tu COG0017J AsnS Asparaginyl-tRNA synthetase COG0215J CysS Cysteinyl-tRNA synthetase Cellular processes and signaling COG2310T YceC Unknown similar to tellurium resistance protein COG1181M Ddl D-alanyl-D-alanine ligase A COG1344N Hag Flagellin protein COG2077O Tpx Probable thiol peroxidase COG0492O YumC Unknown similar to thioredoxin reductase Metabolism COG0538C Icd Isocitrate dehydrogenase COG0508C BkdB Lipoamide acyltransferase COG0045C SucC Succinyl-CoA synthetase (beta subunit) COG1012C DhaS Aldehyde dehydrogenase COG0021G Tkt Transketolase COG0126G Pgk Phosphoglycerate kinase COG0469G Pyk Pyruvate kinase COG0148G Eno Enolase COG0174E GlnA Glutamine synthetase COG1003E GcvPB Probable glycine decarboxylase (subunit 2) COG0115EH Dat Probable D-alanine aminotransferase COG0623I FabI Enoyl-acyl carrier protein reductase COG1182I YvaB Unknown similar to NAD(P)H dehydrogenase (quinone) COG0605P SodA Superoxide dismutase General function prediction only - function unknown COG4326R Spo0M Sporulation-control gene COG0300R YoxD Unknown similar to 3-oxoacylacyl-carrier protein reductase - NA - YjbG Unknown similar to oligoendopeptidase - NA - YvqH Unknown similar to unknown proteins from B. subtilis COG0656R YvgN Unknown similar to dehydrogenase COG2318S YjoA Unknown similar to unknown proteins COG: Clusters of Orthologous Groups; NA: Not Available 46    Results Table 3.4. Functional groups of proteins decreasing in the absence of FtsH according to SubtiList database COGs Protein Name Functional groups Information storage and processing COG1185J PnpA Polynucleotide phosphorylase (PNPase) COG0223J Fmt Methionyl-tRNA formyltransferase COG0250K NusG Transcription antitermination factor Cellular processes and signaling COG0745TK ResD Two-component response regulator involved in aerobic and anaerobic respiration Metabolism COG0074C SucD Succinyl-CoA synthetase (alpha subunit) COG0508C PdhC Pyruvate dehydrogenase (dihydrolipoamide acetyltransferase E2 subunit) COG0567C OdhA 2-Oxoglutarate dehydrogenase (E1 subunit) COG1015G Drm Phosphopentomutase COG0057G GapB Glyceraldehyde-3-phosphate dehydrogenase COG4992E RocD Ornithine aminotransferase COG0444EP OppD Oligopeptide ABC transporter (ATP-binding protein) (initiation of sporulation, competence developme COG0334E RocG Glutamate dehydrogenase (major) COG3962E IolD Myo-inositol catabolism COG0458EF PyrAB Carbamoyl-phosphate synthetase (catalytic subunit) COG0528F PyrH Uridylate kinase COG0035F Upp Uracil phosphoribosyltransferase COG0529P CysC Probable adenylylsulfate kinase The proteomic approach was used to identify FtsH substrates to understand the function of FtsH during sporulation. I hypothesize that these protein substrates are supposed to be overproduced in an ftsH knockout and function during sporulation. As a result, among 28 proteins significantly increased in the absence of FtsH, the most abundant protein was identified as Spo0M with its predicted function as a sporulation control gene. The Spo0M level increased about 4.5-fold in the ftsH null mutant (Fig. 3.1). The spo0M gene has been shown to control sporulation during the process from stage 0 to stage II (Han et al., 1998). An σH-like promoter has been detected in the upstream region of spo0M, and it has also been shown to be down-regulated by benzoate at pH 7.0 or by a low external pH (Kitko et al., 2009). A spo0M null mutant is viable, 47    Results blocked at stage 0, and its sporulation frequency is reduced by 20to 100-fold. If the spo0M gene is inserted into a high-copy number plasmid, the sporulation frequency is reduced, indicating that overproduction of the Spo0M protein results in a negative effect on sporulation (Han et al., 1998). Since Spo0M is overproduced at the beginning of stage 0 in the absence of FtsH, we first asked whether FtsH regulates expression of Spo0M directly or indirectly. Figure 3.1. Comparative proteomics of a wild type ftsH and null mutant strain. (A) Strains 1012 (ftsH+) and (B) WW01 (ftsH::erm) were grown in DSM to stage 0 at 37°C. Then, intracellular proteins were separated by 2D electrophoresis. Proteins were separated by a pH gradient of 4 to 7 in the first dimension followed by the second dimension separation of SDS-PAGE. Gels were stained by Coomassie brilliant blue, and the protein spot of Spo0M is indicated. 3.1.2. FtsH does not influence expression of spo0M In principle, FtsH could regulate the amount of Spo0M indirectly through modulation of a negative regulator or directly through its degradation. To analyze for an indirect influence, the promoter region of spo0M was transcriptionally fused to the bgaB reporter gene and cells carrying the bgaB reporter gene were allowed to sporulate in DS medium (DSM). At the beginning of the stationary phase, samples were removed at intervals and assayed for β-galactosidase activity in the wild type ftsH and the isogenic knockout strain. The results are shown in Fig. 3.2. During transition from the exponential growth phase to the stationary phase, expression of bgaB fused to the spo0M promoter clearly increased, while the bgaB 48    Results activity was not expressed from the vector control (bgaB gene without spo0M promoter fusion) (Fig. 3.2, strain BH3). No difference in the BgaB activity was found between the wild-type ftsH and its isogenic insertion mutant (Fig. 3.2, strain BH1 and BH2). This result clearly demonstrates that FtsH is not involved in regulation of transcription of spo0M. Figure 3.2. FtsH does not influence transcription of spo0M. B. subtilis strains BH1, BH2 and BH3 containing plasmid pBH1 (Pspo0M-bgaB), pBH1 with an ftsH::erm knockout and a promoter-test vector pBgaB, respectively, were grown in DSM at 37°C, and aliquots were withdrawn at the indicated time points for measurement of β -galactosidase activities where t0 indicates entry into the transition phase. 3.1.3. Spo0M is confirmed as a substrate protein of FtsH by an in vitro degradation experiment Since FtsH is not involved in the regulation of transcription of spo0M, I assumed that it directly modulates Spo0M activity by degradation. Therefore, the in vitro degradation of Spo0M by FtsH was tested. First, the Spo0M fused translationally to a GST-tag, was overproduced and purified. The purified GST-Spo0M fusion was incubated with purified GST-FtsH in the presence and absence of ATP. Reactions were carried out under standard conditions as described (Tomoyasu et al., 1995). 49    Results confirm this assumption, isolation of GST-FtsHtrap was carried out using both the cytoplasmic and the membrane fraction. The effect of DSP cross-linking on trapping substrate proteins in vivo was also examined by comparison of the amount of purified proteins in both the presence and absence of DSP. The purified and co-purified proteins were resolved by SDS-PAGE and visualized by silver-staining. The results are shown in Fig. 3.7. As expected, most of the GST-FtsHtrap protein was detected in the membrane fraction, while the major of soluble GST expressed in strain BH9 was present in the cytoplasmic fraction. Unexpectedly, the cross-linking experiment was not effective enough for trapping of substrate proteins. As shown in Fig 3.7, the amount of purified and co-purified proteins detected after cross-linking is very low in comparison with those prepared in the absence of cross-linker. It is known that cross-linking can create protein aggregates, which can not be resolved by SDS-PAGE (Thermo Scientific, Pierce Crosslinking Technical Handbook). Indeed, cross-linking experiments are difficult to be carried out because they require an optimal amount of cross-linker for each specific experiment. Another disadvantage of cross-linking is that they make data analysis become difficult and unreliable due to non-specific interactions (Thermo Scientific, Pierce Crosslinking Technical Handbook). Therefore, we decided to continue the FtsHtrap experiment in vivo without cross-linking. 56    Results DSP - + - + - + - + - + - + FtsH+FtsHtrap GST FtsH+FtsHtrap GST cytoplasmic fraction membrane fraction 14.4 18.4 25.0 35.0 45.0 66.2. 116.0 GST GST-FtsH Figure 3.7. Analysis of purified FtsH and co-purified proteins in the absence or presence of the DSP cross-linker in the cytoplasmic and the membrane fraction. DSP cross-linker was either added (+) or omitted (-), as indicated, cytoplasmic and membrane fractions of strains BH7 (GST-FtsHtrap), BH8 (GST-FtsH+), BH9 (GST) were purified, separated by 15% SDS-PAGE and visualized by silver staining. 3.2.4. Identification of potential FtsH substrate by SDS-PAGE and silver staining The experiments for protein trapping in vivo in strains BH7, BH8 and BH9 were repeated at least three times, and samples were taken for purification and SDS - PAGE analysis. Proteins were resolved in a 10% SDS-PAGE to identify the potential FtsH substrates with a molecular weight higher than 25 kDa and in a 15% SDS-PAGE to detect the FtsH substrates with a molecular weight lower than 25 kDa. There were seven protein bands trapped in the FtsHtrap strain and not present in the FtsH+ strain numbering from 1 to 7 in the gels (Fig. 3.8 & 3.9). All these bands and the regions (sites) corresponding to these bands in the GST-FtsH+ strain were excised and sent for mass spectrometry analysis. 57    Results FtsHtrap GST FtsH+ Figure 3.8. Analysis of proteins by 10% SDS-PAGE after copurification with GSTFtsH+ and GST-FtsHtrap. Protein bands copurifying with GST-FtsHtrap but not with FtsH+ and GST were numbered from 1 to 6 and excised for mass spectrometry identification. Figure 3.9. Analysis of proteins by 15% SDS-PAGE after copurification with GSTFtsH+ and GST-FtsHtrap. Only one band numbered “7a” was detected in GST-FtsHtrap but not in GST-FtsH+ and GST samples. A band numbered “7b” in lane 2 supposed to be a contaminated protein from lane 1 and band “7a” were excised and identified by mass spectrometry. 25.0 .0 .0 66.2. 6. 35 45 11 8 9 1 2 3 4 5 6 7 GST-FtsH 4 56 3 1 2 GST 116.0 62.2 45.0 35.0 1 2 3 4 5 6 7 8 9 10 FtsH+FtsHtrap GST 25.0 18.4 14.4 7b 7a 58    Results 3.2.5. YwnF was identified as a potential substrate of FtsH The names of the trapped protein bands identified by mass spectrometry are presented in Table 3.6. Table 3.6: Identification of protein bands trapped by GST-FtsHtrap Number of the protein band Protein name 1 FtsH 2 FtsH 3 FtsH 4 FtsH 5 GST 6 GST 7a YwnF 7b Unknown Most of the protein bands identified corresponded to FtsH (bands 1 to 4) suggesting that GST-FtsHtrap was partially degraded in vivo. Protein bands 5 and 6 revealed as GST although their size as determined by SDS-PAGE turned out to be higher than the calculated molecular mass. Remarkably, a strong protein band of about 17 kDa pulled-down clearly by GST-FtsH , but not by GST-FtsH was identified as YwnF trap + protein. It is a small protein with 144 amino acids and predicted as a membrane protein with two transmembrane domains involving amino acids 31-53 and 63-80, the function of which is still unknown (www.Uniprot.org). The band “7b” at lane 2 (Fig 3.9) with the same size of YwnF is of unknown origin and could be a contaminating protein present in B. subtilis. Possibly, it represents the β-lactoglobulin of milk from sheep because the 18.4 kDa band of molecular weight the ladder in lane 1 consist of the β-lactoglobulin presence sheep’s milk so that the mass spectrometry could not identify its name from the protein databank of B. subtilis. In summary, by using the GST-FtsH approach, one trapped protein, YwnF, was trap identified as a putative protein substrate of FtsH. However, further experiments in vitro and in vivo showing degradation of this trapped protein by FtsH are required to clarify and confirm this conclusion. 59    Results 3.3. Is the Eag protein involved in the regulation of the activity of Spo0E? The eag gene has been identified as an open reading frame downstream of the spo0E gene coding for a phosphatase (Perego and Hoch, 1987), where eag stands for spo0E-associated gene. It codes for a protein of 143 amino acids with a molecular weight of 16.4 kDa. Eag protein is predicted to be an integral inner membrane protein with two potential transmembrane segments. Since no promoter has been identified upstream of eag, it is assumed that it forms a potential bicistronic operon with spo0E (Perego and Hoch, 1987). Is eag involved in sporulation as described for the upstream gene, spo0E? Since Spo0E has been identified as a substrate of FtsH (Le and Schumann, 2009), we speculate that the Eag protein of still unknown function might be involved in regulation of the synthesis or activity of the Spo0E phosphatase. To test this hypothesis, we first isolated an eag disruptant mutation by integration of a complete plasmid thereby destroying the reading frame of eag. 3.3.1. Construction of an eag null mutant by insertion of the pMUTIN4 integration vector The integration vector pMUTIN4 has been widely used to construct insertion mutants in chromosomal genes of B. subtilis (Vagner et al., 1998). This vector plasmid is unable to replicate in B. subtilis and allows fusion of the promoter-less lacZ-gene to the promoter of the gene to become inactivated (Vagner et al., 1998). In a first step, about 300 bp of the gene to be inactivated are amplified by PCR and inserted in front of the lacZ reporter gene. Next, this recombinant plasmid is transformed into the appropriate B. subtilis strain, and insertion mutants are selected on erythromycin-containing plates. Insertion at the correct site is confirmed by Southern-blotting. By using this technology, strain AM01 was obtained. Is the eag gene expressed during sporulation? To answer this question, strain AM01 was grown in DSM and aliquots were withdrawn before and at different time points after t0. Strain yrdB::pMUTIN4 was analysed as a control. The gene yrdB does not play a role during sporulation. Measurement of the β-galactosidase activities of both strains are presented in Fig. 3.11. While the β-galactosidase activities of the yrdB insertion mutant dropped from 8 to about 2 units when cells entered the transition phase, that of the 60    Results eag::pMUTIN4 strain increased from 1 to 5.5 units (Fig. 3.11). This result indicates that eag is induced during phase 0 of sporulation. 1 2 3 W T ∆ eag::pMUTIN4 t-1 t0 t1 ∆spo0E::bleo Fig. 3.10. Western blot analysis to detect the amount of Spo0A in wild type B. subtilis and two knockout strains. Cells were grown in DSM at 37oC and aliquots were taken at the time point indicated (t-1, t0, t) and analysed by Western blot using Spo0A antibodies. Fig. 3.11. β -Galactosidase activities of strains yrdB::pMUTIN4 and eag::pMUTIN4. Cells were grown in DSM at 37oC and aliquots were taken at the time point indicated (t0, t1, t2, t3) and analysed for β -galactosidase activities. 61    Results 3.3.2. Does the eag gene affect the sporulation frequency? Strain AM01 (eag::pMUTIN4), 1012 (positive control) and AB07 (spo0E::bleo) were grown in DSM, and spores were prepared and analyzed as described under Materials and Methods. The results in Table 3.7 show that the wild type strain 1012 exhibited a sporulation frequency of about 52%, while that of its isogenic spo0E::bleo derivative was 82% that the sporulation frequency is increased in the absence of the Spo0E phosphatase has already published (Perego and Hoch, 1991) and confirmed by our group (Le and Schumann, 2009). Inactivation of the eag gene resulted in a slightly increased sporulation frequency as compared to the wild type strain (58 versus 52%, see Table 3.7). This result suggests a negative influence of eag on the sporulation process. Table 3.7. The sporulation frequencies of the B. subtilis strains 1012, eag::pMUTIN4 and spo0E::bleo. Strains Viable cells/ml Spores/ml Sporulation frequency 1012 4.8 x 1082.5 x 1080.52 1012, eag::pMUTIN4 6.8 x 1083.9 x 1080.58 1012, spo0E::bleo 6.2 x 1085.1 x1080.82 3.3.3. Does the eag gene influence the amount of Spo0A protein? Spo0A is the master regulator of the sporulation phase 0. This protein becomes phosphorylated through the phosphorelay (Burbulys et al., 1991), and Spo0A~P is a DNA-binding protein which acts either as an activator or a repressor depending on the location of the binding site termed OA-box (Perego et al., 1988). Spo0A~P regulates a total of 121 genes directly (Fujita et al., 2005). Spo0A~P is subject to direct regulation of its activity of the phosphatase Spo0E (Stephenson and Perego, 2002). This phosphatase specifically dephosphorylates Spo0A~P. Next, we asked whether eag can influence the amount of Spo0A produced. Two different experiments were carried out to answer this question. First, we directly visualized to Spo0A by immunoblotting and second, we measured the enzymatic activity of a transcriptional fusion dependent on the amount of active Spo0A. Three different strains, wild type 1012 and its isogenic insertion mutants spo0E::bleo and eag::pMUTIN4 62    Results were grown in DSM and aliquots were withdrawn at different time points before and after entry into the transition phase. The Spo0A protein present in these aliquots was visualized by an immunoblot using antibodies raised against Spo0A. As already published, the amount of Spo0A in wild type cells was below the detection level at t-1, started to appear at t0 and further increased at t1 (Fig. 3.10). When the spo0E::bleo strain was analysed, in contrast to the wild type extracts, Spo0A was already present at t-1 and accumulated to a higher amount at t1 as compared to the wild type strain (Fig. 3.10). In the absence of a functional eag gene, small amounts of Spo0A can be detected at t-1 and the amount present at t1 is comparable to the amount present at the same time point in the wild type strain. Therefore, we conclude that the eag gene does not influence the amount of Spo0A significantly. As already mentioned, Spo0A~P acts either as a transcriptional activator or repressor. As to its role as an activator, it has been shown that there are two classes of promoters. While some need only a small amount of Spo0A~P to become activated, others need higher amounts (Fujita et al., 2005). The promoter preceeding the skf operon needs only a small amount of active Spo0A. The transcriptional Pskf - lacZ fusion was introduced by transformation into two different strains, the wild type 1012 used as a control and the eag::pMUTIN4 strain AM01. Both strains were grown in DSM, and aliquots were taken at t-1, t0, t1 and t2. The β-Galactosidase activities increased from about 2 units to 80 units in the wild type strain, while it increased up to 120 units at t2 in the eag disruption mutant (Fig. 3.12). This result indicates that eag exerts a minor effect on the amount of active Spo0A, either by decreasing its amount or favouring its dephosphorylation or both. 63    Results Fig. 3.12. β -Galactosidase activity of an eag knockout and wild type strain. Cells containing the Pskf-lacZ fusion integrated at the amyE locus were grown in DSM at 37oC. Samples were taken at the indicated time points for measurement of β -galactosidase activity. 64    Discussion 4. DISCUSSION The present doctoral thesis deals with different aspects which will be discussed separately: (1) Identification of the Spo0M protein as a novel substrate, (2) construction of an ftsHtrap mutant allowing identification of novel substrate protein, and (3) putative role of the Eag protein in modulating the activity of the Spo0E phosphatase. 4.1. Identification of the Spo0M protein as a novel substrate FtsH is the unique ATP-dependent and membrane-bound protease universally conserved in both prokaryotes and eukaryotes (Okuno et al., 2006b). In B. subtilis, cells of an ftsH knockout strain fail to sporulate presumably due to the absence of a sufficient amount of Spo0A or/and phosphorylated Spo0A (Spo0A~P) for entry into the sporulation programme (Deuerling et al., 1997; Le and Schumann, 2009). The first target of FtsH in B. subtilis identified by our group was the Spo0E phosphatase, involved in dephosphorylation of Spo0A. Since a spo0E ftsH double knockout restored the sporulation frequency to only 0.85% while the sporulation in wild type strains is approximate 60%, we reasoned that additional stage 0-dependent protein(s) are substrates of FtsH (Le and Schumann, 2009). By using the proteomic approach and further analysis in terms of transcription and post-translational modifications, Spo0M was confirmed as a target of FtsH, the second substrate of FtsH which was identified in B. subtilis. 4.1.1. Spo0M, a target of FtsH and its function in sporulation In an attempt to identify protein substrates of the FtsH metalloprotease involved in stage 0 of sporulation in B. subtilis, the proteomics approach using the 2D gel techniquewas applied to compare the proteome of an ftsH wild-type strain to an ftsH null mutant. One of the most abundant proteins identified in the ftsH knockout strain was Spo0M, a sporulation control protein of stage 0. Using a bgaB reporter system, the spo0M promoter was fused transcriptionally with the bgaB reporter gene (Pspo0M-bgaB) and expression analysis did not show any influence of FtsH on transcription of spo0M gene. It implied that FtsH might have a negative regulation on the stability of Spo0M through its 65    Discussion σA eag spo0E RBS1RBS2 Fig. 4.2. Genomic organisation of the spo0E-eag region in B. subtilis. spo0E gene forms a bicistronic operon with eag. Both of genes have their own ribosome binding site (RBS) and are separated by a terminator sequence. Due to the genomic organization of the eag gene, we asked whether it is involved in regulation of spo0E. By using a transcriptional lacZ reporter gene system, it could be shown that the eag gene is induced during phase 0 of sporulation (Fig. 3.11). The analysis of sporulation also revealed that eag has a negative influence on the sporulation frequency. From these results, it can be hypothesized that eag exerts a minor effect on the amount of active Spo0A, either by reducing its amount or favouring its dephosphorylation or both. By which mechanism, transcription of the eag gene occurs when preceded by a transcriptional terminator and no obvious promoter? The recA-recX operon of E. coli may serve as an example (Pages et al., 2003). This operon exhibits an organization comparable to that of spo0E-eag. It contains just one promoter upstream of recA and a putative terminator between recA and recX. Two different transcripts have described, one corresponding to recA and the other to both recA-recX genes in which the full-length transcript represents only about 5-10% of the total amount of transcripts. The recX expression is shown to be down-regulated at the translational level about 500-fold as compared to recA (Pages et al., 2003). Similarly, the eag gene of B. subtilis may influence the activity of the Spo0E phosphatase in the same way with recA and recX transcription. We assume that only small amounts of Eag are produced which modulate either the synthesis or the activity of Spo0E. Eag may interfere with either transcription or translation of spo0E or it may directly interact with the Spo0E protein as described for recX, a new SOS gene located 220 bp downstream of recA, and two genes are cotranscribed in E. coli. RecX protein acts as a negative regulator of RecA activities by inhibiting the RecA-dependent strand exchange reaction and co-protease activity by slow depolymerization of RecA-DNA filaments (Galkin et al., 2011). We prefer the second possibility and suggest the following model shown in Fig. 4.3. 72    Discussion Eag Spo0E FtsH Degradation Fig. 4.3. Hypothetical model how Eag may modulate the activity of the Spo0E phosphatase. Eag may bind Spo0E to prevent it from dephosphorylating Spo0A~P and even transfer it to FtsH for degradation. The Eag protein has been assumed to be integrated into the cytoplasmic membrane. It may bind Spo0E, thereby preventing Spo0E from interacting with Spo0A~P followed by dephosphorylation. This model could be tested by artificial overproduction of the Eag protein. If the model is correct, this should result in an increase in the sporulation frequency and also in the amount of Spo0A. In addition, Eag may transfer Spo0E to the FtsH protease followed by degradation. This hypothesis is suggested since both Eag and FtsH are intergral membrane proteins and may stay close together in the membrane. If Eag really transfers Spo0E to FtsH, it may act as an adapter protein - a protein that recognizes substrate proteins of ATP-dependent proteases and transfers them to the appropriate protease. Examples are ClpS which cooperates with ClpAP of E. coli (Schmidt et al., 2009) and MecA of B. subtilis transferring substrate proteins to ClpCP protease (Kirstein et al., 2006; Mei et al., 2009). 73    Reference list Reference List Akiyama,Y. (2009). Quality control of cytoplasmic membrane proteins in Escherichia coli. J. Biochem. 146, 449-454. Akiyama,Y. and Ito,K. (2003). Reconstitution of membrane proteolysis by FtsH. J. Biol. Chem. 278, 18146-18153. Akiyama,Y., Kihara,A., and Ito,K. (1996a). Subunit a of proton ATPase F0 sector is a substrate of the FtsH protease in Escherichia coli. FEBS Lett. 399, 26-28. Akiyama,Y., Kihara,A., Tokuda,H., and Ito,K. (1996b). FtsH (HflB) is an ATP-dependent protease selectively acting on SecY and some other membrane proteins. J. Biol. Chem. 271, 31196-31201. Akiyama,Y., Kihara,A., Mori,H., Ogura,T., and Ito,K. (1998). Roles of the periplasmic domain of Escherichia coli FtsH (HflB) in protein interactions and activity modulation. J. Biol. Chem. 273, 22326-22333. Asayama,M., Yamamoto,A., and Kobayashi,Y. (1995). Dimer form of phosphorylated Spo0A, a transcriptional regulator, stimulates the spo0F transcription at the initiation of sporulation in Bacillus subtilis. J. Mol. Biol. 250, 11-23. Bai,U., Lewandoski,M., Dubnau,E., and Smith,I. (1990). Temporal regulation of the Bacillus subtilis early sporulation gene spo0F. J. Bacteriol. 172, 5432-5439. Bai,U., Mandic-Mulec,I., and Smith,I. (1993). SinI modulates the activity of SinR, a developmental switch protein of Bacillus subtilis, by protein-protein interaction. Genes Dev. 7, 139-148. Baker,M.D. and Neiditch,M.B. (2011). Structural basis of response regulator inhibition by a bacterial anti-activator protein. PLoS. Biol. 9, e1001226. Banse,A.V., Chastanet,A., Rahn-Lee,L., Hobbs,E.C., and Losick,R. (2008). Parallel pathways of repression and antirepression governing the transition to stationary phase in Bacillus subtilis. Proc. Natl. Acad. Sci. U. S. A 105, 15547-15552. Beloin,C., Valle,J., Latour-Lambert,P., Faure,P., Kzreminski,M., Balestrino,D., Haagensen,J.A., Molin,S., Prensier,G., Arbeille,B., and Ghigo,J.M. (2004). Global impact of mature biofilm lifestyle on Escherichia coli K-12 gene expression. Mol. Microbiol. 51, 659-674. 74    Reference list Bernhardt,J., Buttner,K., Scharf,C., and Hecker,M. (1999). Dual channel imaging of twodimensional electropherograms in Bacillus subtilis. Electrophoresis 20, 2225-2240. Bertani,D., Oppenheim,A.B., and Narberhaus,F. (2001). An internal region of the RpoH heat shock transcription factor is critical for rapid degradation by the FtsH protease. FEBS Lett. 493, 17-20. Bieniossek,C., Niederhauser,B., and Baumann,U.M. (2009). The crystal structure of apoFtsH reveals domain movements necessary for substrate unfolding and translocation. Proc. Natl. Acad. Sci. U. S. A 106, 21579-21584. Bieniossek,C., Schalch,T., Bumann,M., Meister,M., Meier,R., and Baumann,U. (2006). The molecular architecture of the metalloprotease FtsH. Proc. Natl. Acad. Sci. U. S. A 103, 3066-3071. Britton,R.A., Eichenberger,P., Gonzalez-Pastor,J.E., Fawcett,P., Monson,R., Losick,R., and Grossman,A.D. (2002). Genome-wide analysis of the stationary-phase sigma factor (sigma-H) regulon of Bacillus subtilis. J. Bacteriol. 184, 4881-4890. Burbulys,D., Trach,K.A., and Hoch,J.A. (1991). Initiation of sporulation in B. subtilis is controlled by a multicomponent phosphorelay. Cell 64, 545-552. Burkholder,W.F. and A.D.Grossman (2000). Regulation of the initiation of endospore formation in Bacillus subtilis. In Prokaryotic development, Y.V.Brun and L.J.Shimkets, eds. ASM Press, Washington, D.C., pp. 151-166. Büttner,K., Bernhardt,J., Scharf,C., Schmid,R., Mader,U., Eymann,C., Antelmann,H., Völker,A., Völker,U., and Hecker,M. (2001). A comprehensive two-dimensional map of cytosolic proteins of Bacillus subtilis. Electrophoresis 22, 2908-2935. Chastanet,A. and Losick,R. (2011). Just-in-time control of Spo0A synthesis in Bacillus subtilis by multiple regulatory mechanisms. J. Bacteriol. 193, 6366-6374. Chastanet,A., Vitkup,D., Yuan,G.C., Norman,T.M., Liu,J.S., and Losick,R.M. (2010). Broadly heterogeneous activation of the master regulator for sporulation in Bacillus subtilis. Proc. Natl. Acad. Sci. U. S. A 107, 8486-8491. Chen,J., Burke,J.J., Velten,J., and Xin,Z. (2006). FtsH11 protease plays a critical role in Arabidopsis thermotolerance. Plant J. 48, 73-84. 75    Reference list Chiba,S., Akiyama,Y., and Ito,K. (2002). Membrane protein degradation by FtsH can be initiated from either end. J. Bacteriol. 184, 4775-4782. Chiba,S., Akiyama,Y., Mori,H., Matsuo,E., and Ito,K. (2000). Length recognition at the N-terminal tail for the initiation of FtsH-mediated proteolysis. EMBO reports 1, 4752. Core,L. and Perego,M. (2003). TPR-mediated interaction of RapC with ComA inhibits response regulator-DNA binding for competence development in Bacillus subtilis. Mol. Microbiol. 49, 1509-1522. Core,L.J., Ishikawa,S., and Perego,M. (2001). A free terminal carboxylate group is required for PhrA pentapeptide inhibition of RapA phosphatase. Peptides 22, 15491553. Cutting,S., Anderson,M., Lysenko,E., Page,A., Tomoyasu,T., Tatematsu,K., Tatsuta,T., Kroos,L., and Ogura,T. (1997). SpoVM, a small protein essential to development in Bacillus subtilis, interacts with the ATP-dependent protease FtsH. J. Bacteriol. 179, 5534-5542. de Hoon,M.J., Eichenberger,P., and Vitkup,D. (2010). Hierarchical evolution of the bacterial sporulation network. Curr. Biol. 20, R735-R745. Deuerling,E., Mogk,A., Richter,C., Purucker,M., and Schumann,W. (1997). The ftsH gene of Bacillus subtilis is involved in major cellular processes such as sporulation, stress adaptation and secretion. Mol. Microbiol. 23, 921-933. Deuerling,E., Paeslack,B., and Schumann,W. (1995). The ftsH gene of Bacillus subtilis is transiently induced after osmotic and temperature upshock. J. Bacteriol. 177, 41054112. Dixon,L.G., Seredick,S., Richer,M., and Spiegelman,G.B. (2001). Developmental gene expression in Bacillus subtilis crsA47 mutants reveals glucose-activated control of the gene for the minor sigma factor sigma-H. J. Bacteriol. 183, 4814-4822. Dubnau,D. and Losick,R. (2006). Bistability in bacteria. Mol. Microbiol. 61, 564-572. Eichenberger,P., Fujita,M., Jensen,S.T., Conlon,E.M., Rudner,D.Z., Wang,S.T., Ferguson,C., Haga,K., Sato,T., Liu,J.S., and Losick,R. (2004). The program of gene transcription for a single differentiating cell type during sporulation in Bacillus subtilis. PLoS. Biol. 2, e328. 76    Reference list Errington,J. (1993). Bacillus subtilis sporulation: Regulation of gene expression and control of morphogenesis. Microbiol. Rev. 57, 1-33. Errington,J. (1996). Determination of cell fate in Bacillus subtilis. Trends Genet. 12, 3134. Errington,J. (2003). Regulation of endospore formation in Bacillus subtilis. Nat. Rev. Microbiol. 1, 117-126. Fischer,B., Rummel,G., Aldridge,P., and Jenal,U. (2002). The FtsH protease is involved in development, stress response and heat shock control in Caulobacter crescentus. Mol. Microbiol. 44, 461-478. Flynn,J.M., Neher,S.B., Kim,Y.I., Sauer,R.T., and Baker,T.A. (2003). Proteomic discovery of cellular substrates of the ClpXP protease reveals five classes of ClpXrecognition signals. Mol. Cell 11, 671-683. Führer,F., Langklotz,S., and Narberhaus,F. (2006). The C-terminal end of LpxC is required for degradation by the FtsH protease. Mol. Microbiol. 59, 1025-1036. Führer,F., Muller,A., Baumann,H., Langklotz,S., Kutscher,B., and Narberhaus,F. (2007). Sequence and length recognition of the C-terminal turnover element of LpxC, a soluble substrate of the membrane-bound FtsH protease. J. Mol. Biol. 372, 485-496. Fujita,M., Gonzalez-Pastor,J.E., and Losick,R. (2005). Highand low-threshold genes in the Spo0A regulon of Bacillus subtilis. J. Bacteriol. 187, 1357-1368. Fürbass,R., Gocht,M., Zuber,P., and Marahiel,M.A. (1991). Interaction of AbrB, a transcriptional regulator from Bacillus subtilis with the promoters of the transition state-activated genes tycA and spoVG. Mol. Gen. Genet. 225, 347-354. Galkin,V.E., Britt,R.L., Bane,L.B., Yu,X., Cox,M.M., and Egelman,E.H. (2011). Two modes of binding of DinI to RecA filament provide a new insight into the regulation of SOS response by DinI protein. J. Mol. Biol. 408, 815-824. Geisler,U. and Schumann,W. (1993). Isolation of stress mutants of Bacillus subtilis by a novel genetic method. FEMS Microbiol. Lett. 108, 251-254. Gonzalez-Pastor,J.E., Hobbs,E.C., and Losick,R. (2003). Cannibalism by sporulating bacteria. Science 301, 510-513. 77    Reference list Görg,A., Boguth,G., Obermaier,C., Posch,A., and Weiss,W. (1995). Two-dimensional polyacrylamide gel electrophoresis with immobilized pH gradients in the first dimension (IPG-Dalt): the state of the art and the controversy of vertical versus horizontal systems. Electrophoresis 16, 1079-1086. Grossman,A.D. (1995). Genetic networks controlling the initiation of sporulation and the development of genetic competence in Bacillus subtilis. Annu. Rev. Genet. 29, 477508. Halberg,R. and Kroos,L. (1994). Sporulation regulatory protein SpoIIID from Bacillus subtilis activates and represses transcription by both mother-cell-specific forms of RNA polymerase. J. Mol. Biol. 243, 425-436. Han,W.D., Kawamoto,S., Hosoya,Y., Fujita,M., Sadaie,Y., Suzuki,K., Ohashi,Y., Kawamura,F., and Ochi,K. (1998). A novel sporulation-control gene (spo0M) of Bacillus subtilis with a sigmaH-regulated promoter. Gene 217, 31-40. Herman,C., Prakash,S., Lu,C.Z., Matouschek,A., and Gross,C.A. (2003). Lack of a robust unfoldase activity confers a unique level of substrate specificity to the universal AAA protease FtsH. Mol. Cell 11, 659-669. Herman,C., Thévenet,D., Bouloc,P., Walker,G.C., and D'Ari,R. (1998). Degradation of carboxy-terminal-tagged cytoplasmic proteins by the Escherichia coli protease HflB (FtsH). Genes Dev. 12, 1348-1355. Herman,C., Thévenet,D., D'Ari,R., and Bouloc,P. (1997). The HflB protease of Escherichia coli degrades its inhibitor λCIII. J. Bacteriol. 179, 358-363. Horikoshi,M., Yura,T., Tsuchimoto,S., Fukumori,Y., and Kanemori,M. (2004). Conserved region 2.1 of Escherichia coli heat shock transcription factor σ32 is required for modulating both metabolic stability and transcriptional activity. J. Bacteriol. 186, 7474-7480. Ichikawa,H. and Kroos,L. (2000). Combined action of two transcription factors regulates genes encoding spore coat proteins of Bacillus subtilis. J. Biol. Chem. 275, 1384913855. Ireton,K., Rudner,D.Z., Siranosian,K.J., and Grossman,A.D. (1993). Integration of multiple developmental signals in Bacillus subtilis through the Spo0A transcription factor. Genes Dev. 7, 283-294. 78    Reference list Ito,K. and Akiyama,Y. (2005). Cellular functions, mechanism of action, and regulation of FtsH protease. Annu. Rev. Microbiol. 59, 211-231. Jayasekera,M.M.K., Foltin,S.K., Olson,E.R., and Holler,T.P. (2000). Escherichia coli requires the protease activity of FtsH for growth. Arch. Biochem. Biophys. 380, 103-107. Jiang,M., Shao,W., Perego,M., and Hoch,J.A. (2000). Multiple histidine kinases regulate entry into stationary phase and sporulation in Bacillus subtilis. Mol. Microbiol. 38, 535-542. Johnson,W.C., Moran,C.P., Jr., and Losick,R. (1983). Two RNA polymerase sigma factors from Bacillus subtilis discriminate between overlapping promoters for a developmentally regulated gene. Nature 302, 800-804. Katz,C. and Ron,E.Z. (2008). Dual role of FtsH in regulating lipopolysaccharide biosynthesis in Escherichia coli. J. Bacteriol. 190, 7117-7122. Kihara,A. and Ito,K. (1998). Translocation, folding, and stability of the HflKC complex with signal anchor topogenic sequences. J. Biol. Chem. 273, 29770-29775. Kihara,A., Akiyama,Y., and Ito,K. (1995). FtsH is required for proteolytic elimination of uncomplexed forms of SecY, an essential protein translocase subunit. Proc. Natl. Acad. Sci. USA 92, 4532-4536. Kihara,A., Akiyama,Y., and Ito,K. (1996). A protease complex in the Escherichia coli plasma membrane: HflKC (HflA) forms a complex with FtsH (HflB), regulating its proteolytic activity against SecY. EMBO J. 15, 6122-6131. Kihara,A., Akiyama,Y., and Ito,K. (1997). Host regulation of lysogenic decision in bacteriophage lambda: Transmembrane modulation of FtsH (HflB), the CII degrading protease, by HflKC (HflA). Proc. Natl. Acad. Sci. USA 94, 5544-5549. Kihara,A., Akiyama,Y., and Ito,K. (1998). Different pathways for protein degradation by the FtsH/HflKC membrane-embedded protease complex: An implication from the interference by a mutant form of a new substrate protein, YccA. J. Mol. Biol. 279, 175-188. Kihara,A., Akiyama,Y., and Ito,K. (1999). Dislocation of membrane proteins in FtsHmediated proteolysis. EMBO J. 18, 2970-2981. 79    Reference list Kiran,M., Chauhan,A., Dziedzic,R., Maloney,E., Mukherji,S.K., Madiraju,M., and Rajagopalan,M. (2009). Mycobacterium tuberculosis ftsH expression in response to stress and viability. Tuberculosis. (Edinb. ) 89 Suppl 1, S70-S73. Kirstein,J., Schlothauer,T., Dougan,D.A., Lilie,H., Tischendorf,G., Mogk,A., Bukau,B., and Turgay,K. (2006). Adaptor protein controlled oligomerization activates the AAA+ protein ClpC. EMBO J. 25, 1481-1491. Kitko,R.D., Cleeton,R.L., Armentrout,E.I., Lee,G.E., Noguchi,K., Berkmen,M.B., Jones,B.D., and Slonczewski,J.L. (2009). Cytoplasmic acidification and the benzoate transcriptome in Bacillus subtilis. PLoS. One. 4, e8255. Klobutcher,L.A., Ragkousi,K., and Setlow,P. (2006). The Bacillus subtilis spore coat provides "eat resistance" during phagocytic predation by the protozoan Tetrahymena thermophila. Proc. Natl. Acad. Sci. U. S. A 103, 165-170. Kobiler,O., Rokney,A., and Oppenheim,A.B. (2007). Phage lambda CIII: a protease inhibitor regulating the lysis-lysogeny decision. PLoS. One. 2, e363. Kroos,L. (2007). The Bacillus and Myxococcus developmental networks and their transcriptional regulators. Annu. Rev. Genet. 41, 13-39. Laaberki,M.H. and Dworkin,J. (2008). Role of spore coat proteins in the resistance of Bacillus subtilis spores to Caenorhabditis elegans predation. J. Bacteriol. 190, 6197-6203. Laemmli,U.K. (1970). Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 277, 680-685. Langklotz,S., Schakermann,M., and Narberhaus,F. (2011). Control of lipopolysaccharide biosynthesis by FtsH-mediated proteolysis of LpxC is conserved in enterobacteria but not in all gram-negative bacteria. J. Bacteriol. 193, 1090-1097. Lazazzera,B.A., Kurtser,I.G., McQuade,R.S., and Grossman,A.D. (1999). An autoregulatory circuit affecting peptide signaling in Bacillus subtilis. J. Bacteriol. 181, 5193-5200. Le,A.T. and Schumann,W. (2009). The Spo0E phosphatase of Bacillus subtilis is a substrate of the FtsH metalloprotease. Microbiology 155, 1122-1132. 80    Reference list Leffers,G.G. and Gottesman,S. (1998). Lambda Xis degradation in vivo by Lon and FtsH. J. Bacteriol. 180, 1573-1577. Lies,M. and Maurizi,M.R. (2008). Turnover of endogenous SsrA-tagged proteins mediated by ATP-dependent proteases in Escherichia coli. J. Biol. Chem. 283, 22918-22929. Losick,R. and Stragier,P. (1992). Crisscross regulation of cell-type-specific gene expression during development in B. subtilis. Nature 355, 601-604. McQuade,R.S., Comella,N., and Grossman,A.D. (2001). Control of a family of phosphatase regulatory genes (phr) by the alternate sigma factor sigma-H of Bacillus subtilis. J. Bacteriol. 183, 4905-4909. Mei,Z., Wang,F., Qi,Y., Zhou,Z., Hu,Q., Li,H., Wu,J., and Shi,Y. (2009). Molecular determinants of MecA as a degradation tag for the ClpCP protease. J. Biol. Chem. 284, 34366-34375. Miller,J.H. (1972). Experiments in Molecular Genetics. (Cold Spring Harbor, NY: Cold Spring Harbor Laboratory). Mogk,A., Hayward,R., and Schumann,W. (1996). Integrative vectors for constructing single-copy transcriptional fusions between Bacillus subtilis promoters and various reporter genes encoding heat-stable enzymes. Gene 182, 33-36. Molle,V., Fujita,M., Jensen,S.T., Eichenberger,P., Gonzalez-Pastor,J.E., Liu,J.S., and Losick,R. (2003). The Spo0A regulon of Bacillus subtilis. Mol. Microbiol. 50, 1683-1701. Morlot,C., Uehara,T., Marquis,K.A., Bernhardt,T.G., and Rudner,D.Z. (2010). A highly coordinated cell wall degradation machine governs spore morphogenesis in Bacillus subtilis. Genes Dev. 24, 411-422. Muchova,K., Lewis,R.J., Perecko,D., Brannigan,J.A., Ladds,J.C., Leech,A., Wilkinson,A.J., and Barak,I. (2004). Dimer-induced signal propagation in Spo0A. Mol. Microbiol. 53, 829-842. Nakano,M.M., Dailly,Y.P., Zuber,P., and Clark,D.P. (1997). Characterization of anaerobic fermentative growth of Bacillus subtilis: Identification of fermentation end products and genes required for growth. J. Bacteriol. 179, 6749-6755. 81    Abbreviation List of abbreviations and symbols Abbreviation Denotation σ Sigma Factor 2D-Gel Two-Dimensional Gel 2D-PAGE Two-Dimensional Polyacrylamide Gel Electrophoresis AAA ATPases Associated with a Variety of Cellular Activities ATP Adenosine-5'-Triphosphate AmpRResistant to Ampicillin BSA Bovine Serum Albumin Cat Gene Coding for Chloramphenicol-Acetytransferase CHAPS 3-[(3-Cholamidopropyl)Dimethylammonio]-1-Propanesulfonate CmRResistant to Chloramphenicol COG Clusters of Orthologous Groups CSF Competence Stimulating Factor ddH2O Double Distilled Water DHFR Dihydrofolate Reductase DMSO Dimethyl Sulfoxide DSM Difco Sporulation Medium DSP Dithiobis[Succinimidyl Propionate] DTT Dithiothreitol EDTA Ethylene Diamine Tetraacetic Acid Erm Gene Coding for Erythromycin Resistance ErmRResistant to Erythromycin GFP Green Fluorescent Protein GSH Reduced Glutathione GST Glutathione-S-Transferase IEF Isoelectric Focusing IPG Immobilized pH Gradient IPTG Isopropyl-ß-D-Thiogalactoside 88    Abbreviation KDO 3-Deoxy-D-Manno-Oct-2-Ulosonic Acid LB Luria-Bertani LPS Lipopolysaccharide MS Mass Spectrometry Neo Gene Coding for Neomycin Resistance NeoRResistant to Neomycin OD Optical Density OD578 (600) Optical Density at a Wavelength of 578 (or 600) nm PBS Phosphate Buffered Saline PCR Polymerase Chain Reaction PMSF Phenylmethylsulfonyl Fluoride Pgrac An IPTG inducible promoter, which consists promoter of PgroES and lac operator RBS Ribosome Binding Site Rpm Revolution or Round per Minute SDS Sodium Dodecyl Sulphate SDS-PAGE Sodium Dodecyl Sulfate Polyacrylamide Gel Electrophoresis Spc Gene Coding for Spectimomycin Resistance SpcRResistant to Spectinomycin SRH The Second Region of Homology TE Tris – EDTA TCA Tricarboxylic Acid Tris Tris-(Hydroxymethyl)-Aminomethane txStage x of Sporulation Program WT Wild-Type 89    Publication Publication Research in Microbiology The sporulation control gene spo0M of Bacillus subtilis is a target of the FtsH metalloprotease Hue Bach Thi Nguyen and Wolfgang Schumann Institute of Genetics, University of Bayreuth, D-95440 Bayreuth, Germany Received 4 August 2011, Accepted 10 October 2011. Available online 19 November 2011 ********** Publication submitted The eag gene of Bacillus subtilis influences the activity of the Spo0E phosphatase Hue Bach Thi Nguyen, Anja Maier and Wolfgang Schumann Institute of Genetics, University of Bayreuth, D-95440 Bayreuth, Germany Submitted to Current Microbiology ********** Publication in preparation Construction of ftsHtrap mutant to isolate FtsH protein substrate in Bacillus subtilis, Hue Bach Thi Nguyen and Wolfgang Schumann. in preparation. 90    Erklärung Hiermit erkläre ich, die vorliegende Arbeit selbstständig verfasst zu haben und keine anderen als die von mir angegebenen Quellen oder Hilfsmittel verwendet zu haben. Ferner habe ich weder an der Universität Bayreuth, noch an einer anderen Hochschule versucht eine Dissertation einzureichen, oder mich einer Promotionsprüfung zu unterziehen. Hue Bach Thi Nguyen Bayreuth, Januar 2012 91   